CN115232147A - Heterocyclic derivatives as HIF-2 alpha agonists - Google Patents

Heterocyclic derivatives as HIF-2 alpha agonists Download PDF

Info

Publication number
CN115232147A
CN115232147A CN202210954630.7A CN202210954630A CN115232147A CN 115232147 A CN115232147 A CN 115232147A CN 202210954630 A CN202210954630 A CN 202210954630A CN 115232147 A CN115232147 A CN 115232147A
Authority
CN
China
Prior art keywords
atoms
compound
butyl
group
cycloalkyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210954630.7A
Other languages
Chinese (zh)
Other versions
CN115232147B (en
Inventor
薛晓纤
程辉敏
李迎君
王萍
王雯莉
李潮
方磊
张绪穆
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Southwest University of Science and Technology
Shenzhen Jingtai Technology Co Ltd
Original Assignee
Southwest University of Science and Technology
Shenzhen Jingtai Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Southwest University of Science and Technology, Shenzhen Jingtai Technology Co Ltd filed Critical Southwest University of Science and Technology
Priority to CN202210954630.7A priority Critical patent/CN115232147B/en
Publication of CN115232147A publication Critical patent/CN115232147A/en
Application granted granted Critical
Publication of CN115232147B publication Critical patent/CN115232147B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4196—1,2,4-Triazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/422—Oxazoles not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4365—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system having sulfur as a ring hetero atom, e.g. ticlopidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/472—Non-condensed isoquinolines, e.g. papaverine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4985—Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/53—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with three nitrogens as the only ring hetero atoms, e.g. chlorazanil, melamine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D491/00—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
    • C07D491/02—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
    • C07D491/04—Ortho-condensed systems
    • C07D491/044—Ortho-condensed systems with only one oxygen atom as ring hetero atom in the oxygen-containing ring
    • C07D491/048—Ortho-condensed systems with only one oxygen atom as ring hetero atom in the oxygen-containing ring the oxygen-containing ring being five-membered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D519/00—Heterocyclic compounds containing more than one system of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring system not provided for in groups C07D453/00 or C07D455/00

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Urology & Nephrology (AREA)
  • Obesity (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention relates to a heterocyclic derivative used as a hypoxia inducible factor-2 alpha (HIF-2 alpha) agonist, which is a compound shown in a formula (I) or a stereoisomer, a nitrogen oxide, a hydrate, a solvate, a metabolite or a pharmaceutically acceptable salt of the compound shown in the formula (I), and a pharmaceutical composition containing the derivative.
Figure DDA0003789419000000011
Wherein, X 1 Selected from CH, CH 2 C (= O), N, NH, O or S; y is 2 Selected from CH, CH 2 NH, N, O or S;

