CN115177726B

CN115177726B - GPR34 and application of inhibitor thereof in preparation of demyelinating related disease treatment medicines

Info

Publication number: CN115177726B
Application number: CN202110355421.6A
Authority: CN
Inventors: 周荣斌; 江维; 林柏龙
Original assignee: University of Science and Technology of China USTC
Current assignee: University of Science and Technology of China USTC
Priority date: 2021-04-01
Filing date: 2021-04-01
Publication date: 2023-11-28
Anticipated expiration: 2041-04-01
Also published as: WO2022206767A1; CN115177726A

Abstract

The invention relates to GPR34 and application of an inhibitor thereof in preparation of a medicament for treating demyelinating related diseases. A series of in vivo experiments show that GPR34 can be used as a new target point for preparing a therapeutic drug for demyelinating related diseases, and a new scheme for screening and developing functions of the target GPR34 is effective for treating demyelinating related diseases such as experimental autoreactive encephalomyelitis, middle cerebral artery reperfusion, cyclohexanedihydrazone-induced demyelination, but has good application prospect in preparing a therapeutic drug for demyelinating related diseases due to GPR34 and inhibitors thereof, wherein the therapeutic drug is ineffective for treating anxiety central nerve inflammatory diseases induced by repeated electric shock on soles, chronic inflammation-mediated obesity induced by high fat and peripheral inflammation-mediated diseases such as lipopolysaccharide-induced acute inflammation-mediated sepsis. The research provides theoretical support for developing and designing the medicine taking GPR34 as a target spot, and can provide a new strategy for the treatment of demyelinating related diseases.

Description

GPR34 and application of inhibitor thereof in preparation of demyelinating related disease treatment medicines

Technical Field

The invention belongs to the technical field of biology, and particularly relates to GPR34 and application of an inhibitor thereof in preparation of a demyelinating related disease treatment drug.

Background

Demyelination is associated with central nervous system injury, and demyelination is observed in a variety of neurological disorders, such as multiple sclerosis, ischemic stroke, parkinson's disease,alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, epilepsy (Adamo, 2014; chen et al, 2020;and Lassmann,2017; shimizu et al, 2016; werneburg et al 2020). The links between neurons are protected by peripheral myelin structures, the integrity of which is critical for the maintenance of neuronal function. Past studies have shown that myelin fragments produced during demyelination can induce activation of innate immune cells such as glial cells and macrophages to promote neuroinflammation and the onset of demyelinating related diseases (Clarner et al 2012; sun et al 2010). In vitro experiments have shown that myelin fragments, after phagocytosis by microglia, macrophages or endothelial cells, are capable of inducing the production of inflammatory factors such as TNF- α, IL-6, IL-1b (Sun et al, 2010; wang et al, 2015; williams et al, 1994; zhou et al, 2019). In vivo experiments have found that myelin debris injection or accumulation of myelin debris caused by brain injury can induce microglial activation and expression of inflammatory factors (Clarner et al 2012; poliani et al 2015; sun et al 2010). In fact, the efficiency of myelin sheath debris removal is also very important for the recovery of demyelinating related diseases such as multiple sclerosis, ischemic stroke, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, epilepsy, etc. (Doyle and Buckwalter,2020; franklin and Ffrench-Constant,2008; neumann et al, 2009), but it is not clear how myelin sheath debris activates inflammatory responses and promotes the pathological processes of neurological diseases.

Microglia, a macrophage with tissue resident properties specific to the central nervous system, is the first line of defense for the central nervous system to clear infection or "danger" and plays an important role in central nervous system inflammation and homeostasis regulation (Colonna and Butovsky,2017; heneka,2019; kierdorf et al, 2019). Like peripheral macrophages, excessive activation of microglia induces neuronal and oligodendrocyte damage by direct phagocytosis or cytokine secretion, and leads to myelination, thereby exacerbating the progression of demyelinating-related diseases such as multiple sclerosis, ischemic stroke, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, epilepsy, and the like. Myelin contains approximately 80% of lipids, and there is a paper reporting that lipids can elicit an innate immune response as a danger-related signal (Gong et al, 2019). Then microglial cells can directly recognize lipids in myelin fragments and what are their related receptors for recognizing lipids?

G protein-coupled receptors (GPCRs) are a class of seven transmembrane membrane proteins that are collectively known as many extracellular signal changes that can be sensed by GPCRs, causing intracellular signal transduction, thus maintaining body homeostasis (Gilman, 1987). GPCR dysfunction is closely related to a number of major diseases in humans, and many drugs are therefore designed to target GPCRs. It is counted that drugs targeting GPCRs are more than 30% of all clinical drugs approved by the FDA in the United states (O' Hayre et al, 2013). Therefore, the G protein coupled receptor involved in the regulation of demyelinating related diseases is sought, the effectiveness of the application of the drugs for treating demyelinating related diseases in the later development and design can be provided for theoretical support.

GPR34 belongs to the G protein-coupled receptor, and is downstream coupled to the G.alpha.i/o protein, which is expressed mainly in microglia (Bedard et al, 2007; butovsky et al, 2014; engemier et al, 2006), and has been reported to have its ligand lysophosphatidylserine LysoPS (Makid and Aoki,2013; sugo et al, 2006) produced by hydrolysis of phosphatidylserine by hydrolytic enzymes. These work suggest that we, microglial GPR34 may be involved in the pathogenesis of demyelinating-related diseases by recognizing lysophosphatidylserine derived from myelin fragments. The current basic research on GPR34 has focused mainly on its involvement in inflammatory regulation processes, e.g. the significant reduction of neutrophil and macrophage numbers in the spleen of GPR34 deficient mice compared to wild type mice after methylation treated BSA immunization. In the delayed-type hypersensitivity test, the foot swelling of the Gpr 34-deficient mice was significantly increased as compared to the wild-type mice. After lung infection with cryptococcus neoformans, the outer lung tissue of the Gpr34 deficient mice was more loaded with pathogenic bacteria than the wild type mice. However, there have been no reports on the role of GPR34 in demyelinating diseases.

Experimental Autoreactive Encephalomyelitis (EAE) is an animal model widely used for studying multiple sclerosis (Constantinescu et al, 2011; xu et al, 2018), middle cerebral artery reperfusion (MCAO) is an animal model widely used for studying ischemic stroke (Joy et al, 2019; liu et al, 2019), and cyclohexanedihydrazone-induced demyelination model is an animal model widely used for studying demyelination and repair (Vega-rivar et al, 2019; wolf et al, 2018).

Disclosure of Invention

In one aspect, the invention aims to provide GPR34 and the application of an inhibitor thereof in preparing medicines for treating demyelinating related diseases.

In another aspect, the present invention provides the use of a substance that reduces the expression level of the Gpr34 gene and/or a functional inhibitor and/or antagonist of the Gpr34 protein in the manufacture of a medicament for the treatment of demyelinating-related diseases.

Further, the demyelinating related diseases include, but are not limited to: multiple sclerosis, ischemic stroke, transverse myelitis, hilder's disease, neuromyelitis optica, HTLV-I related myelopathy, grignard's syndrome, barohte's disease, acute disseminated encephalomyelitis, central bridge demyelinating disease, extrabridge myelolytic disease, progressive multifocal leukoencephalopathy, post-reversible encephalopathy syndrome, kanawn's disease, alexander's disease, lyme disease, heterogeneous leukocyte dystrophy, adrenal neuropathy, globular leukodystrophy, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, epilepsy.

Further, the demyelinating-related disease is selected from the group consisting of multiple sclerosis, ischemic stroke, transverse myelitis, hilder's disease, neuromyelitis optica, HTLV-I-related myelopathy, grignard's syndrome, barohte's disease, acute disseminated encephalomyelitis, central bridge myelinolysis, extrabridge myelinolysis, progressive multifocal leukoencephalopathy, post-reversible encephalopathy syndrome, kanawan disease, alexander's disease, lyme disease, heterogeneous leukocyte dystrophy, adrenoneuropathy, leukodystrophy, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, and epilepsy.

Further, the functional inhibitor and/or antagonist of GPR34 protein is a GPR34 antibody or a small molecule inhibitor and/or antagonist of GPR34, preferably tyrosine, N- [ ((2E) -3- (4 '-chloro [1,1' -biphenyl ] -4-yl) -1-oxo-2-propen-1-yl ] -O- (benzyl) or a structural analogue thereof.

Further, the GPR34 antibody includes chimeric antibodies, monoclonal antibodies, polyclonal antibodies, humanized antibodies, bispecific antibodies, and multispecific antibodies.

Further, the substance that decreases the expression level of the Gpr34 gene includes a small interfering RNA that promotes degradation of the Gpr34 messenger RNA.

Further, the small interfering RNA is RNAi fragment or siRNA fragment of target Gpr34 gene, or CRISPR gRNA for promoting Gpr34 messenger RNA degradation.

In another aspect, the invention provides a pharmaceutical composition for the treatment of demyelinating-related diseases, comprising an active ingredient that is a substance that reduces the level of Gpr34 gene expression and/or a functional inhibitor and/or antagonist of Gpr34 protein.

In one embodiment, the pharmaceutical composition comprises a pharmaceutically acceptable excipient.

In one embodiment, the functional inhibitor and/or antagonist of GPR34 protein is a GPR34 antibody or a small molecule inhibitor and/or antagonist of GPR34, preferably tyrosine, N- [ ((2E) -3- (4 '-chloro [1,1' -biphenyl ] -4-yl) -1-oxo-2-propen-1-yl ] -O- (benzyl) or a structural analog thereof.

In one embodiment, the agent that reduces the expression level of the Gpr34 gene comprises a small interfering RNA that promotes degradation of the Gpr34 messenger RNA.

In one embodiment, the small interfering RNA is an RNAi or siRNA fragment targeting the Gpr34 gene.

In one embodiment, the demyelinating-related diseases include, but are not limited to: multiple sclerosis, ischemic stroke, transverse myelitis, hilder's disease, neuromyelitis optica, HTLV-I related myelopathy, grignard's syndrome, barohte's disease, acute disseminated encephalomyelitis, central bridge demyelinating disease, extrabridge myelolytic disease, progressive multifocal leukoencephalopathy, post-reversible encephalopathy syndrome, kanawn's disease, alexander's disease, lyme disease, heterogeneous leukocyte dystrophy, adrenal neuropathy, globular leukodystrophy, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, epilepsy.

In one embodiment, the demyelinating-related disease is selected from the group consisting of multiple sclerosis, ischemic stroke, transverse myelitis, hilder's disease, neuromyelitis optica, HTLV-I-related myelopathy, guillain-Barre syndrome, barlow's disease, acute disseminated encephalomyelitis, central bridge myelinolysis, extrabridge myelination, progressive multifocal leukoencephalopathy, post-reversible encephalopathy syndrome, kanawn's disease, alexander's disease, lyme disease, heterogeneous leukocyte dystrophy, adrenoneuropathy, leukodystrophy, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, and epilepsy.

In one embodiment, the pharmaceutical composition may be presented in unit dosage form containing a predetermined amount of active ingredient per unit dose. Preferred unit dose compositions are those containing a daily dose or sub-dose or an appropriate fraction thereof of the active ingredient. Thus, such unit doses may be administered more than once a day. Preferred unit dose compositions are those containing a daily dose or sub-dose (for administration more than once a day) or an appropriate portion thereof of an active ingredient as described herein above.

In one embodiment, the pharmaceutical composition may be adapted for administration by any suitable route, for example by oral, inhalation, parenteral (including subcutaneous, intramuscular, intravenous or intradermal) route.

In one embodiment, the pharmaceutical composition is in a dosage form selected from the group consisting of tablets, capsules, pills, troches, powders, syrups, elixirs, suspensions, solutions, emulsions, aerosols.

In one embodiment, the dosage form of the pharmaceutical composition is selected from the group consisting of tablets, capsules, pills, troches, powders, syrups, elixirs, suspensions, solutions, emulsions and aerosols.

In one embodiment, the pharmaceutically acceptable excipients include the following types of excipients: diluents, fillers, binders, disintegrants, lubricants, glidants, granulating agents, coating agents, wetting agents, solvents, co-solvents, suspending agents, emulsifiers, sweeteners, flavoring agents, odor masking agents, colorants, anti-caking agents, humectants, chelating agents, plasticizers, tackifiers, antioxidants, preservatives, stabilizers, surfactants, buffers. Those skilled in the art will appreciate that certain pharmaceutically acceptable excipients may provide more than one function and may serve alternative functions, depending on how much excipient is present in the formulation and which other excipients are present in the formulation.

In one embodiment, the pharmaceutically acceptable excipient is selected from the group consisting of diluents, fillers, binders, disintegrants, lubricants, glidants, granulating agents, coating agents, wetting agents, solvents, co-solvents, suspending agents, emulsifiers, sweeteners, flavoring agents, odor masking agents, colorants, anti-caking agents, humectants, chelating agents, plasticizers, viscosity enhancing agents, antioxidants, preservatives, stabilizers, surfactants, and buffers.

In another aspect, the invention provides a method of treating or lessening the severity of a demyelinating-related disease comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition as described above.

In one embodiment, the pharmaceutical composition is administered at a dose of, for example, 5mg/kg, 6mg/kg, 7mg/kg, 8mg/kg, 9mg/kg, 10mg/kg, 11mg/kg, 12mg/kg, 13mg/kg, 14mg/kg, 15mg/kg, 16mg/kg, 17mg/kg, 18mg/kg, 19mg/kg, 20mg/kg, 21mg/kg, 22mg/kg, 23mg/kg, 24mg/kg, 25mg/kg, 26mg/kg, 27mg/kg, 28mg/kg, 29mg/kg, 30mg/kg or more.

In one embodiment, the dosage of the pharmaceutical composition is, for example, 5-30mg/kg, 6-30mg/kg, 7-30mg/kg, 8-30mg/kg, 9-30mg/kg or more.

In another aspect, the invention provides a method of treating or lessening the severity of a demyelinating-related disease comprising knocking out or inhibiting the expression of the Gpr34 gene in a subject in need thereof.

Advantageous effects

The invention can provide a treatment thought and a theoretical basis for demyelinating related diseases and can provide a molecular target and a preparation thought for screening and preparing medicines for demyelinating related diseases by determining the effect of GPR34 in experimental autoreactive encephalomyelitis, middle cerebral artery reperfusion and cyclohexanoyl dihydrazone-induced demyelinating diseases.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 is a graph showing the results of stimulating microglial cells derived from wild-type mice and Gpr 34-deficient mice with myelin fragments derived from the wild-type mice, respectively, and then detecting the expression of cytokines interleukin 1b (IL 1 b) and interleukin 6 (IL 6) by a real-time fluorescent quantitative PCR instrument in example 1.

FIG. 2 is a graph showing the results of measuring the expression level of Gpr34 in microglia, astrocytes, neuronal cells, peritoneal macrophages, monocytes, bone marrow-derived macrophages by a real-time fluorescent quantitative PCR instrument in example 2.

Fig. 3 shows a graph of the results of the study of the variation of microglial-specific knockout Gpr34 mice in the EAE model in example 3, wherein fig. 3A shows a significant decrease in clinical scores of microglial-specific knockout Gpr34 mice compared to control mice, fig. 3B shows a significant decrease in lymphocyte infiltration in spinal cord tissue of microglial-specific knockout Gpr34 mice compared to control mice, fig. 3C shows a significant decrease in demyelination in spinal cord tissue of microglial-specific knockout Gpr34 mice compared to control mice, and fig. 3D shows a significant decrease in expression levels of cytokines Il1B and Il6 in spinal cord tissue of microglial-specific knockout Gpr34 mice compared to control mice.

Fig. 4 shows a graph of the results of the study of the variation of microglial-specific knockout Gpr34 mice in MCAO model in example 3, wherein fig. 4A shows a significant decrease in clinical scores of microglial-specific knockout Gpr34 mice compared to control mice, fig. 4B and 4C show a significant decrease in cerebral tissue infarct zone of microglial-specific knockout Gpr34 mice compared to control mice, and fig. 4D shows a significant decrease in cytokine Il1B and Il6 expression levels in infarct tissue of microglial-specific knockout Gpr34 mice compared to control mice.

Fig. 5 shows a graph of the results of exploring the variation of microglial cell-specific knockout Gpr34 mice in a cycloheximide-induced demyelination model in example 3, wherein fig. 5A shows a decrease in myelination of microglial cell-specific knockout Gpr34 mice in a cycloheximide-induced model as compared to control mice, and fig. 5B shows a significant decrease in expression levels of myelin basic protein (Mbp), 2',3' -cyclic nucleotide-3 ' -phosphodiesterase (Cnp), myelin lipid protein (Plp) in brain callus tissue as compared to control mice, and microglial cell-specific knockout Gpr34 mice in a cycloheximide-induced model as compared to control mice.

Fig. 6 is a graph showing the results of exploring the change in the anxiety model induced by repeated electric shock on the sole of a microglial cell-specific knockout Gpr34 mouse in example 4, wherein fig. 6A shows no significant change in the total movement distance of the microglial cell-specific knockout Gpr34 mouse in the open field box as compared to a control mouse, fig. 6B shows no significant change in the movement distance of the microglial cell-specific knockout Gpr34 mouse in the center field as compared to a control mouse, fig. 6C shows no significant change in the percentage of time the microglial cell-specific knockout Gpr34 mouse is active in the center field as compared to a control mouse, and fig. 6D shows no significant change in the number of times the microglial cell-specific knockout Gpr34 mouse enters the center field as compared to a control mouse.

Fig. 7 shows a graph of the results of exploring the change in the model of obesity mediated by chronic inflammation induced by high fat in the whole body knockout Gpr34 mice of example 5, wherein fig. 7A shows no significant change in food intake of the whole body knockout Gpr34 mice compared to the control mice, fig. 7B shows no significant change in body weight of the whole body knockout Gpr34 mice compared to the control mice, fig. 7C shows no change in fasting blood glucose detection of the whole body knockout Gpr34 mice compared to the control mice, fig. 7D shows no significant change in random blood glucose detection of the whole body knockout Gpr34 mice compared to the control mice, fig. 7E shows no significant change in insulin sensitivity detection of the whole body knockout Gpr34 mice compared to the control mice, and fig. 7F shows no significant change in glucose tolerance detection of the whole body knockout Gpr34 mice compared to the control mice.

