CN115232147B - Heterocyclic derivatives as HIF-2 alpha agonists - Google Patents
Heterocyclic derivatives as HIF-2 alpha agonists Download PDFInfo
- Publication number
- CN115232147B CN115232147B CN202210954630.7A CN202210954630A CN115232147B CN 115232147 B CN115232147 B CN 115232147B CN 202210954630 A CN202210954630 A CN 202210954630A CN 115232147 B CN115232147 B CN 115232147B
- Authority
- CN
- China
- Prior art keywords
- group
- compound
- hif
- atoms
- heteroaryl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
- C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
- C07D495/04—Ortho-condensed systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/4196—1,2,4-Triazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/42—Oxazoles
- A61K31/422—Oxazoles not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
- A61K31/4365—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system having sulfur as a ring hetero atom, e.g. ticlopidine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/472—Non-condensed isoquinolines, e.g. papaverine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/4985—Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/53—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with three nitrogens as the only ring hetero atoms, e.g. chlorazanil, melamine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
- C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
- C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
- C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
- C07D409/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
- C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
- C07D413/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
- C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
- C07D487/04—Ortho-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D491/00—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
- C07D491/02—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
- C07D491/04—Ortho-condensed systems
- C07D491/044—Ortho-condensed systems with only one oxygen atom as ring hetero atom in the oxygen-containing ring
- C07D491/048—Ortho-condensed systems with only one oxygen atom as ring hetero atom in the oxygen-containing ring the oxygen-containing ring being five-membered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D519/00—Heterocyclic compounds containing more than one system of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring system not provided for in groups C07D453/00 or C07D455/00
Abstract
The invention relates to a heterocyclic derivative serving as a hypoxia inducible factor-2 alpha (HIF-2 alpha) agonist, which is a compound shown in a formula (I) or a stereoisomer, nitrogen oxide, hydrate, solvate, metabolite or pharmaceutically acceptable salt of the compound shown in the formula (I) and a pharmaceutical composition containing the derivative.Wherein X is 1 Selected from CH, CH 2 C (=o), N, NH, O, or S; y is Y 2 Selected from CH, CH 2 NH, N, O or S;
Description
Technical Field
The invention belongs to the field of medicines, and particularly relates to a heterocyclic derivative serving as a HIF-2 alpha agonist, and further relates to application of the heterocyclic derivative or a pharmaceutical composition thereof in preparation of medicines.
Background
In cases of anemia, trauma, tissue necrosis, defects, etc., the tissue or cells are often in a hypoxic state. Hypoxia results in the expression of a range of transcription inducers that are involved in angiogenesis, iron, sugar metabolism, and cell growth and proliferation. Among them, hypoxia inducible factor (hypoxia inducible factor, HIF) is a transcription factor that is activated by somatic cells under conditions of oxygen deficiency, and is widely distributed in various parts of the body, particularly in the intima, heart, brain, kidney, liver, etc. HIFs mainly include HIF-1, HIF-2 and HIF-3, which are heterodimers composed of oxygen-sensitive alpha subunits (HIF-1α, HIF-2α and HIF-3α) and the constitutive beta subunits HIF-1β (also known as aromatic receptor nuclear transport proteins, aryl Hydrocarbon Receptor Nuclear Translocator, ARNTs). Of the three alpha subunits, HIF-2 alpha is the primary regulator of pathological hypoxia response. In normoxic cells, HIF-2. Alpha. Is rapidly degraded by the mechanism of ubiquitination of the H.beta.Hippel-forest tumor suppressor (von Hippel-Lindau tumor suppressor, pVHL) E3 ligase complex. Under hypoxic conditions, HIF-2 a is not degraded, and the active HIF a/β complex accumulates in the nucleus and activates expression of various genes including glycolytic enzymes (LDH-a), glucose transporter (GLUT 1), erythropoietin (EPO), and Vascular Endothelial Growth Factor (VEGF).
EPO is a naturally occurring hormone that stimulates the production of red blood cells (erythrocytes) that carry oxygen throughout the body. EPO is normally secreted by the kidney, and endogenous EPO increases under conditions of reduced oxygen. All types of anemia are characterized by a reduced ability of the blood to carry oxygen and are thus accompanied by similar signs and symptoms, including pale skin and mucous membranes, weakness, dizziness, fatiguing and somnolence, leading to a reduced quality of life. Anemia is often associated with conditions in the blood that lack red blood cells or hemoglobin. Lean bodyCommon causes of blood include iron, vitamin B 12 And folate deficiency, can also be associated with chronic diseases, such as inflammatory diseases, including diseases with secondary osteomyelitis inhibition, and the like. Anemia is also associated with renal dysfunction, and most renal failure patients who are frequently dialyzed suffer from chronic anemia. Of the three alpha subunits, HIF-2 alpha is the primary regulator of pathological hypoxia response. From the analysis of signal paths, the HIF-2 alpha is the most direct transcription factor of blood regeneration and angiogenesis such as EPO, VEGFA and the like, has specific function and tissue specificity in expression, and is an ideal target for treating ischemic diseases such as renal anemia and the like with small side effects. The HIF2 alpha agonist can activate the target gene of the erythropoietin to induce the kidney to synthesize the erythropoietin, thereby achieving the aim of treating the lean blood caused by the chronic kidney disease and having important significance in developing the HIF2 alpha agonist.
Disclosure of Invention
The invention provides a heterocyclic derivative or a pharmaceutical composition thereof serving as a HIF-2 alpha agonist, and further relates to application of the heterocyclic derivative or the pharmaceutical composition thereof in preparing medicines, namely, the heterocyclic derivative or the pharmaceutical composition is used for protecting, treating or relieving diseases related to HIF and/or EPO, such as anemia and the like, of patients.
In a first aspect, the present invention relates to a compound which is a compound of formula (I) or a stereoisomer, nitroxide, hydrate, solvate, metabolite or pharmaceutically acceptable salt of a compound of formula (I),
wherein, the liquid crystal display device comprises a liquid crystal display device,
X 1 selected from CH, CH 2 C (=o), N, NH, O, or S;
Y 2 selected from CH, CH 2 NH, N, O or S;
is a single bond or a double bond;
R 1 and R is 2 Each independently is H, D, halogen, C 3-8 Cycloalkyl or heterocyclic groups of 3-8 atoms, wherein said C 3-8 Cycloalkyl and heterocyclyl consisting of 3 to 8 atoms are each independently optionally unsubstituted or substituted with 1 to 2 substituents selected from D, halogen, -CN, -NO 2 、-OH、-NH 2 、 C 1-3 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl or C 3-8 Substituted cycloalkyl;
R 1 、R 2 and together with the atoms to which they are attached form C 5-7 Cycloalkyl, heterocyclyl of 5-8 atoms, C 6-8 Aryl or heteroaryl of 5-8 atoms, wherein said C 5-7 Cycloalkyl, heterocyclyl of 5-8 atoms, C 6-8 Aryl and heteroaryl consisting of 5-8 atoms are each independently optionally unsubstituted or substituted with 1-2 groups selected from D, halogen, -NO 2 、-CN、-OH、-NH 2 、-C(＝O)OCH 3 、-C(＝O)NH 2 、 C 1-3 Alkyl or C 1-3 Substituted with alkoxy;
l is- (CR) a R b ) p -、-(CR a R b ) p -O-、-(CR a R b ) p -NH-、-(CR a R b ) p -S-、-(CR a R b ) p -S (=o) -or- (CR) a R b ) p -S(＝O) 2 -；
Each R is a And R is b H, D, C independently 1-3 Alkyl, C 2-4 Alkenyl or C 2-4 Alkynyl;
p is 0, 1, 2 or 3;
a is selected from:
R 3 h, D, halogen, CN, NO 2 、C 3-8 Cycloalkyl, heterocyclyl of 4-12 atoms, C 5-10 Aryl or heteroaryl of 5-12 atoms, wherein said C 3-8 Cycloalkyl, 4-12 atoms compositionHeterocyclic groups of C 5-10 Aryl and heteroaryl consisting of 5 to 12 atoms are each independently optionally unsubstituted or substituted with 1 to 2 groups selected from D, halogen, -CN, -NO 2 、-OCH 3 、-NR x R y 、-C(＝O)R x 、-C(＝O)OR x 、 -C(＝O)NR x R y 、-S(＝O) 2 R x 、C 1-6 Alkyl or C 1-6 Substituted by a substituent of haloalkyl;
each R is x And R is y H, D, C independently 1-3 Alkyl, C 2-4 Alkenyl or C 2-4 Alkynyl groups.
R 4 H, D, NH of a shape of H, D, NH 2 、C 1-3 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl or C 3-8 Cycloalkyl groups.
In some embodiments, R 1 And R is 2 Each independently is H, D, F, cl, br, I, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, piperazinyl or morpholinyl, wherein the methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, piperazinyl and morpholinyl are each independently optionally unsubstituted or substituted with 1-2 groups selected from D, halogen, -CN, -NO 2 、-OH、-NH 2 A methyl, ethyl, n-propyl, isopropyl, vinyl or ethynyl substituent;
R 1 、R 2 and together with the atoms to which they are attached form C 5-7 Cycloalkyl, heterocyclyl of 5-8 atoms, C 6-8 Aryl or heteroaryl of 5-8 atoms, wherein said C 5-7 Cycloalkyl, heterocyclyl of 5-8 atoms, C 6-8 Aryl and heteroaryl consisting of 5-8 atoms are each independently optionally unsubstituted or substituted with 1-2 groups selected from D, F, cl, br, I, -NO 2 、-CN、-OH、-NH 2 、-C(＝O)OCH 3 、-C(＝O)NH 2 Methyl, ethyl, n-propyl, isopropyl, -CHF 2 、-CF 3 、-CH 2 CF 3 Substituted by methoxy, ethoxy, 1-propoxy or 2-propoxy substituents.
In some embodiments, R 3 D, F, cl, br, I, -CN, -NO 2 Cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, piperazinyl, morpholinyl, phenyl, naphthyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, furanyl, thienyl, thiazolyl, oxazolyl, pyridinyl, pyrimidinyl, pyrazinyl or pyridazinyl; wherein each of said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, piperazinyl, morpholinyl, phenyl, naphthyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, furanyl, thienyl, thiazolyl, oxazolyl, pyridinyl, pyrimidinyl, pyrazinyl and pyridazinyl is independently optionally unsubstituted or substituted with 1 to 2 groups selected from D, F, cl, br, I, -CN, -NO 2 、-OCH 3 、-NHCH 3 、-C(＝O)CH 3 、 -C(＝O)OCH 3 、-C(＝O)NCH 3 or-S (=o) 2 CH 3 Is substituted by a substituent of (2);
R 4 d, F, cl, br, I and-NO 2 、-CN、-OH、-NH 2 Methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, vinyl, propenyl, allyl, ethynyl, propargyl, 1-propynyl, cyclopropyl or cyclobutyl;
in some embodiments, the compounds of the invention comprise one of the following compounds or stereoisomers, oxynitrides, hydrates, solvates, metabolites, or pharmaceutically acceptable salts of one of the following compounds:
in a second aspect, the use of a compound according to the first aspect of the invention in the manufacture of a medicament for the prevention, treatment, therapy or alleviation of a disease state mediated at least in part by a hypoxia inducible factor.
In some embodiments, the preparation of the compounds of the invention is useful for protecting, treating, or alleviating at least a portion of a disorder caused by hypoxia inducible factor
The use in medicine of mediated diseases, the structure of the compound can be selected from one of the following:
in a third aspect, the present invention relates to a pharmaceutical composition comprising a compound of the present invention and pharmaceutically acceptable excipients or combinations thereof.
In a fourth aspect, the present application relates to the use of a compound according to the first aspect, a compound for use in a medicament according to the second aspect or a pharmaceutical composition according to the third aspect for the manufacture of a medicament for protecting, treating or alleviating a disease mediated at least in part by hypoxia inducible factor.
In some embodiments, the use of the application, wherein the disease is anemia, ischemia, vascular disease, angina, myocardial ischemia, myocardial infarction, metabolic disorder, or cancer.
In a fifth aspect, the present application relates to the use of a pharmaceutical combination comprising a compound according to the first aspect or a compound according to the second aspect or a pharmaceutical composition according to the third aspect and roflumilast for the preparation of a medicament for the prevention, treatment or alleviation of a disease mediated at least in part by hypoxia inducible factor.
Description of the terms
Reference will now be made in detail to certain embodiments of the application, examples of which are illustrated in the accompanying structural and chemical formulas. The application is intended to cover all alternatives, modifications and equivalents, which may be included within the scope of the application as defined by the appended claims. Those skilled in the art will recognize that many methods and materials similar or equivalent to those described herein can be used in the practice of the present application. The present application is in no way limited to the methods and materials described herein. In the event of one or more of the incorporated references, patents and similar materials differing from or contradictory to the present application (including but not limited to defined terms, term application, described techniques, etc.), the present application controls.
"room temperature" in the present invention refers to an ambient temperature, which is from about 10 ℃ to about 40 ℃. In some embodiments, "room temperature" refers to a temperature from about 20 ℃ to about 30 ℃; in other embodiments, "room temperature" refers to a temperature from about 25 ℃ to about 30 ℃; in still other embodiments, "room temperature" refers to 10 ℃, 15 ℃, 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, and the like.
It should further be appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All patents and publications referred to herein are incorporated by reference in their entirety.
The following definitions as used herein should be applied unless otherwise indicated. For the purposes of the present invention, chemical elements are in accordance with CAS version of the periodic Table of the elements, and handbook of chemistry and physics, 75 th edition, 1994. Furthermore, for general principles of organic chemistry reference is made to "Organic Chemistry", thomas Sorrell, university Science Books, sausalato: 1999, and "March's Advanced Organic Chemistry" by Michael B.Smith and Jerry March, john Wiley & Sons, newYork:2007, the entire contents of which are incorporated herein by reference.
The articles "a," "an," and "the" are intended to include "at least one" or "one or more" unless the context clearly dictates otherwise or otherwise. Thus, as used herein, these articles refer to one or to more than one (i.e., to at least one) object. For example, "a component" refers to one or more components, i.e., more than one component is contemplated as being employed or used in embodiments of the described embodiments.
The term "patient" as used herein refers to a human (including adults and children) or other animals. In some embodiments, "patient" refers to a human.
The term "comprising" is an open-ended expression, i.e., including what is indicated by the invention, but not excluding other aspects.
"stereoisomers" refer to compounds having the same chemical structure but different arrangements of atoms or groups in space. Stereoisomers include enantiomers, diastereomers, conformational isomers (rotamers), geometric isomers (cis/trans), atropisomers, and the like.
"enantiomer" refers to two isomers of a compound that do not overlap but are in mirror image relationship to each other.
"diastereoisomers" refers to stereoisomers which have two or more chiral centers and whose molecules are not mirror images of each other. Diastereomers have different physical properties, such as melting point, boiling point, spectral properties, and reactivity. Diastereomeric mixtures can be separated by high resolution analytical procedures such as electrophoresis and chromatography, e.g. HPLC.
The stereochemical definitions and rules used in the present invention generally follow S.P. Parker, ed., mcGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, new York; and Eliel, e.and Wilen, s., "Stereochemistry of Organic Compounds", john wiley & Sons, inc., newYork,1994.
Any asymmetric atom (e.g., carbon, etc.) of the disclosed compounds may exist in racemic or enantiomerically enriched form, such as in the (R) -, (S) -or (R, S) -configuration. In certain embodiments, each asymmetric atom has at least 50% enantiomeric excess, at least 60% enantiomeric excess, at least 70% enantiomeric excess, at least 80% enantiomeric excess, at least 90% enantiomeric excess, at least 95% enantiomeric excess, or at least 99% enantiomeric excess in the (R) -or (S) -configuration.
The resulting mixture of any stereoisomers may be separated into pure or substantially pure geometric isomers, enantiomers, diastereomers, e.g., by chromatography and/or fractional crystallization, depending on the differences in the physicochemical properties of the components.
The term "tautomer" or "tautomeric form" refers to structural isomers having different energies that can be converted to each other by a low energy barrier (low energy barrier). If tautomerism is possible (e.g., in solution), chemical equilibrium of the tautomers can be achieved. For example, proton tautomers (also known as proton transfer tautomers (prototropic tautomer)) include interconversions by proton transfer, such as keto-enol isomerisation and imine-enamine isomerisation. Valence tautomers (valance tautomers) include interconversions by recombination of some of the bond-forming electrons. Specific examples of keto-enol tautomerism are tautomerism of pentane-2, 4-dione and 4-hydroxypent-3-en-2-one tautomer. Another example of tautomerism is phenol-ketone tautomerism. One specific example of phenol-ketone tautomerism is the interconversion of pyridin-4-ol and pyridin-4 (1H) -one tautomers. Unless otherwise indicated, all tautomeric forms of the compounds of the invention are within the scope of the invention.
The compounds of the invention may be optionally substituted with one or more substituents, as described in the present invention, such as the compounds of the general formula above, or as specific examples within the examples, subclasses, and classes of compounds encompassed by the invention.
It is to be understood that the term "optionally substituted" may be used interchangeably with the term "substituted or unsubstituted". In general, the term "substituted" means that one or more hydrogen atoms in a given structure are replaced with a specific substituent. "optionally substituted" means that the given structure or group is unsubstituted or the given structure or group is substituted with one or more particular substituents. An optional substituent may be substituted at each substitutable position of the substituted group, unless otherwise indicated. When more than one position in a given formula can be substituted with one or more substituents selected from a particular group, then the substituents may be the same or different at each position. Wherein the substituents may be, but are not limited to, oxo (=o), hydrogen, deuterium, cyano, nitro, halogen, hydroxy, mercapto, amino, alkyl, haloalkyl, alkoxy, haloalkoxy, acyl, acyloxy, sulfonyl, sulfinyl, carboxyl, cycloalkyl, cycloalkylalkyl, cycloalkyloxy, heterocyclyl, heterocyclylalkyl, heterocyclyloxy, aryl, arylalkyl, aryloxy, heteroaryl, heteroarylalkyl, heteroaryloxy, and the like.
In addition, unless explicitly stated otherwise, the description as used in this disclosure is "each..and". Independently "and". Independently "can be interchanged, and is to be understood broadly as meaning that specific items expressed between the same symbols in different groups do not affect each other, or that specific items expressed between the same symbols in the same groups do not affect each other. Likewise, for the description "..independently optionally" independent "in" is also to be construed broadly as set forth above.
The term "optional" or "optionally" means that the subsequently described event or circumstance may, but need not, occur, i.e., that the description includes instances where said event or circumstance occurs and instances where it does not. For example, "optionally substituted with 1, 2, 3, or 4 substituents independently selected from the group consisting of. Further, when the group is substituted with 1 or more of the substituents, the substituents are independent of each other, that is, the 1 or more substituents may be different from each other or the same.
In the various parts of the present specification, substituents of the presently disclosed compounds are disclosed in terms of the type or scope of groups. It is specifically noted that the present invention includes each individual subcombination of the individual members of these group classes and ranges. For example, the term "C 1 -C 6 Alkyl "or" C 1-6 Alkyl "means in particular methyl, ethyl, C independently disclosed 3 Alkyl, C 4 Alkyl, C 5 Alkyl and C 6 An alkyl group; "C 1-4 Alkyl "refers specifically to independently disclosed methyl, ethyl, C 3 Alkyl (i.e. propyl, including n-propyl and isopropyl), C 4 Alkyl (i.e., butyl, including n-butyl, isobutyl, sec-butyl, and tert-butyl).
In the various parts of the invention, linking substituents are described. When the structure clearly requires a linking group, the exemplified markush variables for that group are understood to be linking groups. For example, if the structure requires a linking group and the markush group definition for that variable enumerates an "alkyl" or "aryl" group, it will be understood that the "alkyl" or "aryl" represents a linked alkylene group or arylene group, respectively.
The term "alkyl" or "alkyl group" as used herein means a saturated, straight or branched, monovalent hydrocarbon radical containing from 1 to 20 carbon atoms, wherein the alkyl radical may be optionally substituted with one or more substituents described herein. In some embodiments, the alkyl group contains 1 to 12 carbon atoms; in other embodiments, the alkyl group contains 1 to 6 carbon atoms; in still other embodiments, the alkyl group contains 1 to 4 carbon atoms; in some embodiments, the alkyl group contains 1 to 3 carbon atoms.
Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, 2-pentyl, 3-pentyl, 2-methyl-2-butyl, 3-methyl-1-butyl, 2-methyl-1-butyl, n-hexyl, 2-hexyl, 3-hexyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 3-methyl-3-pentyl, 2, 3-dimethyl-2-butyl, 3-dimethyl-2-butyl, n-heptyl, n-octyl, and the like.
In some specific structures, when an alkyl group is explicitly represented as a linking group, then the alkyl group represents a linked alkylene group, e.g., group "C 3-10 Cycloalkyl C 1-6 C in alkyl' 1-6 Alkyl is understood to mean C 1-6 An alkylene group.
The term "alkylene" means a saturated divalent hydrocarbon group resulting from the removal of two hydrogen atoms from a saturated straight or branched hydrocarbon group. Unless otherwise specified, alkylene groups contain 1 to 12 carbon atoms. In some embodiments, the alkylene group contains 1 to 6 carbon atoms; in other embodiments, the alkylene group contains 1 to 4 carbon atoms; in still other embodiments, the alkylene group contains 1 to 3 carbon atoms; in some embodiments, the alkylene group contains 1 to 2 carbon atoms. Examples of this include methylene (-CH) 2 (-), ethylene (including-CH) 2 CH 2 -or-CH (CH) 3 ) (-), isopropylidene (including-CH (CH) 3 )CH 2 -or-C (CH) 3 ) 2 (-), etc. Wherein the alkylene group may be optionally substituted with one or more substituents described herein.
The term "alkenyl" denotes a straight-chain or branched monovalent hydrocarbon radical containing 2 to 12 carbon atoms, in which there is at least one site of unsaturation, i.e. one carbon-carbon sp 2 A double bond, wherein the alkenyl group may be optionally substituted with one or more substituents described herein, including the positioning of "cis" and "tans", or the positioning of "E" and "Z". In some embodiments, the alkenyl group comprises 2 to 8 carbon atoms; in other embodiments, the alkenyl group comprises 2 to 6 carbon atoms; in still other embodiments, alkenyl groups compriseContaining 2-4 carbon atoms. Examples of alkenyl groups include, but are not limited to, vinyl (-ch=ch) 2 ) Allyl (-CH) 2 CH＝CH 2 ) Etc.
The term "alkynyl" denotes a straight or branched chain monovalent hydrocarbon radical containing 2 to 12 carbon atoms, wherein there is at least one site of unsaturation, i.e. one carbon-carbon sp triple bond, wherein the alkynyl group may be optionally substituted with one or more substituents as described herein. In some embodiments, alkynyl groups contain 2 to 8 carbon atoms; in other embodiments, alkynyl groups contain 2 to 6 carbon atoms; in still other embodiments, alkynyl groups contain 2 to 4 carbon atoms. Examples of alkynyl groups include, but are not limited to, ethynyl (-C≡CH), propargyl (-CH) 2 C.ident.CH), 1-propynyl (propynyl, -C.ident.C-CH 3 ) 1-propargyl (-CH) 2 CH 2 C.ident.CH), 2-alkynylbutyl (-CH) 2 C≡CCH 3 ) 3-propargyl (-C.ident.CCH) 2 CH 3 ) And so on.
The term "alkoxy" means that the alkyl group is attached to the remainder of the molecule through an oxygen atom, wherein the alkyl group has the meaning as described herein. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, and the like.
The term "alkylamino" means that the amino groups are each independently substituted with one or two alkyl groups. Wherein, in some embodiments, the alkylamino group is one or two C 1-6 Alkyl groups are attached to lower alkylamino groups formed on the nitrogen atom. In other embodiments, the alkylamino groups are one or two C 1-4 Alkyl groups are attached to lower alkylamino groups formed on the nitrogen atom. Suitable alkylamino groups may be mono-or di-alkylamino, examples of alkylamino include, but are not limited to, N-methylamino, N-ethylamino, N, N-dimethylamino, N, N-diethylamino, and the like.
The term "haloalkyl" or "haloalkoxy" means that an alkyl or alkoxy group is substituted with one or more halogen atoms, examples of which include, but are not limited to, trifluoromethyl, trifluoromethoxy, and the like.
The term "haloalkoxy" means an alkoxy group substituted with one or more halogen atoms, wherein the alkoxy group has the meaning described herein; examples include, but are not limited to, difluoromethoxy (-OCHF) 2 ) Trifluoromethoxy (-OCF) 3 ) Difluoroethoxy (-OCH) 2 CHF 2 ) Trifluoroethoxy (-OCH) 2 CF 3 ) And so on.
The term "hydroxyalkyl" denotes an alkyl group substituted with one or more hydroxyl groups. In some embodiments, hydroxyalkyl groups represent hydroxyalkyl groups containing 1 to 6 carbon atoms, i.e., C 1-6 A hydroxyalkyl group; in other embodiments, the hydroxyalkyl group represents a haloalkyl group having 1 to 4 carbon atoms, i.e., C 1-4 A hydroxyalkyl group; in other embodiments, the hydroxyalkyl group represents a hydroxyalkyl group having 1 to 3 carbon atoms, i.e., C 1-3 A hydroxyalkyl group. Examples include, but are not limited to, hydroxymethyl, hydroxyethyl, 1, 2-dihydroxyethyl, 1-hydroxypropyl, 2-hydroxy-2-methylpropyl, hydroxybutyl, and the like.
The term "cycloalkyl" denotes a monovalent or polyvalent saturated or partially unsaturated monocyclic, bicyclic or tricyclic ring system containing 3 to 12 ring carbon atoms; wherein the cycloalkyl group is non-aromatic and does not contain any aromatic ring. In some embodiments, cycloalkyl groups contain 3 to 10 ring carbon atoms, e.g., C 3-10 Cycloalkyl; in other embodiments, cycloalkyl groups contain 3 to 8 ring carbon atoms, e.g., C 3-8 Cycloalkyl; in still other embodiments, cycloalkyl groups contain 3 to 6 ring carbon atoms, e.g., C 3-6 Cycloalkyl groups. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like; wherein, C is as follows 3-6 Cycloalkyl includes cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl. The cycloalkyl group may be optionally substituted with one or more substituents described herein.
"j-k ring atoms" or "j-k atoms" means that the cyclic group is composed of j-k ring atoms, including carbon atoms and/or O, N, S, P and like heteroatoms. Each of j and k is independently any non-zero natural number, and k > j; the term "j-k" includes j, k and any natural number therebetween. For example, "3-8 atom or 3-8 membered", "3-6 atom or 3-6 membered", "5-10 atom or 5-10 membered" or "5-6 atom or 5-6 membered" means that the cyclic group is composed of 3-8, 3-6, 5-10 or 5-6 ring atoms including heteroatoms such as carbon atoms and/or O, N, S, P. Specifically, for example, "heteroaryl consisting of 5 to 10 ring atoms" or "5 to 10 membered heteroaryl" represents heteroaryl comprising 5, 6, 7, 8, 9 or 10 ring atoms, wherein 5, 6, 7, 8, 9 or 10 is represented as the number of ring atoms, such as pyridyl is heteroaryl consisting of 6 ring atoms or 6 membered heteroaryl.
The term "heterocyclyl" refers to a saturated or partially unsaturated mono-, bi-or tricyclic ring system containing 3 to 12 ring atoms, wherein at least one ring atom is selected from the group consisting of nitrogen, sulfur and oxygen atoms; wherein the heterocyclic group is non-aromatic and does not contain any aromatic ring. Unless otherwise indicated, a heterocyclic group may be a carbon or nitrogen group, and-CH 2 The group may optionally be replaced by-C (=o) -. The sulfur atom of the ring may optionally be oxidized to an S-oxide. The nitrogen atom of the ring may optionally be oxidized to an N-oxide. The heterocyclyl group may be optionally substituted with one or more substituents described herein.
In some embodiments, the heterocyclyl is C 2-9 Heterocyclyl, meaning that the heterocyclyl contains 2-9 ring carbon atoms and at least one ring heteroatom selected from O, S and N; in other embodiments, the heterocyclyl is C 2-7 Heterocyclyl, meaning that the heterocyclyl contains 2-7 ring carbon atoms and at least one ring heteroatom selected from O, S and N; in other embodiments, the heterocyclyl is C 2-5 Heterocyclyl, meaning a heterocyclyl containing 2-5 ring carbon atoms and at least one ring heteroatom selected from O, S and N. Examples of heterocyclyl groups include, but are not limited to: ethylene oxide group, Thietanyl, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, oxazolidinyl, tetrahydrofuranyl, dihydrothienyl, dihydropyranyl, piperidinyl, morpholinyl, tetrahydropyrimidinyl, oxazinyl, thiomorpholinyl, piperazinyl, and the like. In heterocyclic groups-CH 2 Examples of the substitution of the-group by-C (=o) -include, but are not limited to, 2-oxo-pyrrolidinyl, 2-piperidonyl, 3-morpholinonyl, 3-thiomorpholinonyl, oxo-tetrahydropyrimidyl, and the like.
The term "halogen" refers to fluorine (F), chlorine (Cl), bromine (Br) or iodine (I).
The term "aryl" means a monocyclic, bicyclic, and tricyclic carbocyclic ring system containing 6 to 14 ring atoms, or 6 to 12 ring atoms, or 6 to 10 ring atoms, wherein at least one ring is aromatic and has one or more attachment points attached to the remainder of the molecule. The term "aryl" may be used interchangeably with the term "aromatic ring". Examples of aryl groups may include phenyl, 2, 3-dihydro-1H-indenyl, naphthyl and anthracenyl. The aryl group may be optionally substituted with one or more substituents described herein. Unless otherwise indicated, the group "C 6-14 Aryl "means an aryl group containing 6 to 14 ring carbon atoms.
The term "heteroaryl" means monocyclic, bicyclic and tricyclic ring systems containing 5 to 12 ring atoms, or 5 to 10 ring atoms, or 5 to 6 ring atoms, wherein at least one ring is aromatic and at least one ring contains one or more ring heteroatoms selected from nitrogen, oxygen, sulfur, and wherein said heteroaryl has one or more attachment points attached to the remainder of the molecule. When the-CH is present in the heteroaryl group 2 -said-CH, when a group is 2 The group may optionally be replaced by-C (=o) -. Unless otherwise indicated, the heteroaryl group may be attached to the remainder of the molecule (e.g., the host structure in the formula) at any reasonable point (which may be C in CH, or N in NH). The term "heteroaryl" may be used interchangeably with the term "heteroaromatic ring" or "heteroaromatic compound". In some embodiments, heteroaryl is C 1-9 Heteroaryl, meaning that the heteroaryl contains 1 to 9 ring carbon atoms and at least oneA ring heteroatom selected from O, S and N; in other embodiments, heteroaryl is C 1-7 Heteroaryl, meaning heteroaryl contains 1-7 ring carbon atoms and at least one ring heteroatom selected from O, s and N; in other embodiments, heteroaryl is C 1-6 Heteroaryl, meaning that the heteroaryl contains 1-6 ring carbon atoms and at least one ring heteroatom selected from O, s and N; in other embodiments, heteroaryl is C 1-5 Heteroaryl, meaning heteroaryl contains 1-5 ring carbon atoms and at least one ring heteroatom selected from O, S and N; in other embodiments, heteroaryl is C 1-4 Heteroaryl, meaning heteroaryl contains 1-4 ring carbon atoms and at least one ring heteroatom selected from O, s and N; in other embodiments, heteroaryl is C 1-3 Heteroaryl means heteroaryl contains 1 to 3 ring carbon atoms and at least one ring heteroatom selected from O, s and N. Examples include, but are not limited to, furyl, imidazolyl, isoxazolyl, oxazolyl, pyrrolyl, pyrazolyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazinyl, thienyl, thiazolyl, and the like; the following bicyclic rings are also included, but are in no way limited to: benzoimidazolyl, benzofuranyl, benzothienyl, indolyl, oxoindolyl, indolinyl, imidazopyridinyl, pyrazolopyridinyl, pyrazolopyrimidinyl, quinolinyl, isoquinolinyl, quinazolinyl, and the like. The heteroaryl group may be optionally substituted with one or more substituents described herein.
The group "- (CR) as described in the present invention a R b ) p The N- "has two linking sites which can be linked to the rest of the molecule and the way of linking the two linking sites can be interchanged. For example, where L is a group of formula b, as described herein, L (i.e., - (CR) a R b ) p N-) may be linked to the rest of the molecule via the E-terminus or the E' -terminus.
The term "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not generally produce allergies or similar inappropriate reactions, such as gastrointestinal discomfort, dizziness, etc., when administered to humans. Preferably, the term "pharmaceutically acceptable" as used herein refers to use in animals, more particularly in humans, approved by the federal regulatory agency or by a state government or listed in the U.S. pharmacopeia or other generally recognized pharmacopeia.
The term "carrier" refers to a diluent, adjuvant, excipient, or matrix with which the compound is administered. These pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water and aqueous solutions saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly injectable solutions. Suitable drug carriers are described in "Remington's Pharmaceutical Sciences" of e.w. martin.
"metabolite" refers to a product obtained by metabolizing a specific compound or salt thereof in vivo. The metabolites of a compound may be identified by techniques well known in the art and their activity may be characterized by employing the assay methods as described herein. Such products may be obtained by oxidation, reduction, hydrolysis, amidization, deamination, esterification, degreasing, enzymatic cleavage, etc. of the administered compound. Accordingly, the present invention includes metabolites of compounds, including metabolites produced by contacting a mammal with a compound of the present invention for a sufficient period of time.
As used herein, "pharmaceutically acceptable salts" refers to organic and inorganic salts of the compounds of the present invention. Pharmaceutically acceptable salts are well known in the art, as in the literature: m. berge et al describe pharmaceutically acceptable salts in detail in j. Pharmaceutical Sciences,1977, 66:1-19. Pharmaceutically acceptable non-toxic acid forming salts include, but are not limited to, mineral acid salts such as hydrochloride, hydrobromide, phosphate, sulfate, perchlorate; organic acid salts such as acetates, oxalates, maleates, tartrates, Citrate, succinate, malonate; or by other methods described in the book literature, such as ion exchange. Other pharmaceutically acceptable salts include adipic acid salts, alginates, ascorbates, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphoric acid salts, cyclopentylpropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumaric acid salts, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, caproate, hydroiodic acid salts, 2-hydroxy-ethanesulfonate, lactobionic acid salts, lactate, laurate, lauryl sulfate, malate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, palmitate, pamoate, pectate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, stearate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Salts obtained by reaction with suitable bases include alkali metals, alkaline earth metals, ammonium and N + (C 1-4 Alkyl group 4 Is a salt of (a). The present invention also contemplates quaternary ammonium salts formed from any of the compounds containing a group of N. The water-soluble or oil-soluble or dispersible product may be obtained by quaternization. Alkali or alkaline earth metals that may form salts include sodium, lithium, potassium, calcium, magnesium, and the like. The pharmaceutically acceptable salts further include suitable, non-toxic ammonium, quaternary ammonium salts and counter-ion forming amine cations, such as halides, hydroxides, carboxylates, sulphates, phosphates, nitrates, C 1-8 Sulfonate and aromatic sulfonate.
"solvate" according to the present invention refers to an association of one or more solvent molecules with a compound according to the present invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethylsulfoxide, ethyl acetate, acetic acid, and aminoethanol. The term "hydrate" refers to an association of solvent molecules that are water.
"nitroxide" in the present invention means that when a compound contains several amine functions, 1 or more than 1 nitrogen atom can be oxidized to form an N-oxide. Specific examples of N-oxides are N-oxides of tertiary amines or N-oxides of nitrogen atoms of nitrogen-containing heterocycles. The corresponding amine may be treated with an oxidizing agent such as hydrogen peroxide or a peracid (e.g., peroxycarboxylic acid) to form an N-oxide (see Advanced Organic Chemistry, wiley Interscience, 4 th edition, jerry March, pages). In particular, the N-oxides can be prepared by the method L.W.Deady (Syn.Comm.1977, 7, 509-514) in which an amine compound is reacted with m-chloroperoxybenzoic acid (MCPBA), for example in an inert solvent such as methylene chloride.
The term "treating" as used herein refers in some embodiments to ameliorating a disease or disorder (i.e., slowing or preventing or alleviating the progression of the disease or at least one clinical symptom thereof). In other embodiments, "treating" refers to moderating or improving at least one physical parameter, including physical parameters that may not be perceived by the patient. In other embodiments, "treating" refers to modulating a disease or disorder physically (e.g., stabilizing an observable symptom) or physiologically (e.g., stabilizing a parameter of the body) or both. In other embodiments, "treating" refers to preventing or delaying the onset, or exacerbation of a disease or disorder.
"hypoxia-inducible factor-related disease" refers to any condition associated with hypoxia-inducible factor (HIF) less than normal, abnormal or inappropriate regulation. HIF-related disorders include any disorder in which an increase in HIF levels would provide beneficial effects. HIF-related disorders include, but are not limited to, cancer, heart disease, stroke, peripheral vascular disease, ulcers, burns, chronic wounds, chronic ischemia, pulmonary embolism, ischemia-reperfusion injury, inflammation, anemia, and the like.
"Erythropoietin (EPO) -related disease" refers to any He Bingzheng associated with the subnormal, abnormal or inappropriate regulation of endogenous erythropoietin. EPO-associated disorders include any disorder in which increased EPO content will provide a therapeutic benefit. EPO-associated diseases include, but are not limited to, anemia (including anemia associated with diabetes, ulcers, renal failure, cancer, infection, dialysis, surgery, and chemotherapy), ischemic and hypoxic conditions (e.g., arterial occlusive disease, angina, intestinal infarction, pulmonary infarction, cerebral ischemia, and myocardial infarction, etc.).
HIF-related and/or EPO-related diseases include, but are not limited to, anemia, ischemia, vascular disease, angina, myocardial ischemia, myocardial infarction, metabolic disorders, or cancer, among others.
"anemia" refers to any abnormality or deficiency of hemoglobin or red blood cells that results in a decrease in oxygen content in the blood. Anemia may be associated with abnormal production, processing or performance of red blood cells and/or hemoglobin. The term anemia refers to any reduction in the number of red blood cells and/or the amount of hemoglobin in the blood relative to normal blood levels. Anemia can be caused by a variety of conditions, such as acute or chronic kidney disease, infection, inflammation, cancer, radiation, toxins, diabetes, and surgery. Infection may be caused, for example, by viruses, bacteria, and/or parasites, etc. Inflammation may be caused by infection or autoimmune disorders such as rheumatoid arthritis and the like. Anemia may also be associated with blood loss caused by, for example, gastric ulcers, duodenal ulcers, hemorrhoids, gastric or colorectal cancer, trauma, injury, surgical procedures, and the like. Anemia formation may also be associated with radiation therapy, chemotherapy and kidney dialysis. Anemia is also associated with HIV-infected patients treated with azidothymidine (zidovudine) or other reverse transcriptase inhibitors, and can develop in cancer patients receiving chemotherapy (e.g., chemotherapy with or without cyclic cisplatin). Aplastic anemia and myelodysplastic syndromes are diseases associated with bone marrow failure leading to reduced erythropoiesis. In addition, anemia may be caused by defects or abnormalities in hemoglobin or red blood cells, including, for example, microcytic anemia, hypopigmentation anemia, and the like. Anemia may be caused by disorders in iron transport, processing and utilization, such as iron granulocytic anemia (sideroblastic anemia), and the like.
Any formulae given herein are also intended to represent non-isotopically enriched forms as well as isotopically enriched forms of such compounds. The syngeneic enriched compounds have the structure depicted by the general formula given in the present invention, except for oneOr a plurality of atoms replaced with atoms having a selected atomic or mass number. Exemplary isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, and chlorine, such as 2 H， 3 H， 11 C， 13 C， 14 C， 15 N， 17 O， 18 O， 18 F， 32 P， 35 S， 36 C1 and 125 I。
in another aspect, the compounds of the invention include isotopically enriched compounds as defined herein, e.g., wherein a radioactive isotope, such as 3 H， 14 C and C 18 F, or in which non-radioactive isotopes are present, e.g 2 H and 13 C. such isotopically enriched compounds are useful in metabolic studies (using 14 C) Reaction kinetics studies (using, for example 2 H or 3 H) Detection or imaging techniques, such as positive electron emission tomography (PET) or Single Photon Emission Computed Tomography (SPECT) including drug or substrate tissue distribution assays, or may be used in radiation therapy of a patient. 18 F-enriched compounds are particularly desirable for PET or SPECT studies. Isotopically enriched compounds of formula (I) can be prepared by conventional techniques familiar to those skilled in the art or by describing the examples and preparation processes of the present invention using a suitable isobaric labeling reagent in place of the originally used unlabeled reagent.
In addition, heavier isotopes are in particular deuterium (i.e., 2 substitution of H or D) may provide certain therapeutic advantages, which are brought about by a higher metabolic stability. For example, increased in vivo half-life or reduced dosage requirements or improved therapeutic index. It is to be understood that deuterium in the context of the present invention is considered as a substituent for a compound of formula (I) or formula (II). The concentration of such heavier isotopes, particularly deuterium, can be defined by an isotopic enrichment factor. The term "isotopically enriched factor" as used herein refers to the ratio between the isotopic abundance and the natural abundance of a specified isotope. If a substituent of a compound of the present invention is designated as deuterium, the compound is substituted for each designated deuterogenThe sub-has an isotopic enrichment factor of at least 3500 (52.5% deuterium incorporation at each named deuterium atom), at least 4000 (60% deuterium incorporation), at least 4500 (67.5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 5500 (82.5% deuterium incorporation), at least 6000 (90% deuterium incorporation), at least 6333.3 (95% deuterium incorporation), at least 6466.7 (97% deuterium incorporation), at least 6600 (99% deuterium incorporation), or at least 6633.3 (99.5% deuterium incorporation). Pharmaceutically acceptable solvates of the invention include those wherein the crystallization solvent may be isotopically substituted, e.g. D 2 O, acetone-d 6 、DMSO-d 6 Those solvates of (a).
All tautomeric forms of the compounds of the invention are included within the scope of the invention unless otherwise indicated. In addition, unless otherwise indicated, the structural formulae of the compounds described herein include enriched isotopes of one or more different atoms.
Abbreviations for any protecting groups, amino acids and other compounds used in the present invention are, unless otherwise indicated, based on their commonly used, accepted abbreviations or with reference to IUPAC-IUBCommission on Biochemical Nomenclature (see biochem.1972, 11:942-944).
Drawings
FIG. 1 is a graph of the binding activity of HIF-2α/ARNT for examples 1, 2, 3, 4, 9, 10, 11, 12, 13, 19, 20, 35, 36 at a concentration of 100. Mu.M measured by the TR-FRET assay in example 1.
FIG. 2 is a graph showing the binding activity EC of Compound 1 and Compound 20 on HIF-2α/ARNT in example 1 by the TR-FRET assay 50 And EC (EC) max 。
FIG. 3 is a graph of the activity of Compound 1 and Compound 20 on HIF-2α downstream target genes determined in a real-time fluorescent quantitative assay in example 2.
Fig. 4 is a microscope image of the effects of compound 1 and compound 20 on cardiac erythropoiesis in anemic zebra fish as determined by the zebra fish anemia assay of example 3.
FIG. 5 is a graph of relative cardiac erythrocyte counts of compound 1 and compound 20 versus anemic zebrafish for the zebrafish anemia experiment of example 3.
DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION
In order to better understand the technical solution of the present invention, some non-limiting examples are further disclosed below to further describe the present invention in detail.
The reagents used in the present invention are all commercially available or can be prepared by the methods described herein.
Examples 1, 2, 3, 4, 9, 10, 11, 12, 13, 19, 20, 35, 36 were purchased from Shanghai Tao Shu Biotechnology Co., ltd. The ID names are respectively: z16315055, Z351862592, Z23856832, Z17970608, Z19222925, Z13783822, Z16341869, Z272067206, Z285552256, Z16315222, Z351862592, Z25567815, Z16315121.
Example 1: TR-FRET experiment
1. The testing method comprises the following steps:
a) A 100X concentration stock solution of each compound (compound concentration 10 mM) was diluted to 4X using a buffer;
b) Add 4. Mu.L of diluted compound solution to each well of 384 well plates, respectively;
c) Add 4. Mu.L of 4 XARNT working fluid to each well of 384 well plates, respectively;
d) 4 mu L of 4X HIF2α working solution is added into each well of a 384-well plate respectively;
e) Sealing the plate and standing at room temperature for half an hour;
f) Preparing a 4X detection solution (MAb Anti FLAG-Eu and streptavidin-d 2) by using the detection solution of 1X;
g) Add 4. Mu.L of 4 Xdetection solution (MAb Anti FLAG-Eu and streptavidin-d 2) to each well of 384 well plates;
h) After overnight incubation and detection of 665nm/615nm fluorescence ratio, ec was then performed max And IC 50 Is calculated by the computer.
i) The present experiment uses the antagonists PT2385 and agonist M1001 of HIF-2. Alpha. As references.
Inhibition/activation rate calculation formula:
RR positive : average RR value of positive control (RR value of 10 μm PT 2385).
RR vehicle : average RR value of negative control (RR value of non-dosed group).
2. Test results:
the test results are shown in FIG. 1 at a compound concentration of 100. Mu.M: compounds 1, 2, 3, 4, 9, 10, 11, 12, 13, 19, 20, 35, 36 exhibit a certain activity of up-regulating HIF-2a/ARNT binding, wherein compounds 1, 10, 11, 12, 19 and 20 can significantly up-regulate HIF-2α/ARNT binding.
The concentration gradient test results are shown in fig. 2: compound 1 shows binding to agonize HIF-2a/ARNT in a TR-FRET assay, EC 50 910nM, EC max 283%. Compound 20 enhances EC of HIF-2a/ARNT interactions at the protein level 50 At 560nM, EC max 776%.
From the experimental results, the compounds of the present invention have good HIF-2 alpha/ARNT activation activity, and can be used as effective HIF-2a agonists.
Example 2: real-time fluorescent quantitative experiment
1. The testing method comprises the following steps:
renal cancer cells 786-O were seeded onto 6-well plates. After 24h, the compound was added and the cells were incubated with the compound for 24h. The TRIZOL reagent was used for RNA extraction. cDNA transcription uses the All-in-oneTM First-Strand cDNA Synthesis Kit kit (see description for details of the procedures). Signal calibration was performed using SYBR reagent, GAPDH as an internal reference. The qRT-PCR primers are as follows: gapdh_fwd, GCACCGTCAAGGCTGAGAAC; gapdh_rev, TGGTGAAGACGCCAGTGGA; HIF-2α_fwd, CGGAGGTGTTCTATGAGCTGG; HIF-2α_rev, agcttgtgttcgcaggaa. Epo_fwd, AACAATCACTGCTGACACTT; epo_rev, AGAGTTGCTCTCTGGACAGT; serpine1_fwd, ACCGCAACGTGGTTTTCTCA; serpine1_rev, TTGAATCCCATAGCTGCTTGAAT; VEGF_fwd, AGGGCAGAATCATCACGAAGT; VEGF_rev, AGGGTCTCGATTGGATGGCA; ccnd1_fwd, CAATGACCCCGCACGATTTC; ccnd1_rev, CATGGAGGGCGGATTGGAA; glat1_fwd, GGCCAAGAGTGTGCTAAAGAA; GLUT1_rev, ACAGCGTTGATGCCAGACAG; ndrg1_fwd, CTCCTGCAAGAGTTTGATGTCC; ndrg1_rev, TCATGCCGATGTCATGGTAGG; pgk1_fwd, TTAAAGGGAAGCGGGTCGTTA; pgk1_rev, TCCATTGTCCAAGCAGAATTTGA.
3. Test results:
the detection results are shown in fig. 3: compound 1 and compound 20 are capable of effectively activating the HIF-2α downstream target gene erythropoietin gene (EPO) gene, hypoxia inducible factor gene (HIF-2α), vascular endothelial growth factor gene (VEGF), cyclin D1 gene (CCND 1), thrombopoietin serine 1 gene (SERPINE 1), glucose transporter 1 gene (GLUT 1) and N-myc downstream regulatory gene 1 (NDRG 1). But has no effect on the phosphoglycerate kinase gene (PGK 1) of the target gene downstream of HIF-1 alpha.
Example 3: zebra fish anemia experiment
1. Sample formulation information
Compound 1, formulated as a 20.0mM stock solution in DMSO, was stored at-20 ℃.
Compound 20 was prepared as 25.0mM stock solution in DMSO and stored at-20 ℃.
Positive control: luo Shasi he, pale yellow powder, supplied by the company of the medicine, omer, hangzhou, was stored in the shade and protected from light. Stock solution of 200mg/mL was prepared with DMSO, diluted as needed, and stored at-20 ℃.
2. Experimental animal
Zebra fish are all bred in water for breeding fish at 28 ℃ (water quality: 200mg of instant sea salt is added into 1L of reverse osmosis water, conductivity is 450-550 mu S/em, pH is 6.5-8.5, hardness is 50-100 mg/L CaCO 3), and the water is bred by a fish breeding center of the company, and the use license number of experimental animals is: SYXK (Zhe) 2022-0004. The feeding management meets the requirements of international AAALAC authentication (authentication number: 001458).
Wild type AB strain zebra fish is bred in a natural pairing mating breeding mode. Zebra fish aged 2 days after fertilization (2 dpf) were used for evaluation of the efficacy of the samples in combination with roflumilast for improving renal anemia.
3. Instrument, consumable and reagent
Dissecting microscope (SZX 7, OLYMPUS, japan); CCD camera (VertA 1, shanghai Tusen Vision technologies Co., ltd.); precision electronic balances (CP 214, OHAUS, USA); 6-well plates (Nest Biotech, china).
Dimethyl sulfoxide (DMSO, lot BCCD8942, sigma, switzerland); aristolochic acid (lot number WXBD0062V, sigma, USA); o-dianisidine (lot number MKBX3619V, sigma, USA).
4. Detection method
2dpf wild type AB strain zebra fish were randomly selected in 6-well plates, and 30 zebra fish were treated per well (experimental group). A normal zebra fish group (vehicle group), a model control group (Anemia model group), a positive control group (1. Mu.M and 10. Mu.M roxadustat (abbreviated as R)), a dose group of 2 compounds 1 (1. Mu.M and 10. Mu.M), a combination group of roxadustat and compound 1 (1. Mu.M roxadustat+1. Mu.M compound 1, 1. Mu.M roxadustat+10. Mu.M compound 1), a dose group of 2 compounds 20 (1. Mu.M and 10. Mu.M), a combination group of roxadustat and compound 20 (1. Mu.M roxadustat+1. Mu.M compound 20, 1. Mu.M roxadustat+10. Mu.M compound 20) were set respectively. Except for the normal control group, the other experimental groups are all water-soluble to administer aristolochic acid to establish a zebra fish renal anemia model. The various compounds were water soluble with a capacity of 3 mL per well. After 48h of treatment at 28 ℃, the fish were stained with o-dianisidine, and 10 zebra fish were randomly selected from each experimental group after the staining was completed and photographed under a dissecting microscope, as shown in fig. 4. Data are collected by NIS-Elements D3.20 advanced image processing software, the color intensity of the red blood cells of the zebra fish heart is analyzed, and the effect of improving renal anemia by combining the sample with the roflumilast is evaluated according to the statistical significance of the index. Statistical analysis with SPSS software, P < 0.05, P < 0.01, P < 0.001 indicated significant differences compared to the model group, # P＜0.05， ## P＜0.01， ### P < 0.001 shows a significant difference compared to the 1. Mu.M roflumilast-dosed group, the results are shown in FIG. 5.
5. Detection result
From the experimental results, under the experimental conditions, (1) Luo Shasi, 1.0 and 10.0 mu M can improve renal anemia; (2) compound 1 alone can improve renal anemia; (3) Compound 20 alone at 1.00 and 10.0 μm can improve renal anemia; (4) The combination group of the roflumilast and the compound 1 has better effect than the single combination group of the roflumilast; (5) The Luo Shasi he plus compound 20 combination group has better effect than the roflumilast single combination group; (6) Overall, using 1.0 and 10.0 μm of compound 20 alone, the activity was superior to roflumilast at the same concentration.
In the description of the present specification, a description referring to terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms are not necessarily directed to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, the different embodiments or examples described in this specification and the features of the different embodiments or examples may be combined and combined by those skilled in the art without contradiction.
While embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives and variations may be made to the above embodiments by one of ordinary skill in the art within the scope of the invention.
Claims (7)
1. The use of a compound for the preparation of a medicament for the treatment of a disorder mediated at least in part by hypoxia inducible factor HIF-2 alpha, wherein the compound is of formula (I),
(I)，
wherein, the liquid crystal display device comprises a liquid crystal display device,
X 1 selected from the group consisting ofC(=O)；
Y 2 Selected from CH 2 NH, O or S;
R 1 、R 2 and together with the atoms to which they are attached form C 6-8 Aryl or heteroaryl consisting of 5-8 ring atoms, wherein said C 6-8 Aryl and heteroaryl consisting of 5 to 8 ring atoms are each independently optionally substituted with 1 to 2D;
l is- (CR) a R b ) p -S-；
Each R is a And R is b H, D independently;
p is 1, 2 or 3;
a is selected from:
、/>；
R 3 is C 5-10 Aryl or heteroaryl consisting of 5 to 12 ring atoms, wherein said C 5-10 Aryl and heteroaryl consisting of 5 to 12 ring atoms are each independently optionally substituted with 1 to 2D;
R 4 is NH 2 、C 1-3 Alkyl, n-butyl, isobutyl, sec-butyl or tert-butyl.
2. The use according to claim 1, wherein R 3 Is phenyl, naphthyl, pyridinyl, pyrimidinyl, pyrazinyl or pyridazinyl, wherein said phenyl, naphthyl, pyridinyl, pyrimidinyl, pyrazinyl and pyridazinyl are each independently optionally substituted with 1-2D.
3. The use according to claim 1, said compound comprising one of the following compounds:
or->。
4. Use of a pharmaceutical composition comprising a compound according to any one of claims 1-3 for the preparation of a medicament for the treatment of a disease mediated at least in part by hypoxia inducible factor HIF-2 alpha.
5. The use according to claim 4, the pharmaceutical composition further comprising a pharmaceutically acceptable adjuvant.
6. The use according to any one of claims 1-3 or the use according to any one of claims 4-5, wherein the disease is anemia, ischemia, vascular disease, angina pectoris, myocardial infarction, metabolic disorder or cancer.
7. Use of a compound according to any one of claims 1-3 or a pharmaceutical composition according to any one of claims 4-5 in combination with Luo Shasi for the manufacture of a medicament for the treatment of a disease mediated at least in part by hypoxia inducible factor HIF-2 alpha.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210954630.7A CN115232147B (en) | 2022-08-09 | 2022-08-09 | Heterocyclic derivatives as HIF-2 alpha agonists |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210954630.7A CN115232147B (en) | 2022-08-09 | 2022-08-09 | Heterocyclic derivatives as HIF-2 alpha agonists |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115232147A CN115232147A (en) | 2022-10-25 |
| CN115232147B true CN115232147B (en) | 2023-10-13 |
Family
ID=83678567
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210954630.7A Active CN115232147B (en) | 2022-08-09 | 2022-08-09 | Heterocyclic derivatives as HIF-2 alpha agonists |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115232147B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103946226A (en) * | 2011-07-19 | 2014-07-23 | 无限药品股份有限公司 | Heterocyclic compounds and uses thereof |
| WO2018233527A1 (en) * | 2017-06-19 | 2018-12-27 | 上海和誉生物医药科技有限公司 | Nitrogen heteroaryl derivative having csf1r inhibitory activity, and preparation method therefor and application thereof |
| CN110876806A (en) * | 2019-10-23 | 2020-03-13 | 北京大学 | Use of HIF2 α agonist, ACER2 agonist for the manufacture of a medicament for the treatment of atherosclerosis |
| CN112105609A (en) * | 2018-03-22 | 2020-12-18 | 奥瑞基尼探索技术有限公司 | Substituted imidazolidin-2-one derivatives as PRMT5 inhibitors |
| WO2021115375A1 (en) * | 2019-12-11 | 2021-06-17 | 四川海思科制药有限公司 | Nitrogen-containing heterocyclic autotaxin inhibitor, and composition containing same and use thereof |
| CN113264900A (en) * | 2021-06-07 | 2021-08-17 | 南京中医药大学 | Preparation method and medical application of benzisothiazole and benzothiophene |
| WO2023046117A1 (en) * | 2021-09-23 | 2023-03-30 | 3H Pharmaceuticals Co., Ltd. | Fgfr inhibitors and methods of use thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110076278A1 (en) * | 2005-08-02 | 2011-03-31 | Mehran Khodadoust | Modulators of Hypoxia Inducible Factor-1 and Related Uses for the Treatment of Ocular Disorders |
| US8952160B2 (en) * | 2008-01-11 | 2015-02-10 | Fibrogen, Inc. | Isothiazole-pyridine derivatives as modulators of HIF (hypoxia inducible factor) activity |
| WO2021016280A1 (en) * | 2019-07-22 | 2021-01-28 | Nikang Therapeutics, Inc. | Tricyclic derivatives as hypoxia inducible factor-2(alpha) inhibitors |
| US20230226074A1 (en) * | 2020-04-28 | 2023-07-20 | Global Blood Therapeutics, Inc. | Methods of use for pyrimidines as ferroportin inhibitors |
-
2022
- 2022-08-09 CN CN202210954630.7A patent/CN115232147B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103946226A (en) * | 2011-07-19 | 2014-07-23 | 无限药品股份有限公司 | Heterocyclic compounds and uses thereof |
| WO2018233527A1 (en) * | 2017-06-19 | 2018-12-27 | 上海和誉生物医药科技有限公司 | Nitrogen heteroaryl derivative having csf1r inhibitory activity, and preparation method therefor and application thereof |
| CN112105609A (en) * | 2018-03-22 | 2020-12-18 | 奥瑞基尼探索技术有限公司 | Substituted imidazolidin-2-one derivatives as PRMT5 inhibitors |
| CN110876806A (en) * | 2019-10-23 | 2020-03-13 | 北京大学 | Use of HIF2 α agonist, ACER2 agonist for the manufacture of a medicament for the treatment of atherosclerosis |
| WO2021115375A1 (en) * | 2019-12-11 | 2021-06-17 | 四川海思科制药有限公司 | Nitrogen-containing heterocyclic autotaxin inhibitor, and composition containing same and use thereof |
| CN113264900A (en) * | 2021-06-07 | 2021-08-17 | 南京中医药大学 | Preparation method and medical application of benzisothiazole and benzothiophene |
| WO2023046117A1 (en) * | 2021-09-23 | 2023-03-30 | 3H Pharmaceuticals Co., Ltd. | Fgfr inhibitors and methods of use thereof |
Non-Patent Citations (2)
| Title |
|---|
| "RN：926133-97-3，1089649-19-3，1090024-00-2，2181959-84-0，1390373-04-2，1299599-92-0";ACS.registry database;《STNext》;第1-8页 * |
| "新型含苯并咪唑基噻唑烷二酮类化合物的合成及其抗糖尿病脑功能障碍的研究";张俊;《中国博士学位论文全文数据库医药卫生科技辑》(第02期);第E079-19页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115232147A (en) | 2022-10-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11931363B2 (en) | Triazolopyrimidine compounds and uses thereof | |
| JP2021521200A (en) | Compounds for the treatment of cancer | |
| EP3472161B1 (en) | Triazolopyridine compounds and uses thereof | |
| CN105980387B (en) | Serine/threonine kinase inhibitor | |
| DK2364302T3 (en) | TRIAZINE ANALOGS AND THE USE THEREOF AS THERAPEUTIC AGENTS AND DIAGNOSTIC PROBE | |
| CN105384687B (en) | Quinolinones compound and its applied in medicine | |
| US20050239806A1 (en) | Pyrrolopyrimidine derivatives and analogs and their use in the treatment and prevention of diseases | |
| JP7353682B2 (en) | Substituted fused aromatic ring derivatives, compositions thereof, and uses thereof | |
| BR112018007977B1 (en) | INNOVATIVE FERROPORTIN INHIBITORS | |
| CA2913697A1 (en) | Imidazopyrrolidinone derivatives and their use in the treatment of disease | |
| TW200835485A (en) | Novel aminopyrimidine derivatives as PLK1 inhibitors | |
| WO2008026768A1 (en) | Novel aminopyridine derivatives having aurora a selective inhibitory action | |
| PT3004112T (en) | Pyrazolo-pyrrolidin-4-one derivatives and their use in the treatment of disease | |
| AU2020202146A1 (en) | Solid forms of 2-(tert-butylamino)-4-((1r,3r,4r)-3-hydroxy-4-methylcyclohexylamino)-pyrimidine-5-carboxamide, compositions thereof and methods of their use | |
| EP3766884B1 (en) | Crystal form and salt type of triazolopyrimidine compound and preparation method therefor | |
| US11648254B2 (en) | Substituted pyrido[2,3-d]pyrimidines as inhibitors of Ras pathway signaling | |
| EP2036561B1 (en) | Agent for overcoming resistance to anti-cancer agent | |
| JP2018138609A (en) | Naphthyridinedione derivatives | |
| CN115232147B (en) | Heterocyclic derivatives as HIF-2 alpha agonists | |
| WO2018214846A1 (en) | Imidazo[1',2':1,6]pyrido[2,3-d]pyrimidine compound as protein kinase inhibitor | |
| KR102570883B1 (en) | Novel gspt1 degraders and their use | |
| WO2013037292A1 (en) | Substituted aromatic urea compound and use thereof as anti-cancer drug | |
| CN109293652B (en) | Substituted thiazole derivative and application thereof | |
| CN115141202A (en) | Pyrimidopyrazinone compounds and uses thereof | |
| WO2023220237A1 (en) | Benzothiazole compounds as vhl ligands |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |