CN115216481A - Truncated ATP7B gene with increased expression level and application thereof - Google Patents

Abstract

The invention relates to a truncated ATP7B gene with improved expression level and application thereof. The truncated ATP7B gene with the improved expression level is prepared by removing metal binding domains 1-4 and an excess amino acid in the ATP7B full-length gene. According to the preparation method provided by the invention, under the conditions that no redundant amino acid is introduced and the function is not influenced, the prepared truncated ATP7B gene contains a strong kozak sequence, and the protein expression level is higher.

Description

Truncated ATP7B gene with improved expression level and application thereof

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to a truncated ATP7B gene with improved expression level and application thereof.

Background

Wilson Disease (WD), an autosomal recessive genetic disease characterized by copper metabolism disorder, and its clinical manifestations mainly include progressive cirrhosis, kidney damage, and the keratanin ring. Studies have shown that WD is due to mutations in the ATP7B gene, which encodes a copper-transporting P-type ATPase (ATP 7B). ATP7B is a membrane protein expressed in multiple organs, and has a main function of promoting the excretion of copper along with blood and bile. When the ATP7B gene is mutated, the ATP7B protein transport function is weakened or lost by influencing the processes of protein synthesis, folding, positioning, degradation and the like, the copper transport capacity is reduced, and the reduction of serum ceruloplasmin synthesis and the damage of bile duct copper discharge are caused. Excessive copper accumulates in the body, causing cell necrosis and organ damage, which later seriously affects the quality of life of the patient and may eventually lead to death. Once WD is diagnosed, it requires long-term, comprehensive clinical treatment and requires early treatment, lifelong treatment, regular follow-up, and discontinuation of treatment will likely worsen to acute liver failure.

The current treatment schemes for WD mainly include diet treatment, drug treatment, liver transplantation and the like. Dietary therapy requires patients to avoid high copper diets (e.g. shellfish, nuts, chocolate, mushrooms, animal viscera, etc.). The drug therapy mainly establishes negative copper balance, and the adopted drugs mainly comprise metal chelating agents: d-penicillamine and trientine; inhibition of copper ion absorption of the drug: zinc salts and ammonium Tetrathiomolybdate (TM). The diet therapy may affect the dietary life habits of patients due to the restriction of food selection, thereby possibly causing the compliance of patients to be reduced and being difficult to achieve the expected therapeutic effect.

Early drug therapy before WD develops to late hepatitis and brain damage, usually within 2-6 months, results in greater than 90% of patients with good improvement in liver function and transaminase, with longer treatment duration, and 50-60% of patients with neurological improvement. However, each drug has different curative effects and side effects, and the specific application method is determined according to the condition of a patient, but the drug treatment is usually lifelong. In addition, copper chelator drugs often cause severe side effects such as allergic reactions and chronic joint injury when promoting urinary copper excretion, and do not allow for long-term treatment. Another treatment is liver transplantation, which can be considered a phenotypic correction for WD gene deficiency and can restore copper homeostasis, since WD is primarily a disease characterized by damage to hepatocytes, while liver is the major metabolic organ for copper. However, liver transplantation may cause deterioration of the disease of the nervous system, and it is difficult to find a suitable donor because of high treatment cost. There is therefore a great need to find a new strategy for treating WD.

In early studies, recombinant adenovirus and lentivirus were used to introduce ATP7B into WD model, long-Evans Cinnamon (LEC) rats for gene therapy, and the results showed that the gene therapy method of introducing exogenous ATP7B into liver is feasible, but the treatment method has certain disadvantages. For example, adenovirus cannot integrate into host cell chromosome, can only express transiently, has weak and lasting curative effect and often causes stronger immune response. As a gene vector, lentivirus has the advantages of large capacity, difficult induction of host immune response and the like, but the safety of application to human bodies needs to be further proved because the lentivirus vector induces transgene to be integrated on a host genome. These results all have prompted researchers to find longer, effective, safe WD gene therapy strategies, which are also the focus of current research on the treatment of WD.

In recent years, ATP7B derived from human origin introduced by recombinant adeno-associated virus has achieved good results in animal experiments. The human ATP7B gene is introduced into liver cells (AAV 8-ATP 7B) through AAV8 vectors with hepatic tropism, and mutated ATP7B is compensated, so that the ATP7B gene can normally perform the function, the treatment method can effectively improve urine copper and serum ceruloplasmin of WD mice, and alleviate liver pathological changes. However, since AAV has a limited packaging amount and a large full-length ATP7B gene, which is close to the upper limit of AAV packaging, causes packaging difficulty and low yield, it is expected to overcome this limitation if a truncated ATP7B having a copper-removing function equivalent to that of full-length ATP7B can be found.

In view of the above, the present invention aims to provide a novel truncated ATP7B gene fragment to alleviate at least one of the above problems.

Disclosure of Invention

In view of the above, the present invention provides a novel truncated ATP7B gene, and the specific technical solution is as follows.

A truncated ATP7B gene with increased expression level, wherein the nucleotide sequence of the gene comprises the full length shown in Seq ID No.1 and/or fragments thereof.

Further, the amino acid sequence of the gene includes the full length shown in Seq ID No.2 and/or a fragment thereof.

Furthermore, the nucleotide sequence of the gene comprises a kozak sequence.

The Kozak sequence is a nucleic acid sequence located behind the 5' end cap structure of eukaryotic mRNA, usually GCCACCAUGG, and significantly enhances protein translation. Wherein, the 4 th G has stronger function (A of AUG initiation codon is the 1 st base); however, this rule defines that the amino acid coding species immediately adjacent to the start codon can only be valine (GTT/GTC/GTA/GTG), alanine (GCT/GCC/GCA/GCG), aspartic acid (GAT/GAC), glutamic acid (GAA/GAG) and glycine (GGT/GGC/GGA/GGG). Although the base at position 4 can be G by forcing the addition of the codon for the amino acid described above, this strategy risks increasing the immunogenicity of the therapeutic gene and disrupting gene function. The novel truncated ATP7B gene provided by the invention forms a stronger Kozak sequence under the condition of not additionally introducing redundant amino acids by removing an unnecessary amino acid, and can improve the translation efficiency of the ATP7B gene.

Further, the nucleotide sequence of the kozak sequence includes the full length shown in Seq ID No.3 and/or a fragment thereof.

A recombinant adeno-associated virus vector rAAV containing the novel truncated ATP7B gene nucleotide.

The adenovirus vector has high transgenic efficiency; can transduce different types of human tissue cells, and is not limited by whether target cells are dividing cells or not; high titer viral vectors are readily produced.

Further, the adeno-associated virus for constructing the recombinant adeno-associated virus vector is selected from AAV of type 2, type 5, type 8 and type 9 or one or more of its variants.

The recombinant adenovirus vector is applied to the preparation of medicines for treating Wilson's disease.

The invention also aims to provide application of the novel truncated ATP7B gene and a preparation method thereof.

A drug for treating Wilson's disease, which comprises the full-length truncated ATP7B gene and/or a fragment thereof.

Furthermore, the medicine also contains any pharmaceutically acceptable auxiliary materials and/or auxiliary agents.

A preparation method of truncated ATP7B gene with improved expression level comprises the following steps:

1) Removing metal binding domains 1-4 in the ATP7B full-length gene by using an overlap PCR (overlap PCR) technology to obtain a truncated mutant gene fragment tATP7B; overlapping PCR amplifications used 2 primer pairs. Wherein, the sequence of the forward primer F1 of the first primer pair is shown as Seq ID No. 6; the reverse primer R1 has the sequence shown in Seq ID No. 7. The sequence of the forward primer F2 of the second primer pair is shown as Seq ID No. 8; the reverse primer R1 has the sequence shown in Seq ID No. 9.

Then, using the tATP7B gene as a template, designing a primer for PCR amplification, and loading an amplification product into a pVAX1 vector by utilizing a homologous recombination molecular cloning technology to obtain a tATP7B plasmid. the primer for amplifying the tATP7B gene is as follows: the sequence of the forward primer F is shown as Seq ID No. 10; the reverse primer R sequence is shown in Seq ID No. 11.

2) And designing a primer to further perform PCR amplification by using the tATP7B plasmid as a template to obtain a tATP7B-deltP fragment, wherein the amplification primer is as follows: the sequence of the forward primer F is shown as Seq ID No. 12; the reverse primer R sequence is shown in Seq ID No. 13.

Advantageous effects

The invention provides a method for preparing a novel truncated ATP7B gene. The conventional vectors have problems of difficulty in packaging and low yield because the entire ATP7B gene is large. The preparation method provided by the invention prepares the truncated ATP7B gene containing the kozak sequence under the conditions of not introducing redundant amino acids and not influencing functions.

The novel truncated ATP7B gene provided by the invention has higher protein expression level, and the copper-discharging function and the subcellular localization function are equivalent to those of the conventional ATP7B gene.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It is obvious that the drawings in the following description are some embodiments of the invention, and that for a person skilled in the art, other drawings can be derived from them without inventive exercise.

FIG. 1 is a protein expression profile of a truncated ATP7B gene of the invention;

FIG. 2 is a graph showing a luciferase activity of a truncated ATP7B gene according to the present invention;

FIG. 3 is a diagram showing an experimental subcellular localization of the truncated ATP7B gene of the present invention (the leftmost column is labeled with cy3 and exhibits red fluorescence; the middle column is labeled with DAPI and exhibits blue fluorescence; the rightmost column is fused with red and blue fluorescence);

FIG. 4 is a schematic diagram of the structure of ATP7B (nucleic acid binding domain (N-domain), phosphorylation domain (P-domain), dephosphorylation domain (A-domain); the combination of N-domain and P-domain is commonly referred to as ATP-binding domain; N-terminal contains six copper-binding metal binding domains (MBD 1-MBD 6) and transmembrane domain (TMD) contains 8 transmembrane helices).

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention. It is to be understood that the embodiments described are only a few embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

It should be noted that, in this document, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising a … …" does not exclude the presence of another identical element in a process, method, article, or apparatus that comprises the element.

As used in this specification, the term "about" typically means +/-5% of the stated value, more typically +/-4% of the stated value, more typically +/-3% of the stated value, more typically +/-2% of the stated value, even more typically +/-1% of the stated value, and even more typically +/-0.5% of the stated value.

In this specification, certain embodiments may be disclosed in a range of formats. It should be understood that this description of "within a certain range" is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, the range

The description of (a) should be read as having specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within this range, e.g., 1,2,3,4,5 and 6. The above rules apply regardless of the breadth of the range.

Noun interpretation

The term "truncated form" as used herein refers to an ATP7B gene fragment prepared by removing MBD1-4 and an excess amino acid from the full-length ATP7B gene.

The expression quantity improvement means that the protein expression quantity of the truncated tATP7B-deltP gene containing the strong kozak sequence provided by the invention is improved relative to the truncated mutant gene tATP7B and the full-length ATP7B gene of which MBD1-4 is removed.

Example one

Preparation method of truncated ATP7B gene

1. Construction of truncated mutant Gene fragment tATP7B

The ATP7B gene is located on the long arm of chromosome 13 (13q14.3), the DNA length is about 80kb, 21 exons and 20 introns are contained, and the ATP7B protein coded by the cDNA is about 165kDa in size. Referring to FIG. 4, there are 8 transmembrane domains (TMD 1-8) in ATP7B, where A-domain (dephosphorylation domain) is formed between TMD4 and TMD5 and two functional regions involved in ATP hydrolysis and binding, P-domain (phosphorylation domain) and N-domain (nucleic acid binding domain), respectively, are between TMD6 and TMD 7.

ATP7B has 6 Metal Binding Domains (MBDs) at the N-terminus, and the 6 metal binding domains all have a unique sequence: MXCXXC (X represents any amino acid) in which 2 cysteine residues in CXXC are the copper ion binding site. It has been demonstrated that mutations in all the N-terminal MBDs in ATP7B do not affect the expression of ATP7B protein, but do disrupt ATP7B function. MBD1-4 is peculiar to higher organisms, has small influence on the affinity of a transmembrane region and copper ions after deletion, and can promote the hydrolysis and combination of ATP on the contrary, thereby indicating that MBD1-4 has the function of regulating the activity of enzyme.

The experimental group of the invention firstly removes MBD1-4 in the ATP7B full-length gene to obtain a truncated mutant gene fragment tATP7B. the nucleotide sequence of tATP7B includes the full length shown in Seq ID No.4 and/or a fragment thereof; the amino acid sequence of tATP7B includes the full length and/or a fragment thereof as shown in Seq ID No. 5.

2. Construction of truncated ATP7B Gene fragment with increased expression

Through bioinformatics analysis, the experimental group finds that the sequence at the N terminal of the ATP7B protein is not conserved in different mammals, and the fact that the sequence can be modified is suggested. the nucleotide sequence of tATP7B includes a weak Kozak sequence GCCACCATGCCT (1 st base A of ATG initiation codon). In this group, the original weak Kozak sequence was changed to GCCACCATG by removing the CCT, proline (P)GAG, i.e. the stronger Kozak sequenceColumn, as shown in Seq ID No. 3. Obtaining the truncated ATP7B gene tATP7B-deltP with improved expression quantity of the invention, wherein the nucleotide sequence comprises the full length shown as Seq ID No.1 and/or fragments thereof; the amino acid sequence of the polypeptide comprises the full length shown in Seq ID No.2 and/or fragments thereof. The specific operation steps are as follows:

1) Removing metal binding domains 1-4 in the ATP7B full-length gene by using an overlapping PCR technology to obtain a truncated mutant gene fragment tATP7B; the overlapping PCR amplification primers were as follows: f1: ATGCCTGAGCAGGAGAGAC (Seq ID No. 6); r1: GCCACTGCTCTGGTCTGAGAAGAAGGGCCCAG (Seq ID No. 7); f2: GCCCTTCTTCTCAGACCAGAGCAGTGGCACCG (Seq ID No. 8); r2: TTAGATGTACTGCTCCTCATCC (Seq ID No. 9). Taking the tATP7B gene as a template, designing a primer for PCR amplification, and loading an amplification product into a pVAX1 vector by utilizing a homologous recombination molecular cloning technology to obtain a tATP7B plasmid. the primers for amplification of the tATP7B plasmid were as follows: f: ATAGGGAGACCCAAGCTGGCTAGCGCCACCATGCCTGAGCAGGAGAGAC (Seq ID No. 10); r: GCTGGATATCTGCAGAATTCTTAGATGTACTGCTCCTCATCC (Seq ID No. 11).

2) Designing a primer to perform PCR by taking a tATP7B plasmid as a template to obtain a tATP7B-deltP fragment, wherein the amplification primer is as follows: 5'-ATAGGGAGACCCAAGCTGGCTAGCGCCACCATGGAGCAGGAGAGACAGATCAC-3' (Seq ID No. 12); R5'-GCTGGATATCTGCAGAATTCTTAGATGTACTGCTCCTCATCC-3' (Seq ID No. 13).

Example two

tATP7BdeltP functional validation

Experiment of protein expression amount

HEK293T cells are transfected by tATP7B and tATP7BdeltP with the same mass respectively, and cell protein is extracted after 48 hours, and beta-actin is used as an internal reference.

Western Blot procedure:

1) Sample treatment: after washing the cell sample twice with PBS, spin-centrifugation was performed, 200. Mu.l of protease inhibitor (2. Mu.l of 100 XCocktail in 200. Mu.l of RIPA solution) was added, and the protein was extracted by ultrasound on ice;

2) Centrifuging at 4 ℃ for 12000rpm,5min after ultrasonic treatment, taking the supernatant into a new 1.5ml EP tube, and measuring the protein concentration of the supernatant by using Nanodrop;

3) Adding 5 times protein loading with beta-mercaptoethanol into the protein, and boiling for 5min to denature the protein;

4) Electrophoresis: preparing SDS-Page protein gel according to the kit instructions; loading the protein amount of 30 mug per hole, and after loading, performing electrophoresis at constant voltage of 100V under the condition of electrophoresis buffer solution until 5 times of protein loading completely leaves the protein gel;

5) Film transfer: taking down the protein gel after electrophoresis, removing concentrated gel and loading, and cutting off the protein gel according to the position of a marker; cutting the PVDF membrane according to the size of the protein gel, and then soaking the PVDF membrane in methanol for 10s; sequentially placing a PVDF membrane and an albumin glue (the PVDF membrane is marked so as to distinguish upper and lower samples from different samples), adding a membrane transferring buffer solution, transferring the membrane in an ice bath environment, and keeping the pressure constant at 100V for 90min;

6) Taking down the PVDF membrane after the membrane conversion is finished, putting the PVDF membrane into sealing liquid, and sealing the PVDF membrane on a shaking table at room temperature for 1 hour;

7) TBS/T membrane washing is carried out twice, and each time lasts for 10min;

8) Diluting the primary antibody with a primary antibody diluent, incubating in a hybridization bag, and slowly shaking at 4 ℃ for incubation overnight;

9) Taking out and placing the mixture to room temperature;

10 Recovery of primary antibody, TBS/T washing of membrane 3 times, each time for 15min;

11 Corresponding diluted secondary antibody was added and incubated for 1.5h at room temperature;

12 TBS/T membrane washing for 4 times, 15min each time;

13 Color development exposure.

Results of the experiment

As shown in fig. 1, the results showed that the protein expression amount of tapp 7BdeltP was higher than that of tapp 7B in the case of a considerable amount of β -actin protein expression. This result suggests that the present invention is expected to improve the therapeutic effect on the basis of increasing the expression level of the gene ATP7B.

EXAMPLE III

tATP7BdeltP functional verification

Copper discharge experiment

Inserting tATP7B-deltP and tATP7B into pVAX1 plasmid respectively to construct recombinant plasmids, then cotransfecting 293T cells with the 7xMRE and Tk-rluc plasmids respectively (Control group is a pVAX-lacz negative Control group), after 24h, adding a culture medium containing copper or not containing copper to treat the cells for 24h, and detecting the fluorescence intensity by using a microplate reader.

Luciferase activity determination step:

1) 293T cells were inoculated into 48-well plates and transfected when the cells grew to 80% confluence;

2) Transfecting plasmids according to Transeasy operation steps, inoculating a 48-well plate to a 96-well plate after transfecting for 24h, and adding CuSO into a culture medium ₄ The solution was brought to a final concentration of 75uM. Continuously culturing the cells to recover the copper-removing function;

3) After 24h, reference is made to Promega

The Luciferase Assay System protocol was performed by first adding 75ul per well of cells

Incubating Luciferase Assay Reagent at 20-25 ℃ for 30min, detecting the expression quantity of firefly fluorescein in a multifunctional microplate reader, and recording data;

4) Continuously adding to each hole

Stop&

Reagent, incubating at 20-25 ℃ for 30min, detecting the renilla fluorescein expression amount in a multifunctional enzyme labeling instrument, and recording data;

5) The ratio of the two data can reflect the copper discharge condition of each ATP7B subtype.

Results of the experiment

The results are shown in FIG. 2, with the ordinate being the ratio of copper to copper-free (firefly luciferin expression/Renilla luciferin expression) for each group, and the values and error bars being the mean and standard deviation of the data for the three groups. The results showed that the relative fluorescence expression ratio of copper-containing to no-copper of tATP7B and tATP7B-deltP was close to 1 compared to the Control (Control) group, showing a copper exclusion function. The prior art literature has demonstrated that tATP7B has similar copper-extracting function as full-length ATP7B, and thus tATP7B-deltP also has equivalent copper-extracting function as full-length ATP7B.

Example four

tATP7BdeltP functional verification

Subcellular localization experiments

Transfecting recombinant plasmids of tATP7B-deltP and tATP7B, ATP B to CHO cells, culturing overnight, and then culturing with CuSO ₄ Or does not contain CuSO ₄ The cells were treated for 4 hours, then fixed and imaged under a fluorescent microscope.

The method comprises the following specific steps:

1) CHO cells are paved on 24-hole plate creeping tablets, and transfection is carried out when the cells grow to the fusion degree of 70% -80%;

2) After 24h of transfection, the medium was replaced by 75uMCuSO ₄ Culturing in fresh culture medium (without copper as control) for 4-5 hr, and removing culture medium;

3) Cells were rinsed appropriately with PBS;

4) The PBS was aspirated off, and the cells were fixed with 4% paraformaldehyde for 10min;

5) Absorbing paraformaldehyde, and rinsing with PBS for three times, each for 5min;

6) Adding normal goat serum, sealing at room temperature for 1h;

7) After the blocking is finished, the blocking solution is sucked off, and the solution is rinsed for three times with PBS for 5min each time;

8) Adding proper diluted ATP7B primary antibody, and incubating overnight at 4 ℃;

9) Taking out the pore plate, recovering to room temperature, removing primary antibody by suction, and washing the slide with PBS for three times, each time for 5min;

10 Adding a cy 3-labeled fluorescent secondary antibody working solution, and incubating for 1h at room temperature in a dark place;

11 Fluorescent secondary antibody was aspirated, and the slide was washed three times with PBS for 5min each time;

12 Adding DAPI working solution, and incubating for 10min at room temperature in dark place;

13 Aspirate DPAI working solution, wash the slide three times with PBS for 5min each time;

14 Dropping a proper amount of an anti-fluorescence quencher on the glass slide, covering the glass slide, and sealing the glass slide by using a proper amount of nail polish;

15 Under a fluorescent microscope.

Results of the experiment

As shown in FIG. 3, the migration of ATP7B to the periphery was observed in the copper-added test groups compared with the non-copper test group for each group. The principle is that a signal peptide of about 63 amino acids exists at the N terminal of ATP7B, and can respond to the concentration of copper ions, when the concentration of copper ions in cytoplasm is low, ATP7B is mainly concentrated on Golgi reticulum (TGN), when the concentration of copper ions in cytoplasm is high, ATP7B gradually moves to and is accumulated on the lateral membrane of bile duct of cells, and the transposition of copper ions is very likely to lead the copper discharging action of liver cells to bile canaliculi. The tATP7BdeltP prepared by the invention has subcellular translocation function similar to ATP7B.

While the present invention has been described with reference to the embodiments shown in the drawings, the present invention is not limited to the embodiments, which are illustrative and not restrictive, and it will be apparent to those skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> Sichuan university

<120> truncated ATP7B gene with improved expression level and application thereof

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4401

<212> DNA

<213> artificial sequence

<400> 1

gccaccatgg agcaggagag acagatcaca gccagagaag gggccagtcg gaaaatctta 60

tctaagcttt ctttgcctac ccgtgcctgg gaaccagcaa tgaagaagag ttttgctttt 120

gacaatgttg gctatgaagg tggtctggat ggcctgggcc cttcttctca ggtggccacc 180

agcacagtca ggatcttggg catgacttgc cagtcatgtg tgaagtccat tgaggacagg 240

atttccaatt tgaaaggcat catcagcatg aaggtttccc tggaacaagg cagtgccact 300

gtgaaatatg tgccatcggt tgtgtgcctg caacaggttt gccatcaaat tggggacatg 360

ggcttcgagg ccagcattgc agaaggaaag gcagcctcct ggccctcaag gtccttgcct 420

gcccaggagg ctgtggtcaa gctccgggtg gagggcatga cctgccagtc ctgtgtcagc 480

tccattgaag gcaaggtccg gaaactgcaa ggagtagtga gagtcaaagt ctcactcagc 540

aaccaagagg ccgtcatcac ttatcagcct tatctcattc agcccgaaga cctcagggac 600

catgtaaatg acatgggatt tgaagctgcc atcaagagca aagtggctcc cttaagcctg 660

ggaccaattg atattgagcg gttacaaagc actaacccaa agagaccttt atcttctgct 720

aaccagaatt ttaataattc tgagaccttg gggcaccaag gaagccatgt ggtcaccctc 780

caactgagaa tagatggaat gcattgtaag tcttgcgtct tgaatattga agaaaatatt 840

ggccagctcc taggggttca aagtattcaa gtgtccttgg agaacaaaac tgcccaagta 900

aagtatgacc cttcttgtac cagcccagtg gctctgcaga gggctatcga ggcacttcca 960

cctgggaatt ttaaagtttc tcttcctgat ggagccgaag ggagtgggac agatcacagg 1020

tcttccagtt ctcattcccc tggctcccca ccgagaaacc aggtccaggg cacatgcagt 1080

accactctga ttgccattgc cggcatgacc tgtgcatcct gtgtccattc cattgaaggc 1140

atgatctccc aactggaagg ggtgcagcaa atatcggtgt ctttggccga agggactgca 1200

acagttcttt ataatccctc tgtaattagc ccagaagaac tcagagctgc tatagaagac 1260

atgggatttg aggcttcagt cgtttctgaa agctgttcta ctaaccctct tggaaaccac 1320

agtgctggga attccatggt gcaaactaca gatggtacac ctacatctgt gcaggaagtg 1380

gctccccaca ctgggaggct ccctgcaaac catgccccgg acatcttggc aaagtcccca 1440

caatcaacca gagcagtggc accgcagaag tgcttcttac agatcaaagg catgacctgt 1500

gcatcctgtg tgtctaacat agaaaggaat ctgcagaaag aagctggtgt tctctccgtg 1560

ttggttgcct tgatggcagg aaaggcagag atcaagtatg acccagaggt catccagccc 1620

ctcgagatag ctcagttcat ccaggacctg ggttttgagg cagcagtcat ggaggactac 1680

gcaggctccg atggcaacat tgagctgaca atcacaggga tgacctgcgc gtcctgtgtc 1740

cacaacatag agtccaaact cacgaggaca aatggcatca cttatgcctc cgttgccctt 1800

gccaccagca aagcccttgt taagtttgac ccggaaatta tcggtccacg ggatattatc 1860

aaaattattg aggaaattgg ctttcatgct tccctggccc agagaaaccc caacgctcat 1920

cacttggacc acaagatgga aataaagcag tggaagaagt ctttcctgtg cagcctggtg 1980

tttggcatcc ctgtcatggc cttaatgatc tatatgctga tacccagcaa cgagccccac 2040

cagtccatgg tcctggacca caacatcatt ccaggactgt ccattctaaa tctcatcttc 2100

tttatcttgt gtacctttgt ccagctcctc ggtgggtggt acttctacgt tcaggcctac 2160

aaatctctga gacacaggtc agccaacatg gacgtgctca tcgtcctggc cacaagcatt 2220

gcttatgttt attctctggt catcctggtg gttgctgtgg ctgagaaggc ggagaggagc 2280

cctgtgacat tcttcgacac gccccccatg ctctttgtgt tcattgccct gggccggtgg 2340

ctggaacact tggcaaagag caaaacctca gaagccctgg ctaaactcat gtctctccaa 2400

gccacagaag ccaccgttgt gacccttggt gaggacaatt taatcatcag ggaggagcaa 2460

gtccccatgg agctggtgca gcggggcgat atcgtcaagg tggtccctgg gggaaagttt 2520

ccagtggatg ggaaagtcct ggaaggcaat accatggctg atgagtccct catcacagga 2580

gaagccatgc cagtcactaa gaaacccgga agcactgtaa ttgcggggtc tataaatgca 2640

catggctctg tgctcattaa agctacccac gtgggcaatg acaccacttt ggctcagatt 2700

gtgaaactgg tggaagaggc tcagatgtca aaggcaccca ttcagcagct ggctgaccgg 2760

tttagtggat attttgtccc atttatcatc atcatgtcaa ctttgacgtt ggtggtatgg 2820

attgtaatcg gttttatcga ttttggtgtt gttcagagat actttcctaa ccccaacaag 2880

cacatctccc agacagaggt gatcatccgg tttgctttcc agacgtccat cacggtgctg 2940

tgcattgcct gcccctgctc cctggggctg gccacgccca cggctgtcat ggtgggcacc 3000

ggggtggccg cgcagaacgg catcctcatc aagggaggca agcccctgga gatggcgcac 3060

aagataaaga ctgtgatgtt tgacaagact ggcaccatta cccatggcgt ccccagggtc 3120

atgcgggtgc tcctgctggg ggatgtggcc acactgcccc tcaggaaggt tctggctgtg 3180

gtggggactg cggaggccag cagtgaacac cccttgggcg tggcagtcac caaatactgt 3240

aaagaggaac ttggaacaga gaccttggga tactgcacgg acttccaggc agtgccaggc 3300

tgtggaattg ggtgcaaagt cagcaacgtg gaaggcatcc tggcccacag tgagcgccct 3360

ttgagtgcac cggccagtca cctgaatgag gctggcagcc ttcccgcaga aaaagatgca 3420

gtcccccaga ccttctctgt gctgattgga aaccgtgagt ggctgaggcg caacggttta 3480

accatttcta gcgatgtcag tgacgctatg acagaccacg agatgaaagg acagacagcc 3540

atcctggtgg ctattgacgg tgtgctctgt gggatgatcg caatcgcaga cgctgtcaag 3600

caggaggctg ccctggctgt gcacacgctg cagagcatgg gtgtggacgt ggttctgatc 3660

acgggggaca accggaagac agccagagct attgccaccc aggttggcat caacaaagtc 3720

tttgcagagg tgctgccttc gcacaaggtg gccaaggtcc aggagctcca gaataaaggg 3780

aagaaagtcg ccatggtggg ggatggggtc aatgactccc cggccttggc ccaggcagac 3840

atgggtgtgg ccattggcac cggcacggat gtggccatcg aggcagccga cgtcgtcctt 3900

atcagaaatg atttgctgga tgtggtggct agcattcacc tttccaagag gactgtccga 3960

aggatacgca tcaacctggt cctggcactg atttataacc tggttgggat acccattgca 4020

gcaggtgtct tcatgcccat cggcattgtg ctgcagccct ggatgggctc agcggccatg 4080

gcagcctcct ctgtgtctgt ggtgctctca tccctgcagc tcaagtgcta taagaagcct 4140

gacctggaga ggtatgaggc acaggcgcat ggccacatga agcccctgac ggcatcccag 4200

gtcagtgtgc acataggcat ggatgacagg tggcgggact cccccagggc cacaccatgg 4260

gaccaggtca gctatgtcag ccaggtgtcg ctgtcctccc tgacgtccga caagccatct 4320

cggcacagcg ctgcagcaga cgatgatggg gacaagtggt ctctgctcct gaatggcagg 4380

gatgaggagc agtacatctg a 4401

<210> 2

<211> 1464

<212> PRT

<213> artificial sequence

<400> 2

Met Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg Lys

1 5 10 15

Ile Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala Met

20 25 30

Lys Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu Asp

35 40 45

Gly Leu Gly Pro Ser Ser Gln Val Ala Thr Ser Thr Val Arg Ile Leu

50 55 60

Gly Met Thr Cys Gln Ser Cys Val Lys Ser Ile Glu Asp Arg Ile Ser

65 70 75 80

Asn Leu Lys Gly Ile Ile Ser Met Lys Val Ser Leu Glu Gln Gly Ser

85 90 95

Ala Thr Val Lys Tyr Val Pro Ser Val Val Cys Leu Gln Gln Val Cys

100 105 110

His Gln Ile Gly Asp Met Gly Phe Glu Ala Ser Ile Ala Glu Gly Lys

115 120 125

Ala Ala Ser Trp Pro Ser Arg Ser Leu Pro Ala Gln Glu Ala Val Val

130 135 140

Lys Leu Arg Val Glu Gly Met Thr Cys Gln Ser Cys Val Ser Ser Ile

145 150 155 160

Glu Gly Lys Val Arg Lys Leu Gln Gly Val Val Arg Val Lys Val Ser

165 170 175

Leu Ser Asn Gln Glu Ala Val Ile Thr Tyr Gln Pro Tyr Leu Ile Gln

180 185 190

Pro Glu Asp Leu Arg Asp His Val Asn Asp Met Gly Phe Glu Ala Ala

195 200 205

Ile Lys Ser Lys Val Ala Pro Leu Ser Leu Gly Pro Ile Asp Ile Glu

210 215 220

Arg Leu Gln Ser Thr Asn Pro Lys Arg Pro Leu Ser Ser Ala Asn Gln

225 230 235 240

Asn Phe Asn Asn Ser Glu Thr Leu Gly His Gln Gly Ser His Val Val

245 250 255

Thr Leu Gln Leu Arg Ile Asp Gly Met His Cys Lys Ser Cys Val Leu

260 265 270

Asn Ile Glu Glu Asn Ile Gly Gln Leu Leu Gly Val Gln Ser Ile Gln

275 280 285

Val Ser Leu Glu Asn Lys Thr Ala Gln Val Lys Tyr Asp Pro Ser Cys

290 295 300

Thr Ser Pro Val Ala Leu Gln Arg Ala Ile Glu Ala Leu Pro Pro Gly

305 310 315 320

Asn Phe Lys Val Ser Leu Pro Asp Gly Ala Glu Gly Ser Gly Thr Asp

325 330 335

His Arg Ser Ser Ser Ser His Ser Pro Gly Ser Pro Pro Arg Asn Gln

340 345 350

Val Gln Gly Thr Cys Ser Thr Thr Leu Ile Ala Ile Ala Gly Met Thr

355 360 365

Cys Ala Ser Cys Val His Ser Ile Glu Gly Met Ile Ser Gln Leu Glu

370 375 380

Gly Val Gln Gln Ile Ser Val Ser Leu Ala Glu Gly Thr Ala Thr Val

385 390 395 400

Leu Tyr Asn Pro Ser Val Ile Ser Pro Glu Glu Leu Arg Ala Ala Ile

405 410 415

Glu Asp Met Gly Phe Glu Ala Ser Val Val Ser Glu Ser Cys Ser Thr

420 425 430

Asn Pro Leu Gly Asn His Ser Ala Gly Asn Ser Met Val Gln Thr Thr

435 440 445

Asp Gly Thr Pro Thr Ser Val Gln Glu Val Ala Pro His Thr Gly Arg

450 455 460

Leu Pro Ala Asn His Ala Pro Asp Ile Leu Ala Lys Ser Pro Gln Ser

465 470 475 480

Thr Arg Ala Val Ala Pro Gln Lys Cys Phe Leu Gln Ile Lys Gly Met

485 490 495

Thr Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu Gln Lys Glu

500 505 510

Ala Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly Lys Ala Glu

515 520 525

Ile Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile Ala Gln Phe

530 535 540

Ile Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp Tyr Ala Gly

545 550 555 560

Ser Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr Cys Ala Ser

565 570 575

Cys Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn Gly Ile Thr

580 585 590

Tyr Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val Lys Phe Asp

595 600 605

Pro Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile Glu Glu Ile

610 615 620

Gly Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala His His Leu

625 630 635 640

Asp His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe Leu Cys Ser

645 650 655

Leu Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr Met Leu Ile

660 665 670

Pro Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His Asn Ile Ile

675 680 685

Pro Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu Cys Thr Phe

690 695 700

Val Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala Tyr Lys Ser

705 710 715 720

Leu Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val Leu Ala Thr

725 730 735

Ser Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val Ala Val Ala

740 745 750

Glu Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr Pro Pro Met

755 760 765

Leu Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His Leu Ala Lys

770 775 780

Ser Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu Gln Ala Thr

785 790 795 800

Glu Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile Ile Arg Glu

805 810 815

Glu Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile Val Lys Val

820 825 830

Val Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu Glu Gly Asn

835 840 845

Thr Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met Pro Val Thr

850 855 860

Lys Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn Ala His Gly

865 870 875 880

Ser Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr Thr Leu Ala

885 890 895

Gln Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys Ala Pro Ile

900 905 910

Gln Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro Phe Ile Ile

915 920 925

Ile Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile Gly Phe Ile

930 935 940

Asp Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn Lys His Ile

945 950 955 960

Ser Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr Ser Ile Thr

965 970 975

Val Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala Thr Pro Thr

980 985 990

Ala Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly Ile Leu Ile

995 1000 1005

Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys Thr Val Met

1010 1015 1020

Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg Val Met Arg

1025 1030 1035 1040

Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu Arg Lys Val Leu

1045 1050 1055

Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu His Pro Leu Gly Val

1060 1065 1070

Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu Gly Thr Glu Thr Leu Gly

1075 1080 1085

Tyr Cys Thr Asp Phe Gln Ala Val Pro Gly Cys Gly Ile Gly Cys Lys

1090 1095 1100

Val Ser Asn Val Glu Gly Ile Leu Ala His Ser Glu Arg Pro Leu Ser

1105 1110 1115 1120

Ala Pro Ala Ser His Leu Asn Glu Ala Gly Ser Leu Pro Ala Glu Lys

1125 1130 1135

Asp Ala Val Pro Gln Thr Phe Ser Val Leu Ile Gly Asn Arg Glu Trp

1140 1145 1150

Leu Arg Arg Asn Gly Leu Thr Ile Ser Ser Asp Val Ser Asp Ala Met

1155 1160 1165

Thr Asp His Glu Met Lys Gly Gln Thr Ala Ile Leu Val Ala Ile Asp

1170 1175 1180

Gly Val Leu Cys Gly Met Ile Ala Ile Ala Asp Ala Val Lys Gln Glu

1185 1190 1195 1200

Ala Ala Leu Ala Val His Thr Leu Gln Ser Met Gly Val Asp Val Val

1205 1210 1215

Leu Ile Thr Gly Asp Asn Arg Lys Thr Ala Arg Ala Ile Ala Thr Gln

1220 1225 1230

Val Gly Ile Asn Lys Val Phe Ala Glu Val Leu Pro Ser His Lys Val

1235 1240 1245

Ala Lys Val Gln Glu Leu Gln Asn Lys Gly Lys Lys Val Ala Met Val

1250 1255 1260

Gly Asp Gly Val Asn Asp Ser Pro Ala Leu Ala Gln Ala Asp Met Gly

1265 1270 1275 1280

Val Ala Ile Gly Thr Gly Thr Asp Val Ala Ile Glu Ala Ala Asp Val

1285 1290 1295

Val Leu Ile Arg Asn Asp Leu Leu Asp Val Val Ala Ser Ile His Leu

1300 1305 1310

Ser Lys Arg Thr Val Arg Arg Ile Arg Ile Asn Leu Val Leu Ala Leu

1315 1320 1325

Ile Tyr Asn Leu Val Gly Ile Pro Ile Ala Ala Gly Val Phe Met Pro

1330 1335 1340

Ile Gly Ile Val Leu Gln Pro Trp Met Gly Ser Ala Ala Met Ala Ala

1345 1350 1355 1360

Ser Ser Val Ser Val Val Leu Ser Ser Leu Gln Leu Lys Cys Tyr Lys

1365 1370 1375

Lys Pro Asp Leu Glu Arg Tyr Glu Ala Gln Ala His Gly His Met Lys

1380 1385 1390

Pro Leu Thr Ala Ser Gln Val Ser Val His Ile Gly Met Asp Asp Arg

1395 1400 1405

Trp Arg Asp Ser Pro Arg Ala Thr Pro Trp Asp Gln Val Ser Tyr Val

1410 1415 1420

Ser Gln Val Ser Leu Ser Ser Leu Thr Ser Asp Lys Pro Ser Arg His

1425 1430 1435 1440

Ser Ala Ala Ala Asp Asp Asp Gly Asp Lys Trp Ser Leu Leu Leu Asn

1445 1450 1455

Gly Arg Asp Glu Glu Gln Tyr Ile

1460

<210> 3

<211> 12

<212> DNA

<213> artificial sequence

<400> 3

gccaccatgg ag 12

<210> 4

<211> 4404

<212> DNA

<213> artificial sequence

<400> 4

gccaccatgc ctgagcagga gagacagatc acagccagag aaggggccag tcggaaaatc 60

ttatctaagc tttctttgcc tacccgtgcc tgggaaccag caatgaagaa gagttttgct 120

tttgacaatg ttggctatga aggtggtctg gatggcctgg gcccttcttc tcaggtggcc 180

accagcacag tcaggatctt gggcatgact tgccagtcat gtgtgaagtc cattgaggac 240

aggatttcca atttgaaagg catcatcagc atgaaggttt ccctggaaca aggcagtgcc 300

actgtgaaat atgtgccatc ggttgtgtgc ctgcaacagg tttgccatca aattggggac 360

atgggcttcg aggccagcat tgcagaagga aaggcagcct cctggccctc aaggtccttg 420

cctgcccagg aggctgtggt caagctccgg gtggagggca tgacctgcca gtcctgtgtc 480

agctccattg aaggcaaggt ccggaaactg caaggagtag tgagagtcaa agtctcactc 540

agcaaccaag aggccgtcat cacttatcag ccttatctca ttcagcccga agacctcagg 600

gaccatgtaa atgacatggg atttgaagct gccatcaaga gcaaagtggc tcccttaagc 660

ctgggaccaa ttgatattga gcggttacaa agcactaacc caaagagacc tttatcttct 720

gctaaccaga attttaataa ttctgagacc ttggggcacc aaggaagcca tgtggtcacc 780

ctccaactga gaatagatgg aatgcattgt aagtcttgcg tcttgaatat tgaagaaaat 840

attggccagc tcctaggggt tcaaagtatt caagtgtcct tggagaacaa aactgcccaa 900

gtaaagtatg acccttcttg taccagccca gtggctctgc agagggctat cgaggcactt 960

ccacctggga attttaaagt ttctcttcct gatggagccg aagggagtgg gacagatcac 1020

aggtcttcca gttctcattc ccctggctcc ccaccgagaa accaggtcca gggcacatgc 1080

agtaccactc tgattgccat tgccggcatg acctgtgcat cctgtgtcca ttccattgaa 1140

ggcatgatct cccaactgga aggggtgcag caaatatcgg tgtctttggc cgaagggact 1200

gcaacagttc tttataatcc ctctgtaatt agcccagaag aactcagagc tgctatagaa 1260

gacatgggat ttgaggcttc agtcgtttct gaaagctgtt ctactaaccc tcttggaaac 1320

cacagtgctg ggaattccat ggtgcaaact acagatggta cacctacatc tgtgcaggaa 1380

gtggctcccc acactgggag gctccctgca aaccatgccc cggacatctt ggcaaagtcc 1440

ccacaatcaa ccagagcagt ggcaccgcag aagtgcttct tacagatcaa aggcatgacc 1500

tgtgcatcct gtgtgtctaa catagaaagg aatctgcaga aagaagctgg tgttctctcc 1560

gtgttggttg ccttgatggc aggaaaggca gagatcaagt atgacccaga ggtcatccag 1620

cccctcgaga tagctcagtt catccaggac ctgggttttg aggcagcagt catggaggac 1680

tacgcaggct ccgatggcaa cattgagctg acaatcacag ggatgacctg cgcgtcctgt 1740

gtccacaaca tagagtccaa actcacgagg acaaatggca tcacttatgc ctccgttgcc 1800

cttgccacca gcaaagccct tgttaagttt gacccggaaa ttatcggtcc acgggatatt 1860

atcaaaatta ttgaggaaat tggctttcat gcttccctgg cccagagaaa ccccaacgct 1920

catcacttgg accacaagat ggaaataaag cagtggaaga agtctttcct gtgcagcctg 1980

gtgtttggca tccctgtcat ggccttaatg atctatatgc tgatacccag caacgagccc 2040

caccagtcca tggtcctgga ccacaacatc attccaggac tgtccattct aaatctcatc 2100

ttctttatct tgtgtacctt tgtccagctc ctcggtgggt ggtacttcta cgttcaggcc 2160

tacaaatctc tgagacacag gtcagccaac atggacgtgc tcatcgtcct ggccacaagc 2220

attgcttatg tttattctct ggtcatcctg gtggttgctg tggctgagaa ggcggagagg 2280

agccctgtga cattcttcga cacgcccccc atgctctttg tgttcattgc cctgggccgg 2340

tggctggaac acttggcaaa gagcaaaacc tcagaagccc tggctaaact catgtctctc 2400

caagccacag aagccaccgt tgtgaccctt ggtgaggaca atttaatcat cagggaggag 2460

caagtcccca tggagctggt gcagcggggc gatatcgtca aggtggtccc tgggggaaag 2520

tttccagtgg atgggaaagt cctggaaggc aataccatgg ctgatgagtc cctcatcaca 2580

ggagaagcca tgccagtcac taagaaaccc ggaagcactg taattgcggg gtctataaat 2640

gcacatggct ctgtgctcat taaagctacc cacgtgggca atgacaccac tttggctcag 2700

attgtgaaac tggtggaaga ggctcagatg tcaaaggcac ccattcagca gctggctgac 2760

cggtttagtg gatattttgt cccatttatc atcatcatgt caactttgac gttggtggta 2820

tggattgtaa tcggttttat cgattttggt gttgttcaga gatactttcc taaccccaac 2880

aagcacatct cccagacaga ggtgatcatc cggtttgctt tccagacgtc catcacggtg 2940

ctgtgcattg cctgcccctg ctccctgggg ctggccacgc ccacggctgt catggtgggc 3000

accggggtgg ccgcgcagaa cggcatcctc atcaagggag gcaagcccct ggagatggcg 3060

cacaagataa agactgtgat gtttgacaag actggcacca ttacccatgg cgtccccagg 3120

gtcatgcggg tgctcctgct gggggatgtg gccacactgc ccctcaggaa ggttctggct 3180

gtggtgggga ctgcggaggc cagcagtgaa caccccttgg gcgtggcagt caccaaatac 3240

tgtaaagagg aacttggaac agagaccttg ggatactgca cggacttcca ggcagtgcca 3300

ggctgtggaa ttgggtgcaa agtcagcaac gtggaaggca tcctggccca cagtgagcgc 3360

cctttgagtg caccggccag tcacctgaat gaggctggca gccttcccgc agaaaaagat 3420

gcagtccccc agaccttctc tgtgctgatt ggaaaccgtg agtggctgag gcgcaacggt 3480

ttaaccattt ctagcgatgt cagtgacgct atgacagacc acgagatgaa aggacagaca 3540

gccatcctgg tggctattga cggtgtgctc tgtgggatga tcgcaatcgc agacgctgtc 3600

aagcaggagg ctgccctggc tgtgcacacg ctgcagagca tgggtgtgga cgtggttctg 3660

atcacggggg acaaccggaa gacagccaga gctattgcca cccaggttgg catcaacaaa 3720

gtctttgcag aggtgctgcc ttcgcacaag gtggccaagg tccaggagct ccagaataaa 3780

gggaagaaag tcgccatggt gggggatggg gtcaatgact ccccggcctt ggcccaggca 3840

gacatgggtg tggccattgg caccggcacg gatgtggcca tcgaggcagc cgacgtcgtc 3900

cttatcagaa atgatttgct ggatgtggtg gctagcattc acctttccaa gaggactgtc 3960

cgaaggatac gcatcaacct ggtcctggca ctgatttata acctggttgg gatacccatt 4020

gcagcaggtg tcttcatgcc catcggcatt gtgctgcagc cctggatggg ctcagcggcc 4080

atggcagcct cctctgtgtc tgtggtgctc tcatccctgc agctcaagtg ctataagaag 4140

cctgacctgg agaggtatga ggcacaggcg catggccaca tgaagcccct gacggcatcc 4200

caggtcagtg tgcacatagg catggatgac aggtggcggg actcccccag ggccacacca 4260

tgggaccagg tcagctatgt cagccaggtg tcgctgtcct ccctgacgtc cgacaagcca 4320

tctcggcaca gcgctgcagc agacgatgat ggggacaagt ggtctctgct cctgaatggc 4380

agggatgagg agcagtacat ctga 4404

<210> 5

<211> 1465

<212> PRT

<213> artificial sequence

<400> 5

Met Pro Glu Gln Glu Arg Gln Ile Thr Ala Arg Glu Gly Ala Ser Arg

1 5 10 15

Lys Ile Leu Ser Lys Leu Ser Leu Pro Thr Arg Ala Trp Glu Pro Ala

20 25 30

Met Lys Lys Ser Phe Ala Phe Asp Asn Val Gly Tyr Glu Gly Gly Leu

35 40 45

Asp Gly Leu Gly Pro Ser Ser Gln Val Ala Thr Ser Thr Val Arg Ile

50 55 60

Leu Gly Met Thr Cys Gln Ser Cys Val Lys Ser Ile Glu Asp Arg Ile

65 70 75 80

Ser Asn Leu Lys Gly Ile Ile Ser Met Lys Val Ser Leu Glu Gln Gly

85 90 95

Ser Ala Thr Val Lys Tyr Val Pro Ser Val Val Cys Leu Gln Gln Val

100 105 110

Cys His Gln Ile Gly Asp Met Gly Phe Glu Ala Ser Ile Ala Glu Gly

115 120 125

Lys Ala Ala Ser Trp Pro Ser Arg Ser Leu Pro Ala Gln Glu Ala Val

130 135 140

Val Lys Leu Arg Val Glu Gly Met Thr Cys Gln Ser Cys Val Ser Ser

145 150 155 160

Ile Glu Gly Lys Val Arg Lys Leu Gln Gly Val Val Arg Val Lys Val

165 170 175

Ser Leu Ser Asn Gln Glu Ala Val Ile Thr Tyr Gln Pro Tyr Leu Ile

180 185 190

Gln Pro Glu Asp Leu Arg Asp His Val Asn Asp Met Gly Phe Glu Ala

195 200 205

Ala Ile Lys Ser Lys Val Ala Pro Leu Ser Leu Gly Pro Ile Asp Ile

210 215 220

Glu Arg Leu Gln Ser Thr Asn Pro Lys Arg Pro Leu Ser Ser Ala Asn

225 230 235 240

Gln Asn Phe Asn Asn Ser Glu Thr Leu Gly His Gln Gly Ser His Val

245 250 255

Val Thr Leu Gln Leu Arg Ile Asp Gly Met His Cys Lys Ser Cys Val

260 265 270

Leu Asn Ile Glu Glu Asn Ile Gly Gln Leu Leu Gly Val Gln Ser Ile

275 280 285

Gln Val Ser Leu Glu Asn Lys Thr Ala Gln Val Lys Tyr Asp Pro Ser

290 295 300

Cys Thr Ser Pro Val Ala Leu Gln Arg Ala Ile Glu Ala Leu Pro Pro

305 310 315 320

Gly Asn Phe Lys Val Ser Leu Pro Asp Gly Ala Glu Gly Ser Gly Thr

325 330 335

Asp His Arg Ser Ser Ser Ser His Ser Pro Gly Ser Pro Pro Arg Asn

340 345 350

Gln Val Gln Gly Thr Cys Ser Thr Thr Leu Ile Ala Ile Ala Gly Met

355 360 365

Thr Cys Ala Ser Cys Val His Ser Ile Glu Gly Met Ile Ser Gln Leu

370 375 380

Glu Gly Val Gln Gln Ile Ser Val Ser Leu Ala Glu Gly Thr Ala Thr

385 390 395 400

Val Leu Tyr Asn Pro Ser Val Ile Ser Pro Glu Glu Leu Arg Ala Ala

405 410 415

Ile Glu Asp Met Gly Phe Glu Ala Ser Val Val Ser Glu Ser Cys Ser

420 425 430

Thr Asn Pro Leu Gly Asn His Ser Ala Gly Asn Ser Met Val Gln Thr

435 440 445

Thr Asp Gly Thr Pro Thr Ser Val Gln Glu Val Ala Pro His Thr Gly

450 455 460

Arg Leu Pro Ala Asn His Ala Pro Asp Ile Leu Ala Lys Ser Pro Gln

465 470 475 480

Ser Thr Arg Ala Val Ala Pro Gln Lys Cys Phe Leu Gln Ile Lys Gly

485 490 495

Met Thr Cys Ala Ser Cys Val Ser Asn Ile Glu Arg Asn Leu Gln Lys

500 505 510

Glu Ala Gly Val Leu Ser Val Leu Val Ala Leu Met Ala Gly Lys Ala

515 520 525

Glu Ile Lys Tyr Asp Pro Glu Val Ile Gln Pro Leu Glu Ile Ala Gln

530 535 540

Phe Ile Gln Asp Leu Gly Phe Glu Ala Ala Val Met Glu Asp Tyr Ala

545 550 555 560

Gly Ser Asp Gly Asn Ile Glu Leu Thr Ile Thr Gly Met Thr Cys Ala

565 570 575

Ser Cys Val His Asn Ile Glu Ser Lys Leu Thr Arg Thr Asn Gly Ile

580 585 590

Thr Tyr Ala Ser Val Ala Leu Ala Thr Ser Lys Ala Leu Val Lys Phe

595 600 605

Asp Pro Glu Ile Ile Gly Pro Arg Asp Ile Ile Lys Ile Ile Glu Glu

610 615 620

Ile Gly Phe His Ala Ser Leu Ala Gln Arg Asn Pro Asn Ala His His

625 630 635 640

Leu Asp His Lys Met Glu Ile Lys Gln Trp Lys Lys Ser Phe Leu Cys

645 650 655

Ser Leu Val Phe Gly Ile Pro Val Met Ala Leu Met Ile Tyr Met Leu

660 665 670

Ile Pro Ser Asn Glu Pro His Gln Ser Met Val Leu Asp His Asn Ile

675 680 685

Ile Pro Gly Leu Ser Ile Leu Asn Leu Ile Phe Phe Ile Leu Cys Thr

690 695 700

Phe Val Gln Leu Leu Gly Gly Trp Tyr Phe Tyr Val Gln Ala Tyr Lys

705 710 715 720

Ser Leu Arg His Arg Ser Ala Asn Met Asp Val Leu Ile Val Leu Ala

725 730 735

Thr Ser Ile Ala Tyr Val Tyr Ser Leu Val Ile Leu Val Val Ala Val

740 745 750

Ala Glu Lys Ala Glu Arg Ser Pro Val Thr Phe Phe Asp Thr Pro Pro

755 760 765

Met Leu Phe Val Phe Ile Ala Leu Gly Arg Trp Leu Glu His Leu Ala

770 775 780

Lys Ser Lys Thr Ser Glu Ala Leu Ala Lys Leu Met Ser Leu Gln Ala

785 790 795 800

Thr Glu Ala Thr Val Val Thr Leu Gly Glu Asp Asn Leu Ile Ile Arg

805 810 815

Glu Glu Gln Val Pro Met Glu Leu Val Gln Arg Gly Asp Ile Val Lys

820 825 830

Val Val Pro Gly Gly Lys Phe Pro Val Asp Gly Lys Val Leu Glu Gly

835 840 845

Asn Thr Met Ala Asp Glu Ser Leu Ile Thr Gly Glu Ala Met Pro Val

850 855 860

Thr Lys Lys Pro Gly Ser Thr Val Ile Ala Gly Ser Ile Asn Ala His

865 870 875 880

Gly Ser Val Leu Ile Lys Ala Thr His Val Gly Asn Asp Thr Thr Leu

885 890 895

Ala Gln Ile Val Lys Leu Val Glu Glu Ala Gln Met Ser Lys Ala Pro

900 905 910

Ile Gln Gln Leu Ala Asp Arg Phe Ser Gly Tyr Phe Val Pro Phe Ile

915 920 925

Ile Ile Met Ser Thr Leu Thr Leu Val Val Trp Ile Val Ile Gly Phe

930 935 940

Ile Asp Phe Gly Val Val Gln Arg Tyr Phe Pro Asn Pro Asn Lys His

945 950 955 960

Ile Ser Gln Thr Glu Val Ile Ile Arg Phe Ala Phe Gln Thr Ser Ile

965 970 975

Thr Val Leu Cys Ile Ala Cys Pro Cys Ser Leu Gly Leu Ala Thr Pro

980 985 990

Thr Ala Val Met Val Gly Thr Gly Val Ala Ala Gln Asn Gly Ile Leu

995 1000 1005

Ile Lys Gly Gly Lys Pro Leu Glu Met Ala His Lys Ile Lys Thr Val

1010 1015 1020

Met Phe Asp Lys Thr Gly Thr Ile Thr His Gly Val Pro Arg Val Met

1025 1030 1035 1040

Arg Val Leu Leu Leu Gly Asp Val Ala Thr Leu Pro Leu Arg Lys Val

1045 1050 1055

Leu Ala Val Val Gly Thr Ala Glu Ala Ser Ser Glu His Pro Leu Gly

1060 1065 1070

Val Ala Val Thr Lys Tyr Cys Lys Glu Glu Leu Gly Thr Glu Thr Leu

1075 1080 1085

Gly Tyr Cys Thr Asp Phe Gln Ala Val Pro Gly Cys Gly Ile Gly Cys

1090 1095 1100

Lys Val Ser Asn Val Glu Gly Ile Leu Ala His Ser Glu Arg Pro Leu

1105 1110 1115 1120

Ser Ala Pro Ala Ser His Leu Asn Glu Ala Gly Ser Leu Pro Ala Glu

1125 1130 1135

Lys Asp Ala Val Pro Gln Thr Phe Ser Val Leu Ile Gly Asn Arg Glu

1140 1145 1150

Trp Leu Arg Arg Asn Gly Leu Thr Ile Ser Ser Asp Val Ser Asp Ala

1155 1160 1165

Met Thr Asp His Glu Met Lys Gly Gln Thr Ala Ile Leu Val Ala Ile

1170 1175 1180

Asp Gly Val Leu Cys Gly Met Ile Ala Ile Ala Asp Ala Val Lys Gln

1185 1190 1195 1200

Glu Ala Ala Leu Ala Val His Thr Leu Gln Ser Met Gly Val Asp Val

1205 1210 1215

Val Leu Ile Thr Gly Asp Asn Arg Lys Thr Ala Arg Ala Ile Ala Thr

1220 1225 1230

Gln Val Gly Ile Asn Lys Val Phe Ala Glu Val Leu Pro Ser His Lys

1235 1240 1245

Val Ala Lys Val Gln Glu Leu Gln Asn Lys Gly Lys Lys Val Ala Met

1250 1255 1260

Val Gly Asp Gly Val Asn Asp Ser Pro Ala Leu Ala Gln Ala Asp Met

1265 1270 1275 1280

Gly Val Ala Ile Gly Thr Gly Thr Asp Val Ala Ile Glu Ala Ala Asp

1285 1290 1295

Val Val Leu Ile Arg Asn Asp Leu Leu Asp Val Val Ala Ser Ile His

1300 1305 1310

Leu Ser Lys Arg Thr Val Arg Arg Ile Arg Ile Asn Leu Val Leu Ala

1315 1320 1325

Leu Ile Tyr Asn Leu Val Gly Ile Pro Ile Ala Ala Gly Val Phe Met

1330 1335 1340

Pro Ile Gly Ile Val Leu Gln Pro Trp Met Gly Ser Ala Ala Met Ala

1345 1350 1355 1360

Ala Ser Ser Val Ser Val Val Leu Ser Ser Leu Gln Leu Lys Cys Tyr

1365 1370 1375

Lys Lys Pro Asp Leu Glu Arg Tyr Glu Ala Gln Ala His Gly His Met

1380 1385 1390

Lys Pro Leu Thr Ala Ser Gln Val Ser Val His Ile Gly Met Asp Asp

1395 1400 1405

Arg Trp Arg Asp Ser Pro Arg Ala Thr Pro Trp Asp Gln Val Ser Tyr

1410 1415 1420

Val Ser Gln Val Ser Leu Ser Ser Leu Thr Ser Asp Lys Pro Ser Arg

1425 1430 1435 1440

His Ser Ala Ala Ala Asp Asp Asp Gly Asp Lys Trp Ser Leu Leu Leu

1445 1450 1455

Asn Gly Arg Asp Glu Glu Gln Tyr Ile

1460 1465

<210> 6

<211> 19

<212> DNA

<213> artificial sequence

<400> 6

atgcctgagc aggagagac 19

<210> 7

<211> 32

<212> DNA

<213> artificial sequence

<400> 7

gccactgctc tggtctgaga agaagggccc ag 32

<210> 8

<211> 32

<212> DNA

<213> artificial sequence

<400> 8

gcccttcttc tcagaccaga gcagtggcac cg 32

<210> 9

<211> 22

<212> DNA

<213> artificial sequence

<400> 9

ttagatgtac tgctcctcat cc 22

<210> 10

<211> 49

<212> DNA

<213> artificial sequence

<400> 10

atagggagac ccaagctggc tagcgccacc atgcctgagc aggagagac 49

<210> 11

<211> 42

<212> DNA

<213> artificial sequence

<400> 11

gctggatatc tgcagaattc ttagatgtac tgctcctcat cc 42

<210> 12

<211> 53

<212> DNA

<213> artificial sequence

<400> 12

atagggagac ccaagctggc tagcgccacc atggagcagg agagacagat cac 53

<210> 13

<211> 42

<212> DNA

<213> artificial sequence

<400> 13

gctggatatc tgcagaattc ttagatgtac tgctcctcat cc 42

Claims (12)

1. A truncated ATP7B gene with increased expression level, wherein the nucleotide sequence of said gene comprises the full length and/or fragments thereof as shown in Seq ID No. 1.

2. The truncated ATP7B gene of claim 1, wherein the amino acid sequence of said gene comprises the full length of Seq ID No.2 and/or fragments thereof.

3. The truncated ATP7B gene of claim 1, wherein the nucleotide sequence of the gene comprises a kozak sequence.

4. The truncated ATP7B gene according to claim 3, wherein the nucleotide sequence of the kozak sequence comprises the full length shown in Seq ID No.3 and/or a fragment thereof.

5. A recombinant adenoviral vector rAAV comprising the truncated ATP7B gene nucleotide of claim 1.

6. The recombinant adenovirus vector according to claim 5, wherein the adenovirus is selected from one or more of AAV types 2, 5, 8 and 9.

7. The use of the recombinant adenoviral vector of claim 5 or 6 in the preparation of a medicament for the treatment of wilson's disease.

8. A drug for treating Wilson's disease, which comprises the truncated ATP7B gene of any one of claims 1 to 4, in its full length and/or a fragment thereof.

9. The medicament of claim 8, further comprising any pharmaceutically acceptable adjuvants and/or adjuvants.

10. A method for preparing a truncated ATP7B gene with an increased expression level, comprising the steps of:

1) Designing two primer pairs, and removing metal binding domains 1-4 in the ATP7B full-length gene by using an overlapping PCR technology to obtain a truncated mutant gene fragment tATP7B, wherein the sequence of a forward primer F1 of the first primer pair is shown as Seq ID No. 6; the reverse primer R1 has a sequence shown as Seq ID No. 7; the sequence of the forward primer F2 of the second primer pair is shown as Seq ID No. 8; the reverse primer R1 has a sequence shown as Seq ID No. 9;

2) Designing a group of primers to carry out PCR amplification by taking the tATP7B gene as a template, and loading a product obtained after amplification into a carrier to obtain a tATP7B plasmid;

3) And (3) designing a group of primers by using the tATP7B plasmid as a template for further PCR amplification to obtain the truncated ATP7B gene with the improved expression level.

11. The method of claim 10, wherein the tATP7B gene is used as a template for PCR amplification, and the sequence of the forward primer F is shown in Seq ID No.10, and the sequence of the reverse primer R is shown in Seq ID No. 11.

12. The method according to claim 10, wherein PCR amplification is performed using the ta tp7B plasmid as a template, and wherein a forward primer F has a sequence shown as Seq ID No.12 and a reverse primer R has a sequence shown as Seq ID No. 13.

Images