Description

Heterocyclic derivatives as HIF-2 alpha agonists
Technical Field
The invention belongs to the field of medicaments, in particular relates to a heterocyclic derivative serving as an HIF-2 alpha agonist, and further relates to application of the heterocyclic derivative or a pharmaceutical composition thereof in preparing medicaments.
Background
In the case of anemia, trauma, tissue necrosis and defects, the tissue or cells are often in a hypoxic state. Hypoxia results in the expression of a series of transcription inducible factors that are involved in angiogenesis, iron, sugar metabolism, and cell growth and proliferation. Among them, hypoxia Inducible Factor (HIF) is a transcription factor that is activated by body cells under reduced oxygen conditions, and is widely distributed in various parts of the body, particularly intima vascularis, heart, brain, kidney, liver, etc. HIFS mainly include HIF-1, HIF-2 and HIF-3, which are heterodimers composed of an oxygen-sensitive alpha subunit (HIF-1. Alpha., HIF-2. Alpha. And HIF-3. Alpha.) and a constitutive beta subunit HIF-1. Beta. (also known as aromatic Hydrocarbon Receptor Nuclear Transporter, ARNT). Of the three alpha subunits, HIF-2 α is the primary regulator of pathological hypoxia response. In normoxic cells, HIF-2 α is rapidly degraded by the mechanism of ubiquitination of the von Hippel-Lindau tumor suppressor (pVHL) E3 ligase complex. Under hypoxic conditions, HIF-2 α is not degraded, and the active HIF α/β complex accumulates in the nucleus and activates the expression of various genes, including glycolytic enzyme (LDH-A), glucose transporter (GLUT 1), erythropoietin (EPO), and Vascular Endothelial Growth Factor (VEGF).
EPO is a naturally occurring hormone that stimulates the production of red blood cells (erythrocytes) that carry oxygen throughout the body. EPO is normally secreted by the kidney and,and endogenous EPO is increased under reduced oxygen conditions. All types of anemia are characterized by a reduced capacity of the blood to carry oxygen and are therefore accompanied by similar signs and symptoms, including pale skin and mucous membranes, weakness, dizziness, fatigue and lethargy, leading to a reduction in quality of life. Anemia is often associated with conditions lacking red blood cells or hemoglobin in the blood. The common causes of anemia include iron and vitamin B 12 And folate deficiency, and also may be associated with chronic diseases, such as inflammatory diseases, including diseases with secondary myeloinflammatory suppressions, and the like. Anemia is also associated with renal dysfunction, and most renal failure patients who are routinely dialyzed suffer from chronic anemia. Of the three alpha subunits, HIF-2 α is the primary regulator of pathological hypoxia response. From the analysis of signal channels, HIF-2 alpha is the most direct transcription factor of blood regeneration and angiogenesis such as EPO, VEGFA, etc., HIF-2 alpha has specific function and tissue specificity, and is an ideal target spot for treating ischemic diseases such as renal anemia, etc. with little side effect. The HIF2 alpha agonist can activate erythropoietin target genes and induce kidneys to synthesize erythropoietin, so that the aim of treating poor blood caused by chronic kidney diseases is achieved, and the development of the HIF2 alpha agonist has important significance.
Disclosure of Invention
The invention provides a heterocyclic derivative serving as an HIF-2 alpha agonist or a pharmaceutical composition thereof, and further relates to application of the heterocyclic derivative or the pharmaceutical composition thereof in preparing a medicament, namely, the heterocyclic derivative or the pharmaceutical composition thereof is used for preventing, treating or relieving HIF-related and/or EPO-related diseases, such as anemia and the like, of a patient.
In a first aspect, the present invention relates to a compound which is a compound of formula (I) or a stereoisomer, a nitric oxide, a hydrate, a solvate, a metabolite or a pharmaceutically acceptable salt of a compound of formula (I),
Figure BDA0003789418980000011
wherein, the first and the second end of the pipe are connected with each other,
X 1 selected from CH, CH 2 、C(＝O)、N、NH、O or S;
Y 2 selected from CH, CH 2 NH, N, O or S;
Figure BDA0003789418980000021
is a single bond or a double bond;
R 1 and R 2 Each independently H, D, halogen, C 3-8 Cycloalkyl or heterocyclyl of 3 to 8 atoms, wherein said C is 3-8 Cycloalkyl and heterocyclyl consisting of 3 to 8 atoms are each independently optionally unsubstituted or substituted by 1 to 2 substituents selected from D, halogen, -CN, -NO 2 、-OH、-NH 2 、 C 1-3 Alkyl radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl or C 3-8 Cycloalkyl, substituted with a substituent;
R 1 、R 2 together with the atoms to which they are attached form C 5-7 Cycloalkyl, heterocyclic radical consisting of 5-8 atoms, C 6-8 Aryl or heteroaryl of 5 to 8 atoms, wherein said C 5-7 Cycloalkyl, heterocyclic radical consisting of 5-8 atoms, C 6-8 Aryl and 5-8 atom heteroaryl are each independently optionally unsubstituted or substituted by 1-2 substituents selected from D, halogen, -NO 2 、-CN、-OH、-NH 2 、-C(＝O)OCH 3 、-C(＝O)NH 2 、 C 1-3 Alkyl or C 1-3 Substituted by a substituent of alkoxy;
l is- (CR) a R b ) p -、-(CR a R b ) p -O-、-(CR a R b ) p -NH-、-(CR a R b ) p -S-、-(CR a R b ) p -S (= O) -or- (CR) a R b ) p -S(＝O) 2 -；
Each R a And R b Independently H, D, C 1-3 Alkyl radical, C 2-4 Alkenyl or C 2-4 An alkynyl group;
p is 0,1, 2 or 3;
a is selected from:
Figure BDA0003789418980000022
R 3 is H, D, halogen, CN, NO 2 、C 3-8 Cycloalkyl, a heterocyclic group consisting of 4 to 12 atoms, C 5-10 Aryl or heteroaryl of 5 to 12 atoms, wherein C is 3-8 Cycloalkyl, heterocyclic group consisting of 4 to 12 atoms, C 5-10 Aryl and 5-12 atom heteroaryl are each independently optionally unsubstituted or substituted by 1-2 substituents selected from D, halogen, -CN, -NO 2 、-OCH 3 、-NR x R y 、-C(＝O)R x 、-C(＝O)OR x 、 -C(＝O)NR x R y 、-S(＝O) 2 R x 、C 1-6 Alkyl or C 1-6 Substituted with a substituent of haloalkyl;
each R x And R y Independently H, D, C 1-3 Alkyl radical, C 2-4 Alkenyl or C 2-4 Alkynyl.
R 4 Is H, D, NH 2 、C 1-3 Alkyl radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl or C 3-8 A cycloalkyl group.
In some embodiments, R 1 And R 2 Each independently is H, D, F, cl, br, I, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, piperazinyl, or morpholinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, piperazinyl, and morpholinyl are each independently optionally unsubstituted or substituted with 1-2 groups selected from D, halo, -CN, -NO 2 、-OH、-NH 2 Methyl, ethyl, n-propyl, isopropyl, vinyl, or ethynyl;
R 1 、R 2 together with the atoms to which they are attached form C 5-7 CycloalkanesRadical, heterocyclic radical composed of 5-8 atoms, C 6-8 Aryl or heteroaryl of 5 to 8 atoms, wherein said C 5-7 Cycloalkyl, heterocyclic radical consisting of 5-8 atoms, C 6-8 Aryl and 5-8-membered heteroaryl are each independently optionally unsubstituted or substituted by 1-2 substituents selected from D, F, cl, br, I, -NO 2 、-CN、-OH、-NH 2 、-C(＝O)OCH 3 、-C(＝O)NH 2 Methyl, ethyl, n-propyl, isopropyl, -CHF 2 、-CF 3 、-CH 2 CF 3 Methoxy, ethoxy, 1-propoxy or 2-propoxy.
In some embodiments, R 3 Is D, F, cl, br, I, -CN, -NO 2 Cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, piperazinyl, morpholinyl, phenyl, naphthyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, furanyl, thienyl, thiazolyl, oxazolyl, pyridinyl, pyrimidinyl, pyrazinyl, or pyridazinyl; wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyrrolidinyl, tetrahydrofuryl, piperidinyl, piperazinyl, morpholinyl, phenyl, naphthyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, furyl, thienyl, thiazolyl, oxazolyl, pyridinyl, pyrimidinyl, pyrazinyl and pyridazinyl are each independently optionally unsubstituted or substituted with 1 to 2 groups selected from D, F, cl, br, I, -CN, -NO 2 、-OCH 3 、-NHCH 3 、-C(＝O)CH 3 、 -C(＝O)OCH 3 、-C(＝O)NCH 3 or-S (= O) 2 CH 3 Substituted with the substituent(s);
R 4 is D, F, cl, br, I, -NO 2 、-CN、-OH、-NH 2 Methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, vinyl, propenyl, allyl, ethynyl, propargyl, 1-propynyl, cyclopropyl or cyclobutyl;
in some embodiments, the compounds of the present invention comprise a compound of one of the following or a stereoisomer, a nitroxide, a hydrate, a solvate, a metabolite or a pharmaceutically acceptable salt of a compound of one of the following:
Figure BDA0003789418980000031
Figure BDA0003789418980000041
in a second aspect, the use of a compound according to the first aspect of the invention in the manufacture of a medicament for the prevention, treatment or alleviation of a disease or a condition mediated at least in part by a hypoxia-inducible factor.
In some embodiments, the use of a compound of the invention in the preparation of a medicament for the prevention, treatment or amelioration of a condition mediated at least in part by hypoxia-inducible factor
Use in the manufacture of a medicament for the treatment of a mediated disease, said compound further having a structure selected from one of:
Figure BDA0003789418980000051
in a third aspect, the present invention relates to a pharmaceutical composition comprising a compound of the present invention and a pharmaceutically acceptable adjuvant or a combination thereof.
In a fourth aspect, the present invention relates to the use of a compound according to the first aspect, a compound for use in a medicament according to the second aspect, or a pharmaceutical composition according to the third aspect, for the manufacture of a medicament for the prevention, treatment or amelioration of a disease mediated at least in part by hypoxia-inducible factor.
In some embodiments, the use of the invention, wherein the disease is anemia, ischemia, vascular disease, angina, myocardial ischemia, myocardial infarction, metabolic disorder or cancer.
In a fifth aspect, the present invention relates to the use of a pharmaceutical combination for the preparation of a medicament for the prevention, treatment or alleviation of a disease or a disorder mediated at least in part by hypoxia-inducible factors, comprising a compound according to the first aspect or a compound according to the pharmaceutical use of the second aspect or a pharmaceutical composition according to the third aspect and rosxatas.
Description of the terms
Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated by the accompanying structural and chemical formulas. The invention is intended to cover alternatives, modifications and equivalents, which may be included within the scope of the invention as defined by the appended claims. Those skilled in the art will recognize that many methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. The present invention is in no way limited to the methods and materials described herein. In the event that one or more of the incorporated documents, patents, and similar materials differ or contradict this application (including but not limited to defined terminology, application of terminology, described techniques, and the like), this application controls.
"ambient temperature" in the present invention refers to ambient temperature, and the temperature is from about 10 ℃ to about 40 ℃. In some embodiments, "room temperature" refers to a temperature of from about 20 ℃ to about 30 ℃; in other embodiments, "room temperature" refers to a temperature of from about 25 ℃ to about 30 ℃; in still other embodiments, "room temperature" refers to 10 ℃, 15 ℃, 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, etc.
It will be further appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All patents and publications referred to herein are incorporated by reference in their entirety.
The following definitions as used herein should be applied unless otherwise indicated. For the purposes of the present invention, the chemical elements are in accordance with the CAS version of the periodic Table of the elements, and the handbook of chemistry and Physics, 75 th edition, 1994. In addition, general principles of Organic Chemistry can be found in "Organic Chemistry", thomas Sorrell, university Science Books, sausaltito: 1999, and "March's Advanced Organic Chemistry" by Michael B. Smith and Jerry March, john Wiley & Sons, new York:2007, the entire contents of which are incorporated herein by reference.
The articles "a", "an", and "the" as used herein are intended to include "at least one" or "one or more" unless otherwise indicated or clearly contradicted by context. Thus, as used herein, the articles refer to articles of one or more than one (i.e., at least one) object. For example, "a component" refers to one or more components, i.e., there may be more than one component contemplated for use or use in embodiments of the described embodiments.
The term "patient" as used herein refers to humans (including adults and children) or other animals. In some embodiments, "patient" refers to a human.
The term "comprising" is open-ended, i.e. includes the elements indicated in the present invention, but does not exclude other elements.
"stereoisomers" refers to compounds having the same chemical structure but differing in the arrangement of atoms or groups in space. Stereoisomers include enantiomers, diastereomers, conformers (rotamers), geometric isomers (cis/trans), atropisomers, and the like.
"enantiomer" refers to two isomers of a compound that are not overlapping but are in mirror image relationship to each other.
"diastereomer" refers to a stereoisomer having two or more chiral centers and whose molecules are not mirror images of each other. Diastereomers have different physical properties, such as melting points, boiling points, spectral properties, and reactivities. Mixtures of diastereomers may be separated by high resolution analytical procedures such as electrophoresis and chromatography, e.g., HPLC.
The stereochemical definitions and rules used in the present invention generally follow S.P. Parker, ed., mcGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, new York; and Eliel, E.and Wilen, S., "Stereochemistry of Organic Compounds", john Wiley & Sons, inc., new York,1994.
Any asymmetric atom (e.g., carbon, etc.) of a compound disclosed herein can exist in racemic or enantiomerically enriched forms, such as the (R) -, (S) -or (R, S) -configuration. In certain embodiments, each asymmetric atom has at least 50% enantiomeric excess, at least 60% enantiomeric excess, at least 70% enantiomeric excess, at least 80% enantiomeric excess, at least 90% enantiomeric excess, at least 95% enantiomeric excess, or at least 99% enantiomeric excess in the (R) -or (S) -configuration.
Any resulting mixture of stereoisomers may be separated into pure or substantially pure geometric isomers, enantiomers, diastereomers, depending on differences in the physicochemical properties of the components, for example, by chromatography and/or fractional crystallization.
The term "tautomer" or "tautomeric form" refers to structural isomers having different energies that can be converted to each other by a low energy barrier (low energy barrier). If tautomerism is possible (e.g., in solution), then the chemical equilibrium of the tautomer can be reached. For example, proton tautomers (also known as proton transfer tautomers) include interconversions by proton migration, such as keto-enol isomerization and imine-enamine isomerization. Valence tautomers (value tautomers) involve interconversion by recombination of some of the bonding electrons. A specific example of keto-enol tautomerism is the tautomerism of the pentane-2,4-dione and 4-hydroxypent-3-en-2-one tautomers. Another example of tautomerism is phenol-ketone tautomerism. One specific example of phenol-ketone tautomerism is the tautomerism of pyridin-4-ol and pyridin-4 (1H) -one tautomers. Unless otherwise indicated, all tautomeric forms of the compounds of the invention are within the scope of the invention.
The compounds of the invention may be optionally substituted with one or more substituents, as described herein, in compounds of the general formula above, or as specifically exemplified, sub-classes, and classes of compounds encompassed by the invention.
It is understood that the term "optionally substituted" may be used interchangeably with the term "substituted or unsubstituted". In general, the term "substituted" means that one or more hydrogen atoms in a given structure are replaced with a particular substituent. "optionally substituted" means that a given structure or group is unsubstituted or substituted with one or more specific substituents. Unless otherwise indicated, an optional substituent group may be substituted at each substitutable position of the substituted group. When more than one position in a given formula can be substituted with one or more substituents selected from a particular group, the substituents may be substituted at each position, identically or differently. Wherein the substituent may be, but is not limited to, oxo (= O), hydrogen, deuterium, cyano, nitro, halogen, hydroxy, mercapto, amino, alkyl, haloalkyl, alkoxy, haloalkoxy, acyl, acyloxy, sulfonyl, sulfinyl, carboxy, cycloalkyl, cycloalkylalkyl, cycloalkyloxy, heterocyclyl, heterocyclylalkyl, heterocyclyloxy, aryl, arylalkyl, aryloxy, heteroaryl, heteroarylalkyl, heteroaryloxy, and the like.
In addition, unless otherwise expressly indicated, the terms "each independently" and "each independently" are used interchangeably in this disclosure and should be broadly understood to mean that the particular items expressed between the same symbols in different groups do not affect each other, or that the particular items expressed between the same symbols in the same groups do not affect each other. The above should also be broadly interpreted as "independent" in the description.
The terms "optional" or "optionally" mean that the subsequently described event or circumstance may, but need not, occur, i.e., that the description includes instances where said event or circumstance occurs and instances where it does not. For example, "optionally substituted with 1,2, 3, or 4 substituents independently selected from. Further, when the group is substituted with 1 or more of the substituents described above, the substituents are independent of each other, that is, the 1 or more substituents may be different from each other or the same.
In the various parts of this specification, substituents of the disclosed compounds are disclosed in terms of group type or range. It is specifically intended that the invention include each and every independent subcombination of the various members of these groups and ranges. For example, the term "C 1 -C 6 Alkyl "or" C 1-6 Alkyl "means in particular independently disclosed methyl, ethyl, C 3 Alkyl radical, C 4 Alkyl radical, C 5 Alkyl and C 6 An alkyl group; ' C 1-4 Alkyl refers in particular to independently disclosed methyl, ethyl, C 3 Alkyl (i.e. propyl, including n-propyl and isopropyl), C 4 Alkyl (i.e., butyl, including n-butyl, isobutyl, sec-butyl, and tert-butyl).
In each of the sections of the present invention, linking substituents are described. When the structure clearly requires a linking group, the Markush variables listed for that group are understood to be linking groups. For example, if the structure requires a linking group and the markush group definition for the variable recites "alkyl" or "aryl," it is understood that the "alkyl" or "aryl" represents an attached alkylene group or arylene group, respectively.
The term "alkyl" or "alkyl group" as used herein, denotes a saturated, straight or branched chain, monovalent hydrocarbon group containing 1 to 20 carbon atoms, wherein the alkyl group may be optionally substituted with one or more substituents as described herein. In some embodiments, the alkyl group contains 1 to 12 carbon atoms; in other embodiments, the alkyl group contains 1 to 6 carbon atoms; in still other embodiments, the alkyl group contains 1 to 4 carbon atoms; in still other embodiments, the alkyl group contains 1 to 3 carbon atoms.
Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, 2-pentyl, 3-pentyl, 2-methyl-2-butyl, 3-methyl-1-butyl, 2-methyl-1-butyl, n-hexyl, 2-hexyl, 3-hexyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 3-methyl-3-pentyl, 2-methyl-3-pentyl, 2,3-dimethyl-2-butyl, 3,3-dimethyl-2-butyl, n-heptyl, n-octyl, and the like.
In some specific structures, when an alkyl group is expressly indicated as a linking group, then the alkyl group represents a linked alkylene group, e.g., the group "C 3-10 Cycloalkyl radical C 1-6 C in alkyl 1-6 Alkyl is understood to mean C 1-6 An alkylene group.
The term "alkylene" refers to a saturated divalent hydrocarbon radical resulting from the removal of two hydrogen atoms from a saturated straight or branched chain hydrocarbon radical. Unless otherwise specified, the alkylene group contains 1 to 12 carbon atoms. In some embodiments, the alkylene group contains 1 to 6 carbon atoms; in other embodiments, the alkylene group contains from 1 to 4 carbon atoms; in still other embodiments, the alkylene group contains 1 to 3 carbon atoms; in still other embodiments, the alkylene group contains 1 to 2 carbon atoms. Examples of this include methylene (-CH) 2 -), ethylene (including-CH) 2 CH 2 -or-CH (CH) 3 ) -, isopropylidene (including-CH (CH) 3 )CH 2 -or-C (CH) 3 ) 2 -) and the like. Wherein said alkylene may be optionally substituted with one or more substituents as described herein.
The term "alkenyl" denotes a straight or branched chain monovalent hydrocarbon group containing 2 to 12 carbon atoms, whichIn which there is at least one site of unsaturation, i.e. there is one carbon-carbon sp 2 A double bond, wherein the alkenyl group may be optionally substituted with one or more substituents described herein, including the positioning of "cis" and "tan", or the positioning of "E" and "Z". In some embodiments, alkenyl groups contain 2 to 8 carbon atoms; in other embodiments, alkenyl groups contain 2 to 6 carbon atoms; in still other embodiments, alkenyl groups contain 2-4 carbon atoms. Examples of alkenyl groups include, but are not limited to, vinyl (-CH = CH) 2 ) Allyl (-CH) 2 CH＝CH 2 ) And so on.
The term "alkynyl" denotes a straight or branched chain monovalent hydrocarbon radical containing 2 to 12 carbon atoms, wherein there is at least one site of unsaturation, i.e. one carbon-carbon sp triple bond, wherein the alkynyl radical may optionally be substituted with one or more substituents as described herein. In some embodiments, alkynyl groups contain 2-8 carbon atoms; in other embodiments, alkynyl groups contain 2-6 carbon atoms; in still other embodiments, alkynyl groups contain 2-4 carbon atoms. Examples of alkynyl groups include, but are not limited to, ethynyl (-C ≡ CH), propargyl (-CH) 2 C.ident.CH), 1-propynyl (propynyl, -C.ident.C-CH) 3 ) 1-alkynylbutyl (-CH) 2 CH 2 C ≡ CH), 2-alkynylbutyl (-CH) 2 C≡CCH 3 ) 3-alkynylbutyl (-C [ identical to ] CCH 2 CH 3 ) And so on.
The term "alkoxy" means an alkyl group attached to the rest of the molecule through an oxygen atom, wherein the alkyl group has the meaning as described herein. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, 1-propoxy, 2-propoxy, 1-butoxy, and the like.
The term "alkylamino" denotes an amino group independently substituted with one or two alkyl groups, respectively. Wherein, in some embodiments, alkylamino is one or two C 1-6 The alkyl group is attached to a nitrogen atom to form a lower alkylamino group. In other embodiments, the alkylamino group is one or two C 1-4 Alkyl radicalA lower alkylamino group attached to the nitrogen atom. Suitable alkylamino groups can be monoalkylamino or dialkylamino, and examples of alkylamino include, but are not limited to, N-methylamino, N-ethylamino, N-dimethylamino, N-diethylamino, and the like.
The term "haloalkyl" or "haloalkoxy" means an alkyl or alkoxy group substituted with one or more halogen atoms, examples of which include, but are not limited to, trifluoromethyl, trifluoromethoxy, and the like.
The term "haloalkoxy" denotes an alkoxy group substituted with one or more halogen atoms, wherein alkoxy has the meaning described herein; examples include, but are not limited to, difluoromethoxy (-OCHF) 2 ) Trifluoromethoxy (-OCF) 3 ) Difluoroethoxy (-OCH) 2 CHF 2 ) Trifluoro ethoxy (-OCH) 2 CF 3 ) And so on.
The term "hydroxyalkyl" denotes an alkyl group substituted with one or more hydroxyl groups. In some embodiments, a hydroxyalkyl group represents a hydroxyalkyl group containing 1-6 carbon atoms, i.e., C 1-6 A hydroxyalkyl group; in still other embodiments, the hydroxyalkyl group represents a haloalkyl group containing 1 to 4 carbon atoms, i.e., C 1-4 A hydroxyalkyl group; in still other embodiments, the hydroxyalkyl group represents a hydroxyalkyl group containing 1 to 3 carbon atoms, i.e., C 1-3 A hydroxyalkyl group. Examples include, but are not limited to, hydroxymethyl, hydroxyethyl, 1,2-dihydroxyethyl, 1-hydroxypropyl, 2-hydroxy-2 methylpropyl, hydroxybutyl, and the like.
The term "cycloalkyl" denotes a monovalent or polyvalent, saturated or partially unsaturated, monocyclic, bicyclic or tricyclic ring system containing from 3 to 12 ring carbon atoms; wherein the cycloalkyl group is non-aromatic and does not contain any aromatic rings. In some embodiments, cycloalkyl groups contain 3-10 ring carbon atoms, e.g., C 3-10 A cycloalkyl group; in other embodiments, cycloalkyl groups contain 3 to 8 ring carbon atoms, e.g., C 3-8 A cycloalkyl group; in still other embodiments, cycloalkyl groups contain 3 to 6 ring carbon atoms, for exampleSuch as C 3-6 A cycloalkyl group. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like; wherein, said C 3-6 Cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl. The cycloalkyl group may be optionally substituted with one or more substituents described herein.
"j-k ring atoms" or "j-k member" means that the cyclic group consists of j-k ring atoms including carbon atoms and/or heteroatoms such as O, N, S, P. J and k are each independently any non-zero natural number, and k is greater than j; the term "j-k" includes j, k and any natural number therebetween. For example, "3-8 atoms or 3-8 members", "3-6 atoms or 3-6 members", "5-10 atoms or 5-10 members" or "5-6 atoms or 5-6 members" means that the cyclic group consists of 3-8, 3-6, 5-10 or 5-6 ring atoms, including carbon atoms and/or heteroatoms such as O, N, S, P. Specifically, for example, "heteroaryl group consisting of 5 to 10 ring atoms" or "5-to 10-membered heteroaryl group" represents a heteroaryl group consisting of 5, 6, 7, 8, 9 or 10 ring atoms, wherein 5, 6, 7, 8, 9 or 10 represents the number of ring atoms, such as pyridyl is a heteroaryl group consisting of 6 ring atoms or a 6-membered heteroaryl group.
The term "heterocyclyl" refers to a saturated or partially unsaturated monocyclic, bicyclic, or tricyclic ring system containing 3 to 12 ring atoms, wherein at least one ring atom is selected from the group consisting of nitrogen, sulfur, and oxygen atoms; wherein the heterocyclic group is non-aromatic and does not contain any aromatic ring. Unless otherwise specified, heterocyclyl may be carbon-or nitrogen-based, and-CH 2 The-group may optionally be replaced by-C (= O) -. The sulfur atom of the ring may optionally be oxidized to the S-oxide. The nitrogen atom of the ring may optionally be oxidized to the N-oxide. The heterocyclyl group may be optionally substituted with one or more substituents as described herein.
In some embodiments, heterocyclyl is C 2-9 Heterocyclyl, meaning that the heterocyclyl contains 2 to 9A ring carbon atom and at least one ring heteroatom selected from O, S and N; in other embodiments, heterocyclyl is C 2-7 Heterocyclyl, meaning that heterocyclyl contains 2 to 7 ring carbon atoms and at least one ring heteroatom selected from O, S and N; in other embodiments, heterocyclyl is C 2-5 Heterocyclyl, meaning heterocyclyl contains 2 to 5 ring carbon atoms and at least one ring heteroatom selected from O, S and N. Examples of heterocyclyl groups include, but are not limited to: oxiranyl, thietanyl, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, oxazolidinyl, tetrahydrofuranyl, dihydrothienyl, dihydropyranyl, piperidinyl, morpholinyl, tetrahydropyrimidinyl, oxazinidinyl, thiomorpholinyl, piperazinyl, and the like. In heterocyclic radicals of-CH 2 Examples of the substitution of the-group by-C (= O) -include, but are not limited to, 2-oxopyrrolidinyl, 2-piperidinonyl, 3-morpholinonyl, 3-thiomorpholinonyl, oxotetrahydropyrimidinyl and the like.
The term "halogen" refers to fluorine (F), chlorine (Cl), bromine (Br) or iodine (I).
The term "aryl" denotes a monocyclic, bicyclic and tricyclic carbocyclic ring system containing 6 to 14 ring atoms, or 6 to 12 ring atoms, or 6 to 10 ring atoms, wherein at least one ring is aromatic and has one or more attachment points to the rest of the molecule. The term "aryl" may be used interchangeably with the term "aromatic ring". Examples of aryl groups may include phenyl, 2,3-dihydro-1H-indenyl, naphthyl, and anthracenyl. The aryl group may be optionally substituted with one or more substituents described herein. Unless otherwise stated, the group "C 6-14 Aryl "represents an aryl group containing from 6 to 14 ring carbon atoms.
The term "heteroaryl" denotes monocyclic, bicyclic and tricyclic ring systems containing 5 to 12 ring atoms, or 5 to 10 ring atoms, or 5 to 6 ring atoms, wherein at least one ring is aromatic and at least one ring contains one or more ring heteroatoms selected from nitrogen, oxygen, sulfur, and wherein the heteroaryl has one or more attachment points to the rest of the molecule. when-CH is present in the heteroaryl group 2 When it is a group, -CH 2 -radicalThe cluster may optionally be replaced by-C (= O) -. Unless otherwise indicated, the heteroaryl group may be attached to the rest of the molecule (e.g., the main structure in the general formula) via any reasonable site (which may be C in CH, or N in NH). The term "heteroaryl" may be used interchangeably with the terms "heteroaromatic ring" or "heteroaromatic compound". In some embodiments, heteroaryl is C 1-9 Heteroaryl, meaning that heteroaryl contains 1 to 9 ring carbon atoms and at least one ring heteroatom selected from O, S and N; in other embodiments, heteroaryl is C 1-7 Heteroaryl, meaning that heteroaryl contains 1 to 7 ring carbon atoms and at least one ring heteroatom selected from O, s and N; in other embodiments, heteroaryl is C 1-6 Heteroaryl, meaning that heteroaryl contains 1 to 6 ring carbon atoms and at least one ring heteroatom selected from O, s and N; in other embodiments, heteroaryl is C 1-5 Heteroaryl, meaning that heteroaryl contains 1 to 5 ring carbon atoms and at least one ring heteroatom selected from O, S and N; in other embodiments, heteroaryl is C 1-4 Heteroaryl, meaning that heteroaryl contains 1 to 4 ring carbon atoms and at least one ring heteroatom selected from O, s and N; in other embodiments, heteroaryl is C 1-3 Heteroaryl, meaning that heteroaryl contains 1-3 ring carbon atoms and at least one ring heteroatom selected from O, s and N. Examples include, but are not limited to, furyl, imidazolyl, isoxazolyl, oxazolyl, pyrrolyl, pyrazolyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazinyl, thienyl, thiazolyl, and the like; the following bicyclic rings are also included, but are in no way limited to these: benzimidazolyl, benzofuranyl, benzothienyl, indolyl, oxoindolyl, indolinyl, imidazopyridinyl, pyrazolopyridinyl, pyrazolopyrimidinyl, quinolinyl, isoquinolinyl, quinazolinyl and the like. The heteroaryl group may be optionally substituted with one or more substituents as described herein.
The group "- (CR) as described in the present invention a R b ) p The N-has two attachment sites for attachment to the rest of the molecule, and the attachment of the two attachment sites can be interchanged. For example, the present inventionWhen L is a group of formula b, L is- (CR) a R b ) p -N-) may be attached to the rest of the molecule via the E-terminus or the E' -terminus.
Figure BDA0003789418980000101
The term "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastrointestinal distress, dizziness and the like, when administered to a human. Preferably, the term "pharmaceutically acceptable" as used herein refers to those approved by the federal regulatory agency or the state government or listed in the U.S. pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
The term "carrier" refers to a diluent, adjuvant, excipient, or matrix with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Aqueous saline solutions and aqueous dextrose and glycerol solutions are preferably used as carriers, particularly injectable solutions. Suitable Pharmaceutical carriers are described in e.w. martin, "Remington's Pharmaceutical Sciences".
"metabolite" refers to the product of a particular compound or salt thereof that is metabolized in vivo. Metabolites of a compound can be identified by techniques well known in the art, and its activity can be characterized by assay methods as described herein. Such products may be obtained by administering the compound by oxidation, reduction, hydrolysis, amidation, deamidation, esterification, defatting, enzymatic cleavage, and the like. Accordingly, the present invention includes metabolites of compounds, including metabolites produced by contacting a compound of the present invention with a mammal for a sufficient period of time.
As used herein, "pharmaceutically acceptable salts" refers to organic salts and the absence of a compound of the inventionAnd (4) organic salt. Pharmaceutically acceptable salts are well known in the art, as are: berge et al, description Pharmaceutical acceptable salts in detail in j. Pharmaceutical Sciences,1977, 66:1-19. Pharmaceutically acceptable non-toxic acid forming salts include, but are not limited to, inorganic acid salts such as hydrochloride, hydrobromide, phosphate, sulfate, perchlorate; organic acid salts such as acetate, oxalate, maleate, tartrate, citrate, succinate, malonate; or by other methods described in the literature, such as ion exchange. Other pharmaceutically acceptable salts include adipates, alginates, ascorbates, aspartates, benzenesulfonates, benzoates, bisulfates, borates, butyrates, camphorates, camphorsulfonates, cyclopentylpropionates, digluconates, dodecylsulfates, ethanesulfonates, formates, fumarates, glucoheptonates, glycerophosphates, gluconates, hemisulfates, heptanoates, hexanoates, hydroiodides, 2-hydroxy-ethanesulfonates, lactobionates, lactates, laurates, malates, methanesulfonates, 2-naphthalenesulfonates, nicotinates, nitrates, oleates, palmitates, pamoates, pectinates, persulfates, 3-phenylpropionates, picrates, pivalates, propionates, stearates, thiocyanates, p-toluenesulfonates, undecanoates, valeric acid salts, and the like. Salts obtained by reaction with a suitable base include alkali metals, alkaline earth metals, ammonium and N + (C 1-4 Alkyl radical) 4 A salt. The present invention also contemplates quaternary ammonium salts formed from any compound containing a group of N. Water-soluble or oil-soluble or dispersion products can be obtained by quaternization. Alkali or alkaline earth metals that can form salts include sodium, lithium, potassium, calcium, magnesium, and the like. Pharmaceutically acceptable salts further include suitable, non-toxic ammonium, quaternary ammonium salts and amine cations resistant to formation of counterions, such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C 1-8 Sulfonates and aromatic sulfonates.
"solvate" of the present invention refers to an association of one or more solvent molecules with a compound of the present invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, and aminoethanol. The term "hydrate" refers to an association of solvent molecules that is water.
"nitroxide" in the context of the present invention means that when a compound contains several amine functional groups, 1 or more than 1 nitrogen atom can be oxidized to form an N-oxide. Specific examples of N-oxides are N-oxides of tertiary amines or N-oxides of nitrogen-containing heterocyclic nitrogen atoms. The corresponding amines can be treated with an oxidizing agent such as hydrogen peroxide or a peracid (e.g., peroxycarboxylic acid) to form the N-oxide (see Advanced Organic Chemistry, wiley Interscience, 4 th edition, jerry March, pages). In particular, N-oxides may be prepared by the method of l.w. ready (syn.comm.1977, 7, 509-514) in which an amine compound is reacted with m-chloroperoxybenzoic acid (MCPBA), for example, in an inert solvent such as dichloromethane.
The term "treating" or "treatment" as used herein refers, in some embodiments, to ameliorating a disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one clinical symptom thereof). In other embodiments, "treating" or "treatment" refers to moderating or improving at least one physical parameter, including physical parameters that may not be perceived by the patient. In other embodiments, "treating" or "treatment" refers to modulating the disease or disorder, either physically (e.g., stabilizing a perceptible symptom) or physiologically (e.g., stabilizing a parameter of the body), or both. In other embodiments, "treating" or "treatment" refers to preventing or delaying the onset, occurrence, or worsening of a disease or disorder.
"hypoxia-inducible factor-associated disease" refers to any condition associated with subnormal, abnormal, or inappropriate regulation of hypoxia-inducible factor (HIF). HIF-associated disorders include any disorder in which elevated HIF levels would provide a beneficial therapeutic effect. HIF-associated conditions include, but are not limited to, cancer, heart disease, stroke, peripheral vascular disease, ulcers, burns, chronic wounds, chronic ischemia, pulmonary embolism, ischemia-reperfusion injury, inflammation, anemia, and the like.
By "Erythropoietin (EPO) -related disease" is meant any He Bingzheng that is associated with less than normal, abnormal or inappropriate regulation of endogenous erythropoietin. EPO-related disorders include any disorder in which increased EPO levels will provide therapeutic benefit. EPO-related diseases include, but are not limited to, anemia (including anemia associated with diabetes, ulcers, renal failure, cancer, infection, dialysis, surgery, and chemotherapy), ischemic and hypoxic conditions (e.g., arterial occlusive disease, angina, intestinal infarction, pulmonary infarction, cerebral ischemia, and myocardial infarction, among others).
HIF-related and/or EPO-related disorders include, but are not limited to, anemia, ischemia, vascular disease, angina, myocardial ischemia, myocardial infarction, metabolic disorders, cancer, and the like.
"anemia" refers to any abnormality or deficiency in hemoglobin or red blood cells that results in a decrease in the oxygen content of the blood. Anemia may be associated with abnormal production, processing or performance of red blood cells and/or hemoglobin. The term anemia refers to any reduction in the number of red blood cells and/or the hemoglobin content of the blood relative to normal blood content. Anemia can result from a variety of conditions, such as acute or chronic kidney disease, infection, inflammation, cancer, radiation, toxins, diabetes, and surgery. The infection may be caused by, for example, viruses, bacteria, and/or parasites. Inflammation may be caused by infection or autoimmune disorders such as rheumatoid arthritis and the like. Anemia may also be associated with blood loss caused by, for example, gastric ulcers, duodenal ulcers, hemorrhoids, gastric or large bowel cancers, trauma, injury, surgical procedures, and the like. Anemia may also develop in association with radiation therapy, chemotherapy and renal dialysis. Anemia is also associated with HIV-infected patients who receive treatment with zidovudine or other reverse transcriptase inhibitors, and can develop in cancer patients who receive chemotherapy (e.g., chemotherapy with or without cyclic cisplatin). Aplastic anemia and myelodysplastic syndromes are diseases associated with bone marrow failure that result in a reduction in the production of red blood cells. Furthermore, anemia may be caused by hemoglobin or red blood cell defects or abnormalities, including, for example, disorders such as microcytic anemia, hypopigmented anemia, and the like. Anemia can be caused by disorders in iron transport, processing and utilization, such as sideroblastic anemia (sideroblastic anemia), and the like.
Any formulae given herein are also intended to represent the non-isotopically enriched forms as well as the isotopically enriched forms of these compounds. The isotopically enriched compounds have the structure depicted by the general formula given herein, except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Exemplary isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine and chlorine, such as 2 H， 3 H， 11 C， 13 C， 14 C， 15 N， 17 O， 18 O， 18 F， 32 P， 35 S， 36 C1 and 125 I。
in another aspect, the compounds of the invention include isotopically enriched compounds as defined herein, e.g. wherein a radioactive isotope is present, e.g. as 3 H， 14 C and 18 those compounds of F, or in which a non-radioactive isotope is present, e.g. 2 H and 13 C. the isotopically enriched compounds can be used for metabolic studies (use) 14 C) Reaction kinetics study (using, for example 2 H or 3 H) Detection or imaging techniques such as positive electron emission tomography (PET) or Single Photon Emission Computed Tomography (SPECT) including drug or substrate tissue distribution determination, or may be used in radiotherapy of patients. 18 F-enriched compounds are particularly desirable for PET or SPECT studies. Isotopically enriched compounds of formula (I) can be prepared by conventional techniques known to those skilled in the art or by the use of suitable isotopically labelled reagents in place of the original used unlabelled reagents described in the examples and preparations of the present invention.
In addition, heavier isotopes are particularly preferred for deuterium (i.e., 2 substitution of H or D) may provide certain therapeutic advantages resulting from greater metabolic stability. For example, bodiesIncreased internal half-life or reduced dosage requirements or improved therapeutic index. It is to be understood that deuterium in the present invention is to be considered as a substituent of the compound of formula (I) or formula (II). The concentration of such heavier isotopes, particularly deuterium, can be defined by isotopic enrichment factors. The term "isotopic enrichment factor" as used herein refers to the ratio between the isotopic abundance and the natural abundance of a given isotope. If a substituent of a compound of the invention is designated as deuterium, the compound has an isotopic enrichment factor for each designated deuterium atom of at least 3500 (52.5% deuterium incorporation at each designated deuterium atom), at least 4000 (60% deuterium incorporation), at least 4500 (67.5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 5500 (82.5% deuterium incorporation), at least 6000 (90% deuterium incorporation), at least 6333.3 (95% deuterium incorporation), at least 6466.7 (97% deuterium incorporation), at least 6600 (99% deuterium incorporation), or at least 6633.3 (99.5% deuterium incorporation). Pharmaceutically acceptable solvates of the invention include those in which the crystallization solvent may be isotopically substituted, e.g. D 2 O, acetone-d 6 、DMSO-d 6 Those solvates of (a).
Unless otherwise indicated, all tautomeric forms of the compounds of the invention are included within the scope of the invention. Additionally, unless otherwise indicated, the structural formulae for the compounds described herein include isotopically enriched versions of one or more different atoms.
Abbreviations for any protecting groups, amino acids and other compounds used in the present invention are based on their commonly used, accepted abbreviations unless otherwise indicated, or refer to IUPAC-IUBCommission on Biochemical Nomenclature (see biochem.1972, 11: 942-944).
Drawings
FIG. 1 is a graph showing the binding activity of HIF-2. Alpha./ARNT in example 1, in examples 1,2, 3, 4, 9, 10, 11, 12, 13, 19, 20, 35, and 36, measured at a concentration of 100. Mu.M in the TR-FRET assay.
FIG. 2 is a graph showing the determination of the binding activity EC of Compound 1 and Compound 20 to HIF-2 α/ARNT in the TR-FRET assay in example 1 50 And EC max 。
FIG. 3 is a graph showing the activity of Compound 1 and Compound 20 on HIF-2. Alpha. Downstream target genes measured in real-time fluorescence quantification assay in example 2.
FIG. 4 is a microscope image of the zebrafish anemia assay of example 3, which determined the effect of compound 1 and compound 20 on cardiac erythropoiesis in anemic zebrafish.
Fig. 5 is a graph of the relative cardiac red blood cell counts of compound 1 and compound 20 on anemic zebrafish from the zebrafish anemia experiment of example 3.
DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION
In order to make the technical solutions of the present invention better understood by those skilled in the art, some non-limiting examples are further disclosed below to further explain the present invention in detail.
The reagents used in the invention are either commercially available or can be prepared by the methods described herein.
Examples 1,2, 3, 4, 9, 10, 11, 12, 13, 19, 20, 35, 36 were purchased from Shanghai Tao Shu Biotech, inc. The ID names are respectively: z16315055, Z351862592, Z23856832, Z17970608, Z19222925, Z13783822, Z16341869, Z272067206, Z285552256, Z16315222, Z351862592, Z25567815, Z16315121.
Example 1: TR-FRET assay
1. The test method comprises the following steps:
a) 100X concentration stock solutions (compound concentration 10 mM) of each compound were diluted to 4X using buffer;
b) Add 4. Mu.L of the diluted compound solution to each well of the 384-well plate;
c) Adding 4 mu L of 4X ARNT working solution into each well of a 384-well plate respectively;
d) 4 mu L of 4X HIF2 alpha working solution is added into each hole of a 384-hole plate respectively;
e) Sealing the plate and standing at room temperature for half an hour;
f) Preparing 4X detection solution (MAb Anti FLAG-Eu and streptavidin-d 2) by using 1X detection solution;
g) Adding 4 μ L of 4X detection solution (MAb Anti FLAG-Eu and streptavidin-d 2) into each well of 384-well plate;
h) After overnight incubation and detection of the 665nm/615nm fluorescence ratio, ec was carried out max And IC 50 And (4) calculating.
i) The HIF-2 alpha antagonist PT2385 and agonist M1001 were used as references in this experiment.
Inhibition/activation calculation formula:
Figure BDA0003789418980000131
RR positive : average RR value for positive control (RR value for 10. Mu.M PT 2385).
RR vehicle : average RR value of negative control (RR value of no drug group).
Figure BDA0003789418980000132
2. And (3) testing results:
at a compound concentration of 100 μ M, the results are shown in FIG. 1: compounds 1,2, 3, 4, 9, 10, 11, 12, 13, 19, 20, 35, 36 exhibit some activity that upregulates HIF-2a/ARNT binding, wherein compounds 1, 10, 11, 12, 19, and 20 significantly upregulate HIF-2 α/ARNT binding.
The results of the concentration gradient test are shown in FIG. 2: compound 1 shows agonistic binding of HIF-2a/ARNT, EC, in TR-FRET assay 50 Is 910nM, EC max 283 percent. Compound 20 EC for enhancing HIF-2a/ARNT interaction at protein level 50 Is 560nM max The content was 776%.
As can be seen from the experimental results, the compounds of the present invention have excellent HIF-2 α/ARNT activation activity, and can be used as effective HIF-2a agonists.
Example 2: real-time fluorescence quantitative experiment
1. The test method comprises the following steps:
renal cancer cells 786-O were seeded in 6-well plates. After 24h, compound was added and cells were incubated with compound for 24h. TRIZOL reagent was used for RNA extraction. cDNA transcription Using All-in-one First-Strand cDNA Synthesis Kit (see the detailed procedures in the description). Signal calibration was performed using SYBR reagent, GAPDH as an internal control. The qRT-PCR primers were: GAPDH _ fwd, GCACCGTCAAGGCTGAGAAC; GAPDH _ rev, TGGTGAAGACGCCAGTGGA; HIF-2 α _ fwd, CGGAGGTGTTCTATGAGCTGG; HIF-2 α _ rev, AGCTTGTGTGTTCGCAGGAA EPO _ fwd, AACAATCACTGCTGACACTT; EPO _ rev, AGAGTTGCTCTCTGGACAGT; SERPINE1_ fwd, ACCGCAACGTGGTTTTCTCA; SERPINE1_ rev, TTGAATCCCATAGCTGCTTGAAT; VEGF _ fwd, AGGGCAGAATCATCACGAAGT; VEGF _ rev, AGGGTCTCGATTGGATGGCA; CCND1_ fwd, CAATGACCCCGCACGATTTC; CCND1_ rev, CATGGAGGGCGGATTGGAA; GLUT1_ fwd, GGCCAAGAGTGTGCTAAAGAA; GLUT1_ rev, ACAGCGTTGATGCCAGACAG; NDRG1_ fwd, CTCCTGCAAGAGTTTGATGTCC; NDRG1_ rev, TCATGCCGATGTCATGGTAGG; PGK1_ fwd, TTAAAGGGAAGCGGGTCGTTA; PGK1_ rev, TCCATTGTCCAAGCAGAATTTGA.
3. And (3) testing results:
the detection results are shown in fig. 3: compounds 1 and 20 are effective in activating the HIF-2 alpha downstream target genes erythropoietin gene (EPO) gene, hypoxia inducible factor gene (HIF-2 alpha), vascular endothelial growth factor gene (VEGF), cyclin D1 gene (CCND 1), thrombopoietin serine 1 gene (SERPINE 1), glucose transporter 1 gene (GLUT 1), and N-myc downstream regulatory gene 1 (NDRG 1). But had no effect on the phosphoglycerate kinase gene of the target gene downstream of HIF-1 alpha (PGK 1).
Example 3: zebra fish anemia test
1. Sample preparation information
Compound 1, prepared as a 20.0mM stock solution in DMSO, was stored at-20 ℃.
Compound 20, prepared as a 25.0mM stock solution in DMSO, was stored at-20 ℃.
Positive control: luo Shasi ta, a pale yellow powder, was provided by Hangzhou's Aomu pharmaceutical Co., ltd, and was stored in the shade and in the dark. 200mg/mL of mother liquor was prepared in DMSO, diluted as required and stored at-20 ℃.
2. Laboratory animal
The zebra fish are all raised in water for fish culture at 28 ℃ (water quality: 200mg of instant sea salt is added into per 1L of reverse osmosis water, the conductivity is 450-550 mu S/em, the pH is 6.5-8.5, the hardness is 50-100 mg/L CaCO 3), the zebra fish are bred and provided by the fish culture center of the company, and the license numbers for experimental animals are as follows: SYXK (Zhe) 2022-0004. The feeding management meets the requirements of international AAALAC certification (certification number: 001458).
Wild type AB strain zebrafish, in a natural mated mating breeding mode. Zebrafish aged 2 days after fertilization (2 dpf) were used for sample evaluation of efficacy in improving renal anemia in combination with rosxastat.
3. Instruments, consumables and reagents
Dissecting microscopy (SZX 7, OLYMPUS, japan); a CCD camera (VertA 1, shanghai, geosenson vision science and technology ltd, china); precision electronic balances (CP 214, OHAUS, USA); 6-well plates (Nest Biotech, china).
Dimethyl sulfoxide (DMSO, lot No. BCCD8942, sigma, switzerland); aristolochic acid (batch number WXBD0062V, sigma, USA); o-dianisidine (batch No. MKBX3619V, sigma, USA).
4. Detection method
2dpf of wild-type AB strain zebra fish was randomly selected in a 6-well plate, and 30 zebra fish were treated per well (experimental group). A normal zebra fish group (vehicle group), a model control group (Anemia model group), a positive control group (1. Mu.M and 10. Mu.M roxidustat (abbreviated as R)), 2 dose groups of Compound 1 (1. Mu.M and 10. Mu.M), a combination of roxidustat and Compound 1 (1. Mu.M roxidustat + 1. Mu.M Compound 1,1. Mu.M roxidustat + 10. Mu.M Compound 1), 2 dose groups of Compound 20 (1. Mu.M and 10. Mu.M), a combination of roxidustat and Compound 20 (1. Mu.M roxidustat + 1. Mu.M Compound 20,1. Mu.M roxidustat + 10. Mu.M Compound 20) were set, respectively. Except for a normal control group, all the other experimental groups are dissolved in water and are given aristolochic acid to establish a zebra fish renal anemia model. The various compounds were water soluble with a capacity of 3 mL per well. After treatment at 28 ℃ for 48h, the test pieces were stained with o-dianisidine, and after the staining was completed, 10 zebra fish were randomly selected from each experimental group and photographed under an anatomical microscope, as shown in fig. 4. Collecting data with NIS-Elements D3.20 advanced image processing software, analyzing zebra fish heart erythrocyte staining intensity, and using the statistical significance of the indexThe efficacy of the sample in combination with rosxastat in improving renal anemia was evaluated. Statistical analysis was performed using the SPSS software, P < 0.05, P < 0.01, P < 0.001 showing significant differences compared to the model group, # P＜0.05， ## P＜0.01， ### p < 0.001 showed significant differences compared to 1 μ M Luo Shasi in the other groups administered, and the results are shown in FIG. 5.
5. The result of the detection
From the experimental results, under the present experimental conditions, (1) Luo Shasi, both 1.0 and 10.0 μ M alone can improve renal anemia; (2) Compound 1 alone can ameliorate renal anemia; (3) Compound 20 can ameliorate renal anemia both at 1.00 and 10.0 μ M when used alone; (4) The combination group of the roxasistat and the compound 1 has better effect than the single group of the roxasistat; (5) Luo Shasi his + compound 20 combination group is more efficacious than the Rosemastat alone group; (6) Overall, the activity was superior to that of rosxastat at the same concentration using 1.0 and 10.0. Mu.M of Compound 20 alone.
In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.
Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

Claims (10)

1. A compound which is a compound represented by formula (I) or a stereoisomer, a nitrogen oxide, a hydrate, a solvate, a metabolite or a pharmaceutically acceptable salt of the compound represented by formula (I),
Figure FDA0003789418970000011
wherein the content of the first and second substances,
X 1 selected from CH, CH 2 C (= O), N, NH, O or S;
Y 2 selected from CH, CH 2 NH, N, O or S;
Figure FDA0003789418970000012
is a single bond or a double bond;
R 1 and R 2 Each independently H, D, halogen, C 3-8 Cycloalkyl or heterocyclyl consisting of 3 to 8 atoms, wherein said C is 3-8 Cycloalkyl and heterocyclyl consisting of 3 to 8 atoms are each independently optionally unsubstituted or substituted by 1 to 2 substituents selected from D, halogen, -CN, -NO 2 、-OH、-NH 2 、C 1-3 Alkyl radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl or C 3-8 Cycloalkyl, substituted with a substituent;
or R 1 、R 2 And together with the atoms to which they are attached form C 5-7 Cycloalkyl, heterocyclic radical consisting of 5-8 atoms, C 6-8 Aryl or heteroaryl of 5 to 8 atoms, wherein said C 5-7 Cycloalkyl, heterocyclic radical consisting of 5-8 atoms, C 6-8 Aryl and 5-8-membered heteroaryl are each independently optionally unsubstituted or substituted by 1-2 substituents selected from D, halogen, -NO 2 、-CN、-OH、-NH 2 、-C(＝O)OCH 3 、-C(＝O)NH 2 、C 1-3 Alkyl or C 1-3 Substituted by a substituent of alkoxy;
l is- (CR) a R b ) p -、-(CR a R b ) p -O-、-(CR a R b ) p -NH-、-(CR a R b ) p -S-、-(CR a R b ) p -S (= O) -or- (CR) a R b ) p -s(＝O) 2 -；
Each R a And R b Independently H, D, C 1-3 Alkyl radical, C 2-4 Alkenyl or C 2-4 An alkynyl group;
p is 0,1, 2 or 3;
a is selected from:
Figure FDA0003789418970000013
R 3 is H, D, halogen, CN, NO 2 、C 3-8 Cycloalkyl, heterocyclic group consisting of 4 to 12 atoms, C 5-10 Aryl or heteroaryl of 5 to 12 atoms, wherein said C 3-8 Cycloalkyl, heterocyclic group consisting of 4 to 12 atoms, C 5-10 Aryl and heteroaryl of 5 to 12 atoms are each independently optionally unsubstituted or substituted by 1 to 2 substituents selected from D, halogen, -CN, -NO 2 、-OCH 3 、-NR x R y 、-C(＝O)R x 、-C(＝O)OR x 、-C(＝O)NR x R y 、-S(＝O) 2 R x 、C 1-6 Alkyl or C 1-6 Substituted with a substituent of haloalkyl;
each R x And R y Independently H, D, C 1-3 Alkyl radical, C 2-4 Alkenyl or C 2-4 An alkynyl group;
R 4 is H, D, H 2 、C 1-3 Alkyl radical, C 2-6 Alkenyl radical, C 2-6 Alkynyl or C 3-8 A cycloalkyl group.
2. The compound of claim 1, wherein R 1 And R 2 Each independently is H, D, F, cl, br, I, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyridinePyrrolidinyl, tetrahydrofuranyl, piperidinyl, piperazinyl, or morpholinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, piperazinyl, and morpholinyl are each independently optionally unsubstituted or substituted with 1-2 substituents selected from D, halo, -CN, -NO 2 、-OH、-NH 2 Methyl, ethyl, n-propyl, isopropyl, ethenyl or ethynyl;
or R 1 、R 2 And together with the atoms to which they are attached form C 5-7 Cycloalkyl, heterocyclic radical consisting of 5-8 atoms, C 6-8 Aryl or heteroaryl of 5 to 8 atoms, wherein said C 5-7 Cycloalkyl, heterocyclic radical consisting of 5-8 atoms, C 6-8 Aryl and 5-8-membered heteroaryl are each independently optionally unsubstituted or substituted by 1-2 substituents selected from D, F, cl, br, I, -NO 2 、-CN、-OH、-NH 2 、-C(＝O)OCH 3 、-C(＝O)NH 2 Methyl, ethyl, n-propyl, isopropyl, -CHF 2 、-CF 3 、-CH 2 CF 3 Methoxy, ethoxy, 1-propoxy or 2-propoxy.
3. The compound of claim 1, wherein R 3 Is D, F, cl, br, I, -CN, -NO 2 Cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, pyrrolidinyl, tetrahydrofuryl, piperidinyl, piperazinyl, morpholinyl, phenyl, naphthyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, furanyl, thienyl, thiazolyl, oxazolyl, pyridinyl, pyrimidinyl, pyrazinyl, or pyridazinyl, wherein said methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, tetrahydrofuryl, piperidinyl, piperazinyl, morpholinyl, phenyl, naphthyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, furanyl, piperidinyl, piperazinyl, morpholinyl, naphthyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, furanyl, pyridyl, pyrimidinyl, pyrazinyl, or pyridazinylEach of the group, thienyl, thiazolyl, oxazolyl, pyridyl, pyrimidinyl, pyrazinyl and pyridazinyl groups is independently optionally unsubstituted or 1-2 selected from D, F, cl, br, I, -CN, -NO 2 、-OCH 3 、-NHCH 3 、-C(＝O)CH 3 、-C(＝O)OCH 3 、-C(＝O)NCH 3 or-S (= O) 2 CH 3 Substituted with the substituent(s);
R 4 is D, F, cl, br, I, -NO 2 、-CN、-OH、-NH 2 Methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, vinyl, propenyl, allyl, ethynyl, propargyl, 1-propynyl, cyclopropyl or cyclobutyl.
4. A compound comprising a compound of one of the following or a stereoisomer, nitroxide, hydrate, solvate, metabolite or pharmaceutically acceptable salt of a compound of one of the following:
Figure FDA0003789418970000021
Figure FDA0003789418970000031
Figure FDA0003789418970000041
5. a pharmaceutical composition comprising a compound according to any one of claims 1 to 4 or a compound having one of the following structures:
Figure FDA0003789418970000042
6. the pharmaceutical composition of claim 5, further comprising a pharmaceutically acceptable adjuvant or a combination thereof.
7. Use of a compound according to any one of claims 1 to 4 or a pharmaceutical composition according to claims 5 to 6 for the manufacture of a medicament for the prevention, treatment or alleviation of a disease or a condition mediated at least in part by hypoxia-inducible factor.
8. The use according to claim 7, wherein the disease is anemia, ischemia, vascular disease, angina, myocardial ischemia, myocardial infarction, metabolic disorder or cancer.
9. Use of a compound for the manufacture of a medicament for the prevention, treatment or alleviation of a disease or a condition mediated at least in part by a hypoxia-inducible factor, the compound having a structure selected from one of:
Figure FDA0003789418970000051
10. use of a compound according to any one of claims 1 to 4 or a pharmaceutical composition according to claims 5 to 6 in combination with Luo Shasi in the manufacture of a medicament for the prevention, treatment or alleviation of a disease mediated at least in part by hypoxia-inducible factor.
CN202210954630.7A 2022-08-09 2022-08-09 Heterocyclic derivatives as HIF-2 alpha agonists Active CN115232147B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210954630.7A CN115232147B (en) 2022-08-09 2022-08-09 Heterocyclic derivatives as HIF-2 alpha agonists

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210954630.7A CN115232147B (en) 2022-08-09 2022-08-09 Heterocyclic derivatives as HIF-2 alpha agonists

Publications (2)

Publication Number Publication Date
CN115232147A true CN115232147A (en) 2022-10-25
CN115232147B CN115232147B (en) 2023-10-13

Family

ID=83678567

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210954630.7A Active CN115232147B (en) 2022-08-09 2022-08-09 Heterocyclic derivatives as HIF-2 alpha agonists

Country Status (1)

Country Link
CN (1) CN115232147B (en)

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100330199A1 (en) * 2008-01-11 2010-12-30 Fibrogen, Inc. Isothiazole-pyridine derivates as modulators of hif (hypoxia inducible factor) activity
US20110076278A1 (en) * 2005-08-02 2011-03-31 Mehran Khodadoust Modulators of Hypoxia Inducible Factor-1 and Related Uses for the Treatment of Ocular Disorders
CN103946226A (en) * 2011-07-19 2014-07-23 无限药品股份有限公司 Heterocyclic compounds and uses thereof
WO2018233527A1 (en) * 2017-06-19 2018-12-27 上海和誉生物医药科技有限公司 Nitrogen heteroaryl derivative having csf1r inhibitory activity, and preparation method therefor and application thereof
CN110876806A (en) * 2019-10-23 2020-03-13 北京大学 Use of HIF2 α agonist, ACER2 agonist for the manufacture of a medicament for the treatment of atherosclerosis
CN112105609A (en) * 2018-03-22 2020-12-18 奥瑞基尼探索技术有限公司 Substituted imidazolidin-2-one derivatives as PRMT5 inhibitors
WO2021115375A1 (en) * 2019-12-11 2021-06-17 四川海思科制药有限公司 Nitrogen-containing heterocyclic autotaxin inhibitor, and composition containing same and use thereof
CN113264900A (en) * 2021-06-07 2021-08-17 南京中医药大学 Preparation method and medical application of benzisothiazole and benzothiophene
US20220274914A1 (en) * 2019-07-22 2022-09-01 Nikang Therapeutics, Inc. Tricyclic derivatives as hypoxia inducible factor-2(alpha) inhibitors
WO2023046117A1 (en) * 2021-09-23 2023-03-30 3H Pharmaceuticals Co., Ltd. Fgfr inhibitors and methods of use thereof
US20230226074A1 (en) * 2020-04-28 2023-07-20 Global Blood Therapeutics, Inc. Methods of use for pyrimidines as ferroportin inhibitors

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110076278A1 (en) * 2005-08-02 2011-03-31 Mehran Khodadoust Modulators of Hypoxia Inducible Factor-1 and Related Uses for the Treatment of Ocular Disorders
US20100330199A1 (en) * 2008-01-11 2010-12-30 Fibrogen, Inc. Isothiazole-pyridine derivates as modulators of hif (hypoxia inducible factor) activity
CN103946226A (en) * 2011-07-19 2014-07-23 无限药品股份有限公司 Heterocyclic compounds and uses thereof
WO2018233527A1 (en) * 2017-06-19 2018-12-27 上海和誉生物医药科技有限公司 Nitrogen heteroaryl derivative having csf1r inhibitory activity, and preparation method therefor and application thereof
CN112105609A (en) * 2018-03-22 2020-12-18 奥瑞基尼探索技术有限公司 Substituted imidazolidin-2-one derivatives as PRMT5 inhibitors
US20220274914A1 (en) * 2019-07-22 2022-09-01 Nikang Therapeutics, Inc. Tricyclic derivatives as hypoxia inducible factor-2(alpha) inhibitors
CN110876806A (en) * 2019-10-23 2020-03-13 北京大学 Use of HIF2 α agonist, ACER2 agonist for the manufacture of a medicament for the treatment of atherosclerosis
WO2021115375A1 (en) * 2019-12-11 2021-06-17 四川海思科制药有限公司 Nitrogen-containing heterocyclic autotaxin inhibitor, and composition containing same and use thereof
US20230226074A1 (en) * 2020-04-28 2023-07-20 Global Blood Therapeutics, Inc. Methods of use for pyrimidines as ferroportin inhibitors
CN113264900A (en) * 2021-06-07 2021-08-17 南京中医药大学 Preparation method and medical application of benzisothiazole and benzothiophene
WO2023046117A1 (en) * 2021-09-23 2023-03-30 3H Pharmaceuticals Co., Ltd. Fgfr inhibitors and methods of use thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ACS.REGISTRY DATABASE: ""RN：926133-97-3，1089649-19-3，1090024-00-2，2181959-84-0，1390373-04-2，1299599-92-0"", 《STNEXT》, pages 1 - 8 *
张俊: ""新型含苯并咪唑基噻唑烷二酮类化合物的合成及其抗糖尿病脑功能障碍的研究"", 《中国博士学位论文全文数据库医药卫生科技辑》, no. 02, pages 079 - 19 *

Also Published As

Publication number Publication date
CN115232147B (en) 2023-10-13

Similar Documents

Publication Publication Date Title
EP3781564B1 (en) Pyridazine derivatives for the treatment of cancer
WO2020156311A1 (en) Pyridazine derivative inhibitor, and preparation method and application thereof
EP3237418B1 (en) Triazolopyrimidine compounds and uses thereof
JP5963777B2 (en) New heterocyclic derivatives
EP3466953B1 (en) Pyrrolo[2,3-d]pyrimidine derivative as janus kinase inhibitor
WO2021068380A1 (en) Preparation of degradation compound targeting btk protein, and application thereof in treating autoimmune diseases and tumors
EP3472161B1 (en) Triazolopyridine compounds and uses thereof
EA012416B1 (en) Substituted 2-alkyl quinazolinone derivatives as parp inhibitors
EP2303885A1 (en) Process for producing bicycloaniline derivatives
JP2017525737A (en) Quinolinone compounds and their use in drugs
AU2020202146A1 (en) Solid forms of 2-(tert-butylamino)-4-((1r,3r,4r)-3-hydroxy-4-methylcyclohexylamino)-pyrimidine-5-carboxamide, compositions thereof and methods of their use
CN110938060A (en) Compound for selectively targeting and degrading CDK subtype and application thereof
CN111718349B (en) Fluorine-containing pyrazolopyrimidine compound, pharmaceutical composition and application thereof
KR101905295B1 (en) Naphthyridinedione derivatives
US20210163478A1 (en) Fused ring derivative used as fgfr4 inhibitor
CN115232147A (en) Heterocyclic derivatives as HIF-2 alpha agonists
CN115697988B (en) 3, 4-Dihydro isoquinoline compound and application thereof
US8372857B2 (en) Substituted 4-hydroxypyrimidine-5-carboxamides
CN112645946B (en) Substituted tricyclic compounds as PRMT5 inhibitors and application thereof
CN109651395B (en) Compound capable of targeted degradation of FKBP12 and 12.6 and preparation method and application thereof
KR20220000854A (en) Novel compounds, method for preparing the same and pharmaceutical composition for preventing and treating cancer comprising the same
WO2010080170A1 (en) Combination therapies for neoplastic disorders
WO2021071981A1 (en) Compounds for modulating splicing
EP4188353A1 (en) Novel uses
CN116332947A (en) Pyrimidine-2 (1H) -keto bicyclic compounds with MAT2A inhibitory activity and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant