CN115177726A

CN115177726A - Application of GPR34 and inhibitor thereof in preparation of drugs for treating demyelination-related diseases

Info

Publication number: CN115177726A
Application number: CN202110355421.6A
Authority: CN
Inventors: 周荣斌; 江维; 林柏龙
Original assignee: University of Science and Technology of China USTC
Current assignee: University of Science and Technology of China USTC
Priority date: 2021-04-01
Filing date: 2021-04-01
Publication date: 2022-10-14
Anticipated expiration: 2041-04-01
Also published as: WO2022206767A1; CN115177726B

Abstract

The invention relates to a GPR34 and application of an inhibitor thereof in preparing a medicament for treating demyelination-related diseases. A series of in vivo experiments show that GPR34 can be used as a new target point for preparing a treatment medicament for demyelination-related diseases, a new scheme for screening and developing the functions of GPR34 is targeted, and the method is effective in treating demyelination-related diseases such as experimental autoreactive encephalomyelitis, cerebral middle arterial reperfusion, and demyelination induced by cyclohexanoyl dihydrazone and the like, but is ineffective in treating peripheral inflammation-mediated diseases such as anxiety central nervous inflammation diseases induced by repeated shock on soles, high fat-induced chronic inflammation-mediated obesity, lipopolysaccharide-induced acute inflammation-mediated sepsis and the like, and has a good application prospect in preparing the treatment medicament for demyelination-related diseases by GPR34 and an inhibitor thereof. The research provides theoretical support for developing and designing drugs taking GPR34 as a target point, and can provide a new strategy for treating demyelination-related diseases.

Description

Application of GPR34 and inhibitor thereof in preparation of drugs for treating demyelination-related diseases

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a GPR34 and application of an inhibitor thereof in preparation of a medicament for treating demyelination-related diseases.

Background

In the course of central nervous system injury, demyelination is accompanied and a variety of neurological disorders occurDemyelination is also observed, such as multiple sclerosis, ischemic stroke, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, epilepsy (Adamo, chen et al, 2020;

and Lassmann,2017; shimizu et al, 2016; werneburg et al, 2020). The connections between neurons are protected by the structure of the peripheral myelin sheath, the integrity of which is critical to the maintenance of neuronal function. Past studies have shown that myelin debris produced during demyelination can induce activation of innate immune cells such as glial cells and macrophages to promote neuroinflammation and the development of demyelination-related diseases (Clarner et al, 2012 sun et al, 2010). In vitro experiments have shown that myelin debris engulfed by microglia, macrophages or endothelial cells induces the production of inflammatory factors such as TNF- α, IL-6, IL-1b (Sun et al, 2010, wang et al, 2015 Williams et al, 1994. In vivo experiments found that myelin debris accumulation from myelin debris injection or brain injury induces microglial activation and inflammatory factor expression (Clarner et al, 2012, poliani et al, 2015, sun et al, 2010. Indeed, the efficiency of myelin debris removal is also important for the recovery of demyelination-related diseases such as multiple sclerosis, ischemic stroke, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, epilepsy, etc. (Doyle and Buckwalter,2020, franklin and Ffrench-Constant,2008 neumann et al, 2009), but it is unclear how myelin debris activates the inflammatory response and promotes the pathological processes of neurological diseases.

Microglia is a central nervous system-specific macrophage with tissue-resident properties, a first line of defense in central nervous system clearance infection or "danger", playing an important role in central nervous system inflammation and homeostatic regulation (Colonna and Butovsky,2017 heneka, 2019. Like peripheral macrophages, excessive activation of microglia induces damage to neurons and oligodendrocytes by direct phagocytosis or secretion of cytokines, which leads to demyelination, thereby exacerbating the progression of demyelination-related diseases such as multiple sclerosis, ischemic stroke, parkinson's disease, alzheimer's disease, spinal cord injury, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, epilepsy, and the like. Myelin contains approximately 80% of lipids, and there are articles reporting that lipids can trigger an innate immune response as a risk-related signal (Gong et al, 2019). Then is it possible for microglia to directly recognize lipids in myelin debris and what are their associated receptors that recognize lipids?

G-protein coupled receptors (GPCRs) are a collective term for a class of seven transmembrane membrane proteins, and many extracellular signal changes can be sensed by GPCRs, resulting in intracellular signal transduction, thereby maintaining homeostasis (Gilman, 1987). GPCR dysfunction is closely related to a number of major diseases in humans, and therefore, many drug designs target GPCRs. Statistically, GPCR-targeted drugs exceed 30% of all FDA-approved clinical drugs in the united states (O' Hayre et al, 2013). Therefore, the search for the G protein-coupled receptor which participates in the regulation of the demyelination-related diseases can provide theoretical support for the effectiveness of the application of the medicament for treating the demyelination-related diseases in the later development and design of the medicament in the diseases.

GPR34 belongs to a G protein-coupled receptor, a downstream-coupled G α i/o protein, which is expressed predominantly in microglia cells (Bedard et al, 2007, butovsky et al, 2014, engemaier et al, 2006), and studies report that its ligand is lysophosphatidylserine LysoPS (Makide and Aoki,2013 sugo et al, 2006), which is produced by hydrolysis of phosphatidylserine by a hydrolase. These work suggest that it is likely that microglial GPR34 may be involved in the pathogenesis of demyelination-related diseases by recognizing lysophosphatidylserine derived from myelin debris. Current basic research on GPR34 has focused primarily on its involvement in inflammatory regulatory processes, e.g., a significant reduction in neutrophil and macrophage numbers in the spleen of GPR 34-deficient mice as compared to wild-type mice following immunization with methylated BSA. In the delayed-type hypersensitivity test, the Gpr 34-deficient mice had a significant increase in foot swelling compared to wild-type mice. After cryptococcus neoformans lung infection, the extra-pulmonary tissue of Gpr 34-deficient