Fig. 8 shows a graph of the results of the study of the changes in lipopolysaccharide-induced acute inflammation-mediated sepsis model in the systemic knockout Gpr34 mice in example 5.

FIG. 9 shows the structural formula of GPR34 inhibitor, abbreviated as T602, in example 6.

Fig. 10 shows a graph of the results of the study of the therapeutic effect of GPR34 inhibitor in EAE model in example 6, wherein fig. 10A shows a significant decrease in clinical scores of inhibitor-treated mice compared to control mice, fig. 10B shows a significant decrease in lymphocyte infiltration in spinal cord tissue of inhibitor-treated mice compared to control mice, fig. 10C shows a significant decrease in demyelination in spinal cord tissue of inhibitor-treated mice compared to control mice, and fig. 10D shows a significant decrease in expression levels of cytokines Il1B and Il6 in spinal cord tissue of inhibitor-treated mice compared to control mice.

Fig. 11 shows a graph of the results of the study of the therapeutic effect of GPR34 inhibitors in MCAO model in example 6, wherein fig. 11A shows a significant decrease in clinical scores of inhibitor-treated mice compared to control mice, fig. 11B, 11C show a significant decrease in cerebral infarct zone of inhibitor-treated mice compared to control mice, and fig. 11D shows a significant decrease in cytokine Il1B and Il6 expression levels in infarct tissues of inhibitor-treated mice compared to control mice.

Statistical analysis of data

Except as noted specifically in the illustrations, the data statistics used herein were analyzed statistically using GraphPad Prism (software version number 6), analysis method using two-tailed unpaired Student's t-test; * P <0.05, < P <0.01, < P <0.001, ns: no obvious difference exists.

Detailed Description

The present invention will be further described in detail below with reference to specific embodiments and with reference to the accompanying drawings, in order to make the objects, technical solutions and advantages of the present invention more apparent.

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, are commercially available from conventional biochemical reagent stores.

MOG _35-55 Peptide (Met-Glu-Val-Gly-Trp-Tyr-Arg-Ser-Pro-Phe-Ser-Arg-Val-Val-His-Leu-Tyr-Arg-Asn-Gly-Lys): synthesized by Shanghai blaze Biotechnology Inc.

GPR34 inhibitors: synthesized by Shanghai Tao Su Biochemical technologies Co., ltd., product number: t8848.

Pertussis toxin: list Biological, #181, 181238A1;

inactivating mycobacterium tuberculosis: difico,231141, 9347411.

Freund's incomplete adjuvant: difico,263910, 8008624.

MCAO spool: doccol.

High fat food: jiangsu Disen Biometrics Inc., MD1203.

Lipopolysaccharide: invitrogen, LPS-EK Ultrapire.

Glucose: sigma.

Insulin: nova Nordisk.

Experimental animals: wild type C57BL/6J mice were purchased from Shanghai Style laboratory animal Co., ltd., gpr34 ^fl/fl Mice and CX ₃ CR ₁ Cre mice were purchased from Siro Biotech Inc. Gpr34 ^fl/fl Mice and CX ₃ CR ₁ Mating and breeding CX in Cre mice ₃ CR ₁ -Cre.Gpr34 ^fl/fl And (3) a mouse. Because Gpr34 is specifically highly expressed in microglia, it is hardly expressed in peripheral mononuclear macrophages, whereas CX ₃ CR ₁ Mainly expressed in mononuclear macrophages, CX is considered to be ₃ CR ₁ -Cre.Gpr34 ^fl ^/fl The mice were microglial cell-specific deleted Gpr34 mice, described in detail below: gpr34 ^fl/fl The construction process of the mouse is to insert a section of DNA sequence with length of 34bp (ATAACTTCGTATAGCATACATTATACGAAGTTAT) (comprising two 13bp inverted repeats and an 8bp core sequence, wherein the exon 4 of the Gpr34 gene is the expression region of GPR34 protein) at two ends of exon 4 of the Gpr34 gene, the section of 34bp sequence is a site recognized by recombinase, which is called loxP site, and the directions of loxP sites inserted at two ends of the exon 4 of the Gpr34 gene are consistent. Cre recombinase is a monomeric protein consisting of 343 amino acids, and can trigger DNA recombination at loxP site. Any sequence of DNA is deleted by Cre recombinase when it is located between two loxP sites in the same direction. Because Cre recombinase is specifically expressed in monocytes and Gpr34 is highly expressed in microglia and hardly expressed in peripheral monocytes, CX is considered to be ₃ CR ₁ -Cre.Gpr34 ^fl/fl The mice were microglial cell-specific deleted Gpr34 mice. CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl Gpr34 bred by mice ^fl/fl The mice are experimental control mice, CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl The mice were microglial cell-specific deleted Gpr34 mice. The whole body knockout Gpr34 mouse is obtained by a crappr-Cas 9 technology by a technical staff of an animal experiment center of a national institute of science and technology university student. Gpr34 propagated from whole body knockout Gpr34 mice ^+/+ The mice are experimental control mice, gpr34 ^-/- The mice were Gpr34 deficient mice. All experimental animals in the experiment were kept in an SPF facility.

Example 1 myelin debris stimulation up-regulates the expression of cytokines Il1b and Il6 in microglia dependent on GPR34

1. Microglial cell isolation: the brains of the mice from 1-2 days old were removed and sheared, digested at 37℃for 10 minutes with 0.25% pancreatin, quenched by adding serum-containing medium, filtered using a 40 μm filter screen and transferred to a 15ml centrifuge tube, centrifuged at 1500rpm for 10 minutes, the pellet resuspended in serum-containing DMEM and transferred to suspension flasks, and the medium was changed every 3 days. After 2 weeks, the cells were placed on a shaker and vigorously shaken at 220rpm,37℃for 1 hour, the supernatant was collected and transferred to a 15ml centrifuge tube, centrifuged at 1500rpm for 10 minutes, and the pellet was collected as microglial cells.

2. Preparation of myelin sheath fragments: in order to avoid contamination, the following experimental procedure was performed in an ultra clean bench, sucrose solution was prepared with sterile water, and treated with a ToxinEraserTM endotoxin removal kit (company: kirsrui, cat# L00308), and the prepared sucrose solution was tested with an endotoxin test kit (company: kirsrui, cat# L00350) to a result below the minimum test value. Mice were sacrificed by cervical dislocation, 10ml of pre-chilled 1x PBS was then perfused through the heart, brain tissue and spinal cord tissue were removed, placed in a disruption tube, tissue disruption was performed by adding 1 ml of 0.32M sucrose solution, then transferred to an ultracentrifuge tube containing 4 ml of 0.32M sucrose solution, blown evenly, and 4 ml of 0.85M sucrose solution was pipetted with a sterile Pasteur pipette and slowly added to the bottom of the ultracentrifuge tube for 75,000g,30 minutes at 4 ℃. The intermediate white layer was aspirated with a Pasteur pipette, added to an ultracentrifuge tube containing 8ml of sterile water, ice-bathed for 10 minutes, 75,000g,30 minutes, and centrifuged at 4 ℃. The supernatant was discarded, and then 8ml of sterile water was added, and the mixture was centrifuged at 4℃in an ice bath for 10 minutes, 75,000g and 30 minutes. The supernatant was discarded, 5 ml of 0.32M sucrose solution was added, 4 ml of 0.85M sucrose solution was pipetted into the bottom of an ultracentrifuge tube slowly, 75,000g,15 minutes, and centrifuged at 4 ℃. The intermediate layer was aspirated, added to an ultracentrifuge tube containing 8ml of 0.32M sucrose solution, centrifuged at 75,000g for 10 minutes at 4 ℃. The supernatant was discarded, resuspended in 300. Mu.l of sterile water, and then lyophilized and weighed.

3. The isolated microglial cells were placed in serum-free DMEM medium overnight for the next day, the medium was discarded, microglial cells were stimulated with myelin debris at a concentration of 1mg/ml, and after 4 hours cells were collected and examined for expression of cytokines Il1b and Il6 using a real-time fluorescent quantitative PCR instrument.

The experimental results in fig. 1 show that, when wild-type mouse-derived microglial cells are stimulated by using wild-type mouse-derived myelin fragments, the expression levels of cytokines Il1b and Il6 are up-regulated, but when the microglial cells are deficient in Gpr34, the expression levels of cytokines Il1b and Il6 up-regulated by the myelin fragments are significantly reduced compared with those in wild-type mouse microglial cells, wherein the expression level of the cytokines Il1b in the Gpr 34-deficient microglial cells accounts for about 37% of the expression level of the cytokines Il1b in the wild-type mouse microglial cells, and the expression level of the cytokines Il6 accounts for about 31% of the expression level of the cytokines Il6 in the wild-type mouse microglial cells, indicating that the expression of the myelin-fragment-stimulated up-regulated microglial cytokines Il1b and Il6 is dependent on Gpr34.

Example 2 Gpr34 is specifically highly expressed in microglia

1. Astrocyte isolation: the brain of the mice which had been newly grown for 1-2 days was removed and sheared, digested at 0.25% pancreatin 37℃for 10 minutes, quenched by addition of serum-containing DMEM (Gibco, C11965500 BT) medium, filtered using a 40 μm filter screen and transferred to a 15ml centrifuge tube, centrifuged at 1500rpm for 10 minutes, the pellet resuspended in serum-containing DMEM and transferred to a suspension flask, and replaced with fresh DMEM medium every 3 days. After 2 weeks, the cells were placed on a shaker and vigorously shaken at 220rpm,37℃for 1 hour, the supernatant was discarded, and then digested with 0.25% pancreatin, and the resulting cells were subjected to the use of the flow antibody APC-ACSA 1 (company: miltenyi Biotec, cat# 130-098-803) and FITC-CD11b (company: eBioscience, cat# 11-0112-82, clone # M1/70), by flow sorting CD11b ^- ACSA1 ⁺ The cells are astrocytes.

2. Neuron isolation and culture: the cell culture plates were coated with polylysine (company: thermo Fisher Scientific, cat# A3890404) in advance, the neonatal 1-2 day mouse brain was isolated, the meninges were removed and the cortex of the brain was isolated, the cortex was placed in 0.25% pancreatin for 10 minutes, the reaction was stopped by adding serum-containing DMEM medium, gently blown off and filtered through a 40 μm filter screen, the suspension was transferred to a 15ml centrifuge tube, centrifuged at 1500rpm for 10 minutes, and the pellet was resuspended using serum-containing DMEM according to 5.0x10 ⁶ Cells were plated in 6-well plates. After 24 hours, the medium was changed to a neuronal substrate medium (company: thermo Fisher Scientific, cat# 21103049) containing B-27 (company: thermo Fisher Scientific, cat# 17504044), and the neuronal substrate medium was changed every 3 days, and the cells obtained after 2 weeks were neuronal cells.

3. Abdominal macrophage isolation: mice were sacrificed and the abdominal cavity was washed with 20ml of pre-chilled 1 XPBS containing 1mM EDTA. Abdominal lavage fluid was collected and then labeled with the flow-through antibodies FITC-CD11b (company: eBioscience, cat# 11-0112-82, clone # M1/70) and APC-F4/80 (company: eBioscience, cat# 17-4801-82, clone # BM 8) by flow-sorting CD11b ⁺ F4/80 ⁺ The cells are peritoneal macrophages.

4. Monocyte isolation: mouse blood was collected into a centrifuge tube containing anticoagulant, and after lysing erythrocytes, the flow antibody FITC-CD11 b: eBioscience, cat: 11-0112-82, clone number: m1/70) and APC-Ly6C (Co.): biolegend, cat: 128016, clone number: HK 1.4), CD11b by flow sorting ⁺ Ly6C ⁺ The cells are monocytes.

5. Bone marrow-derived macrophage isolation: bone marrow was isolated from wild-type mice, and after erythrocyte lysis, monocytes were incubated with M-CSF (company: novus, cat# NBP1-99791, using a concentration of 10 ng/ml) for 4 days in DMEM medium containing 10% fetal bovine serum, and the differentiated cells were bone marrow-derived macrophages.

6. Microglia, astrocytes, neuronal cells, peritoneal macrophages, monocytes, bone marrow-derived macrophages were collected and examined for the expression of Gpr34 using a real-time fluorescent quantitative PCR instrument.

The experimental results in fig. 2 show that the real-time fluorescent quantitative PCR instrument detects the expression level of Gpr34 in microglia, astrocytes, neuronal cells, peritoneal macrophages, monocytes and bone marrow-derived macrophages, and the Gpr34 is specifically and highly expressed in microglia.

Example 3 significant alleviation of clinical symptoms in microglial-specific knockout Gpr34 mice in demyelinating related disease models

Clinical symptoms were significantly reduced in EAE model in microglial cell-specific knockout Gpr34 mice

1. Day 0, preparation of age and sex matched 8 week old Gpr34 ^fl/fl And CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice in which Gpr34 ^fl/fl Is a control mouse derived from the same parent. The pertussis toxin is dissolved in normal saline, the inactivated mycobacterium tuberculosis is dissolved in Freund's incomplete adjuvant to prepare Freund's complete adjuvant containing 2.5mg/ml inactivated mycobacterium tuberculosis, then MOG is dissolved in the prepared Freund's complete adjuvant, and the emulsion is repeatedly blown by using a syringe. Pertussis toxin 150ng was intravenously injected and then each 150 μg of emulsified MOG peptide was subcutaneously injected on both dorsum of the thigh.

2. On day 2, the mice were again given daily clinical scores with 150ng pertussis toxin intravenous. Score 0, no clinical symptoms; 1 minute, tail weakness; 2 minutes, tail paralysis and hind limb weakness; 3 minutes, hind limb paralysis; 4 minutes, paralysis of the front and rear limbs; 5 minutes, dying.

The results in fig. 3A show that the clinical score of microglial-specific knockout Gpr34 mice was significantly reduced compared to wild-type mice in the EAE model, wherein the clinical score of microglial-specific knockout Gpr34 mice was 0.9 score and the clinical score of wild-type mice was 2.8 score.

3. Day 0, preparation of age and sex matched 8 week old Gpr34 ^fl/fl And CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice in which Gpr34 ^fl/fl Is a control mouse derived from the same parent. The pertussis toxin is dissolved in normal saline, the inactivated mycobacterium tuberculosis is dissolved in Freund's incomplete adjuvant to prepare Freund's complete adjuvant containing 2.5mg/ml inactivated mycobacterium tuberculosis, then MOG is dissolved in the prepared Freund's complete adjuvant, and the emulsion is repeatedly blown by using a syringe. Pertussis toxin 150ng was intravenously injected and then each 150 μg of emulsified MOG peptide was subcutaneously injected on both dorsum of the thigh.

2. On day 2, 150ng pertussis toxin was again injected intravenously.

3. On day 13, mice were sacrificed and then spinal cord tissue from the mice was isolated, subjected to H & E staining, LFB staining and the expression levels of spinal cord tissue cytokines Il1b and Il6 were detected.

3.1H & E staining: spinal cord tissue was paraffin-embedded and 4 micron thick sections of spinal cord were excised for pathology staining. Sequentially placing the slices into an environment-friendly tissue transparent agent for 20 minutes, removing paraffin-absolute ethyl alcohol from the tissue surface for 20 minutes to 90% ethyl alcohol from 5 minutes to 80% ethyl alcohol from 5 minutes to 70% ethyl alcohol from 5 minutes to distilled water for washing for 5 minutes, staining hematoxylin for 5 minutes, washing hematoxylin remained on the tissue surface by using tap water, checking whether the tissue surface is washed clean or not by a microscope, treating the tissue surface with 80% ethyl alcohol for 2 minutes, staining with eosin dye solution for 2 minutes, staining with 80% ethyl alcohol for 5 minutes, 95% ethyl alcohol for 5 minutes, absolute ethyl alcohol for 10 minutes, and environment-friendly tissue transparent agent for 2 minutes, so as to enhance the staining effect, sealing the tissue with neutral resin, and observing lymphocyte infiltration under an air-drying mirror.

3.2LFB staining: sequentially placing the slices into an environment-friendly tissue transparent agent for 20 minutes, removing paraffin-absolute ethanol on the surface of the tissue for 20 minutes to 90 percent ethanol for 5 minutes to 80 percent ethanol for 5 minutes to 70 percent ethanol for 5 minutes to distilled water for washing for 5 minutes, placing the slices into 0.1 percent LFB dye liquor for incubation overnight at 60 ℃, and washing with tap water; the slice is put into 70% ethanol for 5 minutes, the slice is immersed into 0.05% lithium carbonate, the color separation time is controlled under a mirror until the color separation is complete (the color of a visible gray matter part becomes light), if the color separation is bad, the two steps are alternately performed for several times until the microscopic examination is satisfactory, the slice is washed with water, the slice is counterstained with 0.1% eosin for 20 seconds, the slice is washed with water, the environment-friendly tissue is transparent for 2 minutes, so that the dyeing effect is enhanced, the neutral resin is sealed, and the situation of myelin sheath drop is observed under the mirror.

3.3 detection of the expression levels of spinal cord tissue cytokines Il1b and Il6 by a real-time fluorescent quantitative PCR instrument.

The experimental results in fig. 3B show that in EAE model, the lymphocyte infiltration of spinal cord tissue of the microglial-specific knockout Gpr34 mice is significantly reduced compared to wild-type mice, wherein the number of infiltrating lymphocytes of the microglial-specific knockout Gpr34 mice accounts for about 30% of the number of infiltrating lymphocytes of the wild-type mice (box enlarged area shows, picture scale bar is 100 micrometers), indicating that the inflammation of central nervous system of the microglial-specific knockout Gpr34 mice is significantly reduced compared to control mice.

The results in fig. 3C show that demyelination of spinal cord tissue of microglial-specific knockout Gpr34 mice is significantly reduced in EAE model compared to wild type mice, wherein demyelination of microglial-specific knockout Gpr34 mice accounts for about 20% of demyelination in wild type mice (box magnified area, scale bar of 100 microns), indicating that clinical symptoms of microglial-specific knockout Gpr34 mice are significantly reduced.

The results in fig. 3D show that, in the EAE model, the expression of cytokines Il1b and Il6 in spinal cord tissue of the microglial cell-specific knockout Gpr34 mouse is significantly reduced compared to the wild-type mouse, wherein the expression level of cytokine Il1b in spinal cord tissue of the microglial cell-specific knockout Gpr34 mouse is about 21% of the expression level of cytokine Il1b in spinal cord tissue of the wild-type mouse, and the expression level of cytokine Il6 in spinal cord tissue is about 21% of the expression level of cytokine Il6 in spinal cord tissue of the wild-type mouse, indicating that the inflammation of central nervous system of the microglial cell-specific knockout Gpr34 mouse is significantly reduced compared to the control mouse.

The experimental results show that the clinical symptoms of the microglial cell specific knockout Gpr34 mice are obviously reduced in an EAE model.

Clinical symptoms in MCAO model were significantly reduced in microglial cell-specific knockout Gpr34 mice

1. Preparation of age and sex matched 8 week old Gpr34 ^fl/fl And CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice in which Gpr34 ^fl/fl Is a control mouse derived from the same parent. After isoflurane anesthetizing the mice, a small opening was cut on the left side of the neck of the mice, and the external carotid artery and the internal carotid artery on the left side of the mice were isolated. The distal end of the electrocoagulation external carotid artery and the superior thyroid artery. A silicone wire plug (head diameter 0.23 mm) was inserted from the external carotid artery into the internal carotid artery, the wire plug insertion distance was about 10 mm, and the middle cerebral artery was occluded. The anal temperature of the mice was maintained at about 37 ℃ during the surgery with a heating pad. After 60 minutes of embolization, the peg was pulled out to effect reperfusion of the middle cerebral artery.

2. Clinical scoring was performed 12 hours, 24 hours, 48 hours post-surgery: 0: no nerve injury; 1: the adduction of the contralateral forelimb of the ischemic brain cannot be completely straightened when the tail is lifted; 2: rear-end collision occurs during walking; 3: the body is dumped to the opposite side of the ischemic brain; 4: no spontaneous movement or drum-like movement.

3. 48 hours post-surgery, mice were sacrificed and perfused 1×pbs through the heart. The olfactory bulb and cerebellum were removed from the brain, the brain was cut into 2 mm thick brain slices, stained in 0.5%2,3, 5-triphenyltetrazolium chloride (TTC, inc.: sigma-Aldrich, cat# T8877) at 37℃for 15 minutes in the absence of light, 4% paraformaldehyde was fixed for 6 hours, photographed, and the infarct ratio was calculated using Image J software.

The results of the experiment in fig. 4A show that microglial-specific knockout Gpr34 mice have significantly reduced clinical scores in the MCAO model compared to wild-type mice, wherein the clinical score of microglial-specific knockout Gpr34 mice is 1.3 points and the clinical score of wild-type mice is 3.5 points.

Fig. 4B and fig. 4C show that the area of cerebral infarction in MCAO model is significantly reduced in microglial cell-specific knockout Gpr34 mice compared to wild-type mice, wherein the area of cerebral infarction in microglial cell-specific knockout Gpr34 mice is about 21% on average, and the area of cerebral infarction in wild-type mice is about 45% on average.

4. Preparation of age and sex matched 8 week old Gpr34 ^fl/fl And CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice in which Gpr34 ^fl/fl Is a control mouse derived from the same parent. After isoflurane anesthetizing the mice, a small opening was cut on the left side of the neck of the mice, and the external carotid artery and the internal carotid artery on the left side of the mice were isolated. The distal end of the electrocoagulation external carotid artery and the superior thyroid artery. A silicone wire plug (head diameter 0.23 mm) was inserted from the external carotid artery into the internal carotid artery, the wire plug insertion distance was about 10 mm, and the middle cerebral artery was occluded. The anal temperature of the mice was maintained at about 37 ℃ during the surgery with a heating pad. After 60 minutes of embolization, the peg was pulled out to effect reperfusion of the middle cerebral artery.

4.1 mice were sacrificed 48 hours post-surgery and perfused 1 XPBS through the heart. The olfactory bulb and cerebellum are removed from the brain, the infarcted semi-brain tissue is separated, and the expression levels of cytokines Il1b and Il6 of the infarcted semi-brain tissue are detected by a real-time fluorescent quantitative PCR instrument.

The experimental results in fig. 4D show that, compared with the wild-type mice, the expression levels of cytokines Il1b and Il6 in the infarcted semi-brain tissue of the microglial cell-specific knockout Gpr34 mice are significantly reduced in the MCAO model, wherein the expression level of the cytokine Il1b in the infarcted semi-brain tissue of the microglial cell-specific knockout Gpr34 mice accounts for about 25% of the expression level of the cytokine Il1b in the infarcted semi-brain tissue of the wild-type mice, and the expression level of the cytokine Il6 in the infarcted semi-brain tissue of the wild-type mice accounts for about 27% of the expression level of the cytokine Il6 in the infarcted semi-brain tissue of the wild-type mice.

The experimental results show that the clinical symptoms of the microglial cell specific knockout Gpr34 mice are obviously reduced in the MCAO model.

Clinical symptoms were significantly reduced in the cyclohexanoyldihydrazone-induced demyelination model in microglial-specific knockout Gpr34 mice

1. Preparation of age and sex matched 8 week old Gpr34 ^fl/fl And CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice in which Gpr34 ^fl/fl Is a control mouse derived from the same parent. Is divided into four groups of parts,

First group, 8 week old Gpr34 ^fl/fl 6 mice were given normal food feedsAnd (5) culturing for 6 weeks.

CX of 8 weeks of age of second group ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice were given normal diet for 6 weeks.

Third group, 8 week old Gpr34 ^fl/fl The mice were fed with a diet containing 0.2% cyclohexanedihydrazone (company: sigma-Aldrich, cat# C9012, diet synthesized by the company Australian feed Co., beijing) for 6 weeks.

CX of 8 weeks of age in group IV ₃ CR ₁ -Cre.Gpr34 ^fl/fl The 6 mice were fed with a diet containing 0.2% (i.e., 100g of cycloheximide-containing 0.2 g) of cycloheximide for 6 weeks.

2. After 6 weeks of feeding, the brain tissue of the mice was isolated, paraffin-embedded, 6 μm thick brain sections were cut for LFB staining, and myelination was counted. Wherein the first set of data displays are represented by filled circles, the second set of data displays are represented by open circles, the third set of data displays are represented by open squares, and the fourth set of data displays are represented by filled inverted triangles.

FIG. 5A shows the experimental results of an 8 week old Gpr34 under physiological conditions ^fl/fl And CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl The myelin sheath status of mice was not significantly changed. After 6 weeks of cyclohexanoyldihydrazone induction, gpr34 ^fl/fl Gpr34 in physiological condition of mice ^fl/fl The demyelination of mice was markedly severe, indicating the rationality of the cycloheximide-dihydrazone-induced demyelination model. However, CX after 6 weeks of induction of cycloheximide dihydrazone ₃ CR ₁ -Cre.Gpr34 ^fl/fl Demyelination in mice is compared to Gpr34 ^fl/fl Demyelination in mice was significantly reduced with Gpr34 ^fl/fl The myelin content of mice was 50% of that of mice fed normal diet, CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl The myelin content of mice was 80% of that of mice fed normal diet. Indicating that microglial cell specific knockout Gpr34 mice have significantly reduced myelination in a cycloheximide-induced demyelination model.

3. Preparation of age and sex matched 8 week old Gpr34 ^fl/fl And CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice in which Gpr34 ^fl/fl Is a control mouse derived from the same parent. Is divided into four groups of parts,

first group, 8 week old Gpr34 ^fl/fl Mice were given normal diet for 6 weeks.

Third group, 8 week old Gpr34 ^fl/fl Mice 6 were fed with a diet containing 0.2% cyclohexanedihydrazone for 6 weeks.

CX of 8 weeks of age in group IV ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice 6 were fed with a diet containing 0.2% cyclohexanedihydrazone for 6 weeks.

4. After 6 weeks of feeding, brain callus tissues of mice were isolated and examined for expression levels of myelin basic protein (Mbp), 2',3' -cyclic nucleotide-3 ' -phosphodiesterase (Cnp), myelin lipid protein (Plp), and cytokines Il1b and Il6, which are myelin-related synthetic genes. Wherein the first set of data displays are represented by filled circles, the second set of data displays are represented by open circles, the third set of data displays are represented by open squares, and the fourth set of data displays are represented by filled inverted triangles.

FIG. 5B shows the results of an experiment showing that, in physiological conditions, gpr34 is 8 weeks old ^fl/fl And CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl Myelin-associated synthetic genes myelin basic protein (Mbp), 2',3' -cyclic nucleotide-3 ' -phosphodiesterase (Cnp), myelin lipoproteins (Plp) expression in mice were not significantly altered. After 6 weeks of cyclohexanoyldihydrazone induction, gpr34 ^fl/fl Expression of myelin-associated synthetic genes myelin basic protein (Mbp), 2',3' -cyclic nucleotide-3 ' -phosphodiesterase (Cnp), myelin lipid protein (Plp) in mice is more physiological than Gpr34 ^fl/fl The mice were significantly reduced, indicating the rationality of the cycloheximide-dihydrazone-induced demyelination model. However, CX after 6 weeks of induction of cycloheximide dihydrazone ₃ CR ₁ -Cre.Gpr34 ^fl/fl The expression level of myelin basic protein (Mbp) of the myelin-related synthetic gene of mice is 51% of the Mbp expression level of mice fed with normal dietBut Gpr34 ^fl/fl The Mbp expression in mice was only 13% of that in mice fed normal diet. CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl The expression level of the mouse myelin-associated synthetic gene 2',3' -cyclic nucleotide-3 ' -phosphodiesterase (Cnp) is 60% of Cnp expression levels in mice fed normal diet, but Gpr34 ^fl/fl The Cnp expression level of mice was only 20% of that of mice fed normal diet, CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl The expression level of myelin-associated synthetic gene myelin lipid protein (Plp) in mice was 51% of Plp expression in mice fed normal diet, but Gpr34 ^fl/fl The mice showed only 21% of the Plp expression in mice fed normal diet, indicating less demyelination and less symptoms in the cyclohexanoyl dihydrazone-induced demyelination model in microglial cell-specific knockout Gpr34 mice.

FIG. 5C shows the results of an experiment showing that Gpr34 is 8 weeks of age under physiological conditions ^fl/fl And CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl The expression levels of cytokines Il1b and Il6 in mice were not significantly changed. After 6 weeks of cyclohexanoyldihydrazone induction, gpr34 ^fl/fl The expression level of cytokines Il1b and Il6 in mice is higher than that of Gpr34 in physiological conditions ^fl/fl The mice were significantly upregulated, with 28-fold upregulation of cytokine Il1b and 9-fold upregulation of cytokine Il6, indicating the rationality of the cyclohexanoyl dihydrazone-induced demyelination model. However, CX after 6 weeks of induction of cycloheximide dihydrazone ₃ CR ₁ -Cre.Gpr34 ^fl/fl The expression level of cytokines Il1b and Il6 in mice was up-regulated by a multiple of that of Gpr34 ^fl/fl The expression level of cytokines Il1b and Il6 of mice is obviously reduced by up-regulation multiple, wherein CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl The expression level of cytokine Il1b was up-regulated 12-fold and the expression level of cytokine Il6 was up-regulated 4-fold in mice. Indicating that microglial-specific knockout Gpr34 mice have reduced inflammation in brain tissue in a cycloheximide-induced demyelination model.

The experimental results show that the clinical symptoms of the microglial cell specific knockout Gpr34 mice are obviously reduced in a cycloheximide dihydrazone induced demyelination model.

Summarizing example 3, the above experimental results demonstrate that microglial-specific knockout Gpr34 mice significantly reduce clinical symptoms in models of demyelinating-related diseases such as experimental autoreactive encephalomyelitis, middle cerebral artery reperfusion, and cyclohexyldihydrazone-induced demyelination.

Example 4 microglial-derived GPR34 did not play a role in plantar repeated shock induced anxiety model

In the plantar recurrent shock-induced anxiety model, there was no significant change in the behavioral profile of microglial-specific knockout Gpr34 mice compared to control mice

1. Preparation of age and sex matched 8 week old Gpr34 ^fl/fl And CX (CX) ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice in which Gpr34 ^fl/fl Is a control mouse derived from the same parent. Prior to the experiment, mice were placed in the laboratory for 1 hour to acclimatize and then individually placed in a chamber with a grid floor connected to an impact generator. After 2 minutes of placement in the compartment, the mice were randomly exposed to 0.6mA plantar shock 5 times for 3 seconds each for 8 consecutive days within 120 seconds. The compartments were cleaned with 75% alcohol before and after each experiment, avoiding any olfactory induced experimental errors.

2. After 8 consecutive days of plantar shock, the mice were transferred from the feeding area to the room of the experimental area for 1 hour and subjected to open field experiments. The mice were placed from one corner of the open field box, allowed to freely move in the open field box, and the movement track of the mice for 5 minutes was recorded, and the total movement distance of the mice in the open field box, the movement distance at the center field, the percentage of the movement time at the center field, and the number of times of entering the center field were analyzed, and the results are shown in fig. 6. After the experiment of each mouse is finished, the open field box is wiped by 75% alcohol, so that the influence of smell on the mice is eliminated.

Fig. 6A shows that microglial-specific knockout Gpr34 mice have no significant change in total distance traveled in open field boxes during the course of the experiment in a plantar repeated shock-induced anxiety model compared to control mice.

Fig. 6B shows that microglial-specific knockout Gpr34 mice have no significant change in distance moved in the center field during the experiment, as compared to control mice in a plantar repeated shock-induced anxiety model.

Fig. 6C shows that microglial-specific knockout Gpr34 mice have no significant change in the percentage of activity time in the central site during the course of the experiment compared to control mice in the plantar repeated shock-induced anxiety model.

The results of the experiment in fig. 6D show that microglial-specific knockout Gpr34 mice did not significantly change the number of entries into the central site during the experiment compared to control mice in the plantar repeated shock-induced anxiety model.

The above experimental results indicate that microglial-derived GPR34 does not play a role in the plantar repeated shock induced anxiety model.

Example 5 systemic knockout of Gpr34 mice had no apparent pathological changes in the external Zhou Ji/chronically induced inflammation model

In the high fat diet-induced chronic inflammation-mediated obesity model, there was no significant change in the obesity-related index in the systemic knockout Gpr34 mice compared to the control mice

1. Age and sex matched 6 week old Gpr34 was prepared ^+/+ And Gpr34 ^-/- Mice in which Gpr34 ^+/+ Wild type control mice from the same parent were then fed high fat diet for 19 weeks and body weight, diet were recorded. After 19 weeks, mice were subjected to fasting blood glucose testing, randomized blood glucose testing, insulin sensitivity testing, and glucose tolerance testing.

2. Insulin sensitivity assay: after 4 hours of fasting, the mice were tested for blood glucose at 0 minutes, followed by insulin injections of 0.75U/kg, and blood glucose was tested at 15 minutes, 30 minutes, 60 minutes, 90 minutes, 120 minutes. Blood glucose test was performed using tail vein exsanguination and using OneTouchultra blood glucose test System kit (available from Qiangsheng Co.).

3. Glucose tolerance experiment: after 14 hours of fasting, the mice were tested for blood glucose at 0 minutes, followed by glucose injection at 1.5g/kg, and blood glucose was tested at 15 minutes, 30 minutes, 60 minutes, 90 minutes, 120 minutes.

The results of the experiment in fig. 7A show that there was no significant change in food intake in the systemic knockout Gpr34 mice compared to control mice in the high-fat food-induced chronic inflammation-mediated obesity model.

The experimental results in fig. 7B show that there was no significant change in body weight in the systemic knockout Gpr34 mice compared to control mice in the high fat diet-induced chronic inflammation-mediated obesity model.

Fig. 7C shows that there was no significant change in fasting blood glucose detection in the systemic knockout Gpr34 mice compared to control mice in the high fat diet-induced chronic inflammation-mediated obesity model.

The results of the experiment in fig. 7D show that there was no significant change in random blood glucose detection in the systemic knockout Gpr34 mice compared to control mice in the high fat diet-induced chronic inflammation-mediated obesity model.

The results of the experiment in fig. 7E show that there was no significant change in insulin sensitivity detection in the systemic knockout Gpr34 mice compared to control mice in the high fat diet-induced chronic inflammation-mediated obesity model.

The results of the experiment in fig. 7F show that there was no significant change in glucose tolerance detection in the systemic knockout Gpr34 mice compared to control mice in the high fat diet-induced chronic inflammation-mediated obesity model.

The above experimental results indicate that GPR34 is not involved in the high fat diet-induced chronic inflammation-mediated obesity process.

In the lipopolysaccharide-induced acute inflammation-mediated sepsis model, there was no significant change in survival rate of the systemic knockout Gpr34 mice compared to control mice

1. Preparation of age and sex matched 8 week old Gpr34 ^+/+ And Gpr34 ^-/- Mice in which Gpr34 ^+/+ Wild-type control mice from the same parent were then intraperitoneally injected with 20mg/kg lipopolysaccharide and the mice were monitored for survival at 12 hour intervals.

The experimental results in fig. 8 show that there was no significant change in survival rate of the systemic knockout Gpr34 mice compared to control mice in the lipopolysaccharide-induced acute inflammation-mediated sepsis model, indicating that Gpr34 is not involved in the lipopolysaccharide-induced acute inflammation-mediated sepsis process.

Summarizing example 5, gpr34 was not involved in the chronic inflammation-mediated obesity process induced by high lipid foods and the acute inflammation-mediated sepsis process induced by lipopolysaccharide.

Example 6 GPR34 inhibitors are effective in alleviating the progression of demyelinating related diseases

GPR34 inhibitor has the structural formula, T602 for short, as shown in FIG. 9 (Schoneberg et al, 2018).

T602 formula: c (C) ₃₁ H ₂₆ ClNO ₄ ；

T602 chemical name: tyrosine, N- [ ((2E) -3- (4 '-chloro [1,1' -biphenyl ] -4-yl) -1-oxo-2-propen-1-yl ] -O- (benzyl).

GPR34 inhibitor can effectively relieve the disease course of EAE

1. On day 0, wild type C56BL/6J mice of similar body weight at 8 weeks of age were randomly grouped into two groups of 5 animals each, and the specific grouping treatment was as follows:

A first group: 1xPBS with 10% DMSO was intraperitoneally injected on days 0, 2, 4, 6, 8, 10, 12, i.e., control group.

Second group: GPR34 inhibitor (10 mg/kg of GPR34 inhibitor in 1xPBS with 10% dmso) was injected intraperitoneally on days 0, 2, 4, 6, 8, 10, 12, i.e., inhibitor-treated group.

Then EAE induction is carried out, pertussis toxin is dissolved in normal saline, the inactivated mycobacterium tuberculosis is dissolved in Freund's incomplete adjuvant, freund's complete adjuvant containing 2.5mg/ml of the inactivated mycobacterium tuberculosis is prepared, MOG is dissolved in the prepared Freund's complete adjuvant, and the emulsion liquid is repeatedly blown by using a syringe. Pertussis toxin 150ng was intravenously injected and then each 150 μg of emulsified MOG peptide was subcutaneously injected on both dorsum of the thigh.

The results of the experiment in fig. 10A show that in EAE model, the clinical symptom score of the mice treated with the inhibitor is significantly reduced compared to the mice treated with the control group, wherein the clinical score of the mice treated with the inhibitor is 1.2 score, and the clinical score of the mice treated with the control group is 3 score, which indicates that GPR34 inhibitor can effectively alleviate the pathogenesis of EAE.

3. On day 0, wild type C56BL/6J mice of similar body weight at 8 weeks of age were randomly grouped into two groups of 5 animals each, and the specific grouping treatment was as follows:

4. On day 2, 150ng pertussis toxin was again injected intravenously.

5. On day 13, mice were sacrificed and then spinal cord tissue from the mice was isolated, subjected to H & E staining, LFB staining and the expression levels of spinal cord tissue cytokines Il1b and Il6 were detected.

5.1H & E staining: spinal cord tissue was paraffin-embedded and 4 micron thick sections of spinal cord were excised for pathology staining. Sequentially placing the slices into an environment-friendly tissue transparent agent for 20 minutes, removing paraffin-absolute ethyl alcohol from the tissue surface for 20 minutes to 90% ethyl alcohol for 5 minutes to 80% ethyl alcohol for 5 minutes to 70% ethyl alcohol for 5 minutes to distilled water for washing, staining with hematoxylin for 5 minutes, performing running water microscopic examination to turn blue for 10 minutes, treating with 80% ethyl alcohol for 2 minutes, staining with eosin dye solution for 2 minutes, staining with 80% ethyl alcohol for 5 minutes, 95% ethyl alcohol for 5 minutes, and absolute ethyl alcohol for 10 minutes, and using the environment-friendly tissue transparent agent for 2 minutes to enhance the staining effect, sealing the neutral resin, and observing lymphocyte infiltration under an air-drying mirror.

5.2LFB staining: sequentially placing the slices into an environment-friendly tissue transparent agent for 20 minutes, removing paraffin-absolute ethanol on the surface of the tissue for 20 minutes to 90 percent ethanol for 5 minutes to 80 percent ethanol for 5 minutes to 70 percent ethanol for 5 minutes to distilled water for washing, placing the slices into 0.1 percent LFB dye liquor for 60 ℃ for incubation overnight, washing with tap water, placing the slices into 70 percent ethanol for 5 minutes, immersing the slices into 0.05 percent lithium carbonate, controlling the color separation time under a lens until the color separation is complete (the color of a visible gray part becomes light), and alternately performing the two steps of light separation for several times until the microscopic examination is satisfactory, washing with water, counterstaining with 0.1 percent eosin for 20 seconds, washing with water, protecting the environment-friendly tissue transparent agent for 2 minutes, sealing with neutral resin, and observing the situation of myelin drop under a lens.

5.3 the expression levels of spinal cord tissue cytokines Il1b and Il6 were detected by a real-time fluorescent quantitative PCR instrument.

The experimental results in fig. 10B show that in EAE model, the lymphocyte infiltration of spinal cord tissue of mice treated with inhibitor is significantly reduced compared with mice in control group, wherein the number of infiltrating lymphocytes of mice treated with inhibitor is about 20% of the number of infiltrating lymphocytes of mice in control group (box enlarged area shows, picture scale is 100 micrometers), indicating that the inflammation of central nervous system of mice treated with inhibitor is significantly reduced compared with control mice.

The results of the experiment in fig. 10C show that in the EAE model, demyelination of spinal cord tissue of the mice treated with the inhibitor is significantly reduced compared to the mice in the control group, wherein demyelination of the mice treated with the inhibitor accounts for about 30% of demyelination of the mice in the control group (box enlarged area shows, picture scale is 100 μm), indicating that clinical symptoms of the mice treated with the inhibitor are significantly reduced.

The experimental results of fig. 10D show that, in the EAE model, the expression of cytokines Il1b and Il6 in the spinal cord tissue of the mice treated with the inhibitor is significantly reduced compared to the mice in the control group, wherein the expression level of cytokine Il1b in the spinal cord tissue of the mice treated with the inhibitor is about 25% of the expression level of Il1b in the spinal cord tissue of the mice in the control group, and the expression level of cytokine Il6 in the spinal cord tissue of the mice treated with the inhibitor is about 19% of the expression level of Il6 in the spinal cord tissue of the mice in the control group, indicating that the inflammation of the central nervous system of the mice treated with the inhibitor is significantly reduced compared to the mice in the control group.

The experimental results show that GPR34 inhibitor can effectively relieve the disease course of EAE.

GPR34 inhibitor can effectively relieve the disease course of MCAO

1. Wild type C56BL/6J mice with similar body weight at 8 weeks of age were randomly grouped into two groups of 5 mice each, and the specific grouping treatment is as follows:

A first group: the control group, 1x PBS containing 10% dmso, was injected intraperitoneally 12 hours prior to MCAO induction, 0 hours, and 12 hours after MCAO induction.

Second group: GPR34 inhibitor (10 mg/kg of injection, GPR34 inhibitor dissolved in 1xPBS with 10% dmso) was injected intraperitoneally 12 hours before MCAO induction, 0 hours, and 12 hours after MCAO induction, i.e., inhibitor-treated group.

After MCAO induction and isoflurane anesthesia of mice, a small incision was made on the left side of the neck of the mice and the left external carotid artery and internal carotid artery of the mice were isolated. The distal end of the electrocoagulation external carotid artery and the superior thyroid artery. A silicone wire plug (head diameter 0.23 mm) was inserted from the external carotid artery into the internal carotid artery, the wire plug insertion distance was about 10mm, and the middle cerebral artery was occluded. The anal temperature of the mice was maintained at about 37 ℃ during the surgery with a heating pad. After 60 minutes of embolization, the peg was pulled out to effect reperfusion of the middle cerebral artery.

3. 48 hours after operation, sacrificing mice, perfusing 1XPBS through the heart, taking brains to remove olfactory bulbs and cerebellum, cutting the brains into brain slices with the thickness of 2 mm, dying the brains in 0.5% TTC for 15 minutes at 37 ℃ in a dark place, fixing 4% paraformaldehyde for 6 hours, photographing, and calculating the infarct proportion by using Image J software.

The results of the experiment in fig. 11A show that the clinical score of the inhibitor treated mice is significantly reduced in the MCAO model compared to the control mice, wherein the clinical score of the inhibitor treated mice is 1.4 points and the clinical score of the control mice is 3.8 points.

The experimental results in fig. 11B and 11C show that the area of the cerebral infarction area of the mice in the inhibitor-treated group is significantly reduced in the MCAO model compared with the mice in the control group, wherein the area of the cerebral infarction area of the mice in the inhibitor-treated group is about 17% on average, and the area of the cerebral infarction area of the mice in the control group is about 45% on average.

4. Wild type C56BL/6J mice with similar body weight at 8 weeks of age were randomly grouped into two groups of 5 mice each, and the specific grouping treatment is as follows:

a first group: the control group, 1xPBS with 10% DMSO was intraperitoneally injected 12 hours before MCAO induction, 0 hours, and 12 hours after MCAO induction.

5. 48 hours after operation, sacrificing mice, taking brains to remove olfactory bulbs and cerebellum after heart perfusion of 1 XPBS, separating infarcted semi-brain tissues, and detecting the expression levels of cytokines Il1b and Il6 of the infarcted semi-brain tissues by a real-time fluorescent quantitative PCR instrument.

The experimental results in fig. 11D show that, compared with the mice in the control group, the inhibitor-treated mice have significantly reduced levels of cytokine Il1b and Il6 in the infarcted semi-brain tissue in the MCAO model, wherein the amount of cytokine Il1b expressed in the infarcted semi-brain tissue of the inhibitor-treated mice is about 32% of the amount of Il1b expressed in the infarcted semi-brain tissue of the control group, and the amount of cytokine Il6 expressed in the infarcted semi-brain tissue of the inhibitor-treated mice is about 25% of the amount of Il6 expressed in the infarcted semi-brain tissue of the control group.

The above experiments show that GPR34 inhibitors can effectively relieve the disease course of MCAO.

Summarizing example 6, the gpr34 inhibitor can effectively alleviate the pathogenesis of demyelinating related diseases such as EAE and MCAO.

The experiments further prove that the medicine taking GPR34 as a target point can be developed, and a new strategy is provided for the treatment of demyelinating related diseases.

The above examples are provided to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, many modifications and variations of the methods and compositions of the invention set forth herein will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention.

While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the present invention.

Reference to the literature

1.Schoneberg,T.,Meister,J.,Knierim,A.B.,and Schulz,A.(2018).The G protein-coupled receptor GPR34-The past 20years of a grownup.Pharmacology&therapeutics 189,71-88.

2.Adamo,A.M.(2014).Nutritional factors and aging in demyelinating diseases.Genes&nutrition 9,360.

3.Bedard,A.,Tremblay,P.,Chernomoretz,A.,and Vallieres,L.(2007).Identification of genes preferentially expressed by microglia and upregulated during cuprizone-induced inflammation.Glia 55,777-789.

4.Butovsky,O.,Jedrychowski,M.P.,Moore,C.S.,Cialic,R.,Lanser,A.J.,Gabriely,G.,Koeglsperger,T.,Dake,B.,Wu,P.M.,Doykan,C.E.,et al.(2014).Identification of a unique TGF-beta-dependent molecular and functional signature in microglia.Nature neuroscience 17,131-143.

5.Chen,D.,Huang,Y.,Shi,Z.,Li,J.,Zhang,Y.,Wang,K.,Smith,A.D.,Gong,Y.,and Gao,Y.(2020).Demyelinating processes in aging and stroke in the central nervous system and the prospect of treatment strategy.CNS neuroscience&therapeutics 26,1219-1229.

6.Clarner,T.,Diederichs,F.,Berger,K.,Denecke,B.,Gan,L.,van der Valk,P.,Beyer,C.,Amor,S.,and Kipp,M.(2012).Myelin debris regulates inflammatory responses in an experimental demyelination animal model and multiple sclerosis lesions.Glia 60,1468-1480.

7.Colonna,M.,and Butovsky,O.(2017).Microglia Function in the Central Nervous System During Health and Neurodegeneration.Annual review of immunology 35,441-468.

8.Constantinescu,C.S.,Farooqi,N.,O'Brien,K.,and Gran,B.(2011).Experimental autoimmune encephalomyelitis(EAE)as a model for multiple sclerosis(MS).British journal of pharmacology 164,1079-1106.

9.Doyle,K.P.,and Buckwalter,M.S.(2020).Immunological mechanisms in poststroke dementia.Curr Opin Neurol 33,30-36.

10.Engemaier,E.,Rompler,H.,Schoneberg,T.,and Schulz,A.(2006).Genomic and supragenomic structure of the nucleotide-like G-protein-coupled receptor GPR34.Genomics 87,254-264.

11.Franklin,R.J.,and Ffrench-Constant,C.(2008).Remyelination in the CNS:from biology to therapy.Nature reviews Neuroscience 9,839-855.

12.Gilman,A.G.(1987).G proteins:transducers of receptor-generated signals.Annual review of biochemistry 56,615-649.

13.Gong,T.,Liu,L.,Jiang,W.,and Zhou,R.(2020).DAMP-sensing receptors in sterile inflammation and inflammatory diseases.Nature reviews Immunology，95-112.

14.Heneka,M.T.(2019).Microglia take centre stage in neurodegenerative disease.Nature reviews Immunology 19,79-80.

15.R.,and Lassmann,H.(2017).Inflammatory demyelinating diseases of the central nervous system.Handbook of clinical neurology 145,263-283.

16.Joy,M.T.,Ben Assayag,E.,Shabashov-Stone,D.,Liraz-Zaltsman,S.,Mazzitelli,J.,Arenas,M.,Abduljawad,N.,Kliper,E.,Korczyn,A.D.,Thareja,N.S.,et al.(2019).CCR5 Is a Therapeutic Target for Recovery after Stroke and Traumatic Brain Injury.Cell 176,1143-1157.e1113.

17.Kierdorf,K.,Masuda,T.,M.J.C.,and Prinz,M.(2019).Macrophages at CNS interfaces:ontogeny and function in health and disease.Nature reviews Neuroscience 20,547-562.

18.Liu,Q.,Johnson,E.M.,Lam,R.K.,Wang,Q.,Bo Ye,H.,Wilson,E.N.,Minhas,P.S.,Liu,L.,Swarovski,M.S.,Tran,S.,et al.(2019).Peripheral TREM1 responses to brain and intestinal immunogens amplify stroke severity.Nature immunology 20,1023-1034.

19.Makide,K.,and Aoki,J.(2013).GPR34 as a lysophosphatidylserine receptor.Journal of biochemistry 153,327-329.

20.Neumann,H.,Kotter,M.R.,and Franklin,R.J.(2009).Debris clearance by microglia:an essential link between degeneration and regeneration.Brain:a journal of neurology 132,288-295.

21.O'Hayre,M.,Vázquez-Prado,J.,Kufareva,I.,Stawiski,E.W.,Handel,T.M.,Seshagiri,S.,and Gutkind,J.S.(2013).The emerging mutational landscape of G proteins and G-protein-coupled receptors in cancer.Nature reviews Cancer13,412-424.

22.Poliani,P.L.,Wang,Y.,Fontana,E.,Robinette,M.L.,Yamanishi,Y.,Gilfillan,S.,and Colonna,M.(2015).TREM2 sustains microglial expansion during aging and response to demyelination.The Journal of clinical investigation 125,2161-2170.

23.Shimizu,T.,Smits,R.,and Ikenaka,K.(2016).Microglia-induced activation of non-canonical Wnt signaling aggravates neurodegeneration in demyelinating disorders.Molecular and cellular biology 36:2728–2741.

24.Sugo,T.,Tachimoto,H.,Chikatsu,T.,Murakami,Y.,Kikukawa,Y.,Sato,S.,Kikuchi,K.,Nagi,T.,Harada,M.,Ogi,K.,et al.(2006).Identification of a lysophosphatidylserine receptor on mast cells.Biochemical and biophysical research communications 341,1078-1087.

25.Sun,X.,Wang,X.,Chen,T.,Li,T.,Cao,K.,Lu,A.,Chen,Y.,Sun,D.,Luo,J.,Fan,J.,et al.(2010).Myelin activates FAK/Akt/NF-kappaB pathways and provokes CR3-dependent inflammatory response in murine system.PloS one 5,e9380.

26.Vega-Riquer,J.M.,Mendez-Victoriano,G.,Morales-Luckie,R.A.,and Gonzalez-Perez,O.(2019).Five Decades of Cuprizone,an Updated Model to Replicate Demyelinating Diseases.Current neuropharmacology 17,129-141.

27.Wang,X.,Cao,K.,Sun,X.,Chen,Y.,Duan,Z.,Sun,L.,Guo,L.,Bai,P.,Sun,D.,Fan,J.,et al.(2015).Macrophages in spinal cord injury:phenotypic and functional change from exposure to myelin debris.Glia 63,635-651.

28.Werneburg,S.,Jung,J.,Kunjamma,R.B.,Ha,S.-K.,Luciano,N.J.,Willis,C.M.,Gao,G.,Biscola,N.P.,Havton,L.A.,Crocker,S.J.,et al.(2020).Targeted Complement Inhibition at Synapses Prevents Microglial Synaptic Engulfment and Synapse Loss in Demyelinating Disease.Immunity 52,167-182.e167.

29.Williams,K.,Ulvestad,E.,Waage,A.,Antel,J.P.,and McLaurin,J.(1994).Activation of adult human derived microglia by myelin phagocytosis in vitro.Journal of neuroscience research 38,433-443.

30.Wolf,Y.,Shemer,A.,Levy-Efrati,L.,Gross,M.,Kim,J.S.,Engel,A.,David,E.,Chappell-Maor,L.,Grozovski,J.,Rotkopf,R.,et al.(2018).Microglial MHC class II is dispensable for experimental autoimmune encephalomyelitis and cuprizone-induced demyelination.European journal of immunology 48,1308-1318.

31.Xu,L.,Zhang,C.,Jiang,N.,He,D.,Bai,Y.,and Xin,Y.(2018).Rapamycin combined with MCC950 to treat multiple sclerosis in experimental autoimmune encephalomyelitis.Journal of cellular biochemistry，120(4)：5160-5168.

32.Zhou,T.,Zheng,Y.,Sun,L.,Badea,S.R.,Jin,Y.,Liu,Y.,Rolfe,A.J.,Sun,H.,Wang,X.,Cheng,Z.,et al.(2019).Microvascular endothelial cells engulf myelin debris and promote macrophage recruitment and fibrosis after neural injury.Nature neuroscience 22,421-435.

Claims

1. Use of a substance that reduces the expression level of the Gpr34 gene and/or a functional inhibitor and/or antagonist of the Gpr34 protein for the manufacture of a medicament for the treatment of a demyelinating-related disease selected from the group consisting of multiple sclerosis, ischemic stroke, alzheimer's disease, amyotrophic lateral sclerosis.

2. Use according to claim 1, wherein the functional inhibitor and/or antagonist of GPR34 protein is a GPR34 antibody or a small molecule inhibitor and/or antagonist of GPR 34.

3. Use according to claim 2, wherein the small molecule inhibitor and/or antagonist of GPR34 is T602, and wherein the structural formula of T602 is as follows:

4. the use of claim 1, wherein the agent that reduces the expression level of the Gpr34 gene comprises a small interfering RNA that promotes degradation of the Gpr34 messenger RNA.

5. The use of claim 4, wherein the small interfering RNA is an RNAi or siRNA fragment targeting the Gpr34 gene, or a CRISPR gRNA that promotes degradation of the Gpr34 messenger RNA.