CN115197949A - Recombinant Newcastle disease virus rNDV-OX40L, genome thereof, preparation method and application thereof - Google Patents
Recombinant Newcastle disease virus rNDV-OX40L, genome thereof, preparation method and application thereof Download PDFInfo
- Publication number
- CN115197949A CN115197949A CN202110394653.2A CN202110394653A CN115197949A CN 115197949 A CN115197949 A CN 115197949A CN 202110394653 A CN202110394653 A CN 202110394653A CN 115197949 A CN115197949 A CN 115197949A
- Authority
- CN
- China
- Prior art keywords
- cancer
- newcastle disease
- disease virus
- recombinant newcastle
- rndv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/768—Oncolytic viruses not provided for in groups A61K35/761 - A61K35/766
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/155—Paramyxoviridae, e.g. parainfluenza virus
- A61K39/17—Newcastle disease virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
- C07K14/08—RNA viruses
- C07K14/115—Paramyxoviridae, e.g. parainfluenza virus
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70575—NGF/TNF-superfamily, e.g. CD70, CD95L, CD153, CD154
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
- C12N2760/18121—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
- C12N2760/18122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
- C12N2760/18132—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
Abstract
The invention relates to a recombinant newcastle disease virus genome, a recombinant newcastle disease virus rNDV-OX40L containing the genome, a preparation method thereof, a DNA molecule for coding the recombinant newcastle disease virus genome and application of the DNA molecule in preparing a medicament for treating or improving cancer. The recombinant newcastle disease virus provided by the invention has the advantages that the coding gene of OX40L is inserted into the genome of the recombinant newcastle disease virus, so that the obtained recombinant newcastle disease virus improves the oncolytic efficiency and shows a good tumor treatment effect.
Description
Technical Field
The invention belongs to the field of cancer treatment, and particularly relates to a recombinant newcastle disease virus genome, a recombinant newcastle disease virus containing the genome, a preparation method of the recombinant newcastle disease virus, a DNA molecule for encoding the recombinant newcastle disease virus genome and application of the recombinant newcastle disease virus genome and the DNA molecule.
Background
Cancer has become the first killer to affect health. China is a high incidence area of cancers, particularly lung cancer, gastric cancer, liver cancer and rectal cancer. According to statistics, 480 ten thousand of cancer patients are newly increased in one year in 2016, and 230 ten thousand of cancer patients die from various cancers. With the technological progress, various new therapeutic means, especially biopharmaceutical therapy, are continuously put into clinical use. However, the requirements of the safety, effectiveness and quality of life of patients are far from being met. Development of new drugs or therapeutic means is imperative.
In 1991, martuza et al, in the journal "Science", published a test that demonstrated certain efficacy of transgenic herpes simplex virus in the treatment of glioblastoma. Since then, there has been increasing interest in developing oncolytic viruses for the treatment of cancer. The principle of oncolytic virus therapy for cancer is that some viruses with weak pathogenicity existing in nature are subjected to genetic modification, so that the viruses selectively infect tumor cells, largely replicate in the cells and finally destroy the tumor cells. At the same time, it can stimulate immune reaction, attract immune cells to continuously kill residual cancer cells or kill cancer cells which have migrated through immune reaction. In recent decades, research related to oncolytic viruses has made tremendous progress. People develop oncolytic viruses by using Newcastle Disease Virus (NDV), herpes simplex virus type 1 (HSV-1), reovirus (reovirus) and oncolytic adenovirus (oncolytical adenovirus) in sequence, and animal experiments show that the oncolytic viruses are safe and effective. But the clinical manifestations are far below expectations. The inventors note that these poor clinical manifestations are related to current oncolytic virus design strategies.
NDV is an avian paramyxovirus with a negative-sense single-stranded RNA genome, which has been a promising approach for cancer treatment. However, NDV has limited effectiveness as a single agent therapy, on the one hand, the human body's antiviral immune response is able to eliminate the virus, and on the other hand, the human body is able to produce neutralizing antibodies to act against the virus. To increase the therapeutic efficiency of NDV in cancer, these viruses are subsequently used to deliver genes with anti-tumor activity, which would be expected to further enhance activity. Such genes include genes encoding immune checkpoint molecules, tumor suppressor proteins, or immunostimulatory proteins.
However, the therapeutic effect of NDV in combination with certain immune checkpoint inhibitors is not ideal in tumor animal models, and the clinical response rate of NDV in combination with PD1 antibodies is limited, which makes some patients not receive effective treatment, but oncolytic viruses in combination with certain immune checkpoint inhibitors, immunostimulatory molecules, such as immune checkpoint LAG-3 (Lymphocyte-activation gene 3), sirpa (Signal regulatory protein α), CTLA-4 (cytotoxic T Lymphocyte-associated protein 4), TIGIT (T cell immunoglobulin and ITIM domain), immune co-stimulatory molecules ICOS (inductor costimulatory), OX40 (TNFRSF 4, CD 134), 4-1BB (TNFRSF 9, CD 137), etc., are still under investigation.
LAG-3 belongs to the immunoglobulin superfamily, and consists of 3 parts of extracellular, transmembrane and cytoplasmic regions. The gene for LAG-3 maps to chromosome 12 (12P 13), similar to the location and structure of the CD4 molecule on chromosomes. The inhibition of LAG-3 can make T cells regain cytotoxicity, thereby enhancing the killing effect on tumors, and the inhibition of LAG-3 can also reduce the function of regulating T cells to suppress immune response. Thus, LAG-3 is considered to be a more attractive target than other immune checkpoint proteins.
SIRP alpha is a transmembrane protein, the extracellular domain of which consists of 3 Ig-like domains and the cytoplasmic domain (containing immunoreceptor tyrosine inhibition motifs which mediate the binding of protein tyrosine phosphatases SHP1 and SHP 2). Sirpa is particularly abundant in myeloid cells such as macrophages and Dendritic Cells (DCs), while it is expressed at very low levels in T, B, NK and NKT cells. Sirpa inhibits phagocytosis of macrophages after interacting with its ligand, CD47, which is normally upregulated on the surface of malignant cells. Therefore, antibodies that block the CD 47-sirpa interaction should enhance phagocytosis of macrophages in the tumor microenvironment, inhibiting tumor growth, making blocking CD 47-sirpa a promising tool for cancer immunotherapy.
Immune co-stimulatory factor OX40 ligand (OX 40L) is a member of the tumor necrosis factor ligand superfamily. Tumor necrosis factor ligand superfamily member 4 (TNFSF 4) is expressed on the surface of antigen presenting cells such as dendritic cells and B cells, and the receptor is OX40 expressed on the surface of activated T cells, and can provide T cell proliferation and stimulation signals, induce Th2 cells to generate cytokines, promote B cells to be differentiated into plasma cells, promote antibody production and the like.
Disclosure of Invention
Aiming at the technical problems that NDV has limited treatment effect and small response rate and tumor inhibition rate and the like as a single medicament and limits the development and utilization of oncolytic virus in clinic, the inventor of the invention provides a recombinant oncolytic virus through research, selects the typical immune check point and immune co-stimulatory factor ligand to construct the recombinant Newcastle disease virus, and aims to improve the anti-tumor immunity of the virus and enhance the oncolytic effect of the virus. Through pharmacodynamic tests, the inventor unexpectedly finds that compared with other immune checkpoints, the NDV combined with OX40L can overcome the problem of poor anti-tumor immune effect of viruses, and can remarkably inhibit tumors: OX40L is used as an immune co-stimulatory molecule and can activate T cells, and the biological effect generated by the T cells can effectively kill tumor cells; in addition, because NDV has tumor specificity, tumor cells can be selectively infected, so that the effect of OX40L is more targeted, more tumor infiltrating lymphocytes can be stimulated to generate at the tumor part, and stronger immune response is generated, thereby showing more remarkable treatment effect. The oncolytic virus is a recombinant Newcastle disease virus which is transformed by genetic engineering, can be replicated in cancer cells with stronger replication capacity to kill host cancer cells, and has reliable safety for non-cancer cells.
In one aspect, the invention provides a recombinant newcastle disease virus genome, wherein the genome comprises a gene encoding OX40L, and the gene encoding OX40L is located between a P gene and an M gene of the newcastle disease virus genome.
In another aspect, the present application provides a recombinant newcastle disease virus, wherein the virus comprises the recombinant newcastle disease virus genome described above.
In yet another aspect, the present application provides a DNA molecule encoding the recombinant newcastle disease virus genome described above.
In yet another aspect, the present application provides a pharmaceutical composition, wherein the pharmaceutical composition comprises the above-described recombinant newcastle disease virus genome, recombinant newcastle disease virus and/or DNA molecule.
In another aspect, the present application provides a method for preparing the above recombinant newcastle disease virus, comprising:
(1) Carrying out enzyme digestion on a cloning vector containing a DNA sequence of an OX40L encoding gene and an NDV viral vector respectively, and connecting the DNA sequence of the OX40L encoding gene obtained by enzyme digestion with the NDV viral vector to obtain a recombinant Newcastle disease virus plasmid;
(2) Transfecting the recombinant newcastle disease virus plasmid into cells and culturing the transfected cells to obtain the recombinant newcastle disease virus.
In a further aspect, the present application provides the use of a recombinant newcastle disease virus genome, a recombinant newcastle disease virus, DNA molecule and/or pharmaceutical composition as described above in the manufacture of a medicament for the treatment or amelioration of cancer.
The recombinant newcastle disease virus prepared by the invention obviously improves the anti-tumor effect and the oncolytic efficiency of the oncolytic virus.
Drawings
In order to more clearly illustrate the exemplary embodiments of the present invention, reference will now be made briefly to the accompanying drawings, which are to be understood as merely illustrative of certain embodiments of the invention and therefore should not be taken as limiting the scope of protection.
FIG. 1 shows the genomic framework of recombinant Newcastle disease virus rNDV-OX 40L.
FIG. 2 shows growth curves of parental strain rNDV and recombinant Newcastle disease viruses rNDV-hOX40L (a) and rNDV-mOX40L (b).
FIG. 3 shows the expression of OX40L protein in parental strain rNDV as well as recombinant Newcastle disease virus rNDV-mOX40L (a) and rNDV-hOX40L (b) treated cells.
FIG. 4 shows the inhibition of tumors in a mouse colon cancer model by parental strain rNDV and recombinant Newcastle disease virus rNDV-mOX40L, rNDV-Lag3 and rNDV-SIRP alpha.
FIG. 5 shows that rNDV-mOX40L induces tumor necrosis and tumor-infiltrating T-lymphocytosis.
FIG. 6 shows that rNDV-mOX40L stimulates splenic T lymphocytosis.
FIG. 7 shows that rNDV-mOX40L induces OX40+ T lymphocytosis at the tumor site.
FIG. 8 shows that rNDV-mOX40L induces increased tumor site interferon- γ, perforin and granzyme B expression.
FIG. 9 shows inhibition of mouse liver cancer model tumor growth by rClone30-Anh- (F) treatment group and recombinant Newcastle disease virus rClone30-Anh- (F) -SIRPa treatment group, rClone30-Anh- (F) -Lang 3 treatment group and rClone30-Anh- (F) -mOX40L treatment group.
FIG. 10 shows the genomic sequence of recombinant Newcastle disease virus rNDV-hOX40L prepared in example 1.
FIG. 11 shows the genomic sequence of recombinant Newcastle disease virus rNDV-mOX40L prepared in example 1.
FIG. 12 shows the genomic sequence of recombinant Newcastle disease virus rClone30-Anh- (F) -hOX40L prepared in example 9.
FIG. 13 shows the genomic sequence of recombinant Newcastle disease virus rClone30-Anh- (F) -mOX40L prepared in example 9.
Detailed Description
Next, exemplary embodiments of the present invention will be described, but the scope of the present invention is not limited thereto.
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. See, e.g., singleton et al, dictionary of Microbiology and Molecular Biology 2nd ed, J.Wiley & Sons (New York, NY 1994); sambrook et al, molecular Cloning, A Laboratory Manual, cold Springs Harbor Press (Cold Springs Harbor, NY 1989).
As used herein, unless otherwise indicated, the term "treating" or "treatment" means curing, alleviating, relieving, slowing, alleviating or ameliorating a disease or disease-related symptoms, or preventing, delaying, arresting, suspending or stopping the onset or further development of a disease or related symptoms in a statistically significant manner.
The invention constructs a recombinant Newcastle disease virus (rNDV-OX 40L) expressing OX40L by using a reverse genetic manipulation technology. The coding gene of OX40L is inserted between the P gene and the M gene of the newcastle disease virus vector, and then the recombinant newcastle disease virus plasmid (prNDV-OX 40L) and the helper plasmid are cotransfected with BHK-21 cells to carry out the rescue of the recombinant newcastle disease virus. The ability of recombinant newcastle disease virus to express OX40L was examined at the cellular level by measuring the proliferation profile of recombinant newcastle disease virus by DF-1 cells. Meanwhile, a mouse colon cancer and liver cancer model proves that the recombinant Newcastle disease virus rNDV-OX40L has more targeting property, can obviously reduce the tumor volume, induce tumor necrosis and tumor infiltrating T lymphocyte proliferation, stimulate spleen T lymphocyte proliferation, induce tumor part OX40+ T lymphocyte proliferation and induce tumor part interferon-gamma, perforin and granzyme B expression proliferation, thereby generating stronger immunoreaction and showing higher tumor dissolving efficiency.
Newcastle Disease Virus (NDV) is known to belong to the Paramyxoviridae, order Mononegavirales, and has an envelope; the nucleocapsid is located within the envelope and contains the RNA genome and the nucleocapsid protein. The genome of classical newcastle disease virus has a full length of about 15-16 kb, and comprises an NP gene, a P gene, an M gene, an F gene, an HN gene and an L gene from 3 'to 5' in sequence, and is used to encode the following 6 major proteins: nucleocapsid Protein (NP), phosphoprotein (P), matrix Protein (M), fusion Protein (F), hemagglutinin-Neuraminidase Protein (HN), and RNA-dependent RNA polymerase (Large Protein, L). Herein, the open reading frame of immune co-stimulatory molecule is inserted into the sequence between P gene and M gene of NDV genome through GE, GS, and SacII, pmeI restriction endonuclease site is introduced at both ends, matching with the enzyme cutting site of NDV vector.
In one embodiment, the invention provides a recombinant newcastle disease virus genome, wherein the genome comprises a gene encoding OX40L, wherein the gene encoding OX40L is located between the P gene and the M gene of the newcastle disease virus genome.
In some preferred embodiments, the gene encoding OX40L can be in the form of DNA or RNA.
In some preferred embodiments, the gene encoding OX40L is the sequence shown in SEQ ID No.1 or SEQ ID No.2 or a sequence having at least 80% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity to said sequence. Herein, the sequence shown as SEQ ID NO.1 is as follows:
CAGGTATCACATCGGTATCCTCGAATTCAAAGTATCAAAGTACAATTTACCGAATATAAGAAGGAGAAAGGTTTCATCCTCACTTCCCAAAAGGAGGATGAAATCATGAAGGTGCAGAACAACTCAGTCATCATCAACTGTGATGGGTTTTATCTCATCTCCCTGAAGGGCTACTTCTCCCAGGAAGTCAACATTAGCCTTCATTACCAGAAGGATGAGGAGCCCCTCTTCCAACTGAAGAAGGTCAGGTCTGTCAACTCCTTGATGGTGGCCTCTCTGACTTACAAAGACAAAGTCTACTTGAATGTGACCACTGACAATACCTCCCTGGATGACTTCCATGTGAATGGCGGAGAACTGATTCTTATCCATCAAAATCCTGGTGAATTCTGTGTCCTTTGA。
the sequence shown as SEQ ID NO.2 is as follows:
CAACTCTCTTCCTCTCCGGCAAAGGACCCTCCAATCCAAAGACTCAGAGGAGCAGTTACCAGATGTGAGGATGGGCAACTATTCATCAGCTCATACAAGAATGAGTATCAAACTATGGAGGTGCAGAACAATTCGGTTGTCATCAAGTGTGATGGGCTTTATATCATCTACCTGAAGGGCTCCTTTTTCCAGGAGGTCAAGATTGACCTTCATTTCCGGGAGGATCATAATCCCATCTCTATTCCAATGCTGAACGATGGTCGAAGGATTGTCTTCACTGTGGTGGCCTCTTTGGCTTTCAAAGATAAAGTTTACCTGACTGTAAATGCTCCTGATACTCTCTGCGAACACCTCCAGATAAATGATGGGGAGCTGATTGTTGTCCAGCTAACGCCTGGATACTGTGCTCCTGAAGGATCTTACCACAGCACTGTGAACCAAGTACCACTGTGA。
in some preferred embodiments, the sequence of the recombinant newcastle disease virus genome is shown as SEQ ID No.3, SEQ ID No.4, SEQ ID No.7 or SEQ ID No.8 (see fig. 10-13 for the respective sequences).
In one embodiment, the present application provides a recombinant newcastle disease virus, wherein the virus comprises a recombinant newcastle disease virus genome as described above.
In some preferred embodiments, the starting strain of newcastle disease virus may be: low virulent strains LaSota, hitchner B1 and V4, medium virulent strains Muktesvar and Anhinga, and virulent strains F48E9, JS/7/05/Ch, italien, herts/33 and NDV-BJ; and any chimeric strain constructed by genetic engineering means based on the starting strain, but is not limited thereto.
In one embodiment, the present application provides a DNA molecule (e.g., a recombinant newcastle disease virus plasmid) encoding a recombinant newcastle disease virus genome as described above.
In one embodiment, the present application provides a pharmaceutical composition, wherein the pharmaceutical composition comprises the recombinant newcastle disease virus genome, recombinant newcastle disease virus and/or DNA molecule described above.
In some preferred embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient. The pharmaceutically acceptable pharmaceutical excipients may be selected from, for example, but not limited to, solvents, propellants, solubilizers, solubilizing agents, emulsifiers, colorants, disintegrants, fillers, lubricants, wetting agents, tonicity adjusting agents, stabilizers, glidants, flavoring agents, preservatives, suspending agents, antioxidants, permeation enhancers, pH adjusting agents, surfactants, diluents, and the like. For other pharmaceutically acceptable pharmaceutical excipients, see for example handbook of pharmaceutical excipients (4 th edition), r.c. lo et al, zheng Ze folk editions, 2005, chemical industry press.
In one embodiment, the present application provides a method of preparing the above recombinant newcastle disease virus, comprising:
(1) Carrying out enzyme digestion on a cloning vector containing a DNA sequence of an OX40L encoding gene and an NDV viral vector respectively, and connecting the DNA sequence of the OX40L encoding gene obtained by enzyme digestion with the NDV viral vector to obtain a recombinant Newcastle disease virus plasmid;
(2) Transfecting the recombinant newcastle disease virus plasmid into cells and culturing the transfected cells to obtain the recombinant newcastle disease virus.
In some preferred embodiments, the cloning vector may be constructed using a vector selected from the group consisting of: PUC57 vector, pMD18-T vector, pMD19-T vector, pBluescript SK (+/-) vector, pBluescript II KS (+/-).
In some preferred embodiments, the NDV viral vector may be a full-length cDNA sequence of the genome of an NDV virus selected from the group consisting of: the low virulent strains LaSota, hitchner B1 and V4, the medium virulent strains Muktesfar and Anhinga, the high virulent strains F48E9, JS/7/05/Ch, italien, herts/33 and NDV-BJ, but not limited thereto.
Herein, the recombinant newcastle disease virus plasmid is co-transfected into the cell with helper plasmids NP, P and L (which may be any NP, P, L recombinant plasmid constructed onto any eukaryotic expression vector known in the art) capable of expressing nucleocapsid protein NP, phosphoprotein P and RNA-dependent RNA polymerase L. Herein, the genes of helper plasmids NP, P and L may be derived from any strain of NDV, such as LaSota, anhinga, F48E9, and the like. In some preferred embodiments, the recombinant newcastle disease virus plasmid is co-transfected into the cell with a helper plasmid selected from the group consisting of: pTM-NP, pTM-P and pTM-L; pCI-neo-NP, pCI-neo-P, and pCI-neo-L; or pBluescript II KS (+/-) -NP, pBluescript II KS (+/-) -P, and pBluescript II KS (+/-) -L, but is not limited thereto.
Herein, transfection is a technique for introducing exogenous nucleic acid substances (including DNA and RNA) into cells, and mainly includes three types of pathways, namely, physical mediation (electroporation, microinjection, and gene gun), chemical mediation (calcium phosphate coprecipitation, lipofection, cationic substance mediation), and biological mediation (protoplast transfection, virus-mediated transfection). Specific procedures can be performed by those skilled in the art by selecting appropriate experimental conditions and procedures based on general knowledge in the art (see, for example, molecular cloning guidelines (4 th edition), editions by j. Sambrook et al, initials He Fuchu, scientific publishers, 2017) or according to instructions in commercially available kits.
In some preferred embodiments, the cell may be selected from, but is not limited to, BHK-21 cells, BSR-T7/5 cells, VERO cells, DF-1 cells, 293 cells, or MDCK cells.
In this context, the culture of the transfected cells can be carried out by those skilled in the art by selecting conventional media and culture conditions according to the type of the cells (item 5363, eds. Liu Bin, "cell culture (3 rd edition), book publishing company worldwide, 2018, month 01; langu, zhou Zhenhui, item cyto culture technology, chemical industry publishers, 2007, month 8; item Zhang Jingbo, item tissue and cell culture technology (3 rd edition), human health publishers, 2014, 06, etc.).
In one embodiment, the present application provides the use of a recombinant newcastle disease virus genome, a recombinant newcastle disease virus, DNA molecule and/or pharmaceutical composition as described above in the manufacture of a medicament for the treatment or amelioration of cancer.
In some preferred embodiments, the cancer may be selected from, but is not limited to: colon cancer, liver cancer (e.g., hepatocellular carcinoma), lung cancer (e.g., non-small cell lung cancer, small cell lung cancer), gastric cancer, rectal cancer, leukemia, lymphoma, ovarian cancer, breast cancer, endometrial cancer, bladder cancer, urothelial cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, esophageal cancer, renal cell cancer, thyroid cancer, head and neck cancer, testicular cancer, endocrine adenocarcinoma, adrenal cancer, pituitary cancer, skin cancer, soft tissue cancer, vascular cancer, brain cancer, neural cancer, eye cancer, meningeal cancer, oropharyngeal cancer, hypopharynx cancer, cervical cancer, myosarcoma, uterine cancer, glioblastoma, medulloblastoma, neuroblastoma, kidney cancer, astrocytoma, glioma, meningioma, gastrinoma, neuroblastoma, melanoma, acute myeloid leukemia, myelodysplastic syndrome, or sarcoma.
Exemplary aspects of the invention may be illustrated by the following numbered paragraphs:
1. a recombinant newcastle disease virus genome, wherein said genome comprises a gene encoding OX40L, wherein said gene encoding OX40L is located between the P gene and the M gene of the newcastle disease virus genome.
2. The recombinant newcastle disease virus genome of paragraph 1, wherein the gene encoding OX40L is in the form of DNA or RNA.
3. The recombinant newcastle disease virus genome of paragraph 1 or 2, wherein the coding gene of OX40L is a sequence shown as SEQ ID No.1 or SEQ ID No.2 or a sequence having at least 80% identity thereto.
4. The recombinant newcastle disease virus genome of any of paragraphs 1-3, wherein the sequence of the recombinant newcastle disease virus genome is shown as SEQ ID No.3, SEQ ID No.4, SEQ ID No.7 or SEQ ID No. 8.
5. A recombinant newcastle disease virus, wherein the virus comprises the recombinant newcastle disease virus genome of any of paragraphs 1-4.
6. The recombinant newcastle disease virus of paragraph 5, wherein the starting strain of newcastle disease virus is selected from: low virulent strains LaSota, hitchner B1 and V4, medium virulent strains Muktesvar and Anhinga, high virulent strains F48E9, JS/7/05/Ch, italien, herts/33 and NDV-BJ; and any chimeric strain constructed by genetic engineering means based on the starting strain.
7. A DNA molecule encoding the recombinant Newcastle disease virus genome of any of paragraphs 1-4.
8. A pharmaceutical composition comprising the recombinant newcastle disease virus genome of any of paragraphs 1-4, the recombinant newcastle disease virus of paragraph 5 or 6, and/or the DNA molecule of paragraph 7.
9. The recombinant newcastle disease virus of paragraph 8, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant.
10. The recombinant newcastle disease virus of paragraph 8 or 9, wherein the pharmaceutically acceptable pharmaceutical excipient is selected from a solvent, a propellant, a solubilizer, a cosolvent, an emulsifier, a colorant, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure regulator, a stabilizer, a glidant, a flavoring agent, a preservative, a suspending agent, an antioxidant, a permeation enhancer, a pH regulator, a surfactant, or a diluent.
11. A method of making the recombinant Newcastle disease virus of paragraph 5 or 6, comprising:
(1) Carrying out enzyme digestion on a cloning vector containing a DNA sequence of an OX40L encoding gene and an NDV viral vector respectively, and connecting the DNA sequence of the OX40L encoding gene obtained by enzyme digestion with the NDV viral vector to obtain a recombinant Newcastle disease virus plasmid;
(2) Transfecting the recombinant newcastle disease virus plasmid into cells and culturing the transfected cells to obtain the recombinant newcastle disease virus.
12. The method of paragraph 11 wherein the cloning vector is constructed using a vector selected from the group consisting of: PUC57 vector, pMD18-T vector, pMD19-T vector, pBluescript SK (+/-) vector, pBluescript II KS (+/-).
13. The method of paragraphs 11 or 12 wherein the NDV viral vector is a full-length cDNA sequence of the genome of an NDV virus selected from the group consisting of: the attenuated strains LaSota, hitchner B1 and V4, the intermediate strains Muktesfar and Anhinga, and the virulent strains F48E9, JS/7/05/Ch, italien, herts/33 and NDV-BJ.
14. The method of any of paragraphs 11-13, wherein the recombinant newcastle disease virus plasmid is co-transfected into the cell with a helper plasmid selected from the group consisting of: pTM-NP, pTM-P and pTM-L; pCI-neo-NP, pCI-neo-P, and pCI-neo-L; or pBluescript II KS (+/-) -NP, pBluescript II KS (+/-) -P, and pBluescript II KS (+/-) -L.
15. The method of any one of paragraphs 11-14, wherein the cell is selected from the group consisting of BHK-21 cells, BSR-T7/5 cells, VERO cells, DF-1 cells, 293 cells and MDCK cells.
16. Use of the recombinant newcastle disease virus genome of any of paragraphs 1-4, the recombinant newcastle disease virus of paragraph 5 or 6, the DNA molecule of paragraph 7, and/or the pharmaceutical composition of any of paragraphs 8-10 in the preparation of a medicament for treating or ameliorating cancer.
17. The use of paragraph 16 wherein the cancer is selected from: colon cancer, liver cancer, lung cancer, stomach cancer, rectal cancer, leukemia, lymphoma, ovarian cancer, breast cancer, endometrial cancer, bladder cancer, urothelial cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, esophageal cancer, renal cell cancer, thyroid cancer, head and neck cancer, testicular cancer, endocrine adenocarcinoma, adrenal cancer, pituitary cancer, skin cancer, soft tissue cancer, vascular cancer, brain cancer, neural cancer, eye cancer, meningeal cancer, oropharyngeal cancer, hypopharynx cancer, cervical cancer, myosarcoma, uterine cancer, glioblastoma, medulloblastoma, neuroblastoma, renal cancer, astrocytoma, glioma, meningioma, gastrinoma, neuroblastoma, melanoma, acute myeloid leukemia, myelodysplastic syndrome, or sarcoma.
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were carried out according to conventional conditions or conditions recommended by the manufacturer. Unless otherwise indicated, reagents, materials or equipment used are conventional products which are not indicated by the manufacturer and which are commercially available. The features and properties of the present invention are described in further detail below with reference to examples.
Examples
Unless otherwise indicated, the design, synthesis and cloning of the genes and the construction and transfection of vectors and electrophoresis of the genes involved IN the present application can be performed according to techniques known IN the art (see, for example, the description of Current promoters IN MOLECULAR BIOLOGY). Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
Example 1
The oncolytic virus rClone30-F48E9 (F) provided in the following examples as a parent strain was obtained by substituting the F gene of a virulent strain F48E9 of Newcastle disease virus (GenBank accession number: AY 508514.1) for the F gene of the Lasota strain according to the engineering method for "gene substitution" described in Wang Yong and the like (the influence of the substituted HN gene on the virulence of the Lasota strain of Newcastle disease virus, proc. Microbiol., 2008, 48 (5): 638-643), starting from the Newcastle disease virus Lasota (purchased from Harbin veterinary epidemic prevention station), and the parent strain is hereinafter designated rNDV. The genome of the OX 40L-expressing recombinant Newcastle disease virus of this example is shown in SEQ ID No.3 and SEQ ID No. 4; the nucleic acid sequence of OX40L is shown as SEQ ID NO.1 and SEQ ID NO. 2. Next, recombinant Newcastle disease virus plasmids and recombinant Newcastle disease virus NDV-OX40L were constructed by the following exemplary methods.
Human OX40L gene (NM-003326.5) and murine OX40L gene (U12763) were searched by Genebank, a foreign gene fragment was designed according to the 6-base principle, and after adding SacII and PmeI cleavage sites, respective DNA sequences of the foreign genes (vector pUC57 vector) were synthesized by Shanghai Biotech, to obtain plasmids pUC57-hOX40L (containing human OX40L gene) and pUC57-mOX40L (containing murine OX40L gene) containing foreign genes. Plasmid pUC57-hOX40L, pUC-mOX 40L and NDV vector (full-length cDNA sequence of genome of the rNDV strain) are subjected to bidirectional enzyme digestion by restriction enzymes SacII and PmeI (purchased from NEB company), enzyme digestion products are subjected to enzyme digestion identification through nucleic acid agarose gel electrophoresis, after the enzyme digestion identification is correct, agarose gel DNA recovery kit (purchased from Tiangen Biochemical technology (Beijing) Co., ltd., product number: DP 219) is adopted for gel recovery according to the instruction, and gene sequence determination is carried out on the gel recovery products. After purifying gel recovery products of each foreign gene OX40L and NDV vectors, which were correctly sequenced, with TaKaRa MiniBEST DNA fragmentation purification Kit (purchased from Takara, cat.: 9761), purified human OX40L gene purified products and mouse OX40L gene purified products were ligated with purified NDV vectors overnight at 4 ℃ using T4 DNA ligase (purchased from NEB) according to the instructions.
Transforming each ligation product into stbl2 escherichia coli (e.coli) competent cells, respectively, spreading the transformed competent cells on an LB plate containing 100 μ g/mL ampicillin, culturing in a bacterial incubator at 20 ℃ for 24 hours, selecting a single colony, inoculating the single colony in an ampicillin-resistant LB medium containing 100 μ g/mL ampicillin, culturing at 30 ℃ for 16-18 hours for amplification, after the amplification is finished, centrifuging at 12000rpm to collect a bacterial liquid, performing plasmid extraction by using a plasmid miniprep kit (purchased from beige biochem technologies, inc., product number: DP 103), performing enzyme digestion on the obtained plasmid by using SacII and PmeI enzymes (purchased from NEB) and performing enzyme digestion identification by using nucleic acid agarose gel electrophoresis, performing gene sequence determination on the plasmid subjected to enzyme digestion identification, and identifying whether the position and sequence of the exogenous gene OX40L are correct.
The enzyme digestion identification result shows that two strips are obtained, wherein the size of one strip is about 18000bp and is consistent with the size of an NDV (Newcastle disease Virus) vector; one is about 564bp or about 510bp in size, which is consistent with the sizes of the murine OX40L gene and the human OX40L gene respectively. The gene sequence determination result shows that the exogenous gene OX40L is positioned between the P gene and the M gene of the NDV vector, no mutation occurs, and the sequence alignment consistency is 100 percent. The successfully constructed recombinant Newcastle disease virus plasmids were designated prNDV-hOX40L (containing a human OX40L gene) and prNDV-mOX40L (containing a murine OX40L gene).
Next, rescue and identification of recombinant Newcastle disease virus was performed.
After the correctly identified recombinant Newcastle disease virus plasmids prNDV-hOX40L and prNDV-mOX40L were purified separately, 2. Mu.g of prNDV-hOX40L and 2. Mu.g of prNDV-mOX40L were co-transfected with helper plasmids pTM-NP (1. Mu.g), pTM-P (0.5. Mu.g) and pTM-L (0.25. Mu.g), respectively, through liposome 3000 BHK-21 cells (purchased from ATCC) in logarithmic growth phase, and after 72h, the cells were plated on-80The cells were lysed by freeze-thawing at 3 ℃ and then centrifuged at 800rpm to obtain cell supernatants. Inoculating 100 μ L of cell supernatant into 9-day-old SPF chick embryos, and after inoculation, placing the chick embryos in an incubator at 37 deg.C and 5% CO 2 After culturing for 72 hours, allantoic fluid was collected and assayed for hemagglutination titer (see, for example, methods described in Zhongling, li Yanfang, ma Xiali, isolation and identification of a strain of Newcastle disease virus of chicken origin [ J]Zhejiang stockbreeding veterinarians 2015, 40 (03): 8-10) determine whether rescue was successful. The successfully rescued recombinant Newcastle disease viruses were named rNDV-hOX40L and rNDV-mOX40L, respectively.
Viral RNA in the allantoic fluid was extracted using a viral RNA extraction kit (purchased from Tiangen Biochemical technology (Beijing) Ltd., product number: DP 315-R), and purity and gene sequence of rNDV-hOX40L and rNDV-mOX40L were identified by RT-PCR (Thermo Fisher RT-PCR kit, cDNA first strand synthesis and PCR according to the instructions; PCR primer 5 'TCAAGCGCCTTGCTCCTAAATGGC 3' (SEQ ID NO. 5); downstream primer 5 'GGGCAGAATCAAAGTACAGCCAAT 3' (SEQ ID NO. 6)), nucleic acid agarose gel electrophoresis, and gene sequencing.
The result of nucleic acid agarose gel electrophoresis shows that the purities of the recombinant Newcastle disease virus rNDV-hOX40L and rNDV-mOX40L are both higher, and no pollution is caused by other Newcastle disease viruses; the sequencing result of the PCR product shows that the exogenous gene OX40L in the successfully rescued recombinant Newcastle disease viruses rNDV-hOX40L and rNDV-mOX40L has no mutation, and the sequence consistency is 100 percent after sequence comparison.
The effect of the insertion of the foreign gene on the replication ability of the virus and the ability of the recombinant viruses rNDV-hOX40L and rNDV-mOX40L obtained as described above to grow at the cellular level were identified by the following methods.
The DF-1 cells (purchased from Wuhan puzzo) were infected with rNDV-hOX40L and rNDV-mOX40L at 1MOI (multiplicity of infection) for 12h, 24h, 36h, 48h, 60h and 72h, respectively, and rNDV as a control, the TCID50 of the virus contained in the cell supernatants at different time points was examined, and the growth curves of recombinant viruses rNDV-hOX40L (FIG. 2 (a)) and rNDV-mOX40L (FIG. 2 (b)) relative to rNDV were plotted, respectively. The results show that the recombinant viruses rNDV-hOX40L and rNDV-mOX40L are consistent with the growth characteristics of rNDV, indicating that the insertion of foreign genes does not affect the replication capacity of the viruses, and that both the recombinant viruses rNDV-hOX40L and rNDV-mOX40L show good growth capacity at the cellular level (the results are shown in FIG. 2).
Example 2
The titer, virulence and virulence of recombinant Newcastle disease viruses rNDV-hOX40L and rNDV-mOX40L were determined by the following methods.
To compare the titer, virulence and virulence of rNDV with recombinant Newcastle disease viruses rNDV-hOX40L and rNDV-mOX40L, recombinant Newcastle disease viruses rNDV-hOX40L and rNDV-mOX40L and rNDV were propagated in bulk according to the methods disclosed in the OIE standards, allantoic fluids of the parental strains rNDV and recombinant Newcastle disease viruses rNDV-hOX40L and rNDV-mOX40L were collected and titer was determined by the hemagglutination titer (HA) assay as described in example 1, virulence was determined by TCID50, EID50, MDT according to the methods disclosed in the OIE standards and virulence was determined by ICPI according to the methods disclosed in the OIE standards.
The result of the hemagglutination titer detection shows that in the hemagglutination titer detection of the recombinant Newcastle disease virus rNDV-mOX40L, the hemagglutination titer (HA) of the rNDV is 2 9 And the hemagglutination titer (HA) of rNDV-mOX40L is 2 9 (ii) a In the hemagglutination titer detection of the recombinant Newcastle disease virus rNDV-hOX40L, the hemagglutination titer (HA) of the rNDV is 2 10 And the hemagglutination titer (HA) of rNDV-hOX40L is 2 10 . The virulence determination result shows that the virulence of the rNDV is not obviously different from that of the recombinant Newcastle disease viruses rNDV-hOX40L and rNDV-mOX40L. The results of the pathogenicity assay showed no significant difference in the pathogenicity of rNDV and recombinant Newcastle disease viruses rNDV-hOX40L and rNDV-mOX40L (see Table 1 and Table 2). These results indicate that the insertion of the hOX40L gene and the mOX40L gene did not affect the titer, virulence and virulence of the recombinant newcastle disease virus.
TABLE 1 Titers, virulence and virulence of recombinant Newcastle disease Virus rNDV-hOX40L
TABLE 2 Titers, virulence and virulence of recombinant Newcastle disease Virus rNDV-mOX40L
Example 3
Expression of foreign genes hOX40L and mOX40L contained in the recombinant Newcastle disease viruses rNDV-hOX40L and rNDV-mOX40L prepared in example 1 in tumor cells was examined by Western blot.
The rescued rNDV-OX40L and parental NDV (rNDV) infected CT26 cells at 10MOI, at 37 ℃, 5% CO 2 After 24 hours of incubation, cell supernatants were harvested by centrifugation at 800rpm and tested by Western blot (e.g., according to the method disclosed in: an Y, et al. Recombinant New cast disease virus expression P53 recombinant expression plasmid or infection in a hepatoma model [ J]Journal of biological Science 2016 23 (1): 55) expression levels of mOX40L and hOX40L proteins in the cell supernatant. As shown in FIG. 3, the rNDV-mOX40L and rNDV-hOX40L treated groups expressed more mOX40L protein (FIG. 3 (a)) and hOX40L protein (FIG. 3 (b)), respectively, whereas OX40L protein was not detected in the rNDV treated group (NDV group).
Example 4
In the embodiment, the effect of the recombinant Newcastle disease viruses rNDV-mOX40L, rNDV-Lag3 and rNDV-SIRP alpha on inhibiting tumors in mice is detected.
Recombinant Newcastle disease viruses rNDV-Lag3 and rNDV-SIRPa were constructed by using the Lag3 gene (NCBI accession No. NM-002286.6) and the SIRPa gene (Genbank accession No. CAA 71403), respectively, according to the method described in example 1.
Mouse colon cancer model was established by subcutaneous injection of mouse colon cancer CT26 cells (purchased from ATCC) when tumors grew to 100mm 3 On the other hand, 100. Mu.L of PBS suspension (prepared with 1 XPBS buffer) of each of the above-described oncolytic viruses (rNDV-mOX 40L, rNDV-Lag3 and rNDV-SIRP α) and parental NDV strain (rNDV) was initially injected intratumorally. In each experimental group (rNDV-mOX 40L treatment group, rNDV-Lag3 treatment group, and rNDV-SIRPa treatment group, and rNDV treatment group), each oncolytic virus (rNDV-mOX 40L, rNDV-Lag3, rNDV-SI)RP alpha and rNDV) were injected into tumors once a day for 14 days, each injection was 1X 10 7 PFU; intratumorally injecting 1 × PBS buffer (without oncolytic virus) as a negative control group (also referred to as "PBS-treated group") into a mouse colon cancer model; each group had 6 animals. The anti-tumor effect of each oncolytic virus on a mouse colon cancer model is evaluated by drawing a mouse tumor volume change curve. Meanwhile, 6 tumor-free mice were set as normal controls to compare the physiological status of the mice of each treatment group. At the end of the experiment, the tumor size of each group of mice was tested and compared to the negative control group of mice and the relative inhibition was calculated analytically.
Relative inhibition (%) = (negative control tumor volume-experimental group tumor volume)/negative control tumor volume × 100%.
The results showed that the mean tumor volume in the negative control group was 1408.15mm 3 The mean tumor volume in the parental NDV (rNDV) treatment group was 355.33mm 3 The mean tumor volume in the rNDV-mOX40L treated group was 163.36mm 3 (ii) a The mean tumor volume in the rNDV-SIPR α -treated group was 633.72mm 3 The mean tumor volume in the rNDV-Lag3 treated group was 644.43mm 3 . Tumor volume was significantly inhibited in the rNDV-mOX40L treated group relative to the PBS treated group and the rNDV treated group (as shown in fig. 4).
The relative inhibition rate of the tumor of the rNDV treatment group and the rNDV-mOX40L treatment group is 74.77% and 88.40%, respectively, and the tumor inhibition rate of the rNDV-mOX40L treatment group is 13.63% higher than that of the rNDV treatment group. Meanwhile, the mean tumor volumes of the rNDV-SIPR α -treated group, the rNDV-Lag 3-treated group and the rNDV-mOX 40L-treated group were smaller than those of the negative control group, and in particular, the mean tumor volumes of the rNDV-mOX 40L-treated group were the smallest.
Example 5
In this example, rNDV-mOX40L was found to induce tumor necrosis and tumor-infiltrating T-lymphocytosis by HE sectioning and immunohistochemical assays.
To test the anti-tumor immunity of rNDV-mOX40L, tumor tissues were excised after the end of treatment on day 14 as described in example 4, and examined for tumor necrosis and tumor-infiltrating T-lymphocyte expression by HE sectioning and immunohistochemistry.
The results of HE sections showed that the tumor tissues of the negative control group (PBS treated group) xenografts were closely aligned, large in nuclei and obvious in nucleoli. Tumor tissues of xenografts from parental rNDV-treated groups exhibited nuclear pyknosis, and tumor cell volumes of xenografts from rNDV-treated groups were reduced relative to PBS-treated groups. The xenografts in the rNDV-mOX40L treated group were loosely arranged and necrotic areas were large. In addition, tumor cells of the xenograft treated group of rNDV-mOX40L exhibited nuclear deformation, nuclear pyknosis, nucleolar disappearance, nuclear structural unclearance and nucleolysis (FIG. 5). Immunohistochemical staining results show that in a mouse colon cancer model, xenografts of the rdv-mOX 40L treated group exhibited more tumor-infiltrating CD4+ and CD8+ T lymphocyte expression than xenografts of the parental rNDV treated group and xenografts of the PBS treated group, thereby being capable of generating stronger immune responses, showing more significant therapeutic effects.
Example 6
In this example, rNDV-mOX40L was found to stimulate splenic T lymphocytosis by FACS analysis.
To further investigate the immune response induced by rNDV-mOX40L, mouse spleens were excised after the end of day 14 treatment as described in example 4, and the percentage of CD3+, CD4+ and CD8+ T cells in the mouse spleens was analyzed by FACS (results are shown in FIG. 6).
As shown in FIG. 6, the percentages of CD3+ T cells in the spleens of the mice of the normal control group, PBS-treated group, rNDV-treated group and rNDV-mOX 40L-treated group were 34.93%, 17.43%, 22.27% and 33.9%, respectively. The percentage of CD4+ T cells in the spleen of mice in the normal control group, PBS-treated group, rNDV-treated group and rNDV-mOX 40L-treated group was 25.9%, 11.16%, 13.16% and 24.16%, respectively. The percentage of CD8+ T cells in the spleen of mice in the normal control group, PBS-treated group, rNDV-treated group and rNDV-mOX 40L-treated group was 17.47%, 8.3%, 8.73% and 16.7%, respectively. It can be seen that there was no significant difference in the percentage of CD3+ T cells, CD4+ T cells and CD8+ T cells between the normal control group and the rNDV-mOX40L treated group. However, the percentage of CD3+ T cells, CD4+ T cells, and CD8+ T cells after treatment with rdv-mOX 40L was significantly increased compared to the rdv-treated group and PBS-treated group, indicating that rdv-mOX 40L promotes an anti-tumor response by increasing spleen T cells.
Example 7
In this example, rNDV-mOX40L was found to induce OX40+ T lymphocytosis at the tumor site by immunohistochemical staining.
To examine the activation of T cells by mOX40L, the T cell activation marker OX40 in tumor tissue was examined by immunohistochemical staining. Tumor tissue was excised after the end of the 14 th day treatment described in example 4 and immunohistochemically stained with anti-CD 4 and anti-CD 8 antibodies (corresponding secondary antibody to goat anti-rabbit secondary antibody, purchased from Abcam) as follows, after which immunohistochemically stained with anti-OX 40 antibody (corresponding secondary antibody to goat anti-rabbit secondary antibody, purchased from Abcam) in the above mentioned areas enriched for CD4+ and CD8+ T cells as follows:
1. dewaxing and hydrating: and (3) immersing the prepared paraffin section into dimethylbenzene for dewaxing twice, 5min each time, then putting the paraffin section into alcohol solutions of 100vol%, 95vol%, 90vol%, 80vol% and 70vol% for 5min each time, and then putting the paraffin section into distilled water for rinsing twice, 3min each time.
2. Antigen retrieval: after heating to 95 ℃ in a water bath with 0.01M sodium citrate buffer (PH = 6.0), the sections were placed and heated for 10min, and then rinsed 3 times for 5min each with 1 × PBS buffer.
3. Inactivation of endogenous peroxidase: endogenous peroxidase blocking solution (purchased from Beyotime; cat. No. P0100A) was added dropwise to completely cover the sample, incubated at room temperature for 10min, and then washed 3 times with 1 XPBS buffer solution for 3 minutes each.
4. And (3) sealing: tissue sections were blocked by addition of blocking solution (purchased from Beyotime; cat # P0260 QuickBlock) for 10min.
5. Incubating the primary antibody: preparing primary anti-working solution by using confining liquid according to the dilution ratio of an antibody specification, dropwise adding the primary anti-working solution to the tissue section, and incubating overnight at 4 ℃; after incubation of the primary antibody, the tissue sections were washed 3 times with 1 × PBST buffer for 5min each.
6. Incubation of secondary antibody: preparing a secondary antibody working solution by using a confining liquid according to the dilution ratio of an antibody specification, dropwise adding the secondary antibody working solution to the tissue slice, and standing and incubating for 1h at room temperature; after secondary antibody incubation, the tissue sections were washed 3 times with 1 × PBST buffer for 5min each.
7. Color development: dropwise adding 100 μ l of DAB chromogenic working solution (purchased from Beyotime), fully covering the sample, incubating for 15min at room temperature in a dark place, removing the DAB chromogenic working solution after chromogenic reaction, and washing for 1-2 times by using distilled water to stop the chromogenic reaction.
As can be seen from the results in fig. 7, in the CD4+ and CD8+ T cell-rich region, immunohistochemical staining of xenografts of the rNDV-mOX 40L-treated group showed more OX40+ T cell infiltration compared to xenografts of the rNDV-treated group and xenografts of the PBS-treated group, indicating that rNDV-mOX40L promoted anti-tumor response in the mouse colon cancer model by increasing infiltration of OX40+ T cells in tumor tissues.
Example 8
In this example, rNDV-mOX40L was found to induce increased interferon- γ, perforin (perforin) and granzyme B (granzyme B) expression at the tumor site by Western blot assay.
In humans and mice, the OX40/OX40L signaling pathway is able to activate and induce T cell activity. To examine the biological effect of T cells in tumor tissue induced by rdv-mOX 40L, tumor tissue was excised after the end of the 14 th day treatment described in example 4 and the expression of IFN- γ, granzyme B and perforin was examined by Western blot and immunohistochemical staining according to methods known in the art (see, e.g., shuai Li et al fiber growth factor 21 proteins high glucose-induced fibrosis in cellular tissue J, biomedicine & Pharmacotherapy,2017,93 695-704).
As a result, a band of about 20kDa corresponding to the molecular weight of mouse IFN-. Gamma.protein was detected in tumor tissues of rNDV-mOX 40L-treated group, rNDV-treated group and PBS-treated group of the mouse colon cancer model, and the level of IFN-. Gamma.protein of the rNDV-mOX 40L-treated group was significantly higher than that of the rNDV-treated group and PBS-treated group. As shown in fig. 8, immunohistochemical staining of xenografts from the rNDV-mOX40L treated group showed more expression of IFN- γ, granzyme B and perforin compared to xenografts from the rNDV treated group and PBS treated group. These results indicate that rNDV-mOX40L is able to induce the activity of T cells in tumor tissues, producing a cytotoxic T lymphocyte biological effect.
Example 9
The oncolytic virus rClone30-Anh- (F) provided in the following examples as a parent strain was obtained by engineering the F gene of strain Anhinga in Newcastle disease virus (GenBank accession number: EF 065682.1) instead of the Lasota strain according to the engineering method for "gene replacement" described in Wang Yong et al (microbiology, 2008, 48 (5): 638-643, supra), starting from the Lasota strain of Newcastle disease virus (purchased from Harbin veterinary epidemic prevention station). The genomes of the OX 40L-expressing recombinant Newcastle disease viruses of this example are shown as SEQ ID No.7 and SEQ ID No.8 (see FIGS. 12 and 13); the nucleic acid sequence of OX40L is shown as SEQ ID NO.1 and SEQ ID NO. 2.
First, a human OX40L gene (NM-003326.5), a murine OX40L gene (U12763), a Lag3 gene (NCBI accession No. NM-002286.6) and a SIRP alpha gene (Genbank accession No. CAA 71403) were used to construct a recombinant Newcastle disease virus plasmid and a recombinant Newcastle disease virus, respectively, according to the method described in example 1, and the recombinant viruses were successfully rescued. The successfully rescued and correctly identified recombinant Newcastle disease viruses were named rClone30-Anh- (F) -hOX40L, rClone-Anh- (F) -mOX40L, rClone-Anh- (F) -SIRPa and rClone30-Anh- (F) -Lan 3, respectively.
Then, an H22 subcutaneous tumor-bearing model (i.e., mouse liver cancer model) was established using H22 cells (purchased from tokyo bai, south) according to the method described in example 4. When the tumor grows to 100mm 3 On the left and right, 100. Mu.L of PBS suspension (prepared with 1 XPBS buffer) of each of the above oncolytic viruses (rClone 30-Anh- (F) -mOX40L, rClone30-Anh- (F) -Lang 3 and rClone30-Anh- (F) -SIRPa) and parental strain rClone30-Anh- (F) was initiated intratumorally. In each treatment group, each oncolytic virus (rClone 30-Anh- (F) -mOX40L, rClone-Anh- (F) -Lang 3, rClone30-Anh- (F) -SIRPa and rClone30-Anh- (F)) was injected once per day into the tumor,the total injection time is 14 days, and each injection time is 1X 10 7 PFU; intratumorally injecting 1 × PBS buffer (without oncolytic virus) as a negative control group (also referred to as "PBS-treated group") into a mouse liver cancer model; the effect of each recombinant virus treatment was observed by dissecting tumor tissue from 6 animals per group.
As shown in FIG. 9, the mean tumor volume in the negative control group after the end of the treatment was 1421.77mm 3 The mean tumor volume in the parental rClone30-Anh- (F) treatment group was 807.30mm 3 The mean tumor volume in the rClone30-Anh- (F) -mOX40L treatment group was 306.42mm 3 (ii) a The mean tumor volume in the rClone30-Anh- (F) -SIRPa treatment group was 608.05mm 3 The mean tumor volume in the rClone30-Anh- (F) -Lang 3 treated group was 824.49mm 3 . The results show that the parental strain rClone30-Anh- (F) -treated group, rClone30-Anh- (F) -SIRPa-treated group, rClone30-Anh- (F) -Lang 3-treated group, and rClone30-Anh- (F) -mOX 40L-treated group all inhibited tumor growth compared to the negative control group, especially the mean tumor volume of the rClone30-Anh- (F) -mOX 40L-treated group was minimal.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Jiangsu Kang Yuanrui soaring biological medicine science and technology Limited
<120> a recombinant Newcastle disease virus rNDV-OX40L, its genome, preparation method and application thereof
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 402
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> nucleic acid sequence of human OX40L
<400> 1
caggtatcac atcggtatcc tcgaattcaa agtatcaaag tacaatttac cgaatataag 60
aaggagaaag gtttcatcct cacttcccaa aaggaggatg aaatcatgaa ggtgcagaac 120
aactcagtca tcatcaactg tgatgggttt tatctcatct ccctgaaggg ctacttctcc 180
caggaagtca acattagcct tcattaccag aaggatgagg agcccctctt ccaactgaag 240
aaggtcaggt ctgtcaactc cttgatggtg gcctctctga cttacaaaga caaagtctac 300
ttgaatgtga ccactgacaa tacctccctg gatgacttcc atgtgaatgg cggagaactg 360
attcttatcc atcaaaatcc tggtgaattc tgtgtccttt ga 402
<210> 2
<211> 453
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> nucleic acid sequence of murine OX40L
<400> 2
caactctctt cctctccggc aaaggaccct ccaatccaaa gactcagagg agcagttacc 60
agatgtgagg atgggcaact attcatcagc tcatacaaga atgagtatca aactatggag 120
gtgcagaaca attcggttgt catcaagtgt gatgggcttt atatcatcta cctgaagggc 180
tcctttttcc aggaggtcaa gattgacctt catttccggg aggatcataa tcccatctct 240
attccaatgc tgaacgatgg tcgaaggatt gtcttcactg tggtggcctc tttggctttc 300
aaagataaag tttacctgac tgtaaatgct cctgatactc tctgcgaaca cctccagata 360
aatgatgggg agctgattgt tgtccagcta acgcctggat actgtgctcc tgaaggatct 420
taccacagca ctgtgaacca agtaccactg tga 453
<210> 3
<211> 18901
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> genome sequence of recombinant Newcastle disease virus rNDV-hOX40L
<400> 3
ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gtagcctgaa 60
tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 120
cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 180
ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 240
gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 300
acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 360
ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 420
ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 480
acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 540
tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 600
tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 660
gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 720
ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 780
agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 840
agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 900
tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 960
tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 1020
cagtgctgcc ataagcatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1080
aggaccgaag gagctaaccg ctttttttca caacatgggg gatcatgtaa ctcgccttga 1140
tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1200
tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1260
ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1320
ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1380
cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1440
gacgggcagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1500
actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1560
aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1620
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1680
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1740
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1800
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1860
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1920
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1980
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 2040
gcgaacgacc tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct 2100
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2160
cacgagggag cttccagggg ggaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2220
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggccgagcc tatggaaaaa 2280
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2340
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2400
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2460
gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 2520
cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttacct 2580
cactcattag gcaccccagg ctttacactt tatgcttccg gctcctatgt tgtgtggaat 2640
tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg ccaagctcgg 2700
aagcggccgc taatacgact cactataggg accaaacaga gaatccgtaa gttacgataa 2760
aaggcgaagg agcaattgaa gtcgcacggg tagaaggtgt gaatctcgag tgcgagcccg 2820
aagcacaaac tcgagaaagc cttctgccaa catgtcttcc gtatttgatg agtacgaaca 2880
gctcctcgcg gctcagactc gccccaatgg agctcatgga gggggagaaa aagggagtac 2940
cttaaaagta gacgtcccgg tattcactct taacagtgat gacccagaag atagatggag 3000
ctttgtggta ttctgcctcc ggattgctgt tagcgaagat gccaacaaac cactcaggca 3060
aggtgctctc atatctcttt tatgctccca ctcacaggta atgaggaacc atgttgccct 3120
tgcagggaaa cagaatgaag ccacattggc cgtgcttgag attgatggct ttgccaacgg 3180
cacgccccag ttcaacaata ggagtggagt gtctgaagag agagcacaga gatttgcgat 3240
gatagcagga tctctccctc gggcatgcag caacggaacc ccgttcgtca cagccggggc 3300
cgaagatgat gcaccagaag acatcaccga taccctggag aggatcctct ctatccaggc 3360
tcaagtatgg gtcacagtag caaaagccat gactgcgtat gagactgcag atgagtcgga 3420
aacaaggcga atcaataagt atatgcagca aggcagggtc caaaagaaat acatcctcta 3480
ccccgtatgc aggagcacaa tccaactcac gatcagacag tctcttgcag tccgcatctt 3540
tttggttagc gagctcaaga gaggccgcaa cacggcaggt ggtacctcta cttattataa 3600
cctggtaggg gacgtagact catacatcag gaataccggg cttactgcat tcttcttgac 3660
actcaagtac ggaatcaaca ccaagacatc agcccttgca cttagtagcc tctcaggcga 3720
catccagaag atgaagcagc tcatgcgttt gtatcggatg aaaggagata atgcgccgta 3780
catgacatta cttggtgata gtgaccagat gagctttgcg cctgccgagt atgcacaact 3840
ttactccttt gccatgggta tggcatcagt cctagataaa ggtactggga aataccaatt 3900
tgccagggac tttatgagca catcattctg gagacttgga gtagagtacg ctcaggctca 3960
gggaagtagc attaacgagg atatggctgc cgagctaaag ctaaccccag cagcaaggag 4020
gggcctggca gctgctgccc aacgggtctc cgaggagacc agcagcatag acatgcctac 4080
tcaacaagtc ggagtcctca ctgggcttag cgaggggggg tcccaagctc tacaaggcgg 4140
atcgaataga tcgcaagggc aaccagaagc cggggatggg gagacccaat tcctggatct 4200
gatgagagcg gtagcaaata gcatgaggga ggcgccaaac tctgcacagg gcactcccca 4260
atcggggcct cccccaactc ctgggccatc ccaagataac gacaccgact gggggtattg 4320
atggacaaaa cccagcctgc ttccacaaaa acatcccaat gccctcaccc gtagtcgacc 4380
cctcgatttg cggctctata tgaccacacc ctcaaacaaa catccccctc tttcctccct 4440
ccccctgctg tacaactccg cacgccctag ataccacagg cacaatgcgg ctcactaaca 4500
atcaaaacag agccgaggga attagaaaaa agtacgggta gaagagggat attcagagat 4560
cagggcaagt ctcccgagtc tctgctctct cctctacctg atagaccagg acaaacatgg 4620
ccacctttac agatgcagag atcgacgagc tatttgagac aagtggaact gtcattgaca 4680
acataattac agcccagggt aaaccagcag agactgttgg aaggagtgca atcccacaag 4740
gcaagaccaa ggtgctgagc gcagcatggg agaagcatgg gagcatccag ccaccggcca 4800
gtcaagacaa ccccgatcga caggacagat ctgacaaaca accatccaca cccgagcaaa 4860
cgaccccgca tgacagcccg ccggccacat ccgccgacca gccccccacc caggccacag 4920
acgaagccgt cgacacacag ctcaggaccg gagcaagcaa ctctctgctg ttgatgcttg 4980
acaagctcag caataaatcg tccaatgcta aaaagggccc atggtcgagc ccccaagagg 5040
ggaatcacca acgtccgact caacagcagg ggagtcaacc cagtcgcgga aacagtcagg 5100
aaagaccgca gaaccaagtc aaggccgccc ctggaaacca gggcacagac gtgaacacag 5160
catatcatgg acaatgggag gagtcacaac tatcagctgg tgcaacccct catgctctcc 5220
gatcaaggca gagccaagac aatacccttg tatctgcgga tcatgtccag ccacctgtag 5280
actttgtgca agcgatgatg tctatgatgg aggcgatatc acagagagta agtaaggttg 5340
actatcagct agatcttgtc ttgaaacaga catcctccat ccctatgatg cggtccgaaa 5400
tccaacagct gaaaacatct gttgcagtca tggaagccaa cttgggaatg atgaagattc 5460
tggatcccgg ttgtgccaac atttcatctc tgagtgatct acgggcagtt gcccgatctc 5520
acccggtttt agtttcaggc cctggagacc cctctcccta tgtgacacaa ggaggcgaaa 5580
tggcacttaa taaactttcg caaccagtgc cacatccatc tgaattgatt aaacccgcca 5640
ctgcatgcgg gcctgatata ggagtggaaa aggacactgt ccgtgcattg atcatgtcac 5700
gcccaatgca cccgagttct tcagccaagc tcctaagcaa gttagatgca gccgggtcga 5760
tcgaggaaat caggaaaatc aagcgccttg ctctaaatgg ctaattacta ctgccacacg 5820
tagcgggtcc ctgtccactc ggcatcacac ggaatctgca ccgagttccc ccccgcagac 5880
ccaaggtcca actctccaag cggcaatcct ctctcgcttc ctcagcccca ctgaatgatc 5940
gcgtaaccgt aattaatcta gctacattta agattaagaa aaaatacggg tagaatcccc 6000
gcggccgcca ccatggagac agacacactc ctgctatggg tactgctgct ctgggttcca 6060
ggatccactg gtcaggtatc acatcggtat cctcgaattc aaagtatcaa agtacaattt 6120
accgaatata agaaggagaa aggtttcatc ctcacttccc aaaaggagga tgaaatcatg 6180
aaggtgcaga acaactcagt catcatcaac tgtgatgggt tttatctcat ctccctgaag 6240
ggctacttct cccaggaagt caacattagc cttcattacc agaaggatga ggagcccctc 6300
ttccaactga agaaggtcag gtctgtcaac tccttgatgg tggcctctct gacttacaaa 6360
gacaaagtct acttgaatgt gaccactgac aatacctccc tggatgactt ccatgtgaat 6420
ggcggagaac tgattcttat ccatcaaaat cctggtgaat tctgtgtcct ttgataagaa 6480
aaaatacggg tagaagttta aacccttgga gtgccccaat tgtgccaaga tggactcatc 6540
taggacaatt gggctgtact ttgattctgc ccattcttct agcaacctgt tagcatttcc 6600
gatcgtccta caagacacag gagatgggaa gaagcaaatc gccccgcaat ataggatcca 6660
gcgccttgac ttgtggactg atagtaagga ggactcagta ttcatcacca cctatggatt 6720
catctttcaa gttgggaatg aagaagccac tgtcggcatg atcgatgata aacccaagcg 6780
cgagttactt tccgctgcga tgctctgcct aggaagcgtc ccaaataccg gagaccttat 6840
tgagctggca agggcctgtc tcactatgat agtcacatgc aagaagagtg caactaatac 6900
tgagagaatg gttttctcag tagtgcaggc accccaagtg ctgcaaagct gtagggttgt 6960
ggcaaacaaa tactcatcag tgaatgcagt caagcacgtg aaagcgccag agaagattcc 7020
cgggagtgga accctagaat acaaggtgaa ctttgtctcc ttgactgtgg taccgaagaa 7080
ggatgtctac aagatcccag ctgcagtatt gaaggtttct ggctcgagtc tgtacaatct 7140
tgcgctcaat gtcactatta atgtggaggt agacccgagg agtcctttgg ttaaatctct 7200
gtctaagtct gacagcggat actatgctaa cctcttcttg catattggac ttatgaccac 7260
cgtagatagg aaggggaaga aagtgacatt tgacaagctg gaaaagaaaa taaggagcct 7320
tgatctatct gtcgggctca gtgatgtgct cgggccttcc gtgttggtaa aagcaagagg 7380
tgcacggact aagcttttgg cacctttctt ctctagcagt gggacagcct gctatcccat 7440
agcaaatgct tctcctcagg tggccaagat actctggagt caaaccgcgt gcctgcggag 7500
cgttaaaatc attatccaag caggtaccca acgcgctgtc gcagtgaccg ccgaccacga 7560
ggttacctct actaagctgg agaaggggca cacccttgcc aaatacaatc cttttaagaa 7620
ataagctgcg tctctgagat tgcgctccgc ccactcaccc agatcatcat gacacaaaaa 7680
actaatctgt cttgattatt tacagttagt ttacctgtct atcaagttag aaaaaacacg 7740
ggtagaagat tctggatccc ggttggcgcc ctccaggtgc aagatgggcc ccaaatcttc 7800
taccaatgtc ccagcacctc tgatgctgac cgtcaggatt gcgctggcac tgagctgtgt 7860
ccgtctgaca aattctctcg atggaaggcc tcttgcagct gcagggattg tagtaacggg 7920
agacaaagca gtcaacatat acacctcatc tcagacaggg tcaataatag tcaagttact 7980
cccaaatatg cctaaggata aagaggcgtg tgcaaaagcc ccgttggagg catacaacag 8040
gacactgact actttgctca ccccccttgg tgattctatc cgcaggatac aagagtctgc 8100
gactacgtcc ggaggaagga ggcagagacg ctttataggt gccattatcg gcagtgtagc 8160
tcttggggtt gccacagatg cccagataac agcagcctca gctctgatac aagccaacca 8220
gaatgctgcc aacatcctcc ggcttaaaga gagcattgct gcaactaatg aagctgtaca 8280
tgaagtcact gacggattat cgcaactagc agtggcagtt gggaagatgc agcagtttgt 8340
taatgaccag tttaataaca cagctcagga attggactgt ataaaaatta cacagcaggt 8400
tggtgtagaa ctcaacctgt acctaactga attgactaca gtattcgggc cacaaatcac 8460
ttcccctgcc ttaactcagc tgactatcca ggcgctttac aatctagctg gtggtaatat 8520
ggattatttg ttgactaagt taggtgttgg gaacaaccaa ctcagctcat taatcggtag 8580
cggcttgatc accggtaacc ctattctgta cgattcacag actcaactct taggtataca 8640
ggtaacttta ccctcagtcg gtaacctaaa taatatgcgt gctacctact tggagacctt 8700
gtctgtaagc acaaccaagg gatttgcctc agcacttgtc ccaaaagtgg tgacacaggt 8760
cgggtctgtg atagaggaac ttgacacctc atactgtgta gagaccgatt tggatttata 8820
ttgtacaaga atagtgacat tccctatgtc tcctggtatt tattcctgtc tgagcggtaa 8880
tacatcagct tgcatgtatt caaagactga aggtgcactt actacgccat atatgactat 8940
caagggctca gttattgcca attgcaagat gacaacatgc agatgtgcag accctccggg 9000
tatcatatcg caaaattatg gagaagctgt gtctctaata gataggcact catgcaatgt 9060
cttatcctta gacgggataa ctttgaggct cagtggagaa tttgacgtaa cttatcaaaa 9120
gaatatctca atattagatt ctcaggtaat agtgacaggc aatctcgata tctcaactga 9180
acttgggaat gtcaacaact cgataagtaa tgctttggat aagttagagg aaagcaatag 9240
caaacttgac aaagtcaatg tcaagctgac cggcacgtct gctctcatta cctatatagt 9300
tttaactatc atatctcttg tttgtggtat acttagcctg gttctagcat gctatctgat 9360
gtataagcaa aaggcgcaac aaaagacctt attatggctt gggaataata ccctaaatca 9420
gatgagggcc actacaagaa tctgaacaca gatgaggaac gaaggtttcc ctaatagtaa 9480
tttgtgtgaa agttctggta gtctgtcagt taagaaaaaa tacgggtaga aggttaaccg 9540
gcccgcggcg acgcgtggcc tgagaggcct tcagagagtt aagaaaaaac taccggttgt 9600
agatgaccaa aggacgatat acgggtagaa cggtaagaga ggccgcccct caattgcgag 9660
ccaggcttca caacctccgt tctaccgctt caccgacaac agtcctcaat catggaccgc 9720
gccgttagcc aagttgcgtt agagaatgat gaaagagagg caaaaaatac atggcgcttg 9780
atattccgga ttgcaatctt attcttaaca gtagtgacct tggctatatc tgtagcctcc 9840
cttttatata gcatgggggc tagcacacct agcgatcttg taggcatacc gactaggatt 9900
tccagggcag aagaaaagat tacatctaca cttggttcca atcaagatgt agtagatagg 9960
atatataagc aagtggccct tgagtctccg ttggcattgt taaatactga gaccacaatt 10020
atgaacgcaa taacatctct ctcttatcag attaatggag ctgcaaacaa cagtgggtgg 10080
ggggcaccta tccatgaccc agattatata ggggggatag gcaaagaact cattgtagat 10140
gatgctagtg atgtcacatc attctatccc tctgcatttc aagaacatct gaattttatc 10200
ccggcgccta ctacaggatc aggttgcact cgaataccct catttgacat gagtgctacc 10260
cattactgct acacccataa tgtaatattg tctggatgca gagatcactc acattcatat 10320
cagtatttag cacttggtgt gctccggaca tctgcaacag ggagggtatt cttttctact 10380
ctgcgttcca tcaacctgga cgacacccaa aatcggaagt cttgcagtgt gagtgcaact 10440
cccctgggtt gtgatatgct gtgctcgaaa gtcacggaga cagaggaaga agattataac 10500
tcagctgtcc ctacgcggat ggtacatggg aggttagggt tcgacggcca gtaccacgaa 10560
aaggacctag atgtcacaac attattcggg gactgggtgg ccaactaccc aggagtaggg 10620
ggtggatctt ttattgacag ccgcgtatgg ttctcagtct acggagggtt aaaacccaat 10680
tcacccagtg acactgtaca ggaagggaaa tatgtgatat acaagcgata caatgacaca 10740
tgcccagatg agcaagacta ccagattcga atggccaagt cttcgtataa gcctggacgg 10800
tttggtggga aacgcataca gcaggctatc ttatctatca aggtgtcaac atccttaggc 10860
gaagacccgg tactgactgt accgcccaac acagtcacac tcatgggggc cgaaggcaga 10920
attctcacag tagggacatc tcatttcttg tatcaacgag ggtcatcata cttctctccc 10980
gcgttattat atcctatgac agtcagcaac aaaacagcca ctcttcatag tccttataca 11040
ttcaatgcct tcactcggcc aggtagtatc ccttgccagg cttcagcaag atgccccaac 11100
tcgtgtgtta ctggagtcta tacagatcca tatcccctaa tcttctatag aaaccacacc 11160
ttgcgagggg tattcgggac aatgcttgat ggtgtacaag caagacttaa ccctgcgtct 11220
gcagtattcg atagcacatc ccgcagtcgc attactcgag tgagttcaag cagtaccaaa 11280
gcagcataca caacatcaac ttgttttaaa gtggtcaaga ctaataagac ctattgtctc 11340
agcattgctg aaatatctaa tactctcttc ggagaattca gaatcgtccc gttactagtt 11400
gagatcctca aagatgacgg ggttagagaa gccaggtctg gctagttgag tcaattataa 11460
aggagttgga aagatggcat tgtatcacct atcttctgcg acatcaagaa tcaaaccgaa 11520
tgccggcgcg tgctcgaatt ccatgttgcc agttgaccac aatcagccag tgctcatgcg 11580
atcagattaa gccttgtcaa tagtctcttg attaagaaaa aatgtaagtg gcaatgagat 11640
acaaggcaaa acagctcatg gtaaataata cgggtaggac atggcgagct ccggtcctga 11700
aagggcagag catcagatta tcctaccaga gtcacacctg tcttcaccat tggtcaagca 11760
caaactactc tattactgga aattaactgg gctaccgctt cctgatgaat gtgacttcga 11820
ccacctcatt ctcagccgac aatggaaaaa aatacttgaa tcggcctctc ctgatactga 11880
gagaatgata aaactcggaa gggcagtaca ccaaactctt aaccacaatt ccagaataac 11940
cggagtgctc caccccaggt gtttagaaga actggctaat attgaggtcc cagattcaac 12000
caacaaattt cggaagattg agaagaagat ccaaattcac aacacgagat atggagaact 12060
gttcacaagg ctgtgtacgc atatagagaa gaaactgctg gggtcatctt ggtctaacaa 12120
tgtcccccgg tcagaggagt tcagcagcat tcgtacggat ccggcattct ggtttcactc 12180
aaaatggtcc acagccaagt ttgcatggct ccatataaaa cagatccaga ggcatctgat 12240
ggtggcagct aggacaaggt ctgcggccaa caaattggtg atgctaaccc ataaggtagg 12300
ccaagtcttt gtcactcctg aacttgtcgt tgtgacgcat acgaatgaga acaagttcac 12360
atgtcttacc caggaacttg tattgatgta tgcagatatg atggagggca gagatatggt 12420
caacataata tcaaccacgg cggtgcatct cagaagctta tcagagaaaa ttgatgacat 12480
tttgcggtta atagacgctc tggcaaaaga cttgggtaat caagtctacg atgttgtatc 12540
actaatggag ggatttgcat acggagctgt ccagctactc gagccgtcag gtacatttgc 12600
aggagatttc ttcgcattca acctgcagga gcttaaagac attctaattg gcctcctccc 12660
caatgatata gcagaatccg tgactcatgc aatcgctact gtattctctg gtttagaaca 12720
gaatcaagca gctgagatgt tgtgtctgtt gcgtctgtgg ggtcacccac tgcttgagtc 12780
ccgtattgca gcaaaggcag tcaggagcca aatgtgcgca ccgaaaatgg tagactttga 12840
tatgatcctt caggtactgt ctttcttcaa gggaacaatc atcaacgggt acagaaagaa 12900
gaatgcaggt gtgtggccgc gagtcaaagt ggatacaata tatgggaagg tcattgggca 12960
actacatgca gattcagcag agatttcaca cgatatcatg ttgagagagt ataagagttt 13020
atctgcactt gaatttgagc catgtataga atatgaccct gtcaccaacc tgagcatgtt 13080
cctaaaagac aaggcaatcg cacaccccaa cgataattgg cttgcctcgt ttaggcggaa 13140
ccttctctcc gaagaccaga agaaacatgt aaaagaagca acttcgacta atcgcctctt 13200
gatagagttt ttagagtcaa atgattttga tccatataaa gagatggaat atctgacgac 13260
ccttgagtac cttagagatg acaatgtggc agtatcatac tcgctcaagg agaaggaagt 13320
gaaagttaat ggacggatct tcgctaagct gacaaagaag ttaaggaact gtcaggtgat 13380
ggcggaaggg atcctagccg atcagattgc acctttcttt cagggaaatg gagtcattca 13440
ggatagcata tccttgacca agagtatgct agcgatgagt caactgtctt ttaacagcaa 13500
taagaaacgt atcactgact gtaaagaaag agtatcttca aaccgcaatc atgatccgaa 13560
aagcaagaac cgtcggagag ttgcaacctt cataacaact gacctgcaaa agtactgtct 13620
taattggaga tatcagacaa tcaaattgtt cgctcatgcc atcaatcagt tgatgggcct 13680
acctcacttc ttcgaatgga ttcacctaag actgatggac actacgatgt tcgtaggaga 13740
ccctttcaat cctccaagtg accctactga ctgtgacctc tcaagagtcc ctaatgatga 13800
catatatatt gtcagtgcca gagggggtat cgaaggatta tgccagaagc tatggacaat 13860
gatctcaatt gctgcaatcc aacttgctgc agctagatcg cattgtcgtg ttgcctgtat 13920
ggtacagggt gataatcaag taatagcagt aacgagagag gtaagatcag acgactctcc 13980
ggagatggtg ttgacacagt tgcatcaagc cagtgataat ttcttcaagg aattaattca 14040
tgtcaatcat ttgattggcc ataatttgaa ggatcgtgaa accatcaggt cagacacatt 14100
cttcatatac agcaaacgaa tcttcaaaga tggagcaatc ctcagtcaag tcctcaaaaa 14160
ttcatctaaa ttagtgctag tgtcaggtga tctcagtgaa aacaccgtaa tgtcctgtgc 14220
caacattgcc tctactgtag cacggctatg cgagaacggg cttcccaaag acttctgtta 14280
ctatttaaac tatataatga gttgtgtgca gacatacttt gactctgagt tctccatcac 14340
caacaattcg caccccgatc ttaatcagtc gtggattgag gacatctctt ttgtgcactc 14400
atatgttctg actcctgccc aattaggggg actgagtaac cttcaatact caaggctcta 14460
cactagaaat atcggtgacc cggggactac tgcttttgca gagatcaagc gactagaagc 14520
agtgggatta ctgagtccta acattatgac taatatctta actaggccgc ctgggaatgg 14580
agattgggcc agtctgtgca acgacccata ctctttcaat tttgagactg ttgcaagccc 14640
aaatattgtt cttaagaaac atacgcaaag agtcctattt gaaacttgtt caaatccctt 14700
attgtctgga gtgcacacag aggataatga ggcagaagag aaggcattgg ctgaattctt 14760
gcttaatcaa gaggtgattc atccccgcgt tgcgcatgcc atcatggagg caagctctgt 14820
aggtaggaga aagcaaattc aagggcttgt tgacacaaca aacaccgtaa ttaagattgc 14880
gcttactagg aggccattag gcatcaagag gctgatgcgg atagtcaatt attctagcat 14940
gcatgcaatg ctgtttagag acgatgtttt ttcctccagt agatccaacc accccttagt 15000
ctcttctaat atgtgttctc tgacactggc agactatgca cggaatagaa gctggtcacc 15060
tttgacggga ggcaggaaaa tactgggtgt atctaatcct gatacgatag aactcgtaga 15120
gggtgagatt cttagtgtaa gcggagggtg tacaagatgt gacagcggag atgaacaatt 15180
tacttggttc catcttccaa gcaatataga attgaccgat gacaccagca agaatcctcc 15240
gatgagggta ccatatctcg ggtcaaagac acaggagagg agagctgcct cacttgcaaa 15300
aatagctcat atgtcgccac atgtaaaggc tgccctaagg gcatcatccg tgttgatctg 15360
ggcttatggg gataatgaag taaattggac tgctgctctt acgattgcaa aatctcggtg 15420
taatgtaaac ttagagtatc ttcggttact gtccccttta cccacggctg ggaatcttca 15480
acatagacta gatgatggta taactcagat gacattcacc cctgcatctc tctacagggt 15540
gtcaccttac attcacatat ccaatgattc tcaaaggctg ttcactgaag aaggagtcaa 15600
agaggggaat gtggtttacc aacagatcat gctcttgggt ttatctctaa tcgaatcgat 15660
ctttccaata acaacaacca ggacatatga tgagatcaca ctgcacctac atagtaaatt 15720
tagttgctgt atcagagaag cacctgttgc ggttcctttc gagctacttg gggtggtacc 15780
ggaactgagg acagtgacct caaataagtt tatgtatgat cctagccctg tatcggaggg 15840
agactttgcg agacttgact tagctatctt caagagttat gagcttaatc tggagtcata 15900
tcccacgata gagctaatga acattctttc aatatccagc gggaagttga ttggccagtc 15960
tgtggtttct tatgatgaag atacctccat aaagaatgac gccataatag tgtatgacaa 16020
tacccgaaat tggatcagtg aagctcagaa ttcagatgtg gtccgcctat ttgaatatgc 16080
agcacttgaa gtgctcctcg actgttctta ccaactctat tacctgagag taagaggcct 16140
agacaatatt gtcttatata tgggtgattt atacaagaat atgccaggaa ttctactttc 16200
caacattgca gctacaatat ctcatcccgt cattcattca aggttacatg cagtgggcct 16260
ggtcaaccat gacggatcac accaacttgc agatacggat tttatcgaaa tgtctgcaaa 16320
actattagta tcttgcaccc gacgtgtgat ctccggctta tattcaggaa ataagtatga 16380
tctgctgttc ccatctgtct tagatgataa cctgaatgag aagatgcttc agctgatatc 16440
ccggttatgc tgtctgtaca cggtactctt tgctacaaca agagaaatcc cgaaaataag 16500
aggcttaact gcagaagaga aatgttcaat actcactgag tatttactgt cggatgctgt 16560
gaaaccatta cttagtcccg atcaagtgag ctctatcatg tctcctaaca taattacatt 16620
cccagctaat ctgtactaca tgtctcggaa gagcctcaat ttgatcaggg aaagggagga 16680
cagggatact atcctggcgt tgttgttccc ccaagagcca ttattagagt tcccttctgt 16740
gcaagatatt ggtgctcgag tgaaagatcc attcacccga caacctgcgg catttttgca 16800
agagttagat ttgagtgctc cagcaaggta tgacgcattc acacttagtc agattcatcc 16860
tgaactcaca tctccaaatc cggaggaaga ctacttagta cgatacttgt tcagagggat 16920
agggactgca tcttcctctt ggtataaggc atctcatctc ctttctgtac ccgaggtaag 16980
atgtgcaaga cacgggaact ccttatactt agctgaaggg agcggagcca tcatgagtct 17040
tctcgaactg catgtaccac atgaaactat ctattacaat acgctctttt caaatgagat 17100
gaaccccccg caacgacatt tcgggccgac cccaactcag tttttgaatt cggttgttta 17160
taggaatcta caggcggagg taacatgcaa agatggattt gtccaagagt tccgtccatt 17220
atggagagaa aatacagagg aaagtgacct gacctcagat aaagtagtgg ggtatattac 17280
atctgcagtg ccctacagat ctgtatcatt gctgcattgt gacattgaaa ttcctccagg 17340
gtccaatcaa agcttactag atcaactagc tatcaattta tctctgattg ccatgcattc 17400
tgtaagggag ggcggggtag taatcatcaa agtgttgtat gcaatgggat actactttca 17460
tctactcatg aacttgtttg ctccgtgttc cacaaaagga tatattctct ctaatggtta 17520
tgcatgtcga ggagatatgg agtgttacct ggtatttgtc atgggttacc tgggcgggcc 17580
tacatttgta catgaggtgg tgaggatggc gaaaactctg gtgcagcggc acggtacgct 17640
tttgtctaaa tcagatgaga tcacactgac caggttattc acctcacagc ggcagcgtgt 17700
gacagacatc ctatccagtc ctttaccaag attaataaag tacttgagga agaatattga 17760
cactgcgctg attgaagccg ggggacagcc cgtccgtcca ttctgtgcgg agagtctggt 17820
gagcacgcta gcgaacataa ctcagataac ccagatcatc gctagtcaca ttgacacagt 17880
tatccggtct gtgatatata tggaagctga gggtgatctc gctgacacag tatttctatt 17940
taccccttac aatctctcta ctgacgggaa aaagaggaca tcacttaaac agtgcacgag 18000
acagatccta gaggttacaa tactaggtct tagagtcgaa aatctcaata aaataggcga 18060
tataatcagc ctagtgctta aaggcatgat ctccatggag gaccttatcc cactaaggac 18120
atacttgaag catagtacct gccctaaata tttgaaggct gtcctaggta ttaccaaact 18180
caaagaaatg tttacagaca cttctgtact gtacttgact cgtgctcaac aaaaattcta 18240
catgaaaact ataggcaatg cagtcaaagg atattacagt aactgtgact cttaacgaaa 18300
atcacatatt aataggctcc ttttttggcc aattgtattc ttgttgattt aatcatatta 18360
tgttagaaaa aagttgaacc ctgactcctt aggactcgaa ttcgaactca aataaatgtc 18420
ttaaaaaaag gttgcgcaca attattcttg agtgtagtct cgtcattcac caaatctttg 18480
tttggtttgg tggccggcat ggtcccagcc tcctcgctgg cgccggctgg gcaacattcc 18540
gaggggaccg tcccctcggt aatggcgaat gggacgcggc cgatccggct gctaacaaag 18600
cccgaaagga agctgagttg gctgctgcca ccgctgagca ataactagca taaccccttg 18660
gggcctctaa acgggtcttg aggggttttt tgctgaaagg aggaactata tccggatcgg 18720
ccgatccggc tgctaacaaa gcccgaaagg aagctgagtt ggctgctgcc accgctgagc 18780
aataactagc ataacccctt ggggcctcta aacgggtctt gaggggtttt ttgctgaaag 18840
gaggaactat atccggatgg ccgccaccgg tgggccttgc agcacatccc cccttcgcca 18900
g 18901
<210> 4
<211> 18955
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> genome sequence of recombinant Newcastle disease virus rNDV-mOX40L
<400> 4
ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gtagcctgaa 60
tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 120
cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 180
ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 240
gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 300
acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 360
ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 420
ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 480
acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 540
tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 600
tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 660
gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 720
ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 780
agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 840
agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 900
tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 960
tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 1020
cagtgctgcc ataagcatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1080
aggaccgaag gagctaaccg ctttttttca caacatgggg gatcatgtaa ctcgccttga 1140
tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1200
tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1260
ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1320
ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1380
cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1440
gacgggcagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1500
actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1560
aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1620
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1680
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1740
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1800
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1860
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1920
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1980
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 2040
gcgaacgacc tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct 2100
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2160
cacgagggag cttccagggg ggaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2220
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggccgagcc tatggaaaaa 2280
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2340
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2400
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2460
gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 2520
cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttacct 2580
cactcattag gcaccccagg ctttacactt tatgcttccg gctcctatgt tgtgtggaat 2640
tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg ccaagctcgg 2700
aagcggccgc taatacgact cactataggg accaaacaga gaatccgtaa gttacgataa 2760
aaggcgaagg agcaattgaa gtcgcacggg tagaaggtgt gaatctcgag tgcgagcccg 2820
aagcacaaac tcgagaaagc cttctgccaa catgtcttcc gtatttgatg agtacgaaca 2880
gctcctcgcg gctcagactc gccccaatgg agctcatgga gggggagaaa aagggagtac 2940
cttaaaagta gacgtcccgg tattcactct taacagtgat gacccagaag atagatggag 3000
ctttgtggta ttctgcctcc ggattgctgt tagcgaagat gccaacaaac cactcaggca 3060
aggtgctctc atatctcttt tatgctccca ctcacaggta atgaggaacc atgttgccct 3120
tgcagggaaa cagaatgaag ccacattggc cgtgcttgag attgatggct ttgccaacgg 3180
cacgccccag ttcaacaata ggagtggagt gtctgaagag agagcacaga gatttgcgat 3240
gatagcagga tctctccctc gggcatgcag caacggaacc ccgttcgtca cagccggggc 3300
cgaagatgat gcaccagaag acatcaccga taccctggag aggatcctct ctatccaggc 3360
tcaagtatgg gtcacagtag caaaagccat gactgcgtat gagactgcag atgagtcgga 3420
aacaaggcga atcaataagt atatgcagca aggcagggtc caaaagaaat acatcctcta 3480
ccccgtatgc aggagcacaa tccaactcac gatcagacag tctcttgcag tccgcatctt 3540
tttggttagc gagctcaaga gaggccgcaa cacggcaggt ggtacctcta cttattataa 3600
cctggtaggg gacgtagact catacatcag gaataccggg cttactgcat tcttcttgac 3660
actcaagtac ggaatcaaca ccaagacatc agcccttgca cttagtagcc tctcaggcga 3720
catccagaag atgaagcagc tcatgcgttt gtatcggatg aaaggagata atgcgccgta 3780
catgacatta cttggtgata gtgaccagat gagctttgcg cctgccgagt atgcacaact 3840
ttactccttt gccatgggta tggcatcagt cctagataaa ggtactggga aataccaatt 3900
tgccagggac tttatgagca catcattctg gagacttgga gtagagtacg ctcaggctca 3960
gggaagtagc attaacgagg atatggctgc cgagctaaag ctaaccccag cagcaaggag 4020
gggcctggca gctgctgccc aacgggtctc cgaggagacc agcagcatag acatgcctac 4080
tcaacaagtc ggagtcctca ctgggcttag cgaggggggg tcccaagctc tacaaggcgg 4140
atcgaataga tcgcaagggc aaccagaagc cggggatggg gagacccaat tcctggatct 4200
gatgagagcg gtagcaaata gcatgaggga ggcgccaaac tctgcacagg gcactcccca 4260
atcggggcct cccccaactc ctgggccatc ccaagataac gacaccgact gggggtattg 4320
atggacaaaa cccagcctgc ttccacaaaa acatcccaat gccctcaccc gtagtcgacc 4380
cctcgatttg cggctctata tgaccacacc ctcaaacaaa catccccctc tttcctccct 4440
ccccctgctg tacaactccg cacgccctag ataccacagg cacaatgcgg ctcactaaca 4500
atcaaaacag agccgaggga attagaaaaa agtacgggta gaagagggat attcagagat 4560
cagggcaagt ctcccgagtc tctgctctct cctctacctg atagaccagg acaaacatgg 4620
ccacctttac agatgcagag atcgacgagc tatttgagac aagtggaact gtcattgaca 4680
acataattac agcccagggt aaaccagcag agactgttgg aaggagtgca atcccacaag 4740
gcaagaccaa ggtgctgagc gcagcatggg agaagcatgg gagcatccag ccaccggcca 4800
gtcaagacaa ccccgatcga caggacagat ctgacaaaca accatccaca cccgagcaaa 4860
cgaccccgca tgacagcccg ccggccacat ccgccgacca gccccccacc caggccacag 4920
acgaagccgt cgacacacag ctcaggaccg gagcaagcaa ctctctgctg ttgatgcttg 4980
acaagctcag caataaatcg tccaatgcta aaaagggccc atggtcgagc ccccaagagg 5040
ggaatcacca acgtccgact caacagcagg ggagtcaacc cagtcgcgga aacagtcagg 5100
aaagaccgca gaaccaagtc aaggccgccc ctggaaacca gggcacagac gtgaacacag 5160
catatcatgg acaatgggag gagtcacaac tatcagctgg tgcaacccct catgctctcc 5220
gatcaaggca gagccaagac aatacccttg tatctgcgga tcatgtccag ccacctgtag 5280
actttgtgca agcgatgatg tctatgatgg aggcgatatc acagagagta agtaaggttg 5340
actatcagct agatcttgtc ttgaaacaga catcctccat ccctatgatg cggtccgaaa 5400
tccaacagct gaaaacatct gttgcagtca tggaagccaa cttgggaatg atgaagattc 5460
tggatcccgg ttgtgccaac atttcatctc tgagtgatct acgggcagtt gcccgatctc 5520
acccggtttt agtttcaggc cctggagacc cctctcccta tgtgacacaa ggaggcgaaa 5580
tggcacttaa taaactttcg caaccagtgc cacatccatc tgaattgatt aaacccgcca 5640
ctgcatgcgg gcctgatata ggagtggaaa aggacactgt ccgtgcattg atcatgtcac 5700
gcccaatgca cccgagttct tcagccaagc tcctaagcaa gttagatgca gccgggtcga 5760
tcgaggaaat caggaaaatc aagcgccttg ctctaaatgg ctaattacta ctgccacacg 5820
tagcgggtcc ctgtccactc ggcatcacac ggaatctgca ccgagttccc ccccgcagac 5880
ccaaggtcca actctccaag cggcaatcct ctctcgcttc ctcagcccca ctgaatgatc 5940
gcgtaaccgt aattaatcta gctacattta agattaagaa aaaatacggg tagaatcccc 6000
gcggccgcca ccatggagac agacacactc ctgctatggg tactgctgct ctgggttcca 6060
ggatccactg gtcaactctc ttcctctccg gcaaaggacc ctccaatcca aagactcaga 6120
ggagcagtta ccagatgtga ggatgggcaa ctattcatca gctcatacaa gaatgagtat 6180
caaactatgg aggtgcagaa caattcggtt gtcatcaagt gtgatgggct ttatatcatc 6240
tacctgaagg gctccttttt ccaggaggtc aagattgacc ttcatttccg ggaggatcat 6300
aatcccatct ctattccaat gctgaacgat ggtcgaagga ttgtcttcac tgtggtggcc 6360
tctttggctt tcaaagataa agtttacctg actgtaaatg ctcctgatac tctctgcgaa 6420
cacctccaga taaatgatgg ggagctgatt gttgtccagc taacgcctgg atactgtgct 6480
cctgaaggat cttaccacag cactgtgaac caagtaccac tgtgattaag aaaaaatacg 6540
ggtagaaggg tttaaaccct tggagtgccc caattgtgcc aagatggact catctaggac 6600
aattgggctg tactttgatt ctgcccattc ttctagcaac ctgttagcat ttccgatcgt 6660
cctacaagac acaggagatg ggaagaagca aatcgccccg caatatagga tccagcgcct 6720
tgacttgtgg actgatagta aggaggactc agtattcatc accacctatg gattcatctt 6780
tcaagttggg aatgaagaag ccactgtcgg catgatcgat gataaaccca agcgcgagtt 6840
actttccgct gcgatgctct gcctaggaag cgtcccaaat accggagacc ttattgagct 6900
ggcaagggcc tgtctcacta tgatagtcac atgcaagaag agtgcaacta atactgagag 6960
aatggttttc tcagtagtgc aggcacccca agtgctgcaa agctgtaggg ttgtggcaaa 7020
caaatactca tcagtgaatg cagtcaagca cgtgaaagcg ccagagaaga ttcccgggag 7080
tggaacccta gaatacaagg tgaactttgt ctccttgact gtggtaccga agaaggatgt 7140
ctacaagatc ccagctgcag tattgaaggt ttctggctcg agtctgtaca atcttgcgct 7200
caatgtcact attaatgtgg aggtagaccc gaggagtcct ttggttaaat ctctgtctaa 7260
gtctgacagc ggatactatg ctaacctctt cttgcatatt ggacttatga ccaccgtaga 7320
taggaagggg aagaaagtga catttgacaa gctggaaaag aaaataagga gccttgatct 7380
atctgtcggg ctcagtgatg tgctcgggcc ttccgtgttg gtaaaagcaa gaggtgcacg 7440
gactaagctt ttggcacctt tcttctctag cagtgggaca gcctgctatc ccatagcaaa 7500
tgcttctcct caggtggcca agatactctg gagtcaaacc gcgtgcctgc ggagcgttaa 7560
aatcattatc caagcaggta cccaacgcgc tgtcgcagtg accgccgacc acgaggttac 7620
ctctactaag ctggagaagg ggcacaccct tgccaaatac aatcctttta agaaataagc 7680
tgcgtctctg agattgcgct ccgcccactc acccagatca tcatgacaca aaaaactaat 7740
ctgtcttgat tatttacagt tagtttacct gtctatcaag ttagaaaaaa cacgggtaga 7800
agattctgga tcccggttgg cgccctccag gtgcaagatg ggccccaaat cttctaccaa 7860
tgtcccagca cctctgatgc tgaccgtcag gattgcgctg gcactgagct gtgtccgtct 7920
gacaaattct ctcgatggaa ggcctcttgc agctgcaggg attgtagtaa cgggagacaa 7980
agcagtcaac atatacacct catctcagac agggtcaata atagtcaagt tactcccaaa 8040
tatgcctaag gataaagagg cgtgtgcaaa agccccgttg gaggcataca acaggacact 8100
gactactttg ctcacccccc ttggtgattc tatccgcagg atacaagagt ctgcgactac 8160
gtccggagga aggaggcaga gacgctttat aggtgccatt atcggcagtg tagctcttgg 8220
ggttgccaca gatgcccaga taacagcagc ctcagctctg atacaagcca accagaatgc 8280
tgccaacatc ctccggctta aagagagcat tgctgcaact aatgaagctg tacatgaagt 8340
cactgacgga ttatcgcaac tagcagtggc agttgggaag atgcagcagt ttgttaatga 8400
ccagtttaat aacacagctc aggaattgga ctgtataaaa attacacagc aggttggtgt 8460
agaactcaac ctgtacctaa ctgaattgac tacagtattc gggccacaaa tcacttcccc 8520
tgccttaact cagctgacta tccaggcgct ttacaatcta gctggtggta atatggatta 8580
tttgttgact aagttaggtg ttgggaacaa ccaactcagc tcattaatcg gtagcggctt 8640
gatcaccggt aaccctattc tgtacgattc acagactcaa ctcttaggta tacaggtaac 8700
tttaccctca gtcggtaacc taaataatat gcgtgctacc tacttggaga ccttgtctgt 8760
aagcacaacc aagggatttg cctcagcact tgtcccaaaa gtggtgacac aggtcgggtc 8820
tgtgatagag gaacttgaca cctcatactg tgtagagacc gatttggatt tatattgtac 8880
aagaatagtg acattcccta tgtctcctgg tatttattcc tgtctgagcg gtaatacatc 8940
agcttgcatg tattcaaaga ctgaaggtgc acttactacg ccatatatga ctatcaaggg 9000
ctcagttatt gccaattgca agatgacaac atgcagatgt gcagaccctc cgggtatcat 9060
atcgcaaaat tatggagaag ctgtgtctct aatagatagg cactcatgca atgtcttatc 9120
cttagacggg ataactttga ggctcagtgg agaatttgac gtaacttatc aaaagaatat 9180
ctcaatatta gattctcagg taatagtgac aggcaatctc gatatctcaa ctgaacttgg 9240
gaatgtcaac aactcgataa gtaatgcttt ggataagtta gaggaaagca atagcaaact 9300
tgacaaagtc aatgtcaagc tgaccggcac gtctgctctc attacctata tagttttaac 9360
tatcatatct cttgtttgtg gtatacttag cctggttcta gcatgctatc tgatgtataa 9420
gcaaaaggcg caacaaaaga ccttattatg gcttgggaat aataccctaa atcagatgag 9480
ggccactaca agaatctgaa cacagatgag gaacgaaggt ttccctaata gtaatttgtg 9540
tgaaagttct ggtagtctgt cagttaagaa aaaatacggg tagaaggtta accggcccgc 9600
ggcgacgcgt ggcctgagag gccttcagag agttaagaaa aaactaccgg ttgtagatga 9660
ccaaaggacg atatacgggt agaacggtaa gagaggccgc ccctcaattg cgagccaggc 9720
ttcacaacct ccgttctacc gcttcaccga caacagtcct caatcatgga ccgcgccgtt 9780
agccaagttg cgttagagaa tgatgaaaga gaggcaaaaa atacatggcg cttgatattc 9840
cggattgcaa tcttattctt aacagtagtg accttggcta tatctgtagc ctccctttta 9900
tatagcatgg gggctagcac acctagcgat cttgtaggca taccgactag gatttccagg 9960
gcagaagaaa agattacatc tacacttggt tccaatcaag atgtagtaga taggatatat 10020
aagcaagtgg cccttgagtc tccgttggca ttgttaaata ctgagaccac aattatgaac 10080
gcaataacat ctctctctta tcagattaat ggagctgcaa acaacagtgg gtggggggca 10140
cctatccatg acccagatta tatagggggg ataggcaaag aactcattgt agatgatgct 10200
agtgatgtca catcattcta tccctctgca tttcaagaac atctgaattt tatcccggcg 10260
cctactacag gatcaggttg cactcgaata ccctcatttg acatgagtgc tacccattac 10320
tgctacaccc ataatgtaat attgtctgga tgcagagatc actcacattc atatcagtat 10380
ttagcacttg gtgtgctccg gacatctgca acagggaggg tattcttttc tactctgcgt 10440
tccatcaacc tggacgacac ccaaaatcgg aagtcttgca gtgtgagtgc aactcccctg 10500
ggttgtgata tgctgtgctc gaaagtcacg gagacagagg aagaagatta taactcagct 10560
gtccctacgc ggatggtaca tgggaggtta gggttcgacg gccagtacca cgaaaaggac 10620
ctagatgtca caacattatt cggggactgg gtggccaact acccaggagt agggggtgga 10680
tcttttattg acagccgcgt atggttctca gtctacggag ggttaaaacc caattcaccc 10740
agtgacactg tacaggaagg gaaatatgtg atatacaagc gatacaatga cacatgccca 10800
gatgagcaag actaccagat tcgaatggcc aagtcttcgt ataagcctgg acggtttggt 10860
gggaaacgca tacagcaggc tatcttatct atcaaggtgt caacatcctt aggcgaagac 10920
ccggtactga ctgtaccgcc caacacagtc acactcatgg gggccgaagg cagaattctc 10980
acagtaggga catctcattt cttgtatcaa cgagggtcat catacttctc tcccgcgtta 11040
ttatatccta tgacagtcag caacaaaaca gccactcttc atagtcctta tacattcaat 11100
gccttcactc ggccaggtag tatcccttgc caggcttcag caagatgccc caactcgtgt 11160
gttactggag tctatacaga tccatatccc ctaatcttct atagaaacca caccttgcga 11220
ggggtattcg ggacaatgct tgatggtgta caagcaagac ttaaccctgc gtctgcagta 11280
ttcgatagca catcccgcag tcgcattact cgagtgagtt caagcagtac caaagcagca 11340
tacacaacat caacttgttt taaagtggtc aagactaata agacctattg tctcagcatt 11400
gctgaaatat ctaatactct cttcggagaa ttcagaatcg tcccgttact agttgagatc 11460
ctcaaagatg acggggttag agaagccagg tctggctagt tgagtcaatt ataaaggagt 11520
tggaaagatg gcattgtatc acctatcttc tgcgacatca agaatcaaac cgaatgccgg 11580
cgcgtgctcg aattccatgt tgccagttga ccacaatcag ccagtgctca tgcgatcaga 11640
ttaagccttg tcaatagtct cttgattaag aaaaaatgta agtggcaatg agatacaagg 11700
caaaacagct catggtaaat aatacgggta ggacatggcg agctccggtc ctgaaagggc 11760
agagcatcag attatcctac cagagtcaca cctgtcttca ccattggtca agcacaaact 11820
actctattac tggaaattaa ctgggctacc gcttcctgat gaatgtgact tcgaccacct 11880
cattctcagc cgacaatgga aaaaaatact tgaatcggcc tctcctgata ctgagagaat 11940
gataaaactc ggaagggcag tacaccaaac tcttaaccac aattccagaa taaccggagt 12000
gctccacccc aggtgtttag aagaactggc taatattgag gtcccagatt caaccaacaa 12060
atttcggaag attgagaaga agatccaaat tcacaacacg agatatggag aactgttcac 12120
aaggctgtgt acgcatatag agaagaaact gctggggtca tcttggtcta acaatgtccc 12180
ccggtcagag gagttcagca gcattcgtac ggatccggca ttctggtttc actcaaaatg 12240
gtccacagcc aagtttgcat ggctccatat aaaacagatc cagaggcatc tgatggtggc 12300
agctaggaca aggtctgcgg ccaacaaatt ggtgatgcta acccataagg taggccaagt 12360
ctttgtcact cctgaacttg tcgttgtgac gcatacgaat gagaacaagt tcacatgtct 12420
tacccaggaa cttgtattga tgtatgcaga tatgatggag ggcagagata tggtcaacat 12480
aatatcaacc acggcggtgc atctcagaag cttatcagag aaaattgatg acattttgcg 12540
gttaatagac gctctggcaa aagacttggg taatcaagtc tacgatgttg tatcactaat 12600
ggagggattt gcatacggag ctgtccagct actcgagccg tcaggtacat ttgcaggaga 12660
tttcttcgca ttcaacctgc aggagcttaa agacattcta attggcctcc tccccaatga 12720
tatagcagaa tccgtgactc atgcaatcgc tactgtattc tctggtttag aacagaatca 12780
agcagctgag atgttgtgtc tgttgcgtct gtggggtcac ccactgcttg agtcccgtat 12840
tgcagcaaag gcagtcagga gccaaatgtg cgcaccgaaa atggtagact ttgatatgat 12900
ccttcaggta ctgtctttct tcaagggaac aatcatcaac gggtacagaa agaagaatgc 12960
aggtgtgtgg ccgcgagtca aagtggatac aatatatggg aaggtcattg ggcaactaca 13020
tgcagattca gcagagattt cacacgatat catgttgaga gagtataaga gtttatctgc 13080
acttgaattt gagccatgta tagaatatga ccctgtcacc aacctgagca tgttcctaaa 13140
agacaaggca atcgcacacc ccaacgataa ttggcttgcc tcgtttaggc ggaaccttct 13200
ctccgaagac cagaagaaac atgtaaaaga agcaacttcg actaatcgcc tcttgataga 13260
gtttttagag tcaaatgatt ttgatccata taaagagatg gaatatctga cgacccttga 13320
gtaccttaga gatgacaatg tggcagtatc atactcgctc aaggagaagg aagtgaaagt 13380
taatggacgg atcttcgcta agctgacaaa gaagttaagg aactgtcagg tgatggcgga 13440
agggatccta gccgatcaga ttgcaccttt ctttcaggga aatggagtca ttcaggatag 13500
catatccttg accaagagta tgctagcgat gagtcaactg tcttttaaca gcaataagaa 13560
acgtatcact gactgtaaag aaagagtatc ttcaaaccgc aatcatgatc cgaaaagcaa 13620
gaaccgtcgg agagttgcaa ccttcataac aactgacctg caaaagtact gtcttaattg 13680
gagatatcag acaatcaaat tgttcgctca tgccatcaat cagttgatgg gcctacctca 13740
cttcttcgaa tggattcacc taagactgat ggacactacg atgttcgtag gagacccttt 13800
caatcctcca agtgacccta ctgactgtga cctctcaaga gtccctaatg atgacatata 13860
tattgtcagt gccagagggg gtatcgaagg attatgccag aagctatgga caatgatctc 13920
aattgctgca atccaacttg ctgcagctag atcgcattgt cgtgttgcct gtatggtaca 13980
gggtgataat caagtaatag cagtaacgag agaggtaaga tcagacgact ctccggagat 14040
ggtgttgaca cagttgcatc aagccagtga taatttcttc aaggaattaa ttcatgtcaa 14100
tcatttgatt ggccataatt tgaaggatcg tgaaaccatc aggtcagaca cattcttcat 14160
atacagcaaa cgaatcttca aagatggagc aatcctcagt caagtcctca aaaattcatc 14220
taaattagtg ctagtgtcag gtgatctcag tgaaaacacc gtaatgtcct gtgccaacat 14280
tgcctctact gtagcacggc tatgcgagaa cgggcttccc aaagacttct gttactattt 14340
aaactatata atgagttgtg tgcagacata ctttgactct gagttctcca tcaccaacaa 14400
ttcgcacccc gatcttaatc agtcgtggat tgaggacatc tcttttgtgc actcatatgt 14460
tctgactcct gcccaattag ggggactgag taaccttcaa tactcaaggc tctacactag 14520
aaatatcggt gacccgggga ctactgcttt tgcagagatc aagcgactag aagcagtggg 14580
attactgagt cctaacatta tgactaatat cttaactagg ccgcctggga atggagattg 14640
ggccagtctg tgcaacgacc catactcttt caattttgag actgttgcaa gcccaaatat 14700
tgttcttaag aaacatacgc aaagagtcct atttgaaact tgttcaaatc ccttattgtc 14760
tggagtgcac acagaggata atgaggcaga agagaaggca ttggctgaat tcttgcttaa 14820
tcaagaggtg attcatcccc gcgttgcgca tgccatcatg gaggcaagct ctgtaggtag 14880
gagaaagcaa attcaagggc ttgttgacac aacaaacacc gtaattaaga ttgcgcttac 14940
taggaggcca ttaggcatca agaggctgat gcggatagtc aattattcta gcatgcatgc 15000
aatgctgttt agagacgatg ttttttcctc cagtagatcc aaccacccct tagtctcttc 15060
taatatgtgt tctctgacac tggcagacta tgcacggaat agaagctggt cacctttgac 15120
gggaggcagg aaaatactgg gtgtatctaa tcctgatacg atagaactcg tagagggtga 15180
gattcttagt gtaagcggag ggtgtacaag atgtgacagc ggagatgaac aatttacttg 15240
gttccatctt ccaagcaata tagaattgac cgatgacacc agcaagaatc ctccgatgag 15300
ggtaccatat ctcgggtcaa agacacagga gaggagagct gcctcacttg caaaaatagc 15360
tcatatgtcg ccacatgtaa aggctgccct aagggcatca tccgtgttga tctgggctta 15420
tggggataat gaagtaaatt ggactgctgc tcttacgatt gcaaaatctc ggtgtaatgt 15480
aaacttagag tatcttcggt tactgtcccc tttacccacg gctgggaatc ttcaacatag 15540
actagatgat ggtataactc agatgacatt cacccctgca tctctctaca gggtgtcacc 15600
ttacattcac atatccaatg attctcaaag gctgttcact gaagaaggag tcaaagaggg 15660
gaatgtggtt taccaacaga tcatgctctt gggtttatct ctaatcgaat cgatctttcc 15720
aataacaaca accaggacat atgatgagat cacactgcac ctacatagta aatttagttg 15780
ctgtatcaga gaagcacctg ttgcggttcc tttcgagcta cttggggtgg taccggaact 15840
gaggacagtg acctcaaata agtttatgta tgatcctagc cctgtatcgg agggagactt 15900
tgcgagactt gacttagcta tcttcaagag ttatgagctt aatctggagt catatcccac 15960
gatagagcta atgaacattc tttcaatatc cagcgggaag ttgattggcc agtctgtggt 16020
ttcttatgat gaagatacct ccataaagaa tgacgccata atagtgtatg acaatacccg 16080
aaattggatc agtgaagctc agaattcaga tgtggtccgc ctatttgaat atgcagcact 16140
tgaagtgctc ctcgactgtt cttaccaact ctattacctg agagtaagag gcctagacaa 16200
tattgtctta tatatgggtg atttatacaa gaatatgcca ggaattctac tttccaacat 16260
tgcagctaca atatctcatc ccgtcattca ttcaaggtta catgcagtgg gcctggtcaa 16320
ccatgacgga tcacaccaac ttgcagatac ggattttatc gaaatgtctg caaaactatt 16380
agtatcttgc acccgacgtg tgatctccgg cttatattca ggaaataagt atgatctgct 16440
gttcccatct gtcttagatg ataacctgaa tgagaagatg cttcagctga tatcccggtt 16500
atgctgtctg tacacggtac tctttgctac aacaagagaa atcccgaaaa taagaggctt 16560
aactgcagaa gagaaatgtt caatactcac tgagtattta ctgtcggatg ctgtgaaacc 16620
attacttagt cccgatcaag tgagctctat catgtctcct aacataatta cattcccagc 16680
taatctgtac tacatgtctc ggaagagcct caatttgatc agggaaaggg aggacaggga 16740
tactatcctg gcgttgttgt tcccccaaga gccattatta gagttccctt ctgtgcaaga 16800
tattggtgct cgagtgaaag atccattcac ccgacaacct gcggcatttt tgcaagagtt 16860
agatttgagt gctccagcaa ggtatgacgc attcacactt agtcagattc atcctgaact 16920
cacatctcca aatccggagg aagactactt agtacgatac ttgttcagag ggatagggac 16980
tgcatcttcc tcttggtata aggcatctca tctcctttct gtacccgagg taagatgtgc 17040
aagacacggg aactccttat acttagctga agggagcgga gccatcatga gtcttctcga 17100
actgcatgta ccacatgaaa ctatctatta caatacgctc ttttcaaatg agatgaaccc 17160
cccgcaacga catttcgggc cgaccccaac tcagtttttg aattcggttg tttataggaa 17220
tctacaggcg gaggtaacat gcaaagatgg atttgtccaa gagttccgtc cattatggag 17280
agaaaataca gaggaaagtg acctgacctc agataaagta gtggggtata ttacatctgc 17340
agtgccctac agatctgtat cattgctgca ttgtgacatt gaaattcctc cagggtccaa 17400
tcaaagctta ctagatcaac tagctatcaa tttatctctg attgccatgc attctgtaag 17460
ggagggcggg gtagtaatca tcaaagtgtt gtatgcaatg ggatactact ttcatctact 17520
catgaacttg tttgctccgt gttccacaaa aggatatatt ctctctaatg gttatgcatg 17580
tcgaggagat atggagtgtt acctggtatt tgtcatgggt tacctgggcg ggcctacatt 17640
tgtacatgag gtggtgagga tggcgaaaac tctggtgcag cggcacggta cgcttttgtc 17700
taaatcagat gagatcacac tgaccaggtt attcacctca cagcggcagc gtgtgacaga 17760
catcctatcc agtcctttac caagattaat aaagtacttg aggaagaata ttgacactgc 17820
gctgattgaa gccgggggac agcccgtccg tccattctgt gcggagagtc tggtgagcac 17880
gctagcgaac ataactcaga taacccagat catcgctagt cacattgaca cagttatccg 17940
gtctgtgata tatatggaag ctgagggtga tctcgctgac acagtatttc tatttacccc 18000
ttacaatctc tctactgacg ggaaaaagag gacatcactt aaacagtgca cgagacagat 18060
cctagaggtt acaatactag gtcttagagt cgaaaatctc aataaaatag gcgatataat 18120
cagcctagtg cttaaaggca tgatctccat ggaggacctt atcccactaa ggacatactt 18180
gaagcatagt acctgcccta aatatttgaa ggctgtccta ggtattacca aactcaaaga 18240
aatgtttaca gacacttctg tactgtactt gactcgtgct caacaaaaat tctacatgaa 18300
aactataggc aatgcagtca aaggatatta cagtaactgt gactcttaac gaaaatcaca 18360
tattaatagg ctcctttttt ggccaattgt attcttgttg atttaatcat attatgttag 18420
aaaaaagttg aaccctgact ccttaggact cgaattcgaa ctcaaataaa tgtcttaaaa 18480
aaaggttgcg cacaattatt cttgagtgta gtctcgtcat tcaccaaatc tttgtttggt 18540
ttggtggccg gcatggtccc agcctcctcg ctggcgccgg ctgggcaaca ttccgagggg 18600
accgtcccct cggtaatggc gaatgggacg cggccgatcc ggctgctaac aaagcccgaa 18660
aggaagctga gttggctgct gccaccgctg agcaataact agcataaccc cttggggcct 18720
ctaaacgggt cttgaggggt tttttgctga aaggaggaac tatatccgga tcggccgatc 18780
cggctgctaa caaagcccga aaggaagctg agttggctgc tgccaccgct gagcaataac 18840
tagcataacc ccttggggcc tctaaacggg tcttgagggg ttttttgctg aaaggaggaa 18900
ctatatccgg atggccgcca ccggtgggcc ttgcagcaca tccccccttc gccag 18955
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> upstream primer
<400> 5
tcaagcgcct tgctctaaat ggc 23
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> downstream primer
<400> 6
gggcagaatc aaagtacagc ccaat 25
<210> 7
<211> 18901
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> genome sequence of recombinant Newcastle disease virus rClone30-Anh- (F) -hOX40L
<400> 7
ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gtagcctgaa 60
tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 120
cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 180
ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 240
gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 300
acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 360
ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 420
ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 480
acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 540
tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 600
tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 660
gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 720
ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 780
agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 840
agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 900
tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 960
tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 1020
cagtgctgcc ataagcatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1080
aggaccgaag gagctaaccg ctttttttca caacatgggg gatcatgtaa ctcgccttga 1140
tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1200
tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1260
ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1320
ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1380
cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1440
gacgggcagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1500
actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1560
aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1620
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1680
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1740
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1800
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1860
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1920
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1980
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 2040
gcgaacgacc tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct 2100
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2160
cacgagggag cttccagggg ggaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2220
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggccgagcc tatggaaaaa 2280
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2340
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2400
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2460
gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 2520
cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttacct 2580
cactcattag gcaccccagg ctttacactt tatgcttccg gctcctatgt tgtgtggaat 2640
tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg ccaagctcgg 2700
aagcggccgc taatacgact cactataggg accaaacaga gaatccgtaa gttacgataa 2760
aaggcgaagg agcaattgaa gtcgcacggg tagaaggtgt gaatctcgag tgcgagcccg 2820
aagcacaaac tcgagaaagc cttctgccaa catgtcttcc gtatttgatg agtacgaaca 2880
gctcctcgcg gctcagactc gccccaatgg agctcatgga gggggagaaa aagggagtac 2940
cttaaaagta gacgtcccgg tattcactct taacagtgat gacccagaag atagatggag 3000
ctttgtggta ttctgcctcc ggattgctgt tagcgaagat gccaacaaac cactcaggca 3060
aggtgctctc atatctcttt tatgctccca ctcacaggta atgaggaacc atgttgccct 3120
tgcagggaaa cagaatgaag ccacattggc cgtgcttgag attgatggct ttgccaacgg 3180
cacgccccag ttcaacaata ggagtggagt gtctgaagag agagcacaga gatttgcgat 3240
gatagcagga tctctccctc gggcatgcag caacggaacc ccgttcgtca cagccggggc 3300
cgaagatgat gcaccagaag acatcaccga taccctggag aggatcctct ctatccaggc 3360
tcaagtatgg gtcacagtag caaaagccat gactgcgtat gagactgcag atgagtcgga 3420
aacaaggcga atcaataagt atatgcagca aggcagggtc caaaagaaat acatcctcta 3480
ccccgtatgc aggagcacaa tccaactcac gatcagacag tctcttgcag tccgcatctt 3540
tttggttagc gagctcaaga gaggccgcaa cacggcaggt ggtacctcta cttattataa 3600
cctggtaggg gacgtagact catacatcag gaataccggg cttactgcat tcttcttgac 3660
actcaagtac ggaatcaaca ccaagacatc agcccttgca cttagtagcc tctcaggcga 3720
catccagaag atgaagcagc tcatgcgttt gtatcggatg aaaggagata atgcgccgta 3780
catgacatta cttggtgata gtgaccagat gagctttgcg cctgccgagt atgcacaact 3840
ttactccttt gccatgggta tggcatcagt cctagataaa ggtactggga aataccaatt 3900
tgccagggac tttatgagca catcattctg gagacttgga gtagagtacg ctcaggctca 3960
gggaagtagc attaacgagg atatggctgc cgagctaaag ctaaccccag cagcaaggag 4020
gggcctggca gctgctgccc aacgggtctc cgaggagacc agcagcatag acatgcctac 4080
tcaacaagtc ggagtcctca ctgggcttag cgaggggggg tcccaagctc tacaaggcgg 4140
atcgaataga tcgcaagggc aaccagaagc cggggatggg gagacccaat tcctggatct 4200
gatgagagcg gtagcaaata gcatgaggga ggcgccaaac tctgcacagg gcactcccca 4260
atcggggcct cccccaactc ctgggccatc ccaagataac gacaccgact gggggtattg 4320
atggacaaaa cccagcctgc ttccacaaaa acatcccaat gccctcaccc gtagtcgacc 4380
cctcgatttg cggctctata tgaccacacc ctcaaacaaa catccccctc tttcctccct 4440
ccccctgctg tacaactccg cacgccctag ataccacagg cacaatgcgg ctcactaaca 4500
atcaaaacag agccgaggga attagaaaaa agtacgggta gaagagggat attcagagat 4560
cagggcaagt ctcccgagtc tctgctctct cctctacctg atagaccagg acaaacatgg 4620
ccacctttac agatgcagag atcgacgagc tatttgagac aagtggaact gtcattgaca 4680
acataattac agcccagggt aaaccagcag agactgttgg aaggagtgca atcccacaag 4740
gcaagaccaa ggtgctgagc gcagcatggg agaagcatgg gagcatccag ccaccggcca 4800
gtcaagacaa ccccgatcga caggacagat ctgacaaaca accatccaca cccgagcaaa 4860
cgaccccgca tgacagcccg ccggccacat ccgccgacca gccccccacc caggccacag 4920
acgaagccgt cgacacacag ctcaggaccg gagcaagcaa ctctctgctg ttgatgcttg 4980
acaagctcag caataaatcg tccaatgcta aaaagggccc atggtcgagc ccccaagagg 5040
ggaatcacca acgtccgact caacagcagg ggagtcaacc cagtcgcgga aacagtcagg 5100
aaagaccgca gaaccaagtc aaggccgccc ctggaaacca gggcacagac gtgaacacag 5160
catatcatgg acaatgggag gagtcacaac tatcagctgg tgcaacccct catgctctcc 5220
gatcaaggca gagccaagac aatacccttg tatctgcgga tcatgtccag ccacctgtag 5280
actttgtgca agcgatgatg tctatgatgg aggcgatatc acagagagta agtaaggttg 5340
actatcagct agatcttgtc ttgaaacaga catcctccat ccctatgatg cggtccgaaa 5400
tccaacagct gaaaacatct gttgcagtca tggaagccaa cttgggaatg atgaagattc 5460
tggatcccgg ttgtgccaac atttcatctc tgagtgatct acgggcagtt gcccgatctc 5520
acccggtttt agtttcaggc cctggagacc cctctcccta tgtgacacaa ggaggcgaaa 5580
tggcacttaa taaactttcg caaccagtgc cacatccatc tgaattgatt aaacccgcca 5640
ctgcatgcgg gcctgatata ggagtggaaa aggacactgt ccgtgcattg atcatgtcac 5700
gcccaatgca cccgagttct tcagccaagc tcctaagcaa gttagatgca gccgggtcga 5760
tcgaggaaat caggaaaatc aagcgccttg ctctaaatgg ctaattacta ctgccacacg 5820
tagcgggtcc ctgtccactc ggcatcacac ggaatctgca ccgagttccc ccccgcagac 5880
ccaaggtcca actctccaag cggcaatcct ctctcgcttc ctcagcccca ctgaatgatc 5940
gcgtaaccgt aattaatcta gctacattta agattaagaa aaaatacggg tagaatcccc 6000
gcggccgcca ccatggagac agacacactc ctgctatggg tactgctgct ctgggttcca 6060
ggatccactg gtcaggtatc acatcggtat cctcgaattc aaagtatcaa agtacaattt 6120
accgaatata agaaggagaa aggtttcatc ctcacttccc aaaaggagga tgaaatcatg 6180
aaggtgcaga acaactcagt catcatcaac tgtgatgggt tttatctcat ctccctgaag 6240
ggctacttct cccaggaagt caacattagc cttcattacc agaaggatga ggagcccctc 6300
ttccaactga agaaggtcag gtctgtcaac tccttgatgg tggcctctct gacttacaaa 6360
gacaaagtct acttgaatgt gaccactgac aatacctccc tggatgactt ccatgtgaat 6420
ggcggagaac tgattcttat ccatcaaaat cctggtgaat tctgtgtcct ttgataagaa 6480
aaaatacggg tagaagttta aacccttgga gtgccccaat tgtgccaaga tggactcatc 6540
taggacaatt gggctgtact ttgattctgc ccattcttct agcaacctgt tagcatttcc 6600
gatcgtccta caagacacag gagatgggaa gaagcaaatc gccccgcaat ataggatcca 6660
gcgccttgac ttgtggactg atagtaagga ggactcagta ttcatcacca cctatggatt 6720
catctttcaa gttgggaatg aagaagccac tgtcggcatg atcgatgata aacccaagcg 6780
cgagttactt tccgctgcga tgctctgcct aggaagcgtc ccaaataccg gagaccttat 6840
tgagctggca agggcctgtc tcactatgat agtcacatgc aagaagagtg caactaatac 6900
tgagagaatg gttttctcag tagtgcaggc accccaagtg ctgcaaagct gtagggttgt 6960
ggcaaacaaa tactcatcag tgaatgcagt caagcacgtg aaagcgccag agaagattcc 7020
cgggagtgga accctagaat acaaggtgaa ctttgtctcc ttgactgtgg taccgaagaa 7080
ggatgtctac aagatcccag ctgcagtatt gaaggtttct ggctcgagtc tgtacaatct 7140
tgcgctcaat gtcactatta atgtggaggt agacccgagg agtcctttgg ttaaatctct 7200
gtctaagtct gacagcggat actatgctaa cctcttcttg catattggac ttatgaccac 7260
cgtagatagg aaggggaaga aagtgacatt tgacaagctg gaaaagaaaa taaggagcct 7320
tgatctatct gtcgggctca gtgatgtgct cgggccttcc gtgttggtaa aagcaagagg 7380
tgcacggact aagcttttgg cacctttctt ctctagcagt gggacagcct gctatcccat 7440
agcaaatgct tctcctcagg tggccaagat actctggagt caaaccgcgt gcctgcggag 7500
cgttaaaatc attatccaag caggtaccca acgcgctgtc gcagtgaccg ccgaccacga 7560
ggttacctct actaagctgg agaaggggca cacccttgcc aaatacaatc cttttaagaa 7620
ataagctgcg tctctgagat tgcgctccgc ccactcaccc agatcatcat gacacaaaaa 7680
actaatctgt cttgattatt tacagttagt ttacctgtct atcaagttag aaaaaacacg 7740
ggtagaagat tctggatccc ggttggcgcc ctccaggtgc aagatgggcc ccaaaccccc 7800
caccggaacc ccagcgcctc tggtgctgat cgcccggacc gcgctggcgt tgggctgtgt 7860
ctgtccggcg ggctctcttg acggcagacc tcttgcagct gcagggattg tggtaacgag 7920
agataaagca gtcaatatat acacttcatc tcaaacgggg tcaatcatag tcaagttact 7980
cccaaatatg cccaaagaca aggaggcgtg cgcaaaagcc ccattagagg cgtacaatag 8040
aacactgacc actttactca ctcctcttgg cgactccatc cgcaggatac aagggtctgc 8100
aactacatct agaggaagga gacagaaacg ttttgtaggt gctatcattg gcagtatagc 8160
tcttggggtt gcgacagctg cacaagtaac agcagctgca gctctgatac aagccaacca 8220
gaacgctgcc aacatcctcc ggcttaagga gagcattgct gcaaccaatg aagctgtgca 8280
cgaggtcact gacggattat cacaactagc gatggcgatt gggaagatgc agcagtttgt 8340
taatgaccag tttaataata cggcgcgaga attggactgc atcaaaatta cacaacaggt 8400
tggtgtcgaa ctcaatttgt atctaactga actgactaca gtattcgggc cacaaatcac 8460
ttcccctgct ttaactcagc taactatcca ggcactttat aatttagctg gtggcaatat 8520
gaattactta ttgactaagt taggtgtagg gaacaatcaa cttagctcat taattagtag 8580
tggcctgatc actggcaacc ccattttata tgactcacag acccaactct taggcataca 8640
gataaatgta ccctcagtcg ggagcctaaa taatatgcgt gccacctact tggagacctt 8700
atccgtaagc acaaccaggg ggttcgcctc agcacttgtc ccgaaagttg tgacgcaagt 8760
tggttctgtg atagaagaac ttgacacctc atattgtata gaatctaatc tggatttata 8820
ttgtacaagg atagtgacat tccccatgtc tcccggcatt tattcctgtc tgagcggtaa 8880
tacgtcagct tgtatgtatt caaagactga gggtgcactc actacaccat acatagctct 8940
caagggctca gttattgcta attgcaagat gattacatgt agatgtgcag accccccagg 9000
tatcatatcg caaaattacg gagaagctgt gtccctaata gataaacatt catgtaatgt 9060
cttatcccta gacggaataa ccctgaggct cagtggggaa tttgatgcga cctatcaaaa 9120
gaacatctta atactagatt cccaggtcat cgtgacaggc aatctcgata tatcaactga 9180
acttgggaat gtcaacaact cgataagcag tgctctggac aaattagcgg aaagtaacag 9240
caagttaaac aaagtcaatg tcaacctaac tagcacatct gctctcatta cttatattgt 9300
tctagctgtc atatctcttg ttttcggcgt aattagcctg attctagcgt gctgcttgat 9360
gtataaacaa aaagcacaac aaaagacctt actatggctt gggaacaata ccctcgatca 9420
gatgagagcc accacaaaaa catgaacaca gatgaggaac gaaggtttcc ctaatagtaa 9480
tttgtgtgaa agttctggta gtctgtcagt taagaaaaaa tacgggtaga aggttaaccg 9540
gcccgcggcg acgcgtggcc tgagaggcct tcagagagtt aagaaaaaac taccggttgt 9600
agatgaccaa aggacgatat acgggtagaa cggtaagaga ggccgcccct caattgcgag 9660
ccaggcttca caacctccgt tctaccgctt caccgacaac agtcctcaat catggaccgc 9720
gccgttagcc aagttgcgtt agagaatgat gaaagagagg caaaaaatac atggcgcttg 9780
atattccgga ttgcaatctt attcttaaca gtagtgacct tggctatatc tgtagcctcc 9840
cttttatata gcatgggggc tagcacacct agcgatcttg taggcatacc gactaggatt 9900
tccagggcag aagaaaagat tacatctaca cttggttcca atcaagatgt agtagatagg 9960
atatataagc aagtggccct tgagtctccg ttggcattgt taaatactga gaccacaatt 10020
atgaacgcaa taacatctct ctcttatcag attaatggag ctgcaaacaa cagtgggtgg 10080
ggggcaccta tccatgaccc agattatata ggggggatag gcaaagaact cattgtagat 10140
gatgctagtg atgtcacatc attctatccc tctgcatttc aagaacatct gaattttatc 10200
ccggcgccta ctacaggatc aggttgcact cgaataccct catttgacat gagtgctacc 10260
cattactgct acacccataa tgtaatattg tctggatgca gagatcactc acattcatat 10320
cagtatttag cacttggtgt gctccggaca tctgcaacag ggagggtatt cttttctact 10380
ctgcgttcca tcaacctgga cgacacccaa aatcggaagt cttgcagtgt gagtgcaact 10440
cccctgggtt gtgatatgct gtgctcgaaa gtcacggaga cagaggaaga agattataac 10500
tcagctgtcc ctacgcggat ggtacatggg aggttagggt tcgacggcca gtaccacgaa 10560
aaggacctag atgtcacaac attattcggg gactgggtgg ccaactaccc aggagtaggg 10620
ggtggatctt ttattgacag ccgcgtatgg ttctcagtct acggagggtt aaaacccaat 10680
tcacccagtg acactgtaca ggaagggaaa tatgtgatat acaagcgata caatgacaca 10740
tgcccagatg agcaagacta ccagattcga atggccaagt cttcgtataa gcctggacgg 10800
tttggtggga aacgcataca gcaggctatc ttatctatca aggtgtcaac atccttaggc 10860
gaagacccgg tactgactgt accgcccaac acagtcacac tcatgggggc cgaaggcaga 10920
attctcacag tagggacatc tcatttcttg tatcaacgag ggtcatcata cttctctccc 10980
gcgttattat atcctatgac agtcagcaac aaaacagcca ctcttcatag tccttataca 11040
ttcaatgcct tcactcggcc aggtagtatc ccttgccagg cttcagcaag atgccccaac 11100
tcgtgtgtta ctggagtcta tacagatcca tatcccctaa tcttctatag aaaccacacc 11160
ttgcgagggg tattcgggac aatgcttgat ggtgtacaag caagacttaa ccctgcgtct 11220
gcagtattcg atagcacatc ccgcagtcgc attactcgag tgagttcaag cagtaccaaa 11280
gcagcataca caacatcaac ttgttttaaa gtggtcaaga ctaataagac ctattgtctc 11340
agcattgctg aaatatctaa tactctcttc ggagaattca gaatcgtccc gttactagtt 11400
gagatcctca aagatgacgg ggttagagaa gccaggtctg gctagttgag tcaattataa 11460
aggagttgga aagatggcat tgtatcacct atcttctgcg acatcaagaa tcaaaccgaa 11520
tgccggcgcg tgctcgaatt ccatgttgcc agttgaccac aatcagccag tgctcatgcg 11580
atcagattaa gccttgtcaa tagtctcttg attaagaaaa aatgtaagtg gcaatgagat 11640
acaaggcaaa acagctcatg gtaaataata cgggtaggac atggcgagct ccggtcctga 11700
aagggcagag catcagatta tcctaccaga gtcacacctg tcttcaccat tggtcaagca 11760
caaactactc tattactgga aattaactgg gctaccgctt cctgatgaat gtgacttcga 11820
ccacctcatt ctcagccgac aatggaaaaa aatacttgaa tcggcctctc ctgatactga 11880
gagaatgata aaactcggaa gggcagtaca ccaaactctt aaccacaatt ccagaataac 11940
cggagtgctc caccccaggt gtttagaaga actggctaat attgaggtcc cagattcaac 12000
caacaaattt cggaagattg agaagaagat ccaaattcac aacacgagat atggagaact 12060
gttcacaagg ctgtgtacgc atatagagaa gaaactgctg gggtcatctt ggtctaacaa 12120
tgtcccccgg tcagaggagt tcagcagcat tcgtacggat ccggcattct ggtttcactc 12180
aaaatggtcc acagccaagt ttgcatggct ccatataaaa cagatccaga ggcatctgat 12240
ggtggcagct aggacaaggt ctgcggccaa caaattggtg atgctaaccc ataaggtagg 12300
ccaagtcttt gtcactcctg aacttgtcgt tgtgacgcat acgaatgaga acaagttcac 12360
atgtcttacc caggaacttg tattgatgta tgcagatatg atggagggca gagatatggt 12420
caacataata tcaaccacgg cggtgcatct cagaagctta tcagagaaaa ttgatgacat 12480
tttgcggtta atagacgctc tggcaaaaga cttgggtaat caagtctacg atgttgtatc 12540
actaatggag ggatttgcat acggagctgt ccagctactc gagccgtcag gtacatttgc 12600
aggagatttc ttcgcattca acctgcagga gcttaaagac attctaattg gcctcctccc 12660
caatgatata gcagaatccg tgactcatgc aatcgctact gtattctctg gtttagaaca 12720
gaatcaagca gctgagatgt tgtgtctgtt gcgtctgtgg ggtcacccac tgcttgagtc 12780
ccgtattgca gcaaaggcag tcaggagcca aatgtgcgca ccgaaaatgg tagactttga 12840
tatgatcctt caggtactgt ctttcttcaa gggaacaatc atcaacgggt acagaaagaa 12900
gaatgcaggt gtgtggccgc gagtcaaagt ggatacaata tatgggaagg tcattgggca 12960
actacatgca gattcagcag agatttcaca cgatatcatg ttgagagagt ataagagttt 13020
atctgcactt gaatttgagc catgtataga atatgaccct gtcaccaacc tgagcatgtt 13080
cctaaaagac aaggcaatcg cacaccccaa cgataattgg cttgcctcgt ttaggcggaa 13140
ccttctctcc gaagaccaga agaaacatgt aaaagaagca acttcgacta atcgcctctt 13200
gatagagttt ttagagtcaa atgattttga tccatataaa gagatggaat atctgacgac 13260
ccttgagtac cttagagatg acaatgtggc agtatcatac tcgctcaagg agaaggaagt 13320
gaaagttaat ggacggatct tcgctaagct gacaaagaag ttaaggaact gtcaggtgat 13380
ggcggaaggg atcctagccg atcagattgc acctttcttt cagggaaatg gagtcattca 13440
ggatagcata tccttgacca agagtatgct agcgatgagt caactgtctt ttaacagcaa 13500
taagaaacgt atcactgact gtaaagaaag agtatcttca aaccgcaatc atgatccgaa 13560
aagcaagaac cgtcggagag ttgcaacctt cataacaact gacctgcaaa agtactgtct 13620
taattggaga tatcagacaa tcaaattgtt cgctcatgcc atcaatcagt tgatgggcct 13680
acctcacttc ttcgaatgga ttcacctaag actgatggac actacgatgt tcgtaggaga 13740
ccctttcaat cctccaagtg accctactga ctgtgacctc tcaagagtcc ctaatgatga 13800
catatatatt gtcagtgcca gagggggtat cgaaggatta tgccagaagc tatggacaat 13860
gatctcaatt gctgcaatcc aacttgctgc agctagatcg cattgtcgtg ttgcctgtat 13920
ggtacagggt gataatcaag taatagcagt aacgagagag gtaagatcag acgactctcc 13980
ggagatggtg ttgacacagt tgcatcaagc cagtgataat ttcttcaagg aattaattca 14040
tgtcaatcat ttgattggcc ataatttgaa ggatcgtgaa accatcaggt cagacacatt 14100
cttcatatac agcaaacgaa tcttcaaaga tggagcaatc ctcagtcaag tcctcaaaaa 14160
ttcatctaaa ttagtgctag tgtcaggtga tctcagtgaa aacaccgtaa tgtcctgtgc 14220
caacattgcc tctactgtag cacggctatg cgagaacggg cttcccaaag acttctgtta 14280
ctatttaaac tatataatga gttgtgtgca gacatacttt gactctgagt tctccatcac 14340
caacaattcg caccccgatc ttaatcagtc gtggattgag gacatctctt ttgtgcactc 14400
atatgttctg actcctgccc aattaggggg actgagtaac cttcaatact caaggctcta 14460
cactagaaat atcggtgacc cggggactac tgcttttgca gagatcaagc gactagaagc 14520
agtgggatta ctgagtccta acattatgac taatatctta actaggccgc ctgggaatgg 14580
agattgggcc agtctgtgca acgacccata ctctttcaat tttgagactg ttgcaagccc 14640
aaatattgtt cttaagaaac atacgcaaag agtcctattt gaaacttgtt caaatccctt 14700
attgtctgga gtgcacacag aggataatga ggcagaagag aaggcattgg ctgaattctt 14760
gcttaatcaa gaggtgattc atccccgcgt tgcgcatgcc atcatggagg caagctctgt 14820
aggtaggaga aagcaaattc aagggcttgt tgacacaaca aacaccgtaa ttaagattgc 14880
gcttactagg aggccattag gcatcaagag gctgatgcgg atagtcaatt attctagcat 14940
gcatgcaatg ctgtttagag acgatgtttt ttcctccagt agatccaacc accccttagt 15000
ctcttctaat atgtgttctc tgacactggc agactatgca cggaatagaa gctggtcacc 15060
tttgacggga ggcaggaaaa tactgggtgt atctaatcct gatacgatag aactcgtaga 15120
gggtgagatt cttagtgtaa gcggagggtg tacaagatgt gacagcggag atgaacaatt 15180
tacttggttc catcttccaa gcaatataga attgaccgat gacaccagca agaatcctcc 15240
gatgagggta ccatatctcg ggtcaaagac acaggagagg agagctgcct cacttgcaaa 15300
aatagctcat atgtcgccac atgtaaaggc tgccctaagg gcatcatccg tgttgatctg 15360
ggcttatggg gataatgaag taaattggac tgctgctctt acgattgcaa aatctcggtg 15420
taatgtaaac ttagagtatc ttcggttact gtccccttta cccacggctg ggaatcttca 15480
acatagacta gatgatggta taactcagat gacattcacc cctgcatctc tctacagggt 15540
gtcaccttac attcacatat ccaatgattc tcaaaggctg ttcactgaag aaggagtcaa 15600
agaggggaat gtggtttacc aacagatcat gctcttgggt ttatctctaa tcgaatcgat 15660
ctttccaata acaacaacca ggacatatga tgagatcaca ctgcacctac atagtaaatt 15720
tagttgctgt atcagagaag cacctgttgc ggttcctttc gagctacttg gggtggtacc 15780
ggaactgagg acagtgacct caaataagtt tatgtatgat cctagccctg tatcggaggg 15840
agactttgcg agacttgact tagctatctt caagagttat gagcttaatc tggagtcata 15900
tcccacgata gagctaatga acattctttc aatatccagc gggaagttga ttggccagtc 15960
tgtggtttct tatgatgaag atacctccat aaagaatgac gccataatag tgtatgacaa 16020
tacccgaaat tggatcagtg aagctcagaa ttcagatgtg gtccgcctat ttgaatatgc 16080
agcacttgaa gtgctcctcg actgttctta ccaactctat tacctgagag taagaggcct 16140
agacaatatt gtcttatata tgggtgattt atacaagaat atgccaggaa ttctactttc 16200
caacattgca gctacaatat ctcatcccgt cattcattca aggttacatg cagtgggcct 16260
ggtcaaccat gacggatcac accaacttgc agatacggat tttatcgaaa tgtctgcaaa 16320
actattagta tcttgcaccc gacgtgtgat ctccggctta tattcaggaa ataagtatga 16380
tctgctgttc ccatctgtct tagatgataa cctgaatgag aagatgcttc agctgatatc 16440
ccggttatgc tgtctgtaca cggtactctt tgctacaaca agagaaatcc cgaaaataag 16500
aggcttaact gcagaagaga aatgttcaat actcactgag tatttactgt cggatgctgt 16560
gaaaccatta cttagtcccg atcaagtgag ctctatcatg tctcctaaca taattacatt 16620
cccagctaat ctgtactaca tgtctcggaa gagcctcaat ttgatcaggg aaagggagga 16680
cagggatact atcctggcgt tgttgttccc ccaagagcca ttattagagt tcccttctgt 16740
gcaagatatt ggtgctcgag tgaaagatcc attcacccga caacctgcgg catttttgca 16800
agagttagat ttgagtgctc cagcaaggta tgacgcattc acacttagtc agattcatcc 16860
tgaactcaca tctccaaatc cggaggaaga ctacttagta cgatacttgt tcagagggat 16920
agggactgca tcttcctctt ggtataaggc atctcatctc ctttctgtac ccgaggtaag 16980
atgtgcaaga cacgggaact ccttatactt agctgaaggg agcggagcca tcatgagtct 17040
tctcgaactg catgtaccac atgaaactat ctattacaat acgctctttt caaatgagat 17100
gaaccccccg caacgacatt tcgggccgac cccaactcag tttttgaatt cggttgttta 17160
taggaatcta caggcggagg taacatgcaa agatggattt gtccaagagt tccgtccatt 17220
atggagagaa aatacagagg aaagtgacct gacctcagat aaagtagtgg ggtatattac 17280
atctgcagtg ccctacagat ctgtatcatt gctgcattgt gacattgaaa ttcctccagg 17340
gtccaatcaa agcttactag atcaactagc tatcaattta tctctgattg ccatgcattc 17400
tgtaagggag ggcggggtag taatcatcaa agtgttgtat gcaatgggat actactttca 17460
tctactcatg aacttgtttg ctccgtgttc cacaaaagga tatattctct ctaatggtta 17520
tgcatgtcga ggagatatgg agtgttacct ggtatttgtc atgggttacc tgggcgggcc 17580
tacatttgta catgaggtgg tgaggatggc gaaaactctg gtgcagcggc acggtacgct 17640
tttgtctaaa tcagatgaga tcacactgac caggttattc acctcacagc ggcagcgtgt 17700
gacagacatc ctatccagtc ctttaccaag attaataaag tacttgagga agaatattga 17760
cactgcgctg attgaagccg ggggacagcc cgtccgtcca ttctgtgcgg agagtctggt 17820
gagcacgcta gcgaacataa ctcagataac ccagatcatc gctagtcaca ttgacacagt 17880
tatccggtct gtgatatata tggaagctga gggtgatctc gctgacacag tatttctatt 17940
taccccttac aatctctcta ctgacgggaa aaagaggaca tcacttaaac agtgcacgag 18000
acagatccta gaggttacaa tactaggtct tagagtcgaa aatctcaata aaataggcga 18060
tataatcagc ctagtgctta aaggcatgat ctccatggag gaccttatcc cactaaggac 18120
atacttgaag catagtacct gccctaaata tttgaaggct gtcctaggta ttaccaaact 18180
caaagaaatg tttacagaca cttctgtact gtacttgact cgtgctcaac aaaaattcta 18240
catgaaaact ataggcaatg cagtcaaagg atattacagt aactgtgact cttaacgaaa 18300
atcacatatt aataggctcc ttttttggcc aattgtattc ttgttgattt aatcatatta 18360
tgttagaaaa aagttgaacc ctgactcctt aggactcgaa ttcgaactca aataaatgtc 18420
ttaaaaaaag gttgcgcaca attattcttg agtgtagtct cgtcattcac caaatctttg 18480
tttggtttgg tggccggcat ggtcccagcc tcctcgctgg cgccggctgg gcaacattcc 18540
gaggggaccg tcccctcggt aatggcgaat gggacgcggc cgatccggct gctaacaaag 18600
cccgaaagga agctgagttg gctgctgcca ccgctgagca ataactagca taaccccttg 18660
gggcctctaa acgggtcttg aggggttttt tgctgaaagg aggaactata tccggatcgg 18720
ccgatccggc tgctaacaaa gcccgaaagg aagctgagtt ggctgctgcc accgctgagc 18780
aataactagc ataacccctt ggggcctcta aacgggtctt gaggggtttt ttgctgaaag 18840
gaggaactat atccggatgg ccgccaccgg tgggccttgc agcacatccc cccttcgcca 18900
g 18901
<210> 8
<211> 18955
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> genome sequence of recombinant Newcastle disease virus rClone30-Anh- (F) -mOX40L
<400> 8
ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gtagcctgaa 60
tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 120
cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 180
ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 240
gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 300
acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 360
ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 420
ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 480
acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 540
tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 600
tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 660
gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 720
ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 780
agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 840
agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 900
tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 960
tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 1020
cagtgctgcc ataagcatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1080
aggaccgaag gagctaaccg ctttttttca caacatgggg gatcatgtaa ctcgccttga 1140
tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1200
tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1260
ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1320
ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1380
cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1440
gacgggcagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1500
actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1560
aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1620
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1680
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1740
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1800
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1860
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1920
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1980
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 2040
gcgaacgacc tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct 2100
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2160
cacgagggag cttccagggg ggaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2220
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggccgagcc tatggaaaaa 2280
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2340
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2400
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2460
gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 2520
cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttacct 2580
cactcattag gcaccccagg ctttacactt tatgcttccg gctcctatgt tgtgtggaat 2640
tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg ccaagctcgg 2700
aagcggccgc taatacgact cactataggg accaaacaga gaatccgtaa gttacgataa 2760
aaggcgaagg agcaattgaa gtcgcacggg tagaaggtgt gaatctcgag tgcgagcccg 2820
aagcacaaac tcgagaaagc cttctgccaa catgtcttcc gtatttgatg agtacgaaca 2880
gctcctcgcg gctcagactc gccccaatgg agctcatgga gggggagaaa aagggagtac 2940
cttaaaagta gacgtcccgg tattcactct taacagtgat gacccagaag atagatggag 3000
ctttgtggta ttctgcctcc ggattgctgt tagcgaagat gccaacaaac cactcaggca 3060
aggtgctctc atatctcttt tatgctccca ctcacaggta atgaggaacc atgttgccct 3120
tgcagggaaa cagaatgaag ccacattggc cgtgcttgag attgatggct ttgccaacgg 3180
cacgccccag ttcaacaata ggagtggagt gtctgaagag agagcacaga gatttgcgat 3240
gatagcagga tctctccctc gggcatgcag caacggaacc ccgttcgtca cagccggggc 3300
cgaagatgat gcaccagaag acatcaccga taccctggag aggatcctct ctatccaggc 3360
tcaagtatgg gtcacagtag caaaagccat gactgcgtat gagactgcag atgagtcgga 3420
aacaaggcga atcaataagt atatgcagca aggcagggtc caaaagaaat acatcctcta 3480
ccccgtatgc aggagcacaa tccaactcac gatcagacag tctcttgcag tccgcatctt 3540
tttggttagc gagctcaaga gaggccgcaa cacggcaggt ggtacctcta cttattataa 3600
cctggtaggg gacgtagact catacatcag gaataccggg cttactgcat tcttcttgac 3660
actcaagtac ggaatcaaca ccaagacatc agcccttgca cttagtagcc tctcaggcga 3720
catccagaag atgaagcagc tcatgcgttt gtatcggatg aaaggagata atgcgccgta 3780
catgacatta cttggtgata gtgaccagat gagctttgcg cctgccgagt atgcacaact 3840
ttactccttt gccatgggta tggcatcagt cctagataaa ggtactggga aataccaatt 3900
tgccagggac tttatgagca catcattctg gagacttgga gtagagtacg ctcaggctca 3960
gggaagtagc attaacgagg atatggctgc cgagctaaag ctaaccccag cagcaaggag 4020
gggcctggca gctgctgccc aacgggtctc cgaggagacc agcagcatag acatgcctac 4080
tcaacaagtc ggagtcctca ctgggcttag cgaggggggg tcccaagctc tacaaggcgg 4140
atcgaataga tcgcaagggc aaccagaagc cggggatggg gagacccaat tcctggatct 4200
gatgagagcg gtagcaaata gcatgaggga ggcgccaaac tctgcacagg gcactcccca 4260
atcggggcct cccccaactc ctgggccatc ccaagataac gacaccgact gggggtattg 4320
atggacaaaa cccagcctgc ttccacaaaa acatcccaat gccctcaccc gtagtcgacc 4380
cctcgatttg cggctctata tgaccacacc ctcaaacaaa catccccctc tttcctccct 4440
ccccctgctg tacaactccg cacgccctag ataccacagg cacaatgcgg ctcactaaca 4500
atcaaaacag agccgaggga attagaaaaa agtacgggta gaagagggat attcagagat 4560
cagggcaagt ctcccgagtc tctgctctct cctctacctg atagaccagg acaaacatgg 4620
ccacctttac agatgcagag atcgacgagc tatttgagac aagtggaact gtcattgaca 4680
acataattac agcccagggt aaaccagcag agactgttgg aaggagtgca atcccacaag 4740
gcaagaccaa ggtgctgagc gcagcatggg agaagcatgg gagcatccag ccaccggcca 4800
gtcaagacaa ccccgatcga caggacagat ctgacaaaca accatccaca cccgagcaaa 4860
cgaccccgca tgacagcccg ccggccacat ccgccgacca gccccccacc caggccacag 4920
acgaagccgt cgacacacag ctcaggaccg gagcaagcaa ctctctgctg ttgatgcttg 4980
acaagctcag caataaatcg tccaatgcta aaaagggccc atggtcgagc ccccaagagg 5040
ggaatcacca acgtccgact caacagcagg ggagtcaacc cagtcgcgga aacagtcagg 5100
aaagaccgca gaaccaagtc aaggccgccc ctggaaacca gggcacagac gtgaacacag 5160
catatcatgg acaatgggag gagtcacaac tatcagctgg tgcaacccct catgctctcc 5220
gatcaaggca gagccaagac aatacccttg tatctgcgga tcatgtccag ccacctgtag 5280
actttgtgca agcgatgatg tctatgatgg aggcgatatc acagagagta agtaaggttg 5340
actatcagct agatcttgtc ttgaaacaga catcctccat ccctatgatg cggtccgaaa 5400
tccaacagct gaaaacatct gttgcagtca tggaagccaa cttgggaatg atgaagattc 5460
tggatcccgg ttgtgccaac atttcatctc tgagtgatct acgggcagtt gcccgatctc 5520
acccggtttt agtttcaggc cctggagacc cctctcccta tgtgacacaa ggaggcgaaa 5580
tggcacttaa taaactttcg caaccagtgc cacatccatc tgaattgatt aaacccgcca 5640
ctgcatgcgg gcctgatata ggagtggaaa aggacactgt ccgtgcattg atcatgtcac 5700
gcccaatgca cccgagttct tcagccaagc tcctaagcaa gttagatgca gccgggtcga 5760
tcgaggaaat caggaaaatc aagcgccttg ctctaaatgg ctaattacta ctgccacacg 5820
tagcgggtcc ctgtccactc ggcatcacac ggaatctgca ccgagttccc ccccgcagac 5880
ccaaggtcca actctccaag cggcaatcct ctctcgcttc ctcagcccca ctgaatgatc 5940
gcgtaaccgt aattaatcta gctacattta agattaagaa aaaatacggg tagaatcccc 6000
gcggccgcca ccatggagac agacacactc ctgctatggg tactgctgct ctgggttcca 6060
ggatccactg gtcaactctc ttcctctccg gcaaaggacc ctccaatcca aagactcaga 6120
ggagcagtta ccagatgtga ggatgggcaa ctattcatca gctcatacaa gaatgagtat 6180
caaactatgg aggtgcagaa caattcggtt gtcatcaagt gtgatgggct ttatatcatc 6240
tacctgaagg gctccttttt ccaggaggtc aagattgacc ttcatttccg ggaggatcat 6300
aatcccatct ctattccaat gctgaacgat ggtcgaagga ttgtcttcac tgtggtggcc 6360
tctttggctt tcaaagataa agtttacctg actgtaaatg ctcctgatac tctctgcgaa 6420
cacctccaga taaatgatgg ggagctgatt gttgtccagc taacgcctgg atactgtgct 6480
cctgaaggat cttaccacag cactgtgaac caagtaccac tgtgattaag aaaaaatacg 6540
ggtagaaggg tttaaaccct tggagtgccc caattgtgcc aagatggact catctaggac 6600
aattgggctg tactttgatt ctgcccattc ttctagcaac ctgttagcat ttccgatcgt 6660
cctacaagac acaggagatg ggaagaagca aatcgccccg caatatagga tccagcgcct 6720
tgacttgtgg actgatagta aggaggactc agtattcatc accacctatg gattcatctt 6780
tcaagttggg aatgaagaag ccactgtcgg catgatcgat gataaaccca agcgcgagtt 6840
actttccgct gcgatgctct gcctaggaag cgtcccaaat accggagacc ttattgagct 6900
ggcaagggcc tgtctcacta tgatagtcac atgcaagaag agtgcaacta atactgagag 6960
aatggttttc tcagtagtgc aggcacccca agtgctgcaa agctgtaggg ttgtggcaaa 7020
caaatactca tcagtgaatg cagtcaagca cgtgaaagcg ccagagaaga ttcccgggag 7080
tggaacccta gaatacaagg tgaactttgt ctccttgact gtggtaccga agaaggatgt 7140
ctacaagatc ccagctgcag tattgaaggt ttctggctcg agtctgtaca atcttgcgct 7200
caatgtcact attaatgtgg aggtagaccc gaggagtcct ttggttaaat ctctgtctaa 7260
gtctgacagc ggatactatg ctaacctctt cttgcatatt ggacttatga ccaccgtaga 7320
taggaagggg aagaaagtga catttgacaa gctggaaaag aaaataagga gccttgatct 7380
atctgtcggg ctcagtgatg tgctcgggcc ttccgtgttg gtaaaagcaa gaggtgcacg 7440
gactaagctt ttggcacctt tcttctctag cagtgggaca gcctgctatc ccatagcaaa 7500
tgcttctcct caggtggcca agatactctg gagtcaaacc gcgtgcctgc ggagcgttaa 7560
aatcattatc caagcaggta cccaacgcgc tgtcgcagtg accgccgacc acgaggttac 7620
ctctactaag ctggagaagg ggcacaccct tgccaaatac aatcctttta agaaataagc 7680
tgcgtctctg agattgcgct ccgcccactc acccagatca tcatgacaca aaaaactaat 7740
ctgtcttgat tatttacagt tagtttacct gtctatcaag ttagaaaaaa cacgggtaga 7800
agattctgga tcccggttgg cgccctccag gtgcaagatg ggccccaaac cccccaccgg 7860
aaccccagcg cctctggtgc tgatcgcccg gaccgcgctg gcgttgggct gtgtctgtcc 7920
ggcgggctct cttgacggca gacctcttgc agctgcaggg attgtggtaa cgagagataa 7980
agcagtcaat atatacactt catctcaaac ggggtcaatc atagtcaagt tactcccaaa 8040
tatgcccaaa gacaaggagg cgtgcgcaaa agccccatta gaggcgtaca atagaacact 8100
gaccacttta ctcactcctc ttggcgactc catccgcagg atacaagggt ctgcaactac 8160
atctagagga aggagacaga aacgttttgt aggtgctatc attggcagta tagctcttgg 8220
ggttgcgaca gctgcacaag taacagcagc tgcagctctg atacaagcca accagaacgc 8280
tgccaacatc ctccggctta aggagagcat tgctgcaacc aatgaagctg tgcacgaggt 8340
cactgacgga ttatcacaac tagcgatggc gattgggaag atgcagcagt ttgttaatga 8400
ccagtttaat aatacggcgc gagaattgga ctgcatcaaa attacacaac aggttggtgt 8460
cgaactcaat ttgtatctaa ctgaactgac tacagtattc gggccacaaa tcacttcccc 8520
tgctttaact cagctaacta tccaggcact ttataattta gctggtggca atatgaatta 8580
cttattgact aagttaggtg tagggaacaa tcaacttagc tcattaatta gtagtggcct 8640
gatcactggc aaccccattt tatatgactc acagacccaa ctcttaggca tacagataaa 8700
tgtaccctca gtcgggagcc taaataatat gcgtgccacc tacttggaga ccttatccgt 8760
aagcacaacc agggggttcg cctcagcact tgtcccgaaa gttgtgacgc aagttggttc 8820
tgtgatagaa gaacttgaca cctcatattg tatagaatct aatctggatt tatattgtac 8880
aaggatagtg acattcccca tgtctcccgg catttattcc tgtctgagcg gtaatacgtc 8940
agcttgtatg tattcaaaga ctgagggtgc actcactaca ccatacatag ctctcaaggg 9000
ctcagttatt gctaattgca agatgattac atgtagatgt gcagaccccc caggtatcat 9060
atcgcaaaat tacggagaag ctgtgtccct aatagataaa cattcatgta atgtcttatc 9120
cctagacgga ataaccctga ggctcagtgg ggaatttgat gcgacctatc aaaagaacat 9180
cttaatacta gattcccagg tcatcgtgac aggcaatctc gatatatcaa ctgaacttgg 9240
gaatgtcaac aactcgataa gcagtgctct ggacaaatta gcggaaagta acagcaagtt 9300
aaacaaagtc aatgtcaacc taactagcac atctgctctc attacttata ttgttctagc 9360
tgtcatatct cttgttttcg gcgtaattag cctgattcta gcgtgctgct tgatgtataa 9420
acaaaaagca caacaaaaga ccttactatg gcttgggaac aataccctcg atcagatgag 9480
agccaccaca aaaacatgaa cacagatgag gaacgaaggt ttccctaata gtaatttgtg 9540
tgaaagttct ggtagtctgt cagttaagaa aaaatacggg tagaaggtta accggcccgc 9600
ggcgacgcgt ggcctgagag gccttcagag agttaagaaa aaactaccgg ttgtagatga 9660
ccaaaggacg atatacgggt agaacggtaa gagaggccgc ccctcaattg cgagccaggc 9720
ttcacaacct ccgttctacc gcttcaccga caacagtcct caatcatgga ccgcgccgtt 9780
agccaagttg cgttagagaa tgatgaaaga gaggcaaaaa atacatggcg cttgatattc 9840
cggattgcaa tcttattctt aacagtagtg accttggcta tatctgtagc ctccctttta 9900
tatagcatgg gggctagcac acctagcgat cttgtaggca taccgactag gatttccagg 9960
gcagaagaaa agattacatc tacacttggt tccaatcaag atgtagtaga taggatatat 10020
aagcaagtgg cccttgagtc tccgttggca ttgttaaata ctgagaccac aattatgaac 10080
gcaataacat ctctctctta tcagattaat ggagctgcaa acaacagtgg gtggggggca 10140
cctatccatg acccagatta tatagggggg ataggcaaag aactcattgt agatgatgct 10200
agtgatgtca catcattcta tccctctgca tttcaagaac atctgaattt tatcccggcg 10260
cctactacag gatcaggttg cactcgaata ccctcatttg acatgagtgc tacccattac 10320
tgctacaccc ataatgtaat attgtctgga tgcagagatc actcacattc atatcagtat 10380
ttagcacttg gtgtgctccg gacatctgca acagggaggg tattcttttc tactctgcgt 10440
tccatcaacc tggacgacac ccaaaatcgg aagtcttgca gtgtgagtgc aactcccctg 10500
ggttgtgata tgctgtgctc gaaagtcacg gagacagagg aagaagatta taactcagct 10560
gtccctacgc ggatggtaca tgggaggtta gggttcgacg gccagtacca cgaaaaggac 10620
ctagatgtca caacattatt cggggactgg gtggccaact acccaggagt agggggtgga 10680
tcttttattg acagccgcgt atggttctca gtctacggag ggttaaaacc caattcaccc 10740
agtgacactg tacaggaagg gaaatatgtg atatacaagc gatacaatga cacatgccca 10800
gatgagcaag actaccagat tcgaatggcc aagtcttcgt ataagcctgg acggtttggt 10860
gggaaacgca tacagcaggc tatcttatct atcaaggtgt caacatcctt aggcgaagac 10920
ccggtactga ctgtaccgcc caacacagtc acactcatgg gggccgaagg cagaattctc 10980
acagtaggga catctcattt cttgtatcaa cgagggtcat catacttctc tcccgcgtta 11040
ttatatccta tgacagtcag caacaaaaca gccactcttc atagtcctta tacattcaat 11100
gccttcactc ggccaggtag tatcccttgc caggcttcag caagatgccc caactcgtgt 11160
gttactggag tctatacaga tccatatccc ctaatcttct atagaaacca caccttgcga 11220
ggggtattcg ggacaatgct tgatggtgta caagcaagac ttaaccctgc gtctgcagta 11280
ttcgatagca catcccgcag tcgcattact cgagtgagtt caagcagtac caaagcagca 11340
tacacaacat caacttgttt taaagtggtc aagactaata agacctattg tctcagcatt 11400
gctgaaatat ctaatactct cttcggagaa ttcagaatcg tcccgttact agttgagatc 11460
ctcaaagatg acggggttag agaagccagg tctggctagt tgagtcaatt ataaaggagt 11520
tggaaagatg gcattgtatc acctatcttc tgcgacatca agaatcaaac cgaatgccgg 11580
cgcgtgctcg aattccatgt tgccagttga ccacaatcag ccagtgctca tgcgatcaga 11640
ttaagccttg tcaatagtct cttgattaag aaaaaatgta agtggcaatg agatacaagg 11700
caaaacagct catggtaaat aatacgggta ggacatggcg agctccggtc ctgaaagggc 11760
agagcatcag attatcctac cagagtcaca cctgtcttca ccattggtca agcacaaact 11820
actctattac tggaaattaa ctgggctacc gcttcctgat gaatgtgact tcgaccacct 11880
cattctcagc cgacaatgga aaaaaatact tgaatcggcc tctcctgata ctgagagaat 11940
gataaaactc ggaagggcag tacaccaaac tcttaaccac aattccagaa taaccggagt 12000
gctccacccc aggtgtttag aagaactggc taatattgag gtcccagatt caaccaacaa 12060
atttcggaag attgagaaga agatccaaat tcacaacacg agatatggag aactgttcac 12120
aaggctgtgt acgcatatag agaagaaact gctggggtca tcttggtcta acaatgtccc 12180
ccggtcagag gagttcagca gcattcgtac ggatccggca ttctggtttc actcaaaatg 12240
gtccacagcc aagtttgcat ggctccatat aaaacagatc cagaggcatc tgatggtggc 12300
agctaggaca aggtctgcgg ccaacaaatt ggtgatgcta acccataagg taggccaagt 12360
ctttgtcact cctgaacttg tcgttgtgac gcatacgaat gagaacaagt tcacatgtct 12420
tacccaggaa cttgtattga tgtatgcaga tatgatggag ggcagagata tggtcaacat 12480
aatatcaacc acggcggtgc atctcagaag cttatcagag aaaattgatg acattttgcg 12540
gttaatagac gctctggcaa aagacttggg taatcaagtc tacgatgttg tatcactaat 12600
ggagggattt gcatacggag ctgtccagct actcgagccg tcaggtacat ttgcaggaga 12660
tttcttcgca ttcaacctgc aggagcttaa agacattcta attggcctcc tccccaatga 12720
tatagcagaa tccgtgactc atgcaatcgc tactgtattc tctggtttag aacagaatca 12780
agcagctgag atgttgtgtc tgttgcgtct gtggggtcac ccactgcttg agtcccgtat 12840
tgcagcaaag gcagtcagga gccaaatgtg cgcaccgaaa atggtagact ttgatatgat 12900
ccttcaggta ctgtctttct tcaagggaac aatcatcaac gggtacagaa agaagaatgc 12960
aggtgtgtgg ccgcgagtca aagtggatac aatatatggg aaggtcattg ggcaactaca 13020
tgcagattca gcagagattt cacacgatat catgttgaga gagtataaga gtttatctgc 13080
acttgaattt gagccatgta tagaatatga ccctgtcacc aacctgagca tgttcctaaa 13140
agacaaggca atcgcacacc ccaacgataa ttggcttgcc tcgtttaggc ggaaccttct 13200
ctccgaagac cagaagaaac atgtaaaaga agcaacttcg actaatcgcc tcttgataga 13260
gtttttagag tcaaatgatt ttgatccata taaagagatg gaatatctga cgacccttga 13320
gtaccttaga gatgacaatg tggcagtatc atactcgctc aaggagaagg aagtgaaagt 13380
taatggacgg atcttcgcta agctgacaaa gaagttaagg aactgtcagg tgatggcgga 13440
agggatccta gccgatcaga ttgcaccttt ctttcaggga aatggagtca ttcaggatag 13500
catatccttg accaagagta tgctagcgat gagtcaactg tcttttaaca gcaataagaa 13560
acgtatcact gactgtaaag aaagagtatc ttcaaaccgc aatcatgatc cgaaaagcaa 13620
gaaccgtcgg agagttgcaa ccttcataac aactgacctg caaaagtact gtcttaattg 13680
gagatatcag acaatcaaat tgttcgctca tgccatcaat cagttgatgg gcctacctca 13740
cttcttcgaa tggattcacc taagactgat ggacactacg atgttcgtag gagacccttt 13800
caatcctcca agtgacccta ctgactgtga cctctcaaga gtccctaatg atgacatata 13860
tattgtcagt gccagagggg gtatcgaagg attatgccag aagctatgga caatgatctc 13920
aattgctgca atccaacttg ctgcagctag atcgcattgt cgtgttgcct gtatggtaca 13980
gggtgataat caagtaatag cagtaacgag agaggtaaga tcagacgact ctccggagat 14040
ggtgttgaca cagttgcatc aagccagtga taatttcttc aaggaattaa ttcatgtcaa 14100
tcatttgatt ggccataatt tgaaggatcg tgaaaccatc aggtcagaca cattcttcat 14160
atacagcaaa cgaatcttca aagatggagc aatcctcagt caagtcctca aaaattcatc 14220
taaattagtg ctagtgtcag gtgatctcag tgaaaacacc gtaatgtcct gtgccaacat 14280
tgcctctact gtagcacggc tatgcgagaa cgggcttccc aaagacttct gttactattt 14340
aaactatata atgagttgtg tgcagacata ctttgactct gagttctcca tcaccaacaa 14400
ttcgcacccc gatcttaatc agtcgtggat tgaggacatc tcttttgtgc actcatatgt 14460
tctgactcct gcccaattag ggggactgag taaccttcaa tactcaaggc tctacactag 14520
aaatatcggt gacccgggga ctactgcttt tgcagagatc aagcgactag aagcagtggg 14580
attactgagt cctaacatta tgactaatat cttaactagg ccgcctggga atggagattg 14640
ggccagtctg tgcaacgacc catactcttt caattttgag actgttgcaa gcccaaatat 14700
tgttcttaag aaacatacgc aaagagtcct atttgaaact tgttcaaatc ccttattgtc 14760
tggagtgcac acagaggata atgaggcaga agagaaggca ttggctgaat tcttgcttaa 14820
tcaagaggtg attcatcccc gcgttgcgca tgccatcatg gaggcaagct ctgtaggtag 14880
gagaaagcaa attcaagggc ttgttgacac aacaaacacc gtaattaaga ttgcgcttac 14940
taggaggcca ttaggcatca agaggctgat gcggatagtc aattattcta gcatgcatgc 15000
aatgctgttt agagacgatg ttttttcctc cagtagatcc aaccacccct tagtctcttc 15060
taatatgtgt tctctgacac tggcagacta tgcacggaat agaagctggt cacctttgac 15120
gggaggcagg aaaatactgg gtgtatctaa tcctgatacg atagaactcg tagagggtga 15180
gattcttagt gtaagcggag ggtgtacaag atgtgacagc ggagatgaac aatttacttg 15240
gttccatctt ccaagcaata tagaattgac cgatgacacc agcaagaatc ctccgatgag 15300
ggtaccatat ctcgggtcaa agacacagga gaggagagct gcctcacttg caaaaatagc 15360
tcatatgtcg ccacatgtaa aggctgccct aagggcatca tccgtgttga tctgggctta 15420
tggggataat gaagtaaatt ggactgctgc tcttacgatt gcaaaatctc ggtgtaatgt 15480
aaacttagag tatcttcggt tactgtcccc tttacccacg gctgggaatc ttcaacatag 15540
actagatgat ggtataactc agatgacatt cacccctgca tctctctaca gggtgtcacc 15600
ttacattcac atatccaatg attctcaaag gctgttcact gaagaaggag tcaaagaggg 15660
gaatgtggtt taccaacaga tcatgctctt gggtttatct ctaatcgaat cgatctttcc 15720
aataacaaca accaggacat atgatgagat cacactgcac ctacatagta aatttagttg 15780
ctgtatcaga gaagcacctg ttgcggttcc tttcgagcta cttggggtgg taccggaact 15840
gaggacagtg acctcaaata agtttatgta tgatcctagc cctgtatcgg agggagactt 15900
tgcgagactt gacttagcta tcttcaagag ttatgagctt aatctggagt catatcccac 15960
gatagagcta atgaacattc tttcaatatc cagcgggaag ttgattggcc agtctgtggt 16020
ttcttatgat gaagatacct ccataaagaa tgacgccata atagtgtatg acaatacccg 16080
aaattggatc agtgaagctc agaattcaga tgtggtccgc ctatttgaat atgcagcact 16140
tgaagtgctc ctcgactgtt cttaccaact ctattacctg agagtaagag gcctagacaa 16200
tattgtctta tatatgggtg atttatacaa gaatatgcca ggaattctac tttccaacat 16260
tgcagctaca atatctcatc ccgtcattca ttcaaggtta catgcagtgg gcctggtcaa 16320
ccatgacgga tcacaccaac ttgcagatac ggattttatc gaaatgtctg caaaactatt 16380
agtatcttgc acccgacgtg tgatctccgg cttatattca ggaaataagt atgatctgct 16440
gttcccatct gtcttagatg ataacctgaa tgagaagatg cttcagctga tatcccggtt 16500
atgctgtctg tacacggtac tctttgctac aacaagagaa atcccgaaaa taagaggctt 16560
aactgcagaa gagaaatgtt caatactcac tgagtattta ctgtcggatg ctgtgaaacc 16620
attacttagt cccgatcaag tgagctctat catgtctcct aacataatta cattcccagc 16680
taatctgtac tacatgtctc ggaagagcct caatttgatc agggaaaggg aggacaggga 16740
tactatcctg gcgttgttgt tcccccaaga gccattatta gagttccctt ctgtgcaaga 16800
tattggtgct cgagtgaaag atccattcac ccgacaacct gcggcatttt tgcaagagtt 16860
agatttgagt gctccagcaa ggtatgacgc attcacactt agtcagattc atcctgaact 16920
cacatctcca aatccggagg aagactactt agtacgatac ttgttcagag ggatagggac 16980
tgcatcttcc tcttggtata aggcatctca tctcctttct gtacccgagg taagatgtgc 17040
aagacacggg aactccttat acttagctga agggagcgga gccatcatga gtcttctcga 17100
actgcatgta ccacatgaaa ctatctatta caatacgctc ttttcaaatg agatgaaccc 17160
cccgcaacga catttcgggc cgaccccaac tcagtttttg aattcggttg tttataggaa 17220
tctacaggcg gaggtaacat gcaaagatgg atttgtccaa gagttccgtc cattatggag 17280
agaaaataca gaggaaagtg acctgacctc agataaagta gtggggtata ttacatctgc 17340
agtgccctac agatctgtat cattgctgca ttgtgacatt gaaattcctc cagggtccaa 17400
tcaaagctta ctagatcaac tagctatcaa tttatctctg attgccatgc attctgtaag 17460
ggagggcggg gtagtaatca tcaaagtgtt gtatgcaatg ggatactact ttcatctact 17520
catgaacttg tttgctccgt gttccacaaa aggatatatt ctctctaatg gttatgcatg 17580
tcgaggagat atggagtgtt acctggtatt tgtcatgggt tacctgggcg ggcctacatt 17640
tgtacatgag gtggtgagga tggcgaaaac tctggtgcag cggcacggta cgcttttgtc 17700
taaatcagat gagatcacac tgaccaggtt attcacctca cagcggcagc gtgtgacaga 17760
catcctatcc agtcctttac caagattaat aaagtacttg aggaagaata ttgacactgc 17820
gctgattgaa gccgggggac agcccgtccg tccattctgt gcggagagtc tggtgagcac 17880
gctagcgaac ataactcaga taacccagat catcgctagt cacattgaca cagttatccg 17940
gtctgtgata tatatggaag ctgagggtga tctcgctgac acagtatttc tatttacccc 18000
ttacaatctc tctactgacg ggaaaaagag gacatcactt aaacagtgca cgagacagat 18060
cctagaggtt acaatactag gtcttagagt cgaaaatctc aataaaatag gcgatataat 18120
cagcctagtg cttaaaggca tgatctccat ggaggacctt atcccactaa ggacatactt 18180
gaagcatagt acctgcccta aatatttgaa ggctgtccta ggtattacca aactcaaaga 18240
aatgtttaca gacacttctg tactgtactt gactcgtgct caacaaaaat tctacatgaa 18300
aactataggc aatgcagtca aaggatatta cagtaactgt gactcttaac gaaaatcaca 18360
tattaatagg ctcctttttt ggccaattgt attcttgttg atttaatcat attatgttag 18420
aaaaaagttg aaccctgact ccttaggact cgaattcgaa ctcaaataaa tgtcttaaaa 18480
aaaggttgcg cacaattatt cttgagtgta gtctcgtcat tcaccaaatc tttgtttggt 18540
ttggtggccg gcatggtccc agcctcctcg ctggcgccgg ctgggcaaca ttccgagggg 18600
accgtcccct cggtaatggc gaatgggacg cggccgatcc ggctgctaac aaagcccgaa 18660
aggaagctga gttggctgct gccaccgctg agcaataact agcataaccc cttggggcct 18720
ctaaacgggt cttgaggggt tttttgctga aaggaggaac tatatccgga tcggccgatc 18780
cggctgctaa caaagcccga aaggaagctg agttggctgc tgccaccgct gagcaataac 18840
tagcataacc ccttggggcc tctaaacggg tcttgagggg ttttttgctg aaaggaggaa 18900
ctatatccgg atggccgcca ccggtgggcc ttgcagcaca tccccccttc gccag 18955
Claims (10)
1. A recombinant newcastle disease virus genome, wherein the genome comprises a gene encoding OX40L, and the gene encoding OX40L is located between a P gene and an M gene of the newcastle disease virus genome.
2. The recombinant newcastle disease virus genome of claim 1, wherein said OX40L encoding gene is in the form of DNA or RNA;
preferably, the gene encoding OX40L is the sequence shown in SEQ ID No.1 or SEQ ID No.2 or a sequence having at least 80% identity thereto.
3. The recombinant newcastle disease virus genome of claim 1 or 2, wherein the sequence of said recombinant newcastle disease virus genome is represented by SEQ ID No.3, SEQ ID No.4, SEQ ID No.7 or SEQ ID No. 8.
4. A recombinant newcastle disease virus, wherein said virus comprises a recombinant newcastle disease virus genome according to any of claims 1-3.
5. The recombinant newcastle disease virus of claim 4, wherein the starting strain of newcastle disease virus is selected from: low virulent strains LaSota, hitchner B1 and V4, medium virulent strains Muktesvar and Anhinga, high virulent strains F48E9, JS/7/05/Ch, italien, herts/33 and NDV-BJ; and any chimeric strain constructed by genetic engineering means based on the starting strain.
6. A DNA molecule encoding the recombinant newcastle disease virus genome of any of claims 1-3.
7. A pharmaceutical composition comprising the recombinant newcastle disease virus genome of any of claims 1-3, the recombinant newcastle disease virus of claim 4 or 5 and/or the DNA molecule of claim 6;
preferably, the pharmaceutical composition further comprises pharmaceutically acceptable excipients;
preferably, the pharmaceutically acceptable pharmaceutical excipients are selected from solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, antioxidants, permeation enhancers, pH regulators, surfactants or diluents.
8. A method of making the recombinant Newcastle disease virus of claim 4 or 5, comprising:
(1) Carrying out enzyme digestion on a cloning vector containing a DNA sequence of an OX40L encoding gene and an NDV viral vector respectively, and connecting the DNA sequence of the OX40L encoding gene obtained by enzyme digestion with the NDV viral vector to obtain a recombinant Newcastle disease virus plasmid;
(2) Transfecting the recombinant newcastle disease virus plasmid into cells and culturing the transfected cells to obtain the recombinant newcastle disease virus.
9. The method of claim 8, wherein the cloning vector is constructed using a vector selected from the group consisting of: PUC57 vector, pMD18-T vector, pMD19-T vector, pBluescript SK (+/-) vector, pBluescript II KS (+/-);
preferably, the NDV viral vector is a full-length cDNA sequence of the genome of an NDV virus selected from the group consisting of: low virulent strains LaSota, hitchner B1 and V4, medium virulent strains Muktesvar and Anhinga, high virulent strains F48E9, JS/7/05/Ch, italien, herts/33 and NDV-BJ;
preferably, the recombinant newcastle disease virus plasmid is co-transfected into the cell with a helper plasmid selected from the group consisting of: pTM-NP, pTM-P and pTM-L; pCI-neo-NP, pCI-neo-P, and pCI-neo-L; or pBluescript II KS (+/-) -NP, pBluescript II KS (+/-) -P, and pBluescript II KS (+/-) -L;
preferably, the cell is selected from BHK-21 cells, BSR-T7/5 cells, VERO cells, DF-1 cells, 293 cells or MDCK cells.
10. Use of the recombinant newcastle disease virus genome according to any one of claims 1-3, the recombinant newcastle disease virus according to claim 4 or 5, the DNA molecule according to claim 6 and/or the pharmaceutical composition according to claim 7 in the preparation of a medicament for treating or ameliorating cancer;
preferably, the cancer is selected from: colon cancer, liver cancer, lung cancer, stomach cancer, rectal cancer, leukemia, lymphoma, ovarian cancer, breast cancer, endometrial cancer, bladder cancer, urothelial cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, gall bladder cancer, bile duct cancer, esophageal cancer, renal cell cancer, thyroid cancer, head and neck cancer, testicular cancer, endocrine adenocarcinoma, adrenal cancer, pituitary cancer, skin cancer, soft tissue cancer, vascular cancer, brain cancer, neural cancer, eye cancer, meningeal cancer, oropharyngeal cancer, hypopharynx cancer, cervical cancer, myosarcoma, uterine cancer, glioblastoma, medulloblastoma, neuroblastoma, kidney cancer, astrocytoma, glioma, meningioma, gastrinoma, neuroblastoma, melanoma, acute myeloid leukemia, myelodysplastic syndrome, or sarcoma.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110394653.2A CN115197949A (en) | 2021-04-13 | 2021-04-13 | Recombinant Newcastle disease virus rNDV-OX40L, genome thereof, preparation method and application thereof |
PCT/CN2022/086595 WO2022218339A1 (en) | 2021-04-13 | 2022-04-13 | Recombinant newcastle disease virus rndv-ox40l, genome thereof, preparation method therefor and use thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110394653.2A CN115197949A (en) | 2021-04-13 | 2021-04-13 | Recombinant Newcastle disease virus rNDV-OX40L, genome thereof, preparation method and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN115197949A true CN115197949A (en) | 2022-10-18 |
Family
ID=83571082
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110394653.2A Pending CN115197949A (en) | 2021-04-13 | 2021-04-13 | Recombinant Newcastle disease virus rNDV-OX40L, genome thereof, preparation method and application thereof |
Country Status (2)
Country | Link |
---|---|
CN (1) | CN115197949A (en) |
WO (1) | WO2022218339A1 (en) |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
MY180687A (en) * | 2013-03-14 | 2020-12-07 | Icahn School Med Mount Sinai | Newcastle disease viruses and uses thereof |
EP4101457A1 (en) * | 2013-09-03 | 2022-12-14 | MedImmune Limited | Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia |
CN105734023B (en) * | 2016-03-28 | 2019-04-26 | 江苏康缘瑞翱生物医药科技有限公司 | A kind of recombinant Newcastle disease virus is preparing the application in medicines resistant to liver cancer |
-
2021
- 2021-04-13 CN CN202110394653.2A patent/CN115197949A/en active Pending
-
2022
- 2022-04-13 WO PCT/CN2022/086595 patent/WO2022218339A1/en active Application Filing
Also Published As
Publication number | Publication date |
---|---|
WO2022218339A1 (en) | 2022-10-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101120784B1 (en) | Virus-like particles as vaccines for paramyxovirus | |
AU2017248259A1 (en) | Chimeric antigen receptor T cell compositions | |
CN110856724B (en) | Therapeutic agents comprising nucleic acids and CAR-modified immune cells and uses thereof | |
JP2005336206A (en) | Recombinant racoon poxvirus and its use as effective vaccine against feline infectious peritonitis virus disease | |
KR102087458B1 (en) | Rotavirus subunit vaccines and methods of making and use thereof | |
CN112501139B (en) | Recombinant Newcastle disease virus strain and preparation method and application thereof | |
CN110108884A (en) | A kind of ELISA detection method for canine distemper virus and antibody | |
CN112250738B (en) | Preparation, purification and identification method of severe acute respiratory syndrome coronavirus 2 virus-like particles | |
CN115197949A (en) | Recombinant Newcastle disease virus rNDV-OX40L, genome thereof, preparation method and application thereof | |
CN104357409B (en) | Express chicken IL2 recombinant Newcastle disease virus and its application in vaccine | |
KR20130135722A (en) | Light inducible promoter and gene expression system comprising the same | |
CN111748034B (en) | Preparation method of mycoplasma synoviae monoclonal antibody | |
CN108949691B (en) | A method of prepare can real-time detection mescenchymal stem cell aging cell model | |
CN115247173A (en) | Gene editing system for constructing TMPRSS6 gene mutant iron deficiency anemia pig nuclear transplantation donor cells and application thereof | |
CN108949690B (en) | A method of prepare can real-time detection mescenchymal stem cell bone differentiation cell model | |
CN104328136A (en) | Preparation of Newcastle disease virus strain rClone30-fliC and application of the Newcastle disease virus strain rClone30-fliC in prevention and treatment of Newcastle disease | |
CN106755105A (en) | One plasmid Rescue System is used for the preparation and application of influenza virus vaccine strain | |
CN103352042B (en) | The cDNA of coding recombinant Newcastle disease virus, the virus of being saved by this cDNA and the application in treatment malignant tumour thereof | |
CN112272565A (en) | In vivo gene therapy using delivery of lentiviral gene constructs | |
CN113462658A (en) | Recombinant newcastle disease virus, preparation method, recombinant plasmid and application thereof | |
CN113462657A (en) | Recombinant newcastle disease virus, preparation method, recombinant plasmid and application thereof | |
CN109082443A (en) | A method of preparing can the cell model that breaks up to mature hepatic lineage of real-time detection mescenchymal stem cell | |
CN107354172B (en) | Recombinant expression vector and construction method and application thereof | |
CN109321601B (en) | AQP5 recombinant overexpression vector and construction method and application thereof | |
KR100902634B1 (en) | Nucleic acid delivery complex comprising recombinant hmgb-1 peptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |