CN115247183A - Construction method of recombinant microorganism, related biological material and application thereof - Google Patents

Abstract

The invention discloses a construction method of recombinant saccharomyces cerevisiae, a related biological material and application thereof. The construction method comprises the steps of introducing the coding gene of the recombinant fusion protein into a starting microorganism to obtain a recombinant microorganism; the recombinant fusion protein contains a Pln1 protein and a terpene synthesis-related protein. The construction method repositions a part of key enzymes in a triterpene biosynthesis pathway through the Pln1 protein so as to promote the enzymes to be spatially close to a substrate and promote the conversion of natural product fat-soluble intermediates stored in a lipid drop.

Description

Construction method of recombinant microorganism, related biological material and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to a construction method of recombinant microorganisms, related biological materials and application thereof.

Background

Natural compounds and their derivatives have important applications in medical treatment and health care, and the pharmacological actions of more and more natural compound molecules are characterized, and the market demand is increasing. The traditional plant extraction method or chemical synthesis method has many limitations. Plant extraction causes a great waste of plant resources and the obtained active ingredients are extremely low. Chemical synthesis brings environmental pressure on one hand, and on the other hand, when natural compounds with complex structures are processed, the problems of long synthesis route, low yield and the like exist. Synthetic biology is a science of redesigning and engineering construction and application of life systems and processes emerging in recent years, and provides powerful techniques and platform support for large-scale production of natural compounds and design and synthesis of small molecule compounds with new structures. In recent years, reports on the preparation of other active plant natural products by using synthetic biological methods are also continuously reported, the related natural products comprise terpenes, flavonoids, polyphenols, alkaloids and the like, and green and efficient production chains formed by the new technologies are being accepted by science and industry.

Terpenes are one of the most hydrophobic substances with multiple functions and wide application, and can be used as spices and essences, medicines, solvents, cosmetics, food additives and potential advanced biofuels. Yeast is considered to be an ideal host for producing isoprenoid due to the characteristics of clear genetic background, simple genetic operation and the like. However, eukaryotic cells are divided into several subcellular organelles, which have complex structures with their own membranes. In particular, cellular metabolism is divided into specialized subcellular organelles. For example, oxidative phosphorylation occurs in the mitochondria, and β -oxidation of fatty acids is localized in the peroxisomes, which results in the dispersion of cofactors and precursors. This subcellular compartmentalization may present some obstacles to substrate passage in the supply of precursors and cofactors. One of the problems faced in the heterologous synthesis of terpenoid natural products by saccharomyces cerevisiae is that most of its lipid-soluble intermediates are stored in the subcellular space of the yeast cell, inside the lipid droplets.

Despite extensive metabolic engineering, the production of most isoprenoids in yeast has fallen far behind industrial applications, probably due in part to complex metabolic compartmentalization. Thus, systematic studies of cellular sub-compartments and the use of subcellular organelles may provide a viable approach to further enhance isoprenoid biosynthesis in yeast and even other eukaryotic cells.

Disclosure of Invention

The invention provides a method for constructing recombinant microorganisms, which comprises the steps of introducing coding genes of recombinant fusion proteins into starting microorganisms to obtain recombinant microorganisms; the recombinant fusion protein contains a Pln1 protein and a terpene synthesis-related protein.

Optionally, according to the above method, the terpene synthesis-related protein is selected from protopanaxadiol synthase PPDS01 and/or cytochrome P450 reductase ATR1.

The terpene synthesis related protein may include PPDS01 and ATR1, and then PPDS01 and ATR1 may be linked via a linker peptide. ATR1 may be a cytochrome P450 reductase 46tATR1 with a 46 amino acid truncation at the N-terminus, for example the amino acid sequence of 46tATR1 is shown in SEQ ID No.2 from position 780 to position 1425.

Alternatively, according to the above method, in said recombinant fusion protein, said Pln1 protein and said terpene synthesis-related protein are linked via a linker peptide.

Above, the linker peptide may be GGGS or GSTSSG.

Optionally, the recombinant fusion protein is a recombinant protein comprising the Pln1 protein, PPDS01 and ATR1 according to the above method.

Alternatively, the amino acid sequence of the Pln1 protein is as shown in SEQ ID No.2 from position 1 to position 283; the amino acid sequence of the PPDS01 is shown as 288 th to 773 rd positions in SEQ ID No. 2; the amino acid sequence of the ATR1 is shown as 780 th to 1425 th in SEQ ID No. 2.

Alternatively, the amino acid sequence of the recombinant fusion protein is as shown in SEQ ID No.2, according to the method described above. In SEQ ID No.2, the amino acid sequence of the Pln1 protein is shown from position 1 to position 283, the amino acid sequence of the linker peptide GGGS is shown from position 284 to position 287, the amino acid sequence of PPDS01 is shown from position 288 to position 773, the amino acid sequence of the linker peptide GSTSSG is shown from position 774 to position 779, and the amino acid sequence of ATR1 is shown from position 780 to position 1425.

The method may further comprise expressing a gene encoding the above recombinant fusion protein. The specific sequence of the coding gene can be shown as 431 st to 4708 th in SEQ ID No. 1.

Alternatively, according to the above method, in the recombinant microorganism, the gene encoding the recombinant fusion protein is integrated into the YPL062W site of the starting microorganism.

Optionally, according to the above method, the encoding gene of the recombinant fusion protein is introduced into the starting microorganism through an expression cassette for expressing the recombinant fusion protein, so as to obtain the recombinant microorganism. The expression cassette sequence for expressing the recombinant fusion protein can be shown as SEQ ID No.1, wherein, the promoter P _TEF1 1-430 th site, 431-1279 th site of coding gene of Pln1 protein, 1280-1291 th site of coding gene of connecting peptide GGGS, 1292-2749 th site of coding gene of protein PPDS01, 2750-2767 th site of coding gene of connecting peptide GSTSSG, 2768-4708 th site of coding gene of protein 46tATR1 and terminator T _CYC1 From 4709 to 5015.

Optionally, according to the method, the starting microorganism is Saccharomyces cerevisiae, and the Saccharomyces cerevisiae is obtained by performing A1-A12 transformation on a strain BYT1,

a1, introducing a 3-hydroxy-3-methylglutaryl coenzyme A reductase gene tHMG1 gene; a2, introducing a mevalonate kinase gene ERG12 gene; a3, introducing an IDI1 gene of an alcohol dehydrogenase I gene; a4, introducing a mevalonate decarboxylase pyrophosphate gene ERG19 gene; a5, introducing a hydroxymethyl glutaryl coenzyme A reductase gene HMGR gene; a6, introducing hydroxymethyl glutaryl-coenzyme A synthetase gene ERG 13; a7, introducing a phosphomevalonate kinase gene ERG8 gene; a8, introducing acetyl coenzyme A acetyltransferase gene ERG 10; a9, introducing a squalene synthase gene AtSQS2 gene; a10, introducing a squalene monooxygenase gene ERG1 gene; a11, introducing a farnesyl pyrophosphate synthetase gene SmFPS gene; a12, introducing a dammarenediol synthase gene spgDDS gene.

Optionally, the sequence of tmg 1 protein encoded by the tmg 1 gene is genbank accession number: AJS96703.1, bits 530-1054; the sequence of the ERG12 protein coded by the ERG12 gene is genbank accession number: NP _ 013935.1; the sequence of IDI1 protein coded by the IDI1 gene is genbank accession number: NP _ 015208.1; the sequence of the ERG19 protein coded by the ERG19 gene is genbank accession number: NP-014441.1; the sequence of the HMGR protein coded by the HMGR gene is genbank accession number: WP _ 011241944.1; the sequence of the ERG13 protein coded by the ERG13 gene is genbank accession number: NP-013580.1; the sequence of the ERG8 protein coded by the ERG8 gene is genbank accession number: NP-013947.1; the sequence of the ERG10 protein coded by the ERG10 gene is genbank accession number: NP-015297.1; the sequence of the AtSQS2 protein coded by the AtSQS2 gene is genbank accession number: NP-195190.1; the sequence of the ERG1 protein coded by the ERG1 gene is genbank accession number: NP _ 011691.1; the sequence of SmFPS protein coded by the SmFPS gene is genbank accession number: ABV 08819.1; the sequence of the spgDDS protein coded by the spgDDS gene is genbank accession number: ACZ 71036.1.

Alternatively, the sequence of the tHMG1 gene is shown as 757 th-2340 th positions in SEQ ID No. 3; the sequence of the ERG12 gene is shown as 801 rd to 2132 nd in SEQ ID No. 4; the sequence of the IDI1 gene is shown as 1001 st to 1867 th positions in SEQ ID No. 5; the sequence of the ERG19 gene is shown as 1001 st position to 2191 nd position in SEQ ID No. 6; the sequence of the HMGR gene is shown as 563-1864 in SEQ ID No. 7; the sequence of the ERG13 gene is shown as 823 th-2298 th in SEQ ID No. 8; the sequence of the ERG8 gene is shown as 801 st-2156 th in SEQ ID No. 9; the sequence of the ERG10 gene is shown as 431 th site to 1627 th site in SEQ ID No. 10; the sequence of the AtSQS2 gene is shown as 751 th site to 1983 th site in SEQ ID No. 11; the sequence of the ERG1 gene is shown as 801 th-2291 th in SEQ ID No. 12; the sequence of the SmFPS gene is shown as 431 th site to 1480 th site in SEQ ID No. 13; the sequence of the spgDDS gene is shown as 431 st to 2740 th in SEQ ID No. 15.

The gene can be obtained by introducing an expression cassette for expressing the protein or an expression plasmid for expressing the protein into BYT1, for example, the gene can be integrated into LEU site and NDT80 site of BYT 1.

Alternatively, the sequence of the expression cassette for expressing the tHMG1 protein is shown as SEQ ID No. 3; the sequence of an expression cassette for expressing ERG12 protein is shown as SEQ ID No. 4; the sequence of the expression cassette for expressing IDI1 protein is shown in SEQ ID No. 5; the sequence of the expression cassette for expressing ERG19 protein is shown in SEQ ID No. 6; the expression cassette sequence for expressing HMGR protein is shown in SEQ ID No. 7; the sequence of the expression cassette for expressing ERG13 protein is shown in SEQ D No. 8; the sequence of the expression cassette for expressing ERG8 protein is shown in SEQ ID No. 9; the sequence of the expression cassette for expressing ERG10 protein is shown in SEQ ID No. 10; the sequence of an expression cassette for expressing the AtSQS2 protein is shown as SEQ ID No. 11; the sequence of the expression cassette for expressing ERG1 protein is shown in SEQ ID No. 12; the sequence of an expression cassette for expressing SmFPS protein is shown as SEQ ID No. 13; the sequence of the expression cassette for expressing the spgDDS protein is shown in SEQ ID No. 15.

The invention also provides any one of the following biological materials B1) to B6):

b1 Nucleic acid molecules encoding the above recombinant fusion proteins; b2 An expression cassette comprising the nucleic acid molecule according to B1); b3 A recombinant vector containing the nucleic acid molecule according to B1) or a recombinant vector containing the expression cassette according to B2); b4 A recombinant microorganism containing the nucleic acid molecule according to B1), or a recombinant microorganism containing the expression cassette according to B2), or a recombinant microorganism containing the recombinant vector according to B3); b5 ) the above recombinant fusion protein; b6 A recombinant microorganism expressing the recombinant fusion protein.

The invention also provides any one of the following applications:

x1, the application of the method for constructing the recombinant microorganism in the preparation of terpene products; x2, the application of the method for constructing the recombinant microorganism in the production of terpene; x3, application of the biological material in preparation of terpene products; x4, the use of the above mentioned biological material for the production of terpenes; the application of the X5 and the Pln1 protein in the preparation of terpene products; the use of X6, the above-mentioned Pln1 protein, for the production of terpenes; the application of X7 and the Pln1 protein in improving terpene synthesis efficiency (recombination efficiency); x8 and the application of the recombinant fusion protein in improving terpene synthesis efficiency (recombination efficiency).

The present invention also provides a method for increasing the efficiency of terpene biosynthesis, comprising the step of expressing the above recombinant fusion protein in a recipient organism to obtain a recombinant organism having a higher efficiency of terpene synthesis than the recipient organism.

As above, the organism may be a microorganism, a plant or a non-human animal.

As hereinbefore described, the terpene product may be a recombinant bacterium expressing a terpene. The terpene can be protopanaxadiol or cucurbitadienol.

Yeast lipid droplets, a specialized organelle, have the ability to store unwanted hydrophobic materials, not only Fatty Acids (FA) in the form of Triacylglycerol (TAG), but also squalene, sterol esters, and retinyl esters in the lipid droplet to avoid damaging membrane integrity. Pln1 protein (also known in the past as Pet10 p) that specifically binds to TAG-containing lipid droplets early in lipid droplet formation, thereby maintaining lipid droplet morphology and stability and promoting lipid droplet formation from the endoplasmic reticulum. The present invention relocates some of the key enzymes in the triterpene biosynthetic pathway through the Pln1 protein to facilitate spatial access of the enzymes to the substrate to facilitate conversion of the natural product lipid soluble intermediates stored in the lipid droplets.

Drawings

FIG. 1 shows the content of DD and PPD in PTA and LPTA detected by HPLC in example 2.

FIG. 2 is an HPLC plot of the strains PTA and LPTA of example 2.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise specified, were carried out in a conventional manner according to the techniques or conditions described in the literature in this field or according to the product instructions. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Data were processed using SPSS11.5 statistical software and the results were expressed as mean. + -. Standard deviation using One-way ANOVA test.

Saccharomyces cerevisiae BY4742 (Saccharomyces cerevisiae BY 4742) described in Zhubo Dai et al, production agglutinins of ginsenosides in bakers' yeast. Sci Rep.2014Jan 15;4:3698..

The gene fragments and protein sequence related information referred to in the following examples are shown in the following table.

Information on Gene fragments

Information relating to protein sequences

	genbank accession number	Update time
			tHMG1 protein	AJS96703.1 bits 530-1054	2016/5/23
ERG12 protein	NP_013935.1	2020/10/2
			IDI1 protein	NP_015208.1	2020/10/2
ERG19 protein	NP_014441.1	2020/10/2
			HMGR proteins	WP_011241944.1	2019/6/19
ERG13 protein	NP_013580.1	2020/10/2
			ERG8 protein	NP_013947.1	2020/10/2
ERG10 protein	NP_015297.1	2020/10/2
			AtSQS2 protein	NP_195190.1	2019/2/14
ERG1 protein	NP_011691.1	2020/10/2
			SmFPS proteins	ABV08819.1	2011/4/11
spgDDS proteins	ACZ71036.1	2009/12/12

Example 1

1. Cloning of Gene elements

1. Obtaining gene fragment by PCR amplification

The Pln1 gene of the complete ORF and the ATR1 gene (46 tATR 1) with 46 amino acids truncated at the N-terminal are obtained BY amplification BY using the genomic DNA of Saccharomyces cerevisiae BY4742 as a template and the primers in Table 1 respectively.

Protopanaxadiol synthase gene PPDS01 was amplified using the primers in Table 1, using plasmid pM13-pgPPDS containing the pgPPDS gene (described in Dai ZB et al, available from Tianjin Industrial Biotechnology institute for production of polysaccharides, methanoic engineering.2013, 20.

The amplification system was as follows:

GXL DNA Polymerase PrimeSTAR GXL Buffer(Mg ²⁺ plus) x 10. Mu.l, dNTPmix 4. Mu.l, primers 1.5. Mu.l each, DNA template 1. Mu.l, primeSTAR GXL DNA Polymerase (1.25U/. Mu.l) 1. Mu.l, supplemented with ddH ₂ O to a total volume of 50. Mu.l.

The amplification conditions were as follows: pre-denaturation at 95 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 60 ℃ for 15 seconds, and extension at 68 ℃ for 3 minutes (35 cycles); extension at 72 ℃ for 10 min (1 cycle). The product is recovered and stored by glue.

2. Obtaining fusion fragment by fusion PCR

(1) The PPDS01 gene containing 20bp homologous region with 46tATR1 gene was subjected to fusion PCR, and the primers are shown in Table 1.

The fusion PCR system was as follows: primeSTARGXLBuffer (Mg) ²⁺ plus) x 10. Mu.l, dNTPmix 4. Mu.l, primers SexA1-PPDS01-F and Asc1-46tATR1-R each 1.5. Mu.l, DNA templates of fragment 46tATR1 and fragment PPDS01 each 1.5. Mu.l, primeSTAR GXL DNA Polymerase (1.25U/. Mu.l) 1. Mu.l, supplemented with ddH ₂ O to a total volume of 50. Mu.l.

The amplification conditions were as follows: pre-denaturation at 95 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 60 ℃ for 15 seconds, and extension at 68 ℃ for 3 minutes (35 cycles); extension at 72 ℃ for 10 min (1 cycle). Obtaining the fusion gene fragment PPDS 01-GSTSG-46 tATR1.

A fusion gene fragment 14bp-PPDS 01-GSTSG-46 tATR1 containing a 14bp homologous region with the Pln1 gene is obtained by the same method, and primers are shown in Table 1. The fragments were recovered by gel.

(2) The 14bp-PPDS 01-GSTSG-46 tATR1 gene containing 14bp homologous region with Pln1 gene was subjected to fusion PCR, and the primers are shown in Table 1.

The fusion PCR system was as follows: primeSTAR GXL Buffer (Mg) ²⁺ plus) x 10. Mu.l, dNTPmix 4. Mu.l, primers Pac1-Pln1-F and Asc1-46tATR1-R each 1.5. Mu.l, DNA templates of fragment Pln1 and fragment 14bp-PPDS 01-GSTSG-46 tATR1 each 1.5. Mu.l, primeSTAR GXL DNA Polymerase (1.25U/. Mu.l) 1. Mu.l, supplemented with ddH ₂ O to a total volume of 50. Mu.l.

The amplification conditions were as follows: pre-denaturation at 95 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 60 ℃ for 15 seconds, and extension at 68 ℃ for 3 minutes (35 cycles); extension at 72 ℃ for 10 min (1 cycle). Obtaining a fusion gene segment Pln1-GGGS-PPDS01-GSTSSG-46tATR1.

TABLE 1 primer sequences

2. Construction of recombinant plasmid

1、pM3-PPDS01-GSTSSG-46tATR1

Carrying out double enzyme digestion by using restriction enzymes SexAI and AscI to respectively double-enzyme digest plasmid pM3-ERG9 (recorded in Chinese patent application 201210453416.X) and gene PPDS 01-GSTSG-46 tATR1, tapping and recovering a target fragment: pEASY-Blunt-P _TEF1 -//-T _CYC1 (62 ng) and PPDS 01-GSTSG-46 tATR1 (3420bp, 130ng), and connecting the target fragment with a vector in the following system: 5. Mu.l of 2 Xquick Ligation Buffer (NEB), 0.5. Mu.l of Quick T4 DNA Ligase (NEB, 400, 000synergistic end units/ml), supplemented with ddH ₂ And reacting at 25 ℃ for 13min until the volume of O is 10 mu l to obtain a ligation product, transferring the ligation product into Trans 1T 1 competent cells, and performing sequencing verification to obtain the recombinant vector. Through sequencing, the recombinant vector is an expression cassette P of PPDS 01-GSTSG-46 tATR1 gene _TEF1 -PPDS01-GSTSSG-46tATR1-T _CYC1 The vector obtained by being inserted between cloning sites of pEASY-BluntSimple cloning vector (pEASY cloning vector, beijing Quantum Biotechnology (TransGen Biotech) Ltd.) was named pM3-PPDS 01-GSTSG-46 tATR1.

2、pM13-Pln1-GGGS-PPDS01-GSTSSG-46tATR1

Plasmid pM13-pgPPDS (described in Dai ZB et al, 2013, metabolic Engineering 20, publicly available from the institute for biotechnology of Tianjin) and gene fragment Pln1-GGGS-PPDS01-GSTSSG-46tATR1, were double-digested with restriction enzymes PacI and AscI, respectively, and the fragment of interest was recovered by tapping: pEASY-Blunt-P _TEF1 -//-T _CYC1 (50 ng) and pac1-Pln1-GGGS-PPDS01-GSTSSG-46tATR1-Asc1 (4278bp, 104ng), and the target fragment is connected with the vector by the following connection system: 5 ul 2 XQuick Ligation Buffer (NEB), 0.5 ul Quick T4 DNA Ligase (NEB, 400, 000genetic end units/ml), supplemented with ddH ₂ And reacting at 25 ℃ for 13min until the volume of O is 10 mu l to obtain a ligation product, transferring the ligation product into Trans 1T 1 competent cells, and performing sequencing verification to obtain the recombinant vector. After sequencing, the recombinant vector is an expression cassette P of Pln1-GGGS-PPDS 01-GSTSG-46 tATR1 gene _TEF1 -Pln1-GGGS-PPDS01-GSTSSG-46tATR1-T _CYC1 Insert pEASY-Blunt Simple cloning vector (pEASY clone)Vector, a vector obtained between cloning sites of Beijing Quanyu Biotechnology (TransGen Biotech) Ltd.), and named pM13-Pln1-GGGS-PPDS 01-GSTSG-46 tATR1.

3. Leu gRNA, NDT80gRNA and YPL062W gRNA

The p426-SNR52p-gRNA. CAN1.Y-SUP4t plasmid purchased from addge company is taken as a template, and the following primers are respectively used for amplification: gRNA antisense/Leu gRNA forward, gRNA antisense/NDT 80gRNA forward, gRNA antisense/YPL 062W gRNA forward

gRNA reverse: GATCATTTATCTTTCACTGC

LeugRNA forward:

cgcagtgaaagataaatgatcCGATGGTGATGGTGTCGCTTgttttagagctagaaatagcaag

NDT80gRNA forward:

cgcagtgaaagataaatgatcCTGCTTCAGGTGCGGCTTGGgttttagagctagaaatagcaag

YPL062W gRNA forward:

cgcagtgaaagataaatgatcGCACGTCGCCGTGGCTGATGgttttagagctagaaatagcaag

amplifying to obtain three linear segments of Linear Leu gRNA, linear NDT80gRNA and Linear YPL062W gRNA, transferring the three segments into Transl T1 competent cells respectively, and performing sequencing verification to obtain recombinant plasmids Leu gRNA, NDT80gRNA and YPL062W gRNA.

4. plasmid construction of pM7-HMGR

The genome DNA of Saccharomyces cerevisiae BY4742 is used as a template, a promoter pTEF2 (562 bp) is obtained BY adopting primers Pac1-TEF2-F and SexA1-TEF2-R for amplification, and a terminator tENO2 (400 bp) is obtained BY adopting primers Asc1-ENO2-F and Pme1-ENO2-R for amplification. The amplification system was as follows: primeSTAR GXL Buffer (Mg) ²⁺ plus). Times.10. Mu.l, dNTPmix. Times.4. Mu.l, 1.5. Mu.l each of the primers Pac1-TEF2-F and SexA1-TEF2-R (Asc 1-ENO2-F and Pme1-ENO 2-R), 1.5. Mu.l of genomic DNA template, 1. Mu.l of PrimeSTAR GXL DNA Polymerase (1.25U/. Mu.l), and supplemented with ddH2O to a total volume of 50. Mu.l.

Pac1-TEF2-F：5’-GCTTAATTAAATGGGGCCGTATACTTACATATAGTAGA-3’

SexA1-TEF2-R：5’-GCACCAGGTGTTTAGTTAATTATAGTTCGTTGACCGTATATTCTAAAAAC-3’

Asc1-ENO2-F：5’-GCGGCGCGCCAGTGCTTTTAACTAAGAATTATTAGTCTTTTCTGCT-3’

Pme1-ENO2-R：5’-GCGTTTAAACAGGTATCATCTCCATCTCCCATATGC-3’

Carrying out double digestion on plasmid pUC57-synHMGR (the synHMGR gene is totally synthesized by totally-synthesized consignjinsry biotechnology limited of the gene and is inserted into the cloning sites of a pUC57 vector (provided by the kingsry biotechnology limited) by using restriction enzymes SexAI and AscI respectively to obtain a cloning type plasmid pUC57-synHMGR containing the synHMGR gene, and carrying out tapping to recover a target fragment to obtain a SexAI-synHMGR-AscI fragment; respectively double-digesting the fragment pTEF2 by using restriction enzymes SexAI and pacI, and tapping and recovering the target fragment to obtain SexAI-pTEF2-pacI; respectively double-digesting the fragment tENO2 by using restriction endonucleases Ascl and Pme1, tapping and recovering a target fragment to obtain Asc1-tENO2-Pme1, and adding 50ng of each of the three fragments into a connection system: 2ul 10XT4 ligation Buffer (NEB), 1ul T4 ligation Buffer (NEB, 400, 000covalent end units/ml), distilled water was added to 20ul, and the reaction was carried out at room temperature for 2 hours to obtain a ligation product, 1ul of the ligation product was added, and the PCR system: primeSTAR GXL Buffer (Mg 2+ plus) x 10. Mu.l, dNTPmix 4. Mu.l, primers Pac1-TEF2-F and Pme1-ENO2-R each 1.5. Mu.l, ligation product 1. Mu.l, primeSTAR GXL DNA Polymerase (1.25U/. Mu.l) 1. Mu.l, supplemented with ddH2O to a total volume of 50. Mu.l, to obtain expression cassette P _TEF2 -HMGR-T _ENO2 . Cloning the expression cassette into pEASY-Blunt Simple cloning vector (purchased from Beijing Quanyujin Biotechnology Co., ltd.) to obtain recombinant vector pM7-HMGR, and sequencing _TEF2 -HMGR-T _ENO2 (the sequence is shown as SEQ ID No. 7) is inserted between cloning sites of pEASY-Blunt Simple to obtain a vector.

The recombinant plasmids pM3-PPDS 01-GSTSG-46 tATR1, pM13-Pln1-GGGS-PPDS 01-GSTSG-46 tATR1, leu gRNA, NDT80gRNA, YPL062W gRNA and pM7-HMGR are prepared and related information is shown in Table 2.

TABLE 2 plasmid information

3. Construction of recombinant bacterium

(I) construction of YSBYT5 Strain

1. Construction of Gene modules

Respectively taking the plasmids described in the table 2 as PCR templates (p delta-tHMG 1, pM9-ERG12, pM16-IDI1, pM5-ERG19, pM8-ERG13, pM11-ERG8 and pM3-ERG10 are described in the literature: creating Saccharomyces cerevisiae cell factory for fermentation production of lupeol, china journal of Chinese traditional medicine, lingting, wangDong, wearing Bo, zhang Xuanli, huangluqin, 2016, 41 (6): 1008-1015) and corresponding primers in the table 3 for PCR amplification to respectively obtain functional module fragments: m1 (containing P) _PGK1 -tHMG1-T _ADH1 Expression cassette), M2 (comprising P _PDC1 -ERG12-T _ADH2 Expression cassette), M3 (comprising P _ENO2 -IDI1-T- _PDC1 Expression cassette), M4 (comprising P) _PYK1 -ERG19-T _PGI1 Expression cassette), M5 (comprising P) _TEF2 -HMGR-N-T _ENO2 Expression cassette), M6 (comprising P _FBA1 -ERG13-T _TDH2 Expression cassette) and M7 (comprising P) _TDH3 -ERG8-T _TPI1 Expression cassette), M8 (comprising P) _TEF1 -ERG10-T _CYC1 An expression cassette).

The amplification system was as follows:

GXL DNA Polymerase PrimeSTAR GXL Buffer(Mg ²⁺ plus) x 10. Mu.l, dNTPmix 4. Mu.l, primers 1.5. Mu.l each, DNA template 1. Mu.l, primeSTAR GXL DNA Polymerase (1.25U/. Mu.l) 1. Mu.l, supplemented with ddH ₂ O to a total volume of 50. Mu.l.

The amplification conditions were as follows: pre-denaturation at 95 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 60 ℃ for 15 seconds, and extension at 68 ℃ for 3 minutes (35 cycles); extension at 72 ℃ for 10 min (1 cycle). The product is recovered and stored by glue.

TABLE 3 templates, primers and sequences thereof

2. Preparation of Yeast competence

Fresh yeast strain liquid BYT1 (derived from a laboratory-maintained strain, described in Zhubo Dai et al, producing agglomerans of ginsenosides in bakers' yeast. Sci Rep.2014Jan 15, ex vivo) was cultured overnight (P414-P purchased from Addge company _TEF1 -Cas9-T _CYC1 Plasmid) competent (1% inoculum size, 30ul seed inoculum inoculated into 3ml SD-Trp broth (0.8% total synthesis four-deficiency medium (purchased from Beijing Pankeno technology Co., ltd.) +2% glucose +0.005% His +0.01% by weight Ura +0.01% Leu)).

The operation steps are as follows:

(1) and (3) collecting thalli: 1ml of yeast liquid was dispensed into 1.5ml EP tubes. Centrifuge at 12000rpm for 1min, discard the supernatant, and pipette clean. The precipitate was washed with 1ml of sterile water, centrifuged by pipetting, the supernatant discarded and washed twice.

(2) And (3) thallus treatment: 1ml of a treatment solution (preparation of treatment solution: 1M sorbitol +10mM LiAc +10mM Tris-HCl (pH 7.5)) (preservation in a refrigerator at 4 ℃) +10ul DTT (purchased from Beijing Lanbobedrid commercial and trade Co., ltd., product number: 1758-9030-25 g) (-preservation in a refrigerator at 20 ℃), and metal heating at 25 ℃ for 20min.

(3) After 20min, centrifugation was carried out, the supernatant was discarded, the mixture was aspirated off by a gun, 1ml of pre-cooled 1M sob (D-sorbitol, available from Beijing Soilebao Tech. Co., ltd.) (4 ℃ freezer) was added, whipped, centrifuged, and the supernatant was discarded. The column was washed twice with 1M Sob, the supernatant was aspirated off, and 50ul of Sob was added for suspension.

(4) Adding 2 μ l of M1, M2, M3, M4, M5, M6, M7 and M8 modules and 2 μ l of Leu gRNA plasmid, blowing, mixing, transferring into pre-cooled electric rotary cup, and ice-cooling for 5min.

(5) The electric revolving cup is wiped clean with 2.7kv electric shock. Add the first 1ml of sob to the electric rotor, mix well and suck a new 1.5ml EP tube. Shaking-culturing at 30 deg.C and 250rpm for 60min.

(6) After 60min, the supernatant was centrifuged and partially removed from the broth, applied to a plate with auxotrophy SD-UraTrp (0.8% total synthetic medium +2% glucose +0.005% His +0.01% Leu +2% Ager), and cultured in an incubator at 30 ℃ for 36h.

After about two days of culture box culture, selecting a single clone to carry out PCR colony verification to obtain a yeast engineering bacterium YSBYT5, discarding the Leu gRNA plasmid, and carrying out the next step of genetic modification.

The construction principle of the yeast engineering bacteria YSBYT5 is specifically that a recombinant plasmid p414-PTEF1-Cas9-TCYC1 capable of expressing Cas9 protein is transferred into a strain BYT1 in advance, then, a recombinant plasmid (Leu gRNA) for expressing gRNA and a recombinant fragment (M1-M8) are transformed into the strain together, leu gRNA identifies and combines a specific PAM region of a Leu site, and simultaneously, the Leu gRNA is activated and guides the Cas9 protein to perform a shearing function, so that double-stranded DNA of the Leu site is broken, and at the moment, the recombinant fragment M1-M8 containing a homologous region is integrated into the DNA of the strain through homologous recombination repair.

The PCR colony verification method specifically comprises the following steps:

the genome of yeast strain YSBYT5 was extracted using a yeast genome DNA extraction kit (purchased from Beijing Tiangen Biochemical technology Co., ltd., cat # DP 307-02). Performing PCR amplification by using the extracted genome as a template and SacII-PGK1/Asc1-tHMG1-R to obtain a fragment of about 2400bp, which indicates that the fragment contains M1; PCR amplification is carried out on Pac-pPDC1/Asc1-Erg12-R to obtain a fragment of about 2200bp, which indicates that the fragment contains M2; PCR amplification is carried out on pac-pENO2/IDI1-Asc1-R, and a fragment of about 2200bp is obtained, which indicates that the fragment contains M3; PCR amplification is carried out on Pac-PYK1p/Asc1-Erg19-R to obtain a fragment about 2200bp, which indicates that the fragment contains M4; PCR amplification is carried out on pac1-pTEF2/Asc1-HMGR-N-R, and a fragment of about 1900bp is obtained, which indicates that M5 is contained; carrying out PCR amplification on pFBA1-YZ-F/Asc1-Erg13-R to obtain a fragment of about 2300bp, which indicates that the fragment contains M6; PCR amplification is carried out on Pac-pTDH3/Asc1-Erg8-R, and a fragment of about 2200bp is obtained, which indicates that the fragment contains M7; PCR amplification of SacII-pTEF1/Asc1-Erg10-R yielded a fragment of about 1700bp, indicating M8. The primers are specifically shown in Table 4.

TABLE 4 colony validation primers and sequences thereof

Primer name	Sequence (5 '-3')
		SacII-PGK1	GCGCCGCGGACGCACAGATATTATAACATC
Asc1-tHMG1-R	GGCGCGCCTTAGGATTTAATGCAGGTGACGGA
		Pac-pPDC1	GCGTTAATTAACATGCGACTGGGTGAGCATATGTTC
Asc1-Erg12-R	GGCGCGCCTTATGAAGTCCATGGTAAATTCGT
		Pac-pENO2	GCGTTAATTAAAATCCTACTCTTGCCGTTGCCATCC
IDI1-Asc1-R	GCGGCGCGCCTTATAGCATTCTATGAATTTGCCTGTCATTTT
		Pac-PYK1p	GCGTTAATTAAAATGCTACTATTTTGGAGATTAATC
Asc1-Erg19-R	GGCGCGCCTTATTCCTTTGGTAGACCAGTCTT
		pac-pTEF2	GCTTAATTAAATGGGGCCGTATACTTACATATAGTAGA
Asc1-HMGR-N-R	GGCGCGCCTTATGTGTTTTCCAAAACTTGCT
		pFBA1-YZ-F	TGGCTTGAACAACAATACCAGCC
Asc1-Erg13-R	GGCGCGCCTTATTTTTTAACATCGTAAGATCTTCTAAA
		Pac-pTDH3	GCGTTAATTAAATACTAGCGTTGAATGTTAGCGTCA
Asc1-Erg8-R	GGCGCGCCTTATTTATCAAGATAAGTTTCCGGATCTTT
		SacII-pTEF1	GCGCCGCGGAGTGATCCCCCACACACCATAGCTT
Asc1-Erg10-R	GGCGCGCCTCATATCTTTTCAATGACAATAGAGGAAGCAC
		SmFPS-Asc1	GCGGCGCGCCTTATTTCTGCCTCTTGTATATCTTGCC
AtSQS2-Asc1	GCGGCGCGCCTCAGTTTGCTCTGAGATATGCAAAGAC
		ERG1-Asc1	GCGGCGCGCCTTAACCAATCAACTCACCAAACAAAAATGG
spgDDS-Asc1-R	GCGGCGCGCCTCATATCTTTAATTGTTGATGCTTAGGTAACCAAAC
		ypl062w-up-256	GGAATTATTCGTAACGTCATACGA
PPDS01-EGPP-R	GTTGTGTGGGTGTAAGTGGATAG
		ATR1-Ce1805-F	TAAGGGCATGGCGAGGGAC
yp1062w-down-249	GTGTAGCTTAGTCATTGTATTCTGAT

Construction of YSBYT30 Strain

1. Construction of Gene modules

The plasmids described in Table 2 were used as PCR templates (pM 3-SmFPS and pM2-AtSQS2 are described in: wang Dong, liu Yi, xu jiao Yang, wang jin He, zhang Bo, zhang Xun, huang Qi, creating Saccharomyces cerevisiae cell factory for efficient production of dammaraenediol II [ J ] which is a ginsenoside precursor]Pharmaceutical bulletin, 2018, 53 (08): 1233-1241, pM11-ERG1 is described in chinese patent application 201210453416.X, publicly available from tianjin industrial biotechnology research institute) and corresponding primers for PCR amplification to obtain functional modules: m9 (containing P) _PGK1 -AtSQS2-T _ADH1 Expression cassette), M10 (comprising P _TDH3 -ERG1-T _TPI1 Expression cassette), M11 (comprising P _TEF1 -SmFPS-T _CYC1 An expression cassette).

The amplification system was as follows:

GXL DNA Polymerase PrimeSTAR GXL Buffer(Mg ²⁺ plus) x 10. Mu.l, dNTPmix 4. Mu.l, primers 1.5. Mu.l each, DNA template 1. Mu.l, primesTAR GXL DNA Polymerase (1.25U/. Mu.l) 1. Mu.l, supplemented with ddH ₂ O to a total volume of 50. Mu.l.

The amplification conditions were as follows: pre-denaturation at 95 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 60 ℃ for 15 seconds, and extension at 68 ℃ for 3 minutes (35 cycles); extension for 10 min at 72 ℃ (1 cycle). The product is recovered and stored by glue.

2. Preparation of Yeast competence

Culturing fresh yeast liquid YSBYT5 at night to prepare competence (1% inoculation amount, 30ul seed liquid inoculated to 3ml culture medium), and the operation steps are as follows:

(1) and (3) collecting thalli: 1ml of yeast liquid was dispensed into 1.5ml EP tubes. Centrifuge at 12000rpm for 1min, discard the supernatant, and suck clean with a gun. The precipitate was washed with 1ml of sterile water, centrifuged by pipetting, the supernatant discarded and washed twice.

(2) And (3) thallus treatment: adding 1ml of the treatment solution (4 deg.C storage in refrigerator), 10ul DTT (-20 deg.C storage in refrigerator), and heating at 25 deg.C for 20min.

(3) After 20min centrifugation was carried out, the supernatant was discarded, the mixture was aspirated off with a gun, 1ml of precooled 1M sob (in a4 ℃ freezer) was added, whipped, centrifuged and the supernatant discarded. The column was washed twice with 1M Sob, the supernatant was aspirated off, and 50ul of Sob was added for suspension.

(4) Add 2. Mu.l M9, M10 and M11 modules and 2. Mu.l NDT80gRNA plasmid, blow, mix well, transfer to pre-cooled electric rotor, ice-bath 5min.

(5) The electric revolving cup is wiped clean with 2.7kv electric shock. Add the first 1ml of sob into the electric rotating cup, mix well and suck the new 1.5ml EP tube. Shaking-culturing at 30 deg.C and 250rpm for 60min.

(6) After 60min, the supernatant from the centrifugation of the bacterial suspension was spread evenly on a plate of auxotroph Sd-UraTrp (0.8% total synthetic four-deficiency medium +2% glucose +0.005% His +0.01% Leu +2% Ager), and cultured at 30 ℃ in an incubator for 36h.

Culturing in an incubator for about two days, selecting monoclonal for PCR colony verification to obtain yeast engineering bacteria YSBYT30, discarding NDT80gRNA plasmid, and performing genetic modification

The construction principle of the yeast engineering bacteria YSBYT30 is specifically that a recombinant plasmid p414-PTEF1-Cas9-TCYC1 capable of expressing Cas9 protein exists in a strain YSBYT5, the recombinant plasmid (NDT 80 gRNA) expressing NDT80gRNA and a recombinant fragment (M9-M11) are transformed into the strain YSBYT5 together, the gRNA recognizes and combines a specific PAM region of an NDT80 site, and simultaneously activates and guides the Cas9 protein to perform a shearing function, so that double-stranded DNA of the NDT80 site is broken, and the recombinant fragment M9-M11 containing a homologous region is integrated into yeast DNA through homologous recombination repair.

The PCR colony verification method specifically comprises the following steps:

the genome of yeast strain YSBYT30 was extracted using a yeast genome DNA extraction kit (purchased from Beijing Tiangen Biochemical technology Co., ltd., cat # DP 307-02). Performing PCR amplification by using the extracted genome as a template and SacII-pTEF1/SmFPS-Asc1 to obtain a fragment of about 1500bp, which indicates that the fragment contains M11; performing PCR amplification by using SacII-PGK1/AtSQS2-Asc1 to obtain a fragment of about 2000bp, which indicates that the fragment contains M9; PCR amplification was performed using Pac-pTDH3/ERG1-Asc1 to obtain a fragment of about 2300bp, indicating that the fragment contains M10. Primer sequences are shown in Table 4.

(III) construction of T30-DD Strain

1. Preparation of Yeast competence

Fresh yeast liquid YSBYT30 is cultured overnight to prepare competence (1 percent of inoculum size, 30ul of seed liquid is inoculated to 3ml of culture medium), and the operation steps are as follows:

(1) and (3) collecting thalli: 1ml of yeast solution was taken and dispensed into 1.5ml of EP tube. Centrifuge at 12000rpm for 1min, discard the supernatant, and pipette clean. The precipitate was washed with 1ml of sterile water, centrifuged by pipetting, the supernatant discarded and washed twice.

(2) And (3) thallus treatment: adding 1ml of the treatment solution (4 deg.C storage in refrigerator), 10ul DTT (-20 deg.C storage in refrigerator), and heating at 25 deg.C for 20min.

(3) After 20min centrifugation was carried out, the supernatant was discarded, the mixture was aspirated off with a gun, 1ml of precooled 1M sob (in a4 ℃ freezer) was added, whipped, centrifuged and the supernatant discarded. The column was washed twice with 1M Sob, the supernatant was aspirated off, and 50ul of Sob was added for suspension.

(4) Adding 2 μ l pRS425-SpgDDS plasmid (described in the literature: radix asparagi, liuyi, xue Yang, gold crane, zhangzhu, zhangli, huangqi. Creating Saccharomyces cerevisiae cell factory for high-efficiency production of ginsenoside precursor dammarenediol II [ J ]. Pharmaceutical science, 2018, 53 (08): 1233-1241, the plasmid described in the literature as pRS 425-DDS), blowing, mixing, transferring into a precooled electric rotary cup, and ice-cooling for 5min.

(5) The electric revolving cup is wiped clean, and the electric shock is carried out at 2.7 kv. Add the first 1ml of sob to the electric rotor, mix well and suck a new 1.5ml EP tube. Shaking-culturing at 30 deg.C and 250rpm for 60min.

(6) After 60min, the supernatant was centrifuged off part of the bacterial suspension and spread evenly on a plate of auxotroph SD-TrpLeu (0.8% total synthesis medium +2% glucose +0.005% His +0.01% Ura +2% Ager) and cultured for 36h at 30 ℃ in an incubator.

After about two days of incubator culture, selecting the single clone to carry out PCR colony verification, obtaining the engineered yeast T30-DD, and carrying out the next step of genetic modification.

The PCR colony verification method specifically comprises the step of extracting the genome of the yeast strain T30-DD by using a yeast genome DNA extraction kit (purchased from Beijing Tiangen Biochemical technology Co., ltd., product number: DP 307-02). The extracted genome is used as a template, and a strain is subjected to PCR verification by using a primer SacII-pTEF1/spgDDS-Asc1-R to obtain a fragment of about 2800bp, which indicates that the pRS425-spgDDS plasmid is successfully transferred. The primer sequences are shown in Table 4.

(IV) construction of PTA Strain and LPTA

1. Construction of Gene modules

The plasmids described by the plasmid information in Table 2 (publicly available from the institute of biotechnology in Tianjin industry) were used as PCR templates and the corresponding primers in Table 3 for PCR amplification, respectively to obtain functional modules: m12 (including P) _TEF1 -PPDS01-GSTSSG-46tATR1-T _CYC1 Expression cassette) and M13 (comprising P) _TEF1 -Pln1-GGGS-PPDS01-GSTSSG-46tATR1-T _CYC1 An expression cassette).

The amplification system was as follows:

GXL DNA Polymerase PrimeSTAR GXL Buffer(Mg ²⁺ plus) x 10. Mu.l, dNTPmix 4. Mu.l, primers 1.5. Mu.l each, DNA template 1. Mu.l, primeSTAR GXL DNA Polymerase (1.25U/. Mu.l) 1. Mu.l, supplemented with ddH ₂ O to a total volume of 50. Mu.l.

The amplification conditions were as follows: pre-denaturation at 95 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 60 ℃ for 15 seconds, and extension at 68 ℃ for 4 minutes (35 cycles); extension at 72 ℃ for 10 min (1 cycle). The product is recovered and stored by glue.

2. Preparation of Yeast competence

The method for preparing competence (1% inoculation amount, 30ul seed solution inoculated to 3ml culture medium) by culturing fresh yeast liquid T30-DD overnight comprises the following operation steps:

(1) and (3) collecting thalli: 1ml of yeast liquid was dispensed into 1.5ml EP tubes. Centrifuge at 12000rpm for 1min, discard the supernatant, and pipette clean. The precipitate was washed with 1ml sterile water, blown down and centrifuged, the supernatant was discarded and washed twice.

(2) And (3) thallus treatment: adding 1ml of the treatment solution (4 deg.C storage in refrigerator), 10ul DTT (-20 deg.C storage in refrigerator), and heating at 25 deg.C for 20min.

(3) After 20min centrifugation was carried out, the supernatant was discarded, the pipette was used up, 1ml of pre-cooled 1M sob (4 ℃ freezer) was added, whipped, centrifuged and the supernatant discarded. Wash twice more with 1M Sob, aspirate the supernatant and add 50ul of Sob to suspend.

(4) Divided into two groups, one group is added with 2 mul M12 module and 2 mul YPL062W gRNA plasmid, the other group is added with 2 mul M13 module and 2 mul YPL062W gRNA plasmid, and the mixture is blown, beaten, evenly mixed and transferred into a precooled electric rotating cup and ice-bathed for 5min.

(5) The electric revolving cup is wiped clean, and the electric shock is carried out at 2.7 kv. Add the first 1ml of sob to the electric rotor, mix well and suck a new 1.5ml EP tube. Shaking-culturing at 30 deg.C and 250rpm for 60min.

(6) After 60min, the supernatant was centrifuged and partially removed from the broth, applied to a plate of auxotrophy SD-UraTrpLeu (0.8% total synthetic medium +2% glucose +0.005% His +2% Ager), and cultured in an incubator at 30 ℃ for 36h. After about two days of culture box culture, picking single clone to carry out PCR colony verification, and obtaining yeast engineering bacteria PTA and LPTA.

Verification of PTA strain:

and (3) extracting the genome of the yeast strain PTA by using a yeast genome DNA extraction kit. PCR verification is carried out on the strain by taking the extracted genome as a template and using a primer yp1062w-up-256/yp1062w-down-249 to obtain a fragment of about 4700bp, which indicates that the M12 fragment is successfully transferred. See table 4 for primer sequences.

Validation of LPTA strain:

the yeast strain LPTA genome is extracted by using a yeast genome DNA extraction kit. The extracted genome is taken as a template, a primer yp1062w-up-256/PPDS01-EGPP-R is used for carrying out PCR verification to obtain a fragment of about 3000bp, a primer ATR1-Ce1805-F/yp1062w-down-249 is used for carrying out PCR verification on the strain to obtain a fragment of about 1000bp, and the result shows that M13 (P13) is successfully transferred (the P gene is expressed by the DNA sequence) _TEF1 -Pln1-GGGS-PPDS01-GSTSSG-46tATR1-T _CYC1 ) And (3) fragment. See table 4 for primer sequences.

The related information of the prepared strains YSBYT5, YSBYT30, T30-DD, PTA and LPTA is shown in Table 5.

TABLE 5 engineering strain information

EXAMPLE 2 use of microbial lipid droplet technology for Production of Protopanaxadiol (PPD)

1. Shake flask fermentation

(1) Culturing engineering bacteria PTA and LPTA

Yeast engineered strains PTA and LPTA were activated in the corresponding solid selection medium SD-UraTrpLeu, one monoclonal was inoculated to each of the genotype engineered strains, seed solutions (30 ℃,250rpm, 169h) were prepared in the corresponding liquid selection medium SD-UraTrpLeu, inoculated in a 100ml Erlenmeyer flask containing 15ml of the corresponding liquid selection medium at an inoculum size of 1%, three sets of each monoclonal were inoculated in parallel, and cultured for 6 days at 30 ℃,250rpm with shaking.

(2) Extraction of engineering bacteria PTA and LPTA products

And (4) sucking 2ml of bacterial liquid 6 days after shaking the flask for fermentation, centrifuging at 12000rpm for 1min, discarding the supernatant, and sucking the supernatant completely by using a gun. Washing the precipitate twice with ddH2O, transferring to a crushing tube, centrifuging at 12000rpm for 1min, and removing the supernatant; adding glass beads (diameter 0.5 mm) and lml extract (the extract is composed of methanol and acetone, volume ratio of methanol to acetone is 1: 1), vibrating and crushing for 5min,2 times, and ultrasonically crushing for 30min; centrifuging at 12000rpm for 2min, removing precipitate, and filtering the supernatant with 0.22 μm organic filter membrane to obtain solutions, which are named PTA solution and LPTA solution, respectively.

2. Qualitative and quantitative analysis by HPLC

(1) Qualitative analysis by HPLC

The standard products are protopanaxadiol PPD and dacarbazine DD, and are purchased from Shanghai-derived leaf Biotechnology Co., ltd. The samples were PTA solution and LPTA solution.

The instrument comprises the following steps: agilent high performance liquid chromatography 1260

HPLC detection conditions: DAD monitor, monitoring wavelength 203nm, waters

Chromatography column (250 mm. Times.4.6 mm,5 μm), mobile phase A10% methanol, mobile phase B acetonitrile, isocratic elution 20min,10% A +90%

(2) Quantitative analysis by HPLC

The yield of each engineering bacterium after being fermented for 6 days is as follows:

on the basis of T30-DD, a PPD module without yeast lipid droplet compartmentalization localization and a PPD module with yeast lipid droplet compartmentalization localization are respectively integrated at a yeast genome knockout YPL062W locus, HPLC detection results show that the PPD yield of PTA engineering bacteria is 5.39mg/L/OD, the DD yield is 13.88mg/L/OD, the conversion rate from DD to PPD is 27.97%, the PPD yield of corresponding LPTA process bacteria is 19.30mg/L/OD, the DD yield is 3.03mg/L/OD, and the conversion rate from DD to PPD is 86.43%.

The results are shown in fig. 1 and fig. 2, fig. 1 is a graph of HPLC detection of DD and PPD content in strains PTA and LPTA, and fig. 2 is a graph of HPLC of strains PTA and LPTA.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific examples, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is made possible within the scope of the claims attached below.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> construction method of recombinant microorganism, related biological material and application thereof

<130> 210689

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5015

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

agtgatcccc cacacaccat agcttcaaaa tgtttctact ccttttttac tcttccagat 60

tttctcggac tccgcgcatc gccgtaccac ttcaaaacac ccaagcacag catactaaat 120

ttcccctctt tcttcctcta gggtgtcgtt aattacccgt actaaaggtt tggaaaagaa 180

aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg caataaaaat ttttatcacg 240

tttctttttc ttgaaaattt ttttttttga tttttttctc tttcgatgac ctcccattga 300

tatttaagtt aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta 360

ttacaacttt ttttacttct tgctcattag aaagaaagca tagcaatcta atctaagttt 420

taattacaaa atgtctgaat catctatttc ttcttctaaa ccatctgtgg aattgccaca 480

agcaacctgg tcgcatctgc aaagataccc agctttatcc aagtttatta aatatgcgga 540

atctctgcca cctgtggaga gattgatttc cttcaacctc gttgttttgg gatctgtgaa 600

ccagtgggtt tccgaatcgt ccagctctcc tcgtctggtg aagcaagttg ttgctgctgg 660

gaaggaaggg gccttcaagt tggacgagtt agttaacctc ttggtgttca aggagggtgt 720

cgacggcttg ctgtacaatt ggaaatcaca ttccaacacg ccagggatct ggctggtgtg 780

gttcttcgtc gactacgtcg ccaacatttc taatactctg ttgagggagt tcctgatcaa 840

gccattgcac ttgcaaggtt ctaccgcatc gaaggagatc ggctcttccg gtgaggagaa 900

caaggtcact gatgcttctt ctttgcccca cgtggcagag ttgtcttcaa cgaccagagg 960

tatgtcgcag gagatccagt ccaaggtcaa gtcgaactat atcgacccaa ccaaggacct 1020

ggctaaagaa aagtacgacg ccatagtgaa gcccacaact gacaagttgc agtctgtgta 1080

catcgaccca acaaagacta agcttaacga aacctaccaa cgcttcacca ctgtctatga 1140

aaacaatcta agtaaatctg aaagcgtccc taaagccatt gtatccaccg ggttggactt 1200

gggcaatgcc accattgaga agctaaaggc ctcaagagaa gaccaaacca attctaagcc 1260

cgcggctgtg tcgaccaatg gtggtggttc tatggcagcc gctatggttt tgttcttttc 1320

attgtcctta ttgttgttac ctttgttatt gttgtttgct tatttctctt acactaaaag 1380

aataccacaa aaagaaaatg attccaaggc tcctttacct ccaggtcaaa ccggttggcc 1440

attgatcggt gaaactttga actatttgtc atgtgttaag tccggtgtca gtgaaaactt 1500

cgtaaagtac agaaaggaaa agtactctcc aaaggttttc agaacttcat tgttaggtga 1560

accaatggcc attttatgcg gtcctgaagg taataagttc ttgtactcta cagaaaagaa 1620

attggtacaa gtttggtttc catcttcagt tgaaaagatg ttccctagat ctcatggtga 1680

atcaaacgca gataacttct ctaaagttag aggtaaaatg atgttcttgt taaaggtcga 1740

tggtatgaaa aagtatgtag gtttgatgga cagagttatg aagcaattct tggaaacaga 1800

ttggaacaga caacaacaaa ttaatgtaca caacaccgtt aaaaagtaca ccgtcactat 1860

gtcctgtaga gtattcatga gtatagatga cgaagaacaa gttaccagat tgggttccag 1920

tattcaaaac atagaagctg gtttgttagc agtcccaatc aatattcctg gtacagccat 1980

gaacagagct atcaaaacag taaagttgtt aaccagagaa gtcgaagccg taattaaaca 2040

aagaaaggtt gacttgttgg aaaataagca agcatctcaa ccacaagatt tgttgagtca 2100

tttgttgttg actgctaacc aagatggtca atttttatct gaatcagaca tcgcatcaca 2160

cttaattggt ttgatgcaag gtggttacac tacattgaac ggtacaatca ccttcgtctt 2220

gaactatttg gcagaattcc ctgacgtcta caatcaagta ttgaaggaac aagttgaaat 2280

cgccaactct aagcatccaa aggaattgtt gaactgggaa gatttgagaa agatgaagta 2340

ctcatggaac gttgctcaag aagtcttgag aattatacct ccaggtgttg gtacttttag 2400

agaagcaatt accgatttca cttatgccgg ttacttaatt cctaaaggtt ggaagatgca 2460

cttgatacca catgacactc acaagaatcc tacatacttc ccatctcctg aaaagttcga 2520

tcctactaga ttcgagggta acggtccagc tccttatact tttacaccat tcggtggtgg 2580

tccaagaatg tgccctggta tcgaatacgc aagattagtt atattgatct ttatgcataa 2640

tgttgtcaca aacttcagat gggaaaaatt gatcccaaac gaaaagatct tgactgaccc 2700

tatcccaaga ttcgcccacg gtttacctat ccacttacac ccacacaacg gttctacttc 2760

ttcaggttgg aagaaaacga cggcggatcg gagcggggag ctgaagcctt tgatgatccc 2820

taagtctctt atggctaagg acgaggatga tgatttggat ttgggatccg ggaagactag 2880

agtctctatc ttcttcggta cgcagactgg aacagctgag ggatttgcta aggcattatc 2940

cgaagaaatc aaagcgagat atgaaaaagc agcagtcaaa gtcattgact tggatgacta 3000

tgctgccgat gatgaccagt atgaagagaa attgaagaag gaaactttgg catttttctg 3060

tgttgctact tatggagatg gagagcctac tgacaatgct gccagatttt acaaatggtt 3120

tacggaggaa aatgaacggg atataaagct tcaacaacta gcatatggtg tgtttgctct 3180

tggtaatcgc caatatgaac attttaataa gatcgggata gttcttgatg aagagttatg 3240

taagaaaggt gcaaagcgtc ttattgaagt cggtctagga gatgatgatc agagcattga 3300

ggatgatttt aatgcctgga aagaatcact atggtctgag ctagacaagc tcctcaaaga 3360

cgaggatgat aaaagtgtgg caactcctta tacagctgtt attcctgaat accgggtggt 3420

gactcatgat cctcggttta caactcaaaa atcaatggaa tcaaatgtgg ccaatggaaa 3480

tactactatt gacattcatc atccctgcag agttgatgtt gctgtgcaga aggagcttca 3540

cacacatgaa tctgatcggt cttgcattca tctcgagttc gacatatcca ggacgggtat 3600

tacatatgaa acaggtgacc atgtaggtgt atatgctgaa aatcatgttg aaatagttga 3660

agaagctgga aaattgcttg gccactcttt agatttagta ttttccatac atgctgacaa 3720

ggaagatggc tccccattgg aaagcgcagt gccgcctcct ttccctggtc catgcacact 3780

tgggactggt ttggcaagat acgcagacct tttgaaccct cctcgaaagt ctgcgttagt 3840

tgccttggcg gcctatgcca ctgaaccaag tgaagccgag aaacttaagc acctgacatc 3900

acctgatgga aaggatgagt actcacaatg gattgttgca agtcagagaa gtcttttaga 3960

ggtgatggct gcttttccat ctgcaaaacc cccactaggt gtattttttg ctgcaatagc 4020

tcctcgtcta caacctcgtt actactccat ctcatcctcg ccaagattgg cgccaagtag 4080

agttcatgtt acatccgcac tagtatatgg tccaactcct actggtagaa tccacaaggg 4140

tgtgtgttct acgtggatga agaatgcagt tcctgcggag aaaagtcatg aatgtagtgg 4200

agccccaatc tttattcgag catctaattt caagttacca tccaaccctt caactccaat 4260

cgttatggtg ggacctggga ctgggctggc accttttaga ggttttctgc aggaaaggat 4320

ggcactaaaa gaagatggag aagaactagg ttcatctttg ctcttctttg ggtgtagaaa 4380

tcgacagatg gactttatat acgaggatga gctcaataat tttgttgatc aaggcgtaat 4440

atctgagctc atcatggcat tctcccgtga aggagctcag aaggagtatg ttcaacataa 4500

gatgatggag aaggcagcac aagtttggga tctaataaag gaagaaggat atctctatgt 4560

atgcggtgat gctaagggca tggcgaggga cgtccaccga actctacaca ccattgttca 4620

ggagcaggaa ggtgtgagtt cgtcagaggc agaggctata gttaagaaac ttcaaaccga 4680

aggaagatac ctcagagatg tctggtgacc gctgatccta gagggccgca tcatgtaatt 4740

agttatgtca cgcttacatt cacgccctcc ccccacatcc gctctaaccg aaaaggaagg 4800

agttagacaa cctgaagtct aggtccctat ttattttttt atagttatgt tagtattaag 4860

aacgttattt atatttcaaa tttttctttt ttttctgtac agacgcgtgt acgcatgtaa 4920

cattatactg aaaaccttgc ttgagaaggt tttgggacgc tcgaaggctt taatttgcaa 4980

gctgcggccc tgcattaatg aatcggccaa cgcgc 5181

<210> 2

<211> 1425

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ser Glu Ser Ser Ile Ser Ser Ser Lys Pro Ser Val Glu Leu Pro

1 5 10 15

Gln Ala Thr Trp Ser His Leu Gln Arg Tyr Pro Ala Leu Ser Lys Phe

20 25 30

Ile Lys Tyr Ala Glu Ser Leu Pro Pro Val Glu Arg Leu Ile Ser Phe

35 40 45

Asn Leu Val Val Leu Gly Ser Val Asn Gln Trp Val Ser Glu Ser Ser

50 55 60

Ser Ser Pro Arg Leu Val Lys Gln Val Val Ala Ala Gly Lys Glu Gly

65 70 75 80

Ala Phe Lys Leu Asp Glu Leu Val Asn Leu Leu Val Phe Lys Glu Gly

85 90 95

Val Asp Gly Leu Leu Tyr Asn Trp Lys Ser His Ser Asn Thr Pro Gly

100 105 110

Ile Trp Leu Val Trp Phe Phe Val Asp Tyr Val Ala Asn Ile Ser Asn

115 120 125

Thr Leu Leu Arg Glu Phe Leu Ile Lys Pro Leu His Leu Gln Gly Ser

130 135 140

Thr Ala Ser Lys Glu Ile Gly Ser Ser Gly Glu Glu Asn Lys Val Thr

145 150 155 160

Asp Ala Ser Ser Leu Pro His Val Ala Glu Leu Ser Ser Thr Thr Arg

165 170 175

Gly Met Ser Gln Glu Ile Gln Ser Lys Val Lys Ser Asn Tyr Ile Asp

180 185 190

Pro Thr Lys Asp Leu Ala Lys Glu Lys Tyr Asp Ala Ile Val Lys Pro

195 200 205

Thr Thr Asp Lys Leu Gln Ser Val Tyr Ile Asp Pro Thr Lys Thr Lys

210 215 220

Leu Asn Glu Thr Tyr Gln Arg Phe Thr Thr Val Tyr Glu Asn Asn Leu

225 230 235 240

Ser Lys Ser Glu Ser Val Pro Lys Ala Ile Val Ser Thr Gly Leu Asp

245 250 255

Leu Gly Asn Ala Thr Ile Glu Lys Leu Lys Ala Ser Arg Glu Asp Gln

260 265 270

Thr Asn Ser Lys Pro Ala Ala Val Ser Thr Asn Gly Gly Gly Ser Met

275 280 285

Ala Ala Ala Met Val Leu Phe Phe Ser Leu Ser Leu Leu Leu Leu Pro

290 295 300

Leu Leu Leu Leu Phe Ala Tyr Phe Ser Tyr Thr Lys Arg Ile Pro Gln

305 310 315 320

Lys Glu Asn Asp Ser Lys Ala Pro Leu Pro Pro Gly Gln Thr Gly Trp

325 330 335

Pro Leu Ile Gly Glu Thr Leu Asn Tyr Leu Ser Cys Val Lys Ser Gly

340 345 350

Val Ser Glu Asn Phe Val Lys Tyr Arg Lys Glu Lys Tyr Ser Pro Lys

355 360 365

Val Phe Arg Thr Ser Leu Leu Gly Glu Pro Met Ala Ile Leu Cys Gly

370 375 380

Pro Glu Gly Asn Lys Phe Leu Tyr Ser Thr Glu Lys Lys Leu Val Gln

385 390 395 400

Val Trp Phe Pro Ser Ser Val Glu Lys Met Phe Pro Arg Ser His Gly

405 410 415

Glu Ser Asn Ala Asp Asn Phe Ser Lys Val Arg Gly Lys Met Met Phe

420 425 430

Leu Leu Lys Val Asp Gly Met Lys Lys Tyr Val Gly Leu Met Asp Arg

435 440 445

Val Met Lys Gln Phe Leu Glu Thr Asp Trp Asn Arg Gln Gln Gln Ile

450 455 460

Asn Val His Asn Thr Val Lys Lys Tyr Thr Val Thr Met Ser Cys Arg

465 470 475 480

Val Phe Met Ser Ile Asp Asp Glu Glu Gln Val Thr Arg Leu Gly Ser

485 490 495

Ser Ile Gln Asn Ile Glu Ala Gly Leu Leu Ala Val Pro Ile Asn Ile

500 505 510

Pro Gly Thr Ala Met Asn Arg Ala Ile Lys Thr Val Lys Leu Leu Thr

515 520 525

Arg Glu Val Glu Ala Val Ile Lys Gln Arg Lys Val Asp Leu Leu Glu

530 535 540

Asn Lys Gln Ala Ser Gln Pro Gln Asp Leu Leu Ser His Leu Leu Leu

545 550 555 560

Thr Ala Asn Gln Asp Gly Gln Phe Leu Ser Glu Ser Asp Ile Ala Ser

565 570 575

His Leu Ile Gly Leu Met Gln Gly Gly Tyr Thr Thr Leu Asn Gly Thr

580 585 590

Ile Thr Phe Val Leu Asn Tyr Leu Ala Glu Phe Pro Asp Val Tyr Asn

595 600 605

Gln Val Leu Lys Glu Gln Val Glu Ile Ala Asn Ser Lys His Pro Lys

610 615 620

Glu Leu Leu Asn Trp Glu Asp Leu Arg Lys Met Lys Tyr Ser Trp Asn

625 630 635 640

Val Ala Gln Glu Val Leu Arg Ile Ile Pro Pro Gly Val Gly Thr Phe

645 650 655

Arg Glu Ala Ile Thr Asp Phe Thr Tyr Ala Gly Tyr Leu Ile Pro Lys

660 665 670

Gly Trp Lys Met His Leu Ile Pro His Asp Thr His Lys Asn Pro Thr

675 680 685

Tyr Phe Pro Ser Pro Glu Lys Phe Asp Pro Thr Arg Phe Glu Gly Asn

690 695 700

Gly Pro Ala Pro Tyr Thr Phe Thr Pro Phe Gly Gly Gly Pro Arg Met

705 710 715 720

Cys Pro Gly Ile Glu Tyr Ala Arg Leu Val Ile Leu Ile Phe Met His

725 730 735

Asn Val Val Thr Asn Phe Arg Trp Glu Lys Leu Ile Pro Asn Glu Lys

740 745 750

Ile Leu Thr Asp Pro Ile Pro Arg Phe Ala His Gly Leu Pro Ile His

755 760 765

Leu His Pro His Asn Gly Ser Thr Ser Ser Gly Trp Lys Lys Thr Thr

770 775 780

Ala Asp Arg Ser Gly Glu Leu Lys Pro Leu Met Ile Pro Lys Ser Leu

785 790 795 800

Met Ala Lys Asp Glu Asp Asp Asp Leu Asp Leu Gly Ser Gly Lys Thr

805 810 815

Arg Val Ser Ile Phe Phe Gly Thr Gln Thr Gly Thr Ala Glu Gly Phe

820 825 830

Ala Lys Ala Leu Ser Glu Glu Ile Lys Ala Arg Tyr Glu Lys Ala Ala

835 840 845

Val Lys Val Ile Asp Leu Asp Asp Tyr Ala Ala Asp Asp Asp Gln Tyr

850 855 860

Glu Glu Lys Leu Lys Lys Glu Thr Leu Ala Phe Phe Cys Val Ala Thr

865 870 875 880

Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe Tyr Lys Trp

885 890 895

Phe Thr Glu Glu Asn Glu Arg Asp Ile Lys Leu Gln Gln Leu Ala Tyr

900 905 910

Gly Val Phe Ala Leu Gly Asn Arg Gln Tyr Glu His Phe Asn Lys Ile

915 920 925

Gly Ile Val Leu Asp Glu Glu Leu Cys Lys Lys Gly Ala Lys Arg Leu

930 935 940

Ile Glu Val Gly Leu Gly Asp Asp Asp Gln Ser Ile Glu Asp Asp Phe

945 950 955 960

Asn Ala Trp Lys Glu Ser Leu Trp Ser Glu Leu Asp Lys Leu Leu Lys

965 970 975

Asp Glu Asp Asp Lys Ser Val Ala Thr Pro Tyr Thr Ala Val Ile Pro

980 985 990

Glu Tyr Arg Val Val Thr His Asp Pro Arg Phe Thr Thr Gln Lys Ser

995 1000 1005

Met Glu Ser Asn Val Ala Asn Gly Asn Thr Thr Ile Asp Ile His His

1010 1015 1020

Pro Cys Arg Val Asp Val Ala Val Gln Lys Glu Leu His Thr His Glu

1025 1030 1035 1040

Ser Asp Arg Ser Cys Ile His Leu Glu Phe Asp Ile Ser Arg Thr Gly

1045 1050 1055

Ile Thr Tyr Glu Thr Gly Asp His Val Gly Val Tyr Ala Glu Asn His

1060 1065 1070

Val Glu Ile Val Glu Glu Ala Gly Lys Leu Leu Gly His Ser Leu Asp

1075 1080 1085

Leu Val Phe Ser Ile His Ala Asp Lys Glu Asp Gly Ser Pro Leu Glu

1090 1095 1100

Ser Ala Val Pro Pro Pro Phe Pro Gly Pro Cys Thr Leu Gly Thr Gly

1105 1110 1115 1120

Leu Ala Arg Tyr Ala Asp Leu Leu Asn Pro Pro Arg Lys Ser Ala Leu

1125 1130 1135

Val Ala Leu Ala Ala Tyr Ala Thr Glu Pro Ser Glu Ala Glu Lys Leu

1140 1145 1150

Lys His Leu Thr Ser Pro Asp Gly Lys Asp Glu Tyr Ser Gln Trp Ile

1155 1160 1165

Val Ala Ser Gln Arg Ser Leu Leu Glu Val Met Ala Ala Phe Pro Ser

1170 1175 1180

Ala Lys Pro Pro Leu Gly Val Phe Phe Ala Ala Ile Ala Pro Arg Leu

1185 1190 1195 1200

Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Ser Pro Arg Leu Ala Pro Ser

1205 1210 1215

Arg Val His Val Thr Ser Ala Leu Val Tyr Gly Pro Thr Pro Thr Gly

1220 1225 1230

Arg Ile His Lys Gly Val Cys Ser Thr Trp Met Lys Asn Ala Val Pro

1235 1240 1245

Ala Glu Lys Ser His Glu Cys Ser Gly Ala Pro Ile Phe Ile Arg Ala

1250 1255 1260

Ser Asn Phe Lys Leu Pro Ser Asn Pro Ser Thr Pro Ile Val Met Val

1265 1270 1275 1280

Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe Leu Gln Glu Arg

1285 1290 1295

Met Ala Leu Lys Glu Asp Gly Glu Glu Leu Gly Ser Ser Leu Leu Phe

1300 1305 1310

Phe Gly Cys Arg Asn Arg Gln Met Asp Phe Ile Tyr Glu Asp Glu Leu

1315 1320 1325

Asn Asn Phe Val Asp Gln Gly Val Ile Ser Glu Leu Ile Met Ala Phe

1330 1335 1340

Ser Arg Glu Gly Ala Gln Lys Glu Tyr Val Gln His Lys Met Met Glu

1345 1350 1355 1360

Lys Ala Ala Gln Val Trp Asp Leu Ile Lys Glu Glu Gly Tyr Leu Tyr

1365 1370 1375

Val Cys Gly Asp Ala Lys Gly Met Ala Arg Asp Val His Arg Thr Leu

1380 1385 1390

His Thr Ile Val Gln Glu Gln Glu Gly Val Ser Ser Ser Glu Ala Glu

1395 1400 1405

Ala Ile Val Lys Lys Leu Gln Thr Glu Gly Arg Tyr Leu Arg Asp Val

1410 1415 1420

Trp

1425

<210> 3

<211> 2498

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acgcacagat attataacat ctgcacaata ggcatttgca agaattactc gtgagtaagg 60

aaagagtgag gaactatcgc atacctgcat ttaaagatgc cgatttgggc gcgaatcctt 120

tattttggct tcaccctcat actattatca gggccagaaa aaggaagtgt ttccctcctt 180

cttgaattga tgttaccctc ataaagcacg tggcctctta tcgagaaaga aattaccgtc 240

gctcgtgatt tgtttgcaaa aagaacaaaa ctgaaaaaac ccagacacgc tcgacttcct 300

gtcttcctat tgattgcagc ttccaatttc gtcacacaac aaggtcctag cgacggctca 360

caggttttgt aacaagcaat cgaaggttct ggaatggcgg gaaagggttt agtaccacat 420

gctatgatgc ccactgtgat ctccagagca aagttcgttc gatcgtactg ttactctctc 480

tctttcaaac agaattgtcc gaatcgtgtg acaacaacag cctgttctca cacactcttt 540

tcttctaacc aagggggtgg tttagtttag tagaacctcg tgaaacttac atttacatat 600

atataaactt gcataaattg gtcaatgcaa gaaatacata tttggtcttt tctaattcgt 660

agtttttcaa gttcttagat gctttctttt tctctttttt acagatcatc aaggaagtaa 720

ttatctactt tttacaacaa atataaaaca aaaacaatgg ctgcagacca attggtgaaa 780

actgaagtca ccaagaagtc ttttactgct cctgtacaaa aggcttctac accagtttta 840

accaataaaa cagtcatttc tggatcgaaa gtcaaaagtt tatcatctgc gcaatcgagc 900

tcatcaggac cttcatcatc tagtgaggaa gatgattccc gcgatattga aagcttggat 960

aagaaaatac gtcctttaga agaattagaa gcattattaa gtagtggaaa tacaaaacaa 1020

ttgaagaaca aagaggtcgc tgccttggtt attcacggta agttaccttt gtacgctttg 1080

gagaaaaaat taggtgatac tacgagagcg gttgcggtac gtaggaaggc tctttcaatt 1140

ttggcagaag ctcctgtatt agcatctgat cgtttaccat ataaaaatta tgactacgac 1200

cgcgtatttg gcgcttgttg tgaaaatgtt ataggttaca tgcctttgcc cgttggtgtt 1260

ataggcccct tggttatcga tggtacatct tatcatatac caatggcaac tacagagggt 1320

tgtttggtag cttctgccat gcgtggctgt aaggcaatca atgctggcgg tggtgcaaca 1380

actgttttaa ctaaggatgg tatgacaaga ggcccagtag tccgtttccc aactttgaaa 1440

agatctggtg cctgtaagat atggttagac tcagaagagg gacaaaacgc aattaaaaaa 1500

gcttttaact ctacatcaag atttgcacgt ctgcaacata ttcaaacttg tctagcagga 1560

gatttactct tcatgagatt tagaacaact actggtgacg caatgggtat gaatatgatt 1620

tctaaaggtg tcgaatactc attaaagcaa atggtagaag agtatggctg ggaagatatg 1680

gaggttgtct ccgtttctgg taactactgt accgacaaaa aaccagctgc catcaactgg 1740

atcgaaggtc gtggtaagag tgtcgtcgca gaagctacta ttcctggtga tgttgtcaga 1800

aaagtgttaa aaagtgatgt ttccgcattg gttgagttga acattgctaa gaatttggtt 1860

ggatctgcaa tggctgggtc tgttggtgga tttaacgcac atgcagctaa tttagtgaca 1920

gctgttttct tggcattagg acaagatcct gcacaaaatg ttgaaagttc caactgtata 1980

acattgatga aagaagtgga cggtgatttg agaatttccg tatccatgcc atccatcgaa 2040

gtaggtacca tcggtggtgg tactgttcta gaaccacaag gtgccatgtt ggacttatta 2100

ggtgtaagag gcccgcatgc taccgctcct ggtaccaacg cacgtcaatt agcaagaata 2160

gttgcctgtg ccgtcttggc aggtgaatta tccttatgtg ctgccctagc agccggccat 2220

ttggttcaaa gtcatatgac ccacaacagg aaacctgctg aaccaacaaa acctaacaat 2280

ttggacgcca ctgatataaa tcgtttgaaa gatgggtccg tcacctgcat taaatcctaa 2340

agttataaaa aaaataagtg tatacaaatt ttaaagtgac tcttaggttt taaaacgaaa 2400

attcttattc ttgagtaact ctttcctgta ggtcaggttg ctttctcagg tatagcatga 2460

ggtcgctctt attgaccaca cctctaccgg catgccga 2580

<210> 4

<211> 2532

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

catgcgactg ggtgagcata tgttccgctg atgtgatgtg caagataaac aagcaaggca 60

gaaactaact tcttcttcat gtaataaaca caccccgcgt ttatttacct atctctaaac 120

ttcaacacct tatatcataa ctaatatttc ttgagataag cacactgcac ccataccttc 180

cttaaaaacg tagcttccag tttttggtgg ttccggcttc cttcccgatt ccgcccgcta 240

aacgcatatt tttgttgcct ggtggcattt gcaaaatgca taacctatgc atttaaaaga 300

ttatgtatgc tcttctgact tttcgtgtga tgaggctcgt ggaaaaaatg aataatttat 360

gaatttgaga acaattttgt gttgttacgg tattttacta tggaataatc aatcaattga 420

ggattttatg caaatatcgt ttgaatattt ttccgaccct ttgagtactt ttcttcataa 480

ttgcataata ttgtccgctg cccctttttc tgttagacgg tgtcttgatc tacttgctat 540

cgttcaacac caccttattt tctaactatt ttttttttag ctcatttgaa tcagcttatg 600

gtgatggcac atttttgcat aaacctagct gtcctcgttg aacataggaa aaaaaaatat 660

ataaacaagg ctctttcact ctccttgcaa tcagatttgg gtttgttccc tttattttca 720

tatttcttgt catattcctt tctcaattat tattttctac tcataacctc acgcaaaata 780

acacagtcaa atcaatcaaa atgtcattac cgttcttaac ttctgcaccg ggaaaggtta 840

ttatttttgg tgaacactct gctgtgtaca acaagcctgc cgtcgctgct agtgtgtctg 900

cgttgagaac ctacctgcta ataagcgagt catctgcacc agatactatt gaattggact 960

tcccggacat tagctttaat cataagtggt ccatcaatga tttcaatgcc atcaccgagg 1020

atcaagtaaa ctcccaaaaa ttggccaagg ctcaacaagc caccgatggc ttgtctcagg 1080

aactcgttag tcttttggat ccgttgttag ctcaactatc cgaatccttc cactaccatg 1140

cagcgttttg tttcctgtat atgtttgttt gcctatgccc ccatgccaag aatattaagt 1200

tttctttaaa gtctacttta cccatcggtg ctgggttggg ctcaagcgcc tctatttctg 1260

tatcactggc cttagctatg gcctacttgg gggggttaat aggatctaat gacttggaaa 1320

agctgtcaga aaacgataag catatagtga atcaatgggc cttcataggt gaaaagtgta 1380

ttcacggtac cccttcagga atagataacg ctgtggccac ttatggtaat gccctgctat 1440

ttgaaaaaga ctcacataat ggaacaataa acacaaacaa ttttaagttc ttagatgatt 1500

tcccagccat tccaatgatc ctaacctata ctagaattcc aaggtctaca aaagatcttg 1560

ttgctcgcgt tcgtgtgttg gtcaccgaga aatttcctga agttatgaag ccaattctag 1620

atgccatggg tgaatgtgcc ctacaaggct tagagatcat gactaagtta agtaaatgta 1680

aaggcaccga tgacgaggct gtagaaacta ataatgaact gtatgaacaa ctattggaat 1740

tgataagaat aaatcatgga ctgcttgtct caatcggtgt ttctcatcct ggattagaac 1800

ttattaaaaa tctgagcgat gatttgagaa ttggctccac aaaacttacc ggtgctggtg 1860

gcggcggttg ctctttgact ttgttacgaa gagacattac tcaagagcaa attgacagct 1920

tcaaaaagaa attgcaagat gattttagtt acgagacatt tgaaacagac ttgggtggga 1980

ctggctgctg tttgttaagc gcaaaaaatt tgaataaaga tcttaaaatc aaatccctag 2040

tattccaatt atttgaaaat aaaactacca caaagcaaca aattgacgat ctattattgc 2100

caggaaacac gaatttacca tggacttcat aagcggatct cttatgtctt tacgatttat 2160

agttttcatt atcaagtatg cctatattag tatatagcat ctttagatga cagtgttcga 2220

agtttcacga ataaaagata atattctact ttttgctccc accgcgtttg ctagcacgag 2280

tgaacaccat ccctcgcctg tgagttgtac ccattcctct aaactgtaga catggtagct 2340

tcagcagtgt tcgttatgta cggcatcctc caacaaacag tcggttatag tttgtcctgc 2400

tcctctgaat cgtctccctc gatatttctc attttccttc gcatgccagc attgaaatga 2460

tcgaagttca atgatgaaac ggtaattctt ctgtcattta ctcatctcat ctcatcaagt 2520

tatataattc ta 2616

<210> 5

<211> 2267

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aatcctactc ttgccgttgc catccaaaat gagctagaag gtggattaac aaatataatg 60

acaaatcgtt gcttgtctga cttgattcca ctacagttac aaatatttga cattgtatat 120

aagttttgca agttcatcaa atctatgaga gcaaaattat gtcaactgga ccccgtacta 180

tatgagaaac acaaaagcgg gatgatgaaa acactaaacg aaggctatcg tacaaacaat 240

ggcggtcagg aagatgttgg ttaccaagaa gatgccgccc tggaattaat tcagaagctg 300

attgaataca ttagcaacgc gtccagcatt tttcggaagt gtctcataaa ctttactcaa 360

gagttaagta ctgaaaaatt cgacttttat gatagttcaa gtgtcgacgc tgcgggtata 420

gaaagggttc tttactctat agtacctcct cgctcagcat ctgcttcttc ccaaagatga 480

acgcggcgtt atgtcactaa cgacgtgcac caacttgcgg aaagtggaat cccgttccaa 540

aactggcatc cactaattga tacatctaca caccgcacgc cttttttctg aagcccactt 600

tcgtggactt tgccatatgc aaaattcatg aagtgtgata ccaagtcagc atacacctca 660

ctagggtagt ttctttggtt gtattgatca tttggttcat cgtggttcat taattttttt 720

tctccattgc tttctggctt tgatcttact atcatttgga tttttgtcga aggttgtaga 780

attgtatgtg acaagtggca ccaagcatat ataaaaaaaa aaagcattat cttcctacca 840

gagttgattg ttaaaaacgt atttatagca aacgcaattg taattaattc ttattttgta 900

tcttttcttc ccttgtctca atcttttatt tttattttat ttttcttttc ttagtttctt 960

tcataacacc aagcaactaa tactataaca tacaataata atgactgccg acaacaatag 1020

tatgccccat ggtgcagtat ctagttacgc caaattagtg caaaaccaaa cacctgaaga 1080

cattttggaa gagtttcctg aaattattcc attacaacaa agacctaata cccgatctag 1140

tgagacgtca aatgacgaaa gcggagaaac atgtttttct ggtcatgatg aggagcaaat 1200

taagttaatg aatgaaaatt gtattgtttt ggattgggac gataatgcta ttggtgccgg 1260

taccaagaaa gtttgtcatt taatggaaaa tattgaaaag ggtttactac atcgtgcatt 1320

ctccgtcttt attttcaatg aacaaggtga attactttta caacaaagag ccactgaaaa 1380

aataactttc cctgatcttt ggactaacac atgctgctct catccactat gtattgatga 1440

cgaattaggt ttgaagggta agctagacga taagattaag ggcgctatta ctgcggcggt 1500

gagaaaacta gatcatgaat taggtattcc agaagatgaa actaagacaa ggggtaagtt 1560

tcacttttta aacagaatcc attacatggc accaagcaat gaaccatggg gtgaacatga 1620

aattgattac atcctatttt ataagatcaa cgctaaagaa aacttgactg tcaacccaaa 1680

cgtcaatgaa gttagagact tcaaatgggt ttcaccaaat gatttgaaaa ctatgtttgc 1740

tgacccaagt tacaagttta cgccttggtt taagattatt tgcgagaatt acttattcaa 1800

ctggtgggag caattagatg acctttctga agtggaaaat gacaggcaaa ttcatagaat 1860

gctataagcg atttaatctc taattattag ttaaagtttt ataagcattt ttatgtaacg 1920

aaaaataaat tggttcatat tattactgca ctgtcactta ccatggaaag accagacaag 1980

aagttgccga cagtctgttg aattggcctg gttaggctta agtctgggtc cgcttcttta 2040

caaatttgga gaatttctct taaacgatat gtatattctt ttcgttggaa aagatgtctt 2100

ccaaaaaaaa aaccgatgaa ttagtggaac caaggaaaaa aaaagaggta tccttgatta 2160

aggaacactg tttaaacagt gtggtttcca aaaccctgaa actgcattag tgtaatagaa 2220

gactagacac ctcgatacaa ataatggtta ctcaattcaa aactgcc 2341

<210> 6

<211> 2591

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aatgctacta ttttggagat taatctcagt acaaaacaat attaaaaaga ggtgaattat 60

ttttcccccc ttattttttt tttgttaaaa ttgatccaaa tgtaaataaa caatcacaag 120

gaaaaaaaaa aaaaaaaaaa aaatagccgc catgaccccg gatcgtcggt tgtgatacgg 180

tcagggtagc gccctggtca aacttcagaa ctaaaaaaat aataaggaag aaaaaaatag 240

ctaatttttc cggcagaaag attttcgcta cccgaaagtt tttccggcaa gctaaatgga 300

aaaaggaaag attattgaaa gagaaagaaa gaaaaaaaaa aaatgtacac ccagacatcg 360

ggcttccaca atttcggctc tattgttttc catctctcgc aacggcggga ttcctctatg 420

gcgtgtgatg tctgtatctg ttacttaatc cagaaactgg cacttgaccc aactctgcca 480

cgtgggtcgt tttgccatcg acagattggg agattttcat agtagaattc agcatgatag 540

ctacgtaaat gtgttccgca ccgtcacaaa gtgttttcta ctgttctttc ttctttcgtt 600

cattcagttg agttgagtga gtgctttgtt caatggatct tagctaaaat gcatattttt 660

tctcttggta aatgaatgct tgtgatgtct tccaagtgat ttcctttcct tcccatatga 720

tgctaggtac ctttagtgtc ttcctaaaaa aaaaaaaagg ctcgccatca aaacgatatt 780

cgttggcttt tttttctgaa ttataaatac tctttggtaa cttttcattt ccaagaacct 840

cttttttcca gttatatcat ggtccccttt caaagttatt ctctactctt tttcatattc 900

attctttttc atcctttggt tttttattct taacttgttt attattctct cttgtttcta 960

tttacaagac accaatcaaa acaaataaaa catcatcaca atgaccgttt acacagcatc 1020

cgttaccgca cccgtcaaca tcgcaaccct taagtattgg gggaaaaggg acacgaagtt 1080

gaatctgccc accaattcgt ccatatcagt gactttatcg caagatgacc tcagaacgtt 1140

gacctctgcg gctactgcac ctgagtttga acgcgacact ttgtggttaa atggagaacc 1200

acacagcatc gacaatgaaa gaactcaaaa ttgtctgcgc gacctacgcc aattaagaaa 1260

ggaaatggaa tcgaaggacg cctcattgcc cacattatct caatggaaac tccacattgt 1320

ctccgaaaat aactttccta cagcagctgg tttagcttcc tccgctgctg gctttgctgc 1380

attggtctct gcaattgcta agttatacca attaccacag tcaacttcag aaatatctag 1440

aatagcaaga aaggggtctg gttcagcttg tagatcgttg tttggcggat acgtggcctg 1500

ggaaatggga aaagctgaag atggtcatga ttccatggca gtacaaatcg cagacagctc 1560

tgactggcct cagatgaaag cttgtgtcct agttgtcagc gatattaaaa aggatgtgag 1620

ttccactcag ggtatgcaat tgaccgtggc aacctccgaa ctatttaaag aaagaattga 1680

acatgtcgta ccaaagagat ttgaagtcat gcgtaaagcc attgttgaaa aagatttcgc 1740

cacctttgca aaggaaacaa tgatggattc caactctttc catgccacat gtttggactc 1800

tttccctcca atattctaca tgaatgacac ttccaagcgt atcatcagtt ggtgccacac 1860

cattaatcag ttttacggag aaacaatcgt tgcatacacg tttgatgcag gtccaaatgc 1920

tgtgttgtac tacttagctg aaaatgagtc gaaactcttt gcatttatct ataaattgtt 1980

tggctctgtt cctggatggg acaagaaatt tactactgag cagcttgagg ctttcaacca 2040

tcaatttgaa tcatctaact ttactgcacg tgaattggat cttgagttgc aaaaggatgt 2100

tgccagagtg attttaactc aagtcggttc aggcccacaa gaaacaaacg aatctttgat 2160

tgacgcaaag actggtctac caaaggaata aacaaatcgc tcttaaatat atacctaaag 2220

aacattaaag ctatattata agcaaagata cgtaaatttt gcttatatta ttatacacat 2280

atcatatttc tatattttta agatttggtt atataatgta cgtaatgcaa aggaaataaa 2340

ttttatacat tattgaacag cgtccaagta actacattat gtgcactaat agtttagcgt 2400

cgtgaagact ttattgtgtc gcgaaaagta aaaattttaa aaattagagc accttgaact 2460

tgcgaaaaag gttctcatca actgtttaaa aggaggatat caggtcctat ttctgacaaa 2520

caatatacaa atttagtttc aaagatgaat cagtgcgcga aggacataac tcatgaagcc 2580

tccagtatac c 2677

<210> 7

<211> 2264

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atggggccgt atacttacat atagtagatg tcaagcgtag gcgcttcccc tgccggctgt 60

gagggcgcca taaccaaggt atctatagac cgccaatcag caaactacct ccgtacattc 120

atgttgcacc cacacattta tacacccaga ccgcgacaaa ttacccataa ggttgtttgt 180

gacggcgtcg tacaagagaa cgtgggaact ttttaggctc accaaaaaag aaagaaaaaa 240

tacgagttgc tgacagaagc ctcaagaaaa aaaaaattct tcttcgacta tgctggaggc 300

agagatgatc gagccggtag ttaactatat atagctaaat tggttccatc accttctttt 360

ctggtgtcgc tccttctagt gctatttctg gcttttccta tttttttttt tccatttttc 420

tttctctctt tctaatatat aaattctctt gcattttcta tttttctctc tatctattct 480

acttgtttat tcccttcaag gttttttttt aaggagtact tgtttttaga atatacggtc 540

aacgaactat aattaactaa acatgactgg taaaacaggt catatcgatg gtttgaattc 600

tagaatcgaa aagatgagag atttggaccc agcacaaaga ttagttagag ttgctgaagc 660

tgcaggtttg gaaccagaag ctatttctgc attagctggt aatggtgcat tgccattatc 720

attggctaac ggtatgatcg aaaacgttat cggtaaattc gaattgccat tgggtgttgc 780

tactaacttc acagttaacg gtagagatta tttgatccca atggctgttg aagaaccatc 840

tgttgttgct gcagcttcat acatggcaag aattgctaga gaaaatggtg gttttactgc 900

acatggtaca gctccattga tgagagctca aattcaagtt gttggtttag gtgacccaga 960

aggtgcaaga caaagattgt tagctcataa agcagctttt atggaagcag ctgatgctgt 1020

tgatccagtt ttagttggtt tgggtggtgg ttgtagagat atcgaagttc atgtttttag 1080

agatactcca gttggtgcta tggttgtttt gcatttgatc gttgatgtta gagatgcaat 1140

gggtgctaac actgttaaca caatggcaga aagattggct ccagaagttg aaagaattgc 1200

aggtggtact gttagattga gaattttgtc taatttggct gatttgagat tggttagagc 1260

aagagttgaa ttggctccag aaacattaac tacacaaggt tatgatggtg cagatgttgc 1320

tcgtggtatg gttgaagcat gtgctttagc aattgttgat ccatacagag cagctactca 1380

taataagggt atcatgaacg gtatcgatcc agttgttgtt gcaactggta atgattggag 1440

agctattgaa gctggtgcac atgcttatgc agctagaact ggtcattaca cttcattgac 1500

aagatgggaa ttagctaatg atggtagatt ggttggtact attgaattac cattggcatt 1560

aggtttggtt ggtggtgcta ctaaaacaca tccaacagca agagcagctt tagctttgat 1620

gcaagttgaa actgcaacag aattggctca agttacagca gctgttggtt tagctcaaaa 1680

tatggcagct attagagcat tggctactga aggtattcaa agaggtcata tgacattgca 1740

tgcaagaaac atcgctatta tggcaggtgc tactggtgca gatatcgata gagttacaag 1800

agttattgtt gaagctggtg acgtttcagt tgcaagagct aagcaagttt tggaaaacac 1860

ataaagtgct tttaactaag aattattagt cttttctgct tattttttca tcatagttta 1920

gaacacttta tattaacgaa tagtttatga atctatttag gtttaaaaat tgatacagtt 1980

ttataagtta ctttttcaaa gactcgtgct gtctattgca taatgcactg gaaggggaaa 2040

aaaaaggtgc acacgcgtgg ctttttcttg aatttgcagt ttgaaaaata actacatgga 2100

tgataagaaa acatggagta cagtcacttt gagaaccttc aatcagctgg taacgtcttc 2160

gttaattgga tactcaaaaa agatggatag catgaatcac aagatggaag gaaatgcggg 2220

ccacgaccac agtgatatgc atatgggaga tggagatgat acct 2338

<210> 8

<211> 2699

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gatccaactg gcaccgctgg cttgaacaac aataccagcc ttccaacttc tgtaaataac 60

ggcggtacgc cagtgccacc agtaccgtta cctttcggta tacctccttt ccccatgttt 120

ccaatgccct tcatgcctcc aacggctact atcacaaatc ctcatcaagc tgacgcaagc 180

cctaagaaat gaataacaat actgacagta ctaaataatt gcctacttgg cttcacatac 240

gttgcatacg tcgatataga taataatgat aatgacagca ggattatcgt aatacgtaat 300

agttgaaaat ctcaaaaatg tgtgggtcat tacgtaaata atgataggaa tgggattctt 360

ctatttttcc tttttccatt ctagcagccg tcgggaaaac gtggcatcct ctctttcggg 420

ctcaattgga gtcacgctgc cgtgagcatc ctctctttcc atatctaaca actgagcacg 480

taaccaatgg aaaagcatga gcttagcgtt gctccaaaaa agtattggat ggttaatacc 540

atttgtctgt tctcttctga ctttgactcc tcaaaaaaaa aaaatctaca atcaacagat 600

cgcttcaatt acgccctcac aaaaactttt ttccttcttc ttcgcccacg ttaaatttta 660

tccctcatgt tgtctaacgg atttctgcac ttgatttatt ataaaaagac aaagacataa 720

tacttctcta tcaatttcag ttattgttct tccttgcgtt attcttctgt tcttcttttt 780

cttttgtcat atataaccat aaccaagtaa tacatattca aaatgaaact ctcaactaaa 840

ctttgttggt gtggtattaa aggaagactt aggccgcaaa agcaacaaca attacacaat 900

acaaacttgc aaatgactga actaaaaaaa caaaagaccg ctgaacaaaa aaccagacct 960

caaaatgtcg gtattaaagg tatccaaatt tacatcccaa ctcaatgtgt caaccaatct 1020

gagctagaga aatttgatgg cgtttctcaa ggtaaataca caattggtct gggccaaacc 1080

aacatgtctt ttgtcaatga cagagaagat atctactcga tgtccctaac tgttttgtct 1140

aagttgatca agagttacaa catcgacacc aacaaaattg gtagattaga agtcggtact 1200

gaaactctga ttgacaagtc caagtctgtc aagtctgtct tgatgcaatt gtttggtgaa 1260

aacactgacg tcgaaggtat tgacacgctt aatgcctgtt acggtggtac caacgcgttg 1320

ttcaactctt tgaactggat tgaatctaac gcatgggatg gtagagacgc cattgtagtt 1380

tgcggtgata ttgccatcta cgataagggt gccgcaagac caaccggtgg tgccggtact 1440

gttgctatgt ggatcggtcc tgatgctcca attgtatttg actctgtaag agcttcttac 1500

atggaacacg cctacgattt ttacaagcca gatttcacca gcgaatatcc ttacgtcgat 1560

ggtcattttt cattaacttg ttacgtcaag gctcttgatc aagtttacaa gagttattcc 1620

aagaaggcta tttctaaagg gttggttagc gatcccgctg gttcggatgc tttgaacgtt 1680

ttgaaatatt tcgactacaa cgttttccat gttccaacct gtaaattggt cacaaaatca 1740

tacggtagat tactatataa cgatttcaga gccaatcctc aattgttccc agaagttgac 1800

gccgaattag ctactcgcga ttatgacgaa tctttaaccg ataagaacat tgaaaaaact 1860

tttgttaatg ttgctaagcc attccacaaa gagagagttg cccaatcttt gattgttcca 1920

acaaacacag gtaacatgta caccgcatct gtttatgccg cctttgcatc tctattaaac 1980

tatgttggat ctgacgactt acaaggcaag cgtgttggtt tattttctta cggttccggt 2040

ttagctgcat ctctatattc ttgcaaaatt gttggtgacg tccaacatat tatcaaggaa 2100

ttagatatta ctaacaaatt agccaagaga atcaccgaaa ctccaaagga ttacgaagct 2160

gccatcgaat tgagagaaaa tgcccatttg aagaagaact tcaaacctca aggttccatt 2220

gagcatttgc aaagtggtgt ttactacttg accaacatcg atgacaaatt tagaagatct 2280

tacgatgtta aaaaataaat ttaactcctt aagttacttt aatgatttag tttttattat 2340

taataattca tgctcatgac atctcatata cacgtttata aaacttaaat agattgaaaa 2400

tgtattaaag attcctcagg gattcgattt ttttggaagt ttttgttttt ttttccttga 2460

gatgctgtag tatttgggaa caattataca atcgaaagat atatgcttac attcgaccgt 2520

tttagccgtg atcattatcc tatagtaaca taacctgaag cataactgac actactatca 2580

tcaatacttg tcacatgaga actctgtgaa taattaggcc actgaaattt gatgcctgaa 2640

ggaccggcat cacggatttt cgataaagca cttagtatca cactaattgg cttttcgcc 2787

<210> 9

<211> 2558

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atactagcgt tgaatgttag cgtcaacaac aagaagttta atgacgcgga ggccaaggca 60

aaaagattcc ttgattacgt aagggagtta gaatcatttt gaataaaaaa cacgcttttt 120

cagttcgagt ttatcattat caatactgcc atttcaaaga atacgtaaat aattaatagt 180

agtgattttc ctaactttat ttagtcaaaa aattagcctt ttaattctgc tgtaacccgt 240

acatgcccaa aatagggggc gggttacaca gaatatataa catcgtaggt gtctgggtga 300

acagtttatt cctggcatcc actaaatata atggagcccg ctttttaagc tggcatccag 360

aaaaaaaaag aatcccagca ccaaaatatt gttttcttca ccaaccatca gttcataggt 420

ccattctctt agcgcaacta cagagaacag gggcacaaac aggcaaaaaa cgggcacaac 480

ctcaatggag tgatgcaacc tgcctggagt aaatgatgac acaaggcaat tgacccacgc 540

atgtatctat ctcattttct tacaccttct attaccttct gctctctctg atttggaaaa 600

agctgaaaaa aaaggttgaa accagttccc tgaaattatt cccctacttg actaataagt 660

atataaagac ggtaggtatt gattgtaatt ctgtaaatct atttcttaaa cttcttaaat 720

tctactttta tagttagtct tttttttagt tttaaaacac caagaactta gtttcgaata 780

aacacacata aacaaacaaa atgtcagagt tgagagcctt cagtgcccca gggaaagcgt 840

tactagctgg tggatattta gttttagata caaaatatga agcatttgta gtcggattat 900

cggcaagaat gcatgctgta gcccatcctt acggttcatt gcaagggtct gataagtttg 960

aagtgcgtgt gaaaagtaaa caatttaaag atggggagtg gctgtaccat ataagtccta 1020

aaagtggctt cattcctgtt tcgataggcg gatctaagaa ccctttcatt gaaaaagtta 1080

tcgctaacgt atttagctac tttaaaccta acatggacga ctactgcaat agaaacttgt 1140

tcgttattga tattttctct gatgatgcct accattctca ggaggatagc gttaccgaac 1200

atcgtggcaa cagaagattg agttttcatt cgcacagaat tgaagaagtt cccaaaacag 1260

ggctgggctc ctcggcaggt ttagtcacag ttttaactac agctttggcc tccttttttg 1320

tatcggacct ggaaaataat gtagacaaat atagagaagt tattcataat ttagcacaag 1380

ttgctcattg tcaagctcag ggtaaaattg gaagcgggtt tgatgtagcg gcggcagcat 1440

atggatctat cagatataga agattcccac ccgcattaat ctctaatttg ccagatattg 1500

gaagtgctac ttacggcagt aaactggcgc atttggttga tgaagaagac tggaatatta 1560

cgattaaaag taaccattta ccttcgggat taactttatg gatgggcgat attaagaatg 1620

gttcagaaac agtaaaactg gtccagaagg taaaaaattg gtatgattcg catatgccag 1680

aaagcttgaa aatatataca gaactcgatc atgcaaattc tagatttatg gatggactat 1740

ctaaactaga tcgcttacac gagactcatg acgattacag cgatcagata tttgagtctc 1800

ttgagaggaa tgactgtacc tgtcaaaagt atcctgaaat cacagaagtt agagatgcag 1860

ttgccacaat tagacgttcc tttagaaaaa taactaaaga atctggtgcc gatatcgaac 1920

ctcccgtaca aactagctta ttggatgatt gccagacctt aaaaggagtt cttacttgct 1980

taatacctgg tgctggtggt tatgacgcca ttgcagtgat tactaagcaa gatgttgatc 2040

ttagggctca aaccgctaat gacaaaagat tttctaaggt tcaatggctg gatgtaactc 2100

aggctgactg gggtgttagg aaagaaaaag atccggaaac ttatcttgat aaataagatt 2160

aatataatta tataaaaata ttatcttctt ttctttatat ctagtgttat gtaaaataaa 2220

ttgatgacta cggaaagctt ttttatattg tttctttttc attctgagcc acttaaattt 2280

cgtgaatgtt cttgtaaggg acggtagatt tacaagtgat acaacaaaaa gcaaggcgct 2340

ttttctaata aaaagaagaa aagcatttaa caattgaaca cctctatatc aacgaagaat 2400

attactttgt ctctaaatcc ttgtaaaatg tgtacgatct ctatatgggt tactcataag 2460

tgtaccgaag actgcattga aagtttatgt tttttcactg gaggcgtcat tttcgcgttg 2520

agaagatgtt cttatccaaa tttcaactgt tatataga 2642

<210> 10

<211> 1934

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

agtgatcccc cacacaccat agcttcaaaa tgtttctact ccttttttac tcttccagat 60

tttctcggac tccgcgcatc gccgtaccac ttcaaaacac ccaagcacag catactaaat 120

ttcccctctt tcttcctcta gggtgtcgtt aattacccgt actaaaggtt tggaaaagaa 180

aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg caataaaaat ttttatcacg 240

tttctttttc ttgaaaattt ttttttttga tttttttctc tttcgatgac ctcccattga 300

tatttaagtt aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta 360

ttacaacttt ttttacttct tgctcattag aaagaaagca tagcaatcta atctaagttt 420

taattacaaa atgtctcaga acgtttacat tgtatcgact gccagaaccc caattggttc 480

attccagggt tctctatcct ccaagacagc agtggaattg ggtgctgttg ctttaaaagg 540

cgccttggct aaggttccag aattggatgc atccaaggat tttgacgaaa ttatttttgg 600

taacgttctt tctgccaatt tgggccaagc tccggccaga caagttgctt tggctgccgg 660

tttgagtaat catatcgttg caagcacagt taacaaggtc tgtgcatccg ctatgaaggc 720

aatcattttg ggtgctcaat ccatcaaatg tggtaatgct gatgttgtcg tagctggtgg 780

ttgtgaatct atgactaacg caccatacta catgccagca gcccgtgcgg gtgccaaatt 840

tggccaaact gttcttgttg atggtgtcga aagagatggg ttgaacgatg cgtacgatgg 900

tctagccatg ggtgtacacg cagaaaagtg tgcccgtgat tgggatatta ctagagaaca 960

acaagacaat tttgccatcg aatcctacca aaaatctcaa aaatctcaaa aggaaggtaa 1020

attcgacaat gaaattgtac ctgttaccat taagggattt agaggtaagc ctgatactca 1080

agtcacgaag gacgaggaac ctgctagatt acacgttgaa aaattgagat ctgcaaggac 1140

tgttttccaa aaagaaaacg gtactgttac tgccgctaac gcttctccaa tcaacgatgg 1200

tgctgcagcc gtcatcttgg tttccgaaaa agttttgaag gaaaagaatt tgaagccttt 1260

ggctattatc aaaggttggg gtgaggccgc tcatcaacca gctgatttta catgggctcc 1320

atctcttgca gttccaaagg ctttgaaaca tgctggcatc gaagacatca attctgttga 1380

ttactttgaa ttcaatgaag ccttttcggt tgtcggtttg gtgaacacta agattttgaa 1440

gctagaccca tctaaggtta atgtatatgg tggtgctgtt gctctaggtc acccattggg 1500

ttgttctggt gctagagtgg ttgttacact gctatccatc ttacagcaag aaggaggtaa 1560

gatcggtgtt gccgccattt gtaatggtgg tggtggtgct tcctctattg tcattgaaaa 1620

gatatgaccg ctgatcctag agggccgcat catgtaatta gttatgtcac gcttacattc 1680

acgccctccc cccacatccg ctctaaccga aaaggaagga gttagacaac ctgaagtcta 1740

ggtccctatt tattttttta tagttatgtt agtattaaga acgttattta tatttcaaat 1800

ttttcttttt tttctgtaca gacgcgtgta cgcatgtaac attatactga aaaccttgct 1860

tgagaaggtt ttgggacgct cgaaggcttt aatttgcaag ctgcggccct gcattaatga 1920

atcggccaac gcgc 1998

<210> 11

<211> 2141

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

acgcacagat attataacat ctgcacaata ggcatttgca agaattactc gtgagtaagg 60

aaagagtgag gaactatcgc atacctgcat ttaaagatgc cgatttgggc gcgaatcctt 120

tattttggct tcaccctcat actattatca gggccagaaa aaggaagtgt ttccctcctt 180

cttgaattga tgttaccctc ataaagcacg tggcctctta tcgagaaaga aattaccgtc 240

gctcgtgatt tgtttgcaaa aagaacaaaa ctgaaaaaac ccagacacgc tcgacttcct 300

gtcttcctat tgattgcagc ttccaatttc gtcacacaac aaggtcctag cgacggctca 360

caggttttgt aacaagcaat cgaaggttct ggaatggcgg gaaagggttt agtaccacat 420

gctatgatgc ccactgtgat ctccagagca aagttcgttc gatcgtactg ttactctctc 480

tctttcaaac agaattgtcc gaatcgtgtg acaacaacag cctgttctca cacactcttt 540

tcttctaacc aagggggtgg tttagtttag tagaacctcg tgaaacttac atttacatat 600

atataaactt gcataaattg gtcaatgcaa gaaatacata tttggtcttt tctaattcgt 660

agtttttcaa gttcttagat gctttctttt tctctttttt acagatcatc aaggaagtaa 720

ttatctactt tttacaacaa atataaaaca atggggagct tggggacgat gctgagatat 780

ccggatgaca tatatccgct cctgaagatg aaacgagcga ttgagaaagc ggagaagcag 840

atccctcctg agccacactg gggtttctgc tattcgatgc tccacaaggt ttctcgaagc 900

ttttctctcg ttattcagca actcaacacc gagctccgta acgccgtgtg tgtgttctac 960

ttggttctcc gagctcttga tactgttgag gatgatacta gcataccaac tgatgaaaag 1020

gttcccatcc tgatagcttt tcaccggcac atatacgata ctgattggca ttattcatgt 1080

ggtacgaagg agtacaagat tctaatggac caatttcacc atgtttctgc agcttttttg 1140

gaacttgaaa aagggtatca agaggctatc gaggaaatta ctagaagaat gggtgcaggg 1200

atggccaagt ttatctgcca agaggtagaa actgttgatg actacgatga atactgccac 1260

tatgttgctg ggcttgttgg tttaggtttg tcgaaactct tcctcgctgc aggatcagag 1320

gttttgacac cagattggga ggcgatttcc aattcaatgg gtttatttct gcagaaaaca 1380

aacattatca gagattatct tgaggacatt aatgagatac caaaatcccg catgttttgg 1440

cctcgcgaga tttggggcaa atatgctgac aagcttgagg atttaaaata cgaggagaac 1500

acaaacaaat ccgtacagtg cttaaatgaa atggttacca atgcgttgat gcatattgaa 1560

gattgcctga aatacatggt ttccttgcgt gatccttcca tatttcggtt ctgtgccatc 1620

cctcagatca tggcgattgg aacacttgca ttatgctata acaatgaaca agtattcaga 1680

ggcgttgtga aactgaggcg aggtcttact gctaaagtca ttgatcgtac aaagacaatg 1740

gctgatgtct atggtgcttt ctatgatttt tcctgcatgc tgaagacaaa ggttgacaag 1800

aacgatccaa atgccagtaa gacactaaac cgacttgaag ccgttcagaa actctgcaga 1860

gacgctggag ttcttcaaaa cagaaaatct tatgttaatg acaaaggaca accaaacagt 1920

gtctttatta taatggttgt gattctactg gccatagtct ttgcatatct cagagcaaac 1980

tgaagttata aaaaaaataa gtgtatacaa attttaaagt gactcttagg ttttaaaacg 2040

aaaattctta ttcttgagta actctttcct gtaggtcagg ttgctttctc aggtatagca 2100

tgaggtcgct cttattgacc acacctctac cggcatgccg a 2211

<210> 12

<211> 2693

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atactagcgt tgaatgttag cgtcaacaac aagaagttta atgacgcgga ggccaaggca 60

aaaagattcc ttgattacgt aagggagtta gaatcatttt gaataaaaaa cacgcttttt 120

cagttcgagt ttatcattat caatactgcc atttcaaaga atacgtaaat aattaatagt 180

agtgattttc ctaactttat ttagtcaaaa aattagcctt ttaattctgc tgtaacccgt 240

acatgcccaa aatagggggc gggttacaca gaatatataa catcgtaggt gtctgggtga 300

acagtttatt cctggcatcc actaaatata atggagcccg ctttttaagc tggcatccag 360

aaaaaaaaag aatcccagca ccaaaatatt gttttcttca ccaaccatca gttcataggt 420

ccattctctt agcgcaacta cagagaacag gggcacaaac aggcaaaaaa cgggcacaac 480

ctcaatggag tgatgcaacc tgcctggagt aaatgatgac acaaggcaat tgacccacgc 540

atgtatctat ctcattttct tacaccttct attaccttct gctctctctg atttggaaaa 600

agctgaaaaa aaaggttgaa accagttccc tgaaattatt cccctacttg actaataagt 660

atataaagac ggtaggtatt gattgtaatt ctgtaaatct atttcttaaa cttcttaaat 720

tctactttta tagttagtct tttttttagt tttaaaacac caagaactta gtttcgaata 780

aacacacata aacaaacaaa atgtctgctg ttaacgttgc acctgaattg attaatgccg 840

acaacacaat tacctacgat gcgattgtca tcggtgctgg tgttatcggt ccatgtgttg 900

ctactggtct agcaagaaag ggtaagaaag ttcttatcgt agaacgtgac tgggctatgc 960

ctgatagaat tgttggtgaa ttgatgcaac caggtggtgt tagagcattg agaagtctgg 1020

gtatgattca atctatcaac aacatcgaag catatcctgt taccggttat accgtctttt 1080

tcaacggcga acaagttgat attccatacc cttacaaggc cgatatccct aaagttgaaa 1140

aattgaagga cttggtcaaa gatggtaatg acaaggtctt ggaagacagc actattcaca 1200

tcaaggatta cgaagatgat gaaagagaaa ggggtgttgc ttttgttcat ggtagattct 1260

tgaacaactt gagaaacatt actgctcaag agccaaatgt tactagagtg caaggtaact 1320

gtattgagat attgaaggat gaaaagaatg aggttgttgg tgccaaggtt gacattgatg 1380

gccgtggcaa ggtggaattc aaagcccact tgacatttat ctgtgacggt atcttttcac 1440

gtttcagaaa ggaattgcac ccagaccatg ttccaactgt cggttcttcg tttgtcggta 1500

tgtctttgtt caatgctaag aatcctgctc ctatgcacgg tcacgttatt cttggtagtg 1560

atcatatgcc aatcttggtt taccaaatca gtccagaaga aacaagaatc ctttgtgctt 1620

acaactctcc aaaggtccca gctgatatca agagttggat gattaaggat gtccaacctt 1680

tcattccaaa gagtctacgt ccttcatttg atgaagccgt cagccaaggt aaatttagag 1740

ctatgccaaa ctcctacttg ccagctagac aaaacgacgt cactggtatg tgtgttatcg 1800

gtgacgctct aaatatgaga catccattga ctggtggtgg tatgactgtc ggtttgcatg 1860

atgttgtctt gttgattaag aaaataggtg acctagactt cagcgaccgt gaaaaggttt 1920

tggatgaatt actagactac catttcgaaa gaaagagtta cgattccgtt attaacgttt 1980

tgtcagtggc tttgtattct ttgttcgctg ctgacagcga taacttgaag gcattacaaa 2040

aaggttgttt caaatatttc caaagaggtg gcgattgtgt caacaaaccc gttgaatttc 2100

tgtctggtgt cttgccaaag cctttgcaat tgaccagggt tttcttcgct gtcgcttttt 2160

acaccattta cttgaacatg gaagaacgtg gtttcttggg attaccaatg gctttattgg 2220

aaggtattat gattttgatc acagctatta gagtattcac cccatttttg tttggtgagt 2280

tgattggtta agattaatat aattatataa aaatattatc ttcttttctt tatatctagt 2340

gttatgtaaa ataaattgat gactacggaa agctttttta tattgtttct ttttcattct 2400

gagccactta aatttcgtga atgttcttgt aagggacggt agatttacaa gtgatacaac 2460

aaaaagcaag gcgctttttc taataaaaag aagaaaagca tttaacaatt gaacacctct 2520

atatcaacga agaatattac tttgtctcta aatccttgta aaatgtgtac gatctctata 2580

tgggttactc ataagtgtac cgaagactgc attgaaagtt tatgtttttt cactggaggc 2640

gtcattttcg cgttgagaag atgttcttat ccaaatttca actgttatat aga 2781

<210> 13

<211> 1787

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

agtgatcccc cacacaccat agcttcaaaa tgtttctact ccttttttac tcttccagat 60

tttctcggac tccgcgcatc gccgtaccac ttcaaaacac ccaagcacag catactaaat 120

ttcccctctt tcttcctcta gggtgtcgtt aattacccgt actaaaggtt tggaaaagaa 180

aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg caataaaaat ttttatcacg 240

tttctttttc ttgaaaattt ttttttttga tttttttctc tttcgatgac ctcccattga 300

tatttaagtt aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta 360

ttacaacttt ttttacttct tgctcattag aaagaaagca tagcaatcta atctaagttt 420

taattacaaa atggctaatt tgaatggtga atctgctgat ttgagagcaa catttttggg 480

tgtttactct gttttgaagt cagaattgtt gaatgatcca gcatttgaat ggacagatgg 540

ttcaagacaa tgggttgaaa gaatgttgga ttacaacgtt ccaggtggta aattgaacag 600

aggtttgtct gttattgatt catacaaatt gttgaagggt ggtaaagatt tgactgatga 660

tgaagttttc ttggcttctg cattaggttg gtgtgttgaa tggttacaag catacttttt 720

ggttttggat gatatcatgg ataactcaca tacaagaaga ggtcaaccat gttggtttag 780

agttccaaaa gttggtatga tcgcaattaa tgatggtatc atcttgagaa atcatattcc 840

aagaattttg aagaaacatt ttagaactaa accatactac gttgatttgt tggatttgtt 900

taatgaagtt gaattccaaa cagcttctgg tcaaatgatc gatttgatca ctacaatcga 960

aggtgaaaag gatttgtcta agtactcatt gccattgcat agaagaatcg ttcaatacaa 1020

gactgcttat tactcatttt acttgccagt tgcttgtgca ttgttaatgg caggtgaaga 1080

tttggaaaaa catccaacag ttaaggatgt tttgattaat atgggtatct atttccaagt 1140

tcaagatgat tacttagatt gttttggtga accagaaaag attggtaaaa tcggtactga 1200

tatcgaagat ttcaagtgtt cttggttggt tgttaaagca ttggaattgt gtaacgaaga 1260

acaaaagaaa actttatttg aacattatgg taaagaagat ccagctgatg ttgcaaagat 1320

taaagttttg tacaacgaaa ttaatttgca aggtgttttc gcagaattcg aatctaagtc 1380

atacgaaaaa ttgaattctt caattgaagc tcatccatct aagtcagttc aagcagtttt 1440

gaaatcattt ttgggtaaaa tctataaaag acaaaaatga ccgctgatcc tagagggccg 1500

catcatgtaa ttagttatgt cacgcttaca ttcacgccct ccccccacat ccgctctaac 1560

cgaaaaggaa ggagttagac aacctgaagt ctaggtccct atttattttt ttatagttat 1620

gttagtatta agaacgttat ttatatttca aatttttctt ttttttctgt acagacgcgt 1680

gtacgcatgt aacattatac tgaaaacctt gcttgagaag gttttgggac gctcgaaggc 1740

tttaatttgc aagctgcggc cctgcattaa tgaatcggcc aacgcgc 1845

<210> 14

<211> 4154

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

agtgatcccc cacacaccat agcttcaaaa tgtttctact ccttttttac tcttccagat 60

tttctcggac tccgcgcatc gccgtaccac ttcaaaacac ccaagcacag catactaaat 120

ttcccctctt tcttcctcta gggtgtcgtt aattacccgt actaaaggtt tggaaaagaa 180

aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg caataaaaat ttttatcacg 240

tttctttttc ttgaaaattt ttttttttga tttttttctc tttcgatgac ctcccattga 300

tatttaagtt aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta 360

ttacaacttt ttttacttct tgctcattag aaagaaagca tagcaatcta atctaagttt 420

taattacaaa atggcagccg ctatggtttt gttcttttca ttgtccttat tgttgttacc 480

tttgttattg ttgtttgctt atttctctta cactaaaaga ataccacaaa aagaaaatga 540

ttccaaggct cctttacctc caggtcaaac cggttggcca ttgatcggtg aaactttgaa 600

ctatttgtca tgtgttaagt ccggtgtcag tgaaaacttc gtaaagtaca gaaaggaaaa 660

gtactctcca aaggttttca gaacttcatt gttaggtgaa ccaatggcca ttttatgcgg 720

tcctgaaggt aataagttct tgtactctac agaaaagaaa ttggtacaag tttggtttcc 780

atcttcagtt gaaaagatgt tccctagatc tcatggtgaa tcaaacgcag ataacttctc 840

taaagttaga ggtaaaatga tgttcttgtt aaaggtcgat ggtatgaaaa agtatgtagg 900

tttgatggac agagttatga agcaattctt ggaaacagat tggaacagac aacaacaaat 960

taatgtacac aacaccgtta aaaagtacac cgtcactatg tcctgtagag tattcatgag 1020

tatagatgac gaagaacaag ttaccagatt gggttccagt attcaaaaca tagaagctgg 1080

tttgttagca gtcccaatca atattcctgg tacagccatg aacagagcta tcaaaacagt 1140

aaagttgtta accagagaag tcgaagccgt aattaaacaa agaaaggttg acttgttgga 1200

aaataagcaa gcatctcaac cacaagattt gttgagtcat ttgttgttga ctgctaacca 1260

agatggtcaa tttttatctg aatcagacat cgcatcacac ttaattggtt tgatgcaagg 1320

tggttacact acattgaacg gtacaatcac cttcgtcttg aactatttgg cagaattccc 1380

tgacgtctac aatcaagtat tgaaggaaca agttgaaatc gccaactcta agcatccaaa 1440

ggaattgttg aactgggaag atttgagaaa gatgaagtac tcatggaacg ttgctcaaga 1500

agtcttgaga attatacctc caggtgttgg tacttttaga gaagcaatta ccgatttcac 1560

ttatgccggt tacttaattc ctaaaggttg gaagatgcac ttgataccac atgacactca 1620

caagaatcct acatacttcc catctcctga aaagttcgat cctactagat tcgagggtaa 1680

cggtccagct ccttatactt ttacaccatt cggtggtggt ccaagaatgt gccctggtat 1740

cgaatacgca agattagtta tattgatctt tatgcataat gttgtcacaa acttcagatg 1800

ggaaaaattg atcccaaacg aaaagatctt gactgaccct atcccaagat tcgcccacgg 1860

tttacctatc cacttacacc cacacaacgg ttctacttct tcaggttgga agaaaacgac 1920

ggcggatcgg agcggggagc tgaagccttt gatgatccct aagtctctta tggctaagga 1980

cgaggatgat gatttggatt tgggatccgg gaagactaga gtctctatct tcttcggtac 2040

gcagactgga acagctgagg gatttgctaa ggcattatcc gaagaaatca aagcgagata 2100

tgaaaaagca gcagtcaaag tcattgactt ggatgactat gctgccgatg atgaccagta 2160

tgaagagaaa ttgaagaagg aaactttggc atttttctgt gttgctactt atggagatgg 2220

agagcctact gacaatgctg ccagatttta caaatggttt acggaggaaa atgaacggga 2280

tataaagctt caacaactag catatggtgt gtttgctctt ggtaatcgcc aatatgaaca 2340

ttttaataag atcgggatag ttcttgatga agagttatgt aagaaaggtg caaagcgtct 2400

tattgaagtc ggtctaggag atgatgatca gagcattgag gatgatttta atgcctggaa 2460

agaatcacta tggtctgagc tagacaagct cctcaaagac gaggatgata aaagtgtggc 2520

aactccttat acagctgtta ttcctgaata ccgggtggtg actcatgatc ctcggtttac 2580

aactcaaaaa tcaatggaat caaatgtggc caatggaaat actactattg acattcatca 2640

tccctgcaga gttgatgttg ctgtgcagaa ggagcttcac acacatgaat ctgatcggtc 2700

ttgcattcat ctcgagttcg acatatccag gacgggtatt acatatgaaa caggtgacca 2760

tgtaggtgta tatgctgaaa atcatgttga aatagttgaa gaagctggaa aattgcttgg 2820

ccactcttta gatttagtat tttccataca tgctgacaag gaagatggct ccccattgga 2880

aagcgcagtg ccgcctcctt tccctggtcc atgcacactt gggactggtt tggcaagata 2940

cgcagacctt ttgaaccctc ctcgaaagtc tgcgttagtt gccttggcgg cctatgccac 3000

tgaaccaagt gaagccgaga aacttaagca cctgacatca cctgatggaa aggatgagta 3060

ctcacaatgg attgttgcaa gtcagagaag tcttttagag gtgatggctg cttttccatc 3120

tgcaaaaccc ccactaggtg tattttttgc tgcaatagct cctcgtctac aacctcgtta 3180

ctactccatc tcatcctcgc caagattggc gccaagtaga gttcatgtta catccgcact 3240

agtatatggt ccaactccta ctggtagaat ccacaagggt gtgtgttcta cgtggatgaa 3300

gaatgcagtt cctgcggaga aaagtcatga atgtagtgga gccccaatct ttattcgagc 3360

atctaatttc aagttaccat ccaacccttc aactccaatc gttatggtgg gacctgggac 3420

tgggctggca ccttttagag gttttctgca ggaaaggatg gcactaaaag aagatggaga 3480

agaactaggt tcatctttgc tcttctttgg gtgtagaaat cgacagatgg actttatata 3540

cgaggatgag ctcaataatt ttgttgatca aggcgtaata tctgagctca tcatggcatt 3600

ctcccgtgaa ggagctcaga aggagtatgt tcaacataag atgatggaga aggcagcaca 3660

agtttgggat ctaataaagg aagaaggata tctctatgta tgcggtgatg ctaagggcat 3720

ggcgagggac gtccaccgaa ctctacacac cattgttcag gagcaggaag gtgtgagttc 3780

gtcagaggca gaggctatag ttaagaaact tcaaaccgaa ggaagatacc tcagagatgt 3840

ctggtgaccg ctgatcctag agggccgcat catgtaatta gttatgtcac gcttacattc 3900

acgccctccc cccacatccg ctctaaccga aaaggaagga gttagacaac ctgaagtcta 3960

ggtccctatt tattttttta tagttatgtt agtattaaga acgttattta tatttcaaat 4020

ttttcttttt tttctgtaca gacgcgtgta cgcatgtaac attatactga aaaccttgct 4080

tgagaaggtt ttgggacgct cgaaggcttt aatttgcaag ctgcggccct gcattaatga 4140

atcggccaac gcgc 4292

<210> 15

<211> 3047

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

agtgatcccc cacacaccat agcttcaaaa tgtttctact ccttttttac tcttccagat 60

tttctcggac tccgcgcatc gccgtaccac ttcaaaacac ccaagcacag catactaaat 120

ttcccctctt tcttcctcta gggtgtcgtt aattacccgt actaaaggtt tggaaaagaa 180

aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg caataaaaat ttttatcacg 240

tttctttttc ttgaaaattt ttttttttga tttttttctc tttcgatgac ctcccattga 300

tatttaagtt aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta 360

ttacaacttt ttttacttct tgctcattag aaagaaagca tagcaatcta atctaagttt 420

taattacaaa atgtggaagt taaaggtagc tcaaggtaat gacccttact tatactcaac 480

caacaatttc gtcggtagac aatactggga atttcaacca gatgctggta cacctgaaga 540

aagagaagaa gtcgaaaagg caagaaagga ctacgtaaac aacaaaaagt tacatggtat 600

tcacccatgt tcagatatgt tgatgagaag acaattgata aaagaatcag gtatcgactt 660

gttatccatt ccacctttga gattggatga aaacgaacaa gttaactacg acgccgtcac 720

tacagctgtt aaaaaggctt tgagattaaa tagagcaatt caagcccatg atggtcactg 780

gccagctgaa aacgcaggta gtttgttgta caccccacct ttgataatag ctttgtacat 840

ctctggtact atagatacaa tcttaaccaa gcaacataaa aaggaattga tcagattcgt 900

ctacaaccac caaaacgaag atggtggttg gggtagttac atcgaaggtc attctactat 960

gattggttcc gttttgagtt acgtcatgtt gagattgttg ggtgaaggtt tagccgaatc 1020

agatgacggt aatggtgctg ttgaaagagg tagaaaatgg atcttggatc atggtggtgc 1080

tgcaggtatt ccatcttggg gtaaaacata tttggctgta ttgggtgttt acgaatggga 1140

aggttgtaat ccattaccac ctgaattttg gttgttccct tcttcatttc cattccatcc 1200

tgcaaaaatg tggatctatt gtagatgcac ctacatgcca atgtcatatt tgtacggtaa 1260

aagataccac ggtcctataa ctgatttggt tttatccttg agacaagaaa tctataacat 1320

cccatacgaa caaattaaat ggaaccaaca aagacacaac tgttgcaagg aagatttgta 1380

ttaccctcac actttagtac aagatttggt ttgggacggt ttgcattact tctctgaacc 1440

attcttgaag agatggcctt ttaataagtt gagaaagaga ggtttgaaga gagttgtcga 1500

attaatgaga tacggtgcta cagaaactag attcattacc actggtaatg gtgaaaaagc 1560

attgcaaatc atgtcatggt gggccgaaga tccaaacggt gacgaattca agcatcactt 1620

agccagaatt cctgatttct tgtggatagc tgaagacggt atgacagttc aatcttttgg 1680

ttcacaattg tgggattgta tattggccac tcaagctatc attgcaacaa atatggtcga 1740

agaatatggt gacagtttga agaaagctca tttctttatc aaggaatctc aaatcaagga 1800

aaacccacgt ggtgactttt tgaaaatgtg tagacaattc accaagggtg catggacttt 1860

ttcagatcaa gaccacggtt gtgtagtttc cgattgcacc gcagaagcct tgaagtgctt 1920

gttgttgttg tctcaaatgc cacaagacat tgtaggtgaa aagcctgaag ttgaaagatt 1980

gtacgaagcc gttaacgtct tgttgtactt gcaatccaga gttagtggtg gtttcgctgt 2040

ttgggaacca cctgtcccaa aaccttattt ggaaatgttg aacccatcag aaatctttgc 2100

tgatatagtc gtagaaagag aacatatcga atgtacagct tccgtaatca aaggtttgat 2160

ggcttttaaa tgcttgcatc caggtcacag acaaaaggaa atagaagata gtgttgctaa 2220

ggcaatcaga tatttggaaa gaaaccaaat gcctgacggt tcttggtatg gtttttgggg 2280

tatatgtttc ttatacggta ctttctttac attgagtggt tttgcctctg ctggtagaac 2340

atacgataat tcagaagcag tcagaaaagg tgtaaagttt ttcttatcca cccaaaacga 2400

agaaggtggt tggggtgaat ctttggaatc atgcccatcc gaaaaattca ctcctttgaa 2460

gggtaacaga acaaacttgg ttcaaacctc ttgggcaatg ttaggtttga tgtttggtgg 2520

tcaagccgaa agagatccaa ctcctttgca tagagccgct aaattgttga ttaatgcaca 2580

aatggataac ggtgacttcc cacaacaaga aatcacaggt gtttactgta agaactctat 2640

gttgcactac gccgaataca gaaacatttt tcctttgtgg gccttgggtg aatacagaaa 2700

aagagtttgg ttacctaagc atcaacaatt aaagatatga ccgctgatcc tagagggccg 2760

catcatgtaa ttagttatgt cacgcttaca ttcacgccct ccccccacat ccgctctaac 2820

cgaaaaggaa ggagttagac aacctgaagt ctaggtccct atttattttt ttatagttat 2880

gttagtatta agaacgttat ttatatttca aatttttctt ttttttctgt acagacgcgt 2940

gtacgcatgt aacattatac tgaaaacctt gcttgagaag gttttgggac gctcgaaggc 3000

tttaatttgc aagctgcggc cctgcattaa tgaatcggcc aacgcgc 3047

Claims (10)

1. A method of constructing a recombinant microorganism, comprising: comprises introducing the coding gene of the recombinant fusion protein into a starting microorganism to obtain a recombinant microorganism; the recombinant fusion protein contains a Pln1 protein and a terpene synthesis-related protein.

2. The method of claim 1, wherein: the terpene synthesis related protein is selected from protopanaxadiol synthase PPDS01 and/or cytochrome P450 reductase ATR1.

3. The method according to claim 1 or 2, characterized in that: in the recombinant fusion protein, the Pln1 protein and the terpene synthesis-related protein are linked via a linker peptide.

4. The method according to any one of claims 1-3, wherein: the recombinant fusion protein is a recombinant protein containing the Pln1 protein, PPDS01 and ATR1.

5. The construction method according to claim 4, wherein:

the amino acid sequence of the Pln1 protein is shown as 1 st to 283 th in SEQ ID No. 2;

the amino acid sequence of the PPDS01 is shown as 288 th to 773 rd positions in SEQ ID No. 2;

the amino acid sequence of the ATR1 is shown as 780 st to 1425 th in SEQ ID No. 2.

6. The method according to claim 4 or 5, characterized in that:

the amino acid sequence of the recombinant fusion protein is shown in SEQ ID No. 2.

7. The method according to any one of claims 1-6, wherein: in the recombinant microorganism, the coding gene of the recombinant fusion protein is integrated into YJL062W locus of the starting microorganism.

8. The method according to any one of claims 1-7, wherein: and introducing the coding gene of the recombinant fusion protein into the starting microorganism through an expression cassette for expressing the recombinant fusion protein to obtain the recombinant microorganism.

9. The method according to any one of claims 1-8, wherein: the starting microorganism is saccharomyces cerevisiae, the saccharomyces cerevisiae is a strain obtained by carrying out the following A1-A12 transformation on a strain BYT1,

a1, introducing a 3-hydroxy-3-methylglutaryl coenzyme A reductase gene tHMG1 gene;

a2, introducing a mevalonate kinase gene ERG12 gene;

a3, introducing an IDI1 gene of an alcohol dehydrogenase I gene;

a4, introducing a mevalonate pyrophosphate decarboxylase gene ERG19 gene;

a5, introducing a hydroxymethyl glutaryl coenzyme A reductase gene HMGR gene;

a6, introducing hydroxymethyl glutaryl-coenzyme A synthetase gene ERG 13;

a7, introducing a phosphomevalonate kinase gene ERG8 gene;

a8, introducing acetyl coenzyme A acetyltransferase gene ERG 10;

a9, introducing a squalene synthase gene AtSQS2 gene;

a10, introducing a squalene monooxygenase gene ERG1 gene;

a11, introducing a farnesyl pyrophosphate synthetase gene SmFPS gene;

a12, introduction of dammarenediol synthase gene spgDDS gene.

10. Biomaterial, use or method, characterized in that: the biological material is any one of the following B1) -B6),

b1 A nucleic acid molecule encoding the recombinant fusion protein of claim 1;

b2 An expression cassette comprising the nucleic acid molecule according to B1);

b3 A recombinant vector containing the nucleic acid molecule according to B1) or a recombinant vector containing the expression cassette according to B2);

b4 A recombinant microorganism containing the nucleic acid molecule according to B1), or a recombinant microorganism containing the expression cassette according to B2), or a recombinant microorganism containing the recombinant vector according to B3);

b5 A recombinant fusion protein according to claim 1;

b6 A recombinant microorganism expressing the recombinant fusion protein of claim 1;

the application is any one of the following applications,

use of X1, a process according to any one of claims 1 to 9, for the manufacture of a terpene product;

use of X2, the method of any one of claims 1-9, for the production of a terpene;

x3, the application of the biological material in the preparation of terpene products;

x4, the use of said biomaterial in the production of terpenes;

use of X5, the Pln1 protein of claim 1, in the manufacture of a terpene product;

use of X6, the Pln1 protein of claim 1, for the production of a terpene;

use of X7, the Pln1 protein of claim 1, for increasing the efficiency of terpene synthesis;

use of X8, the recombinant fusion protein of claim 1 for increasing efficiency of terpene synthesis;

the method is a method for increasing efficiency of terpene biosynthesis, comprising the step of expressing the recombinant fusion protein of claim 1 in a recipient organism to obtain a recombinant organism having a higher efficiency of terpene synthesis than the recipient organism.

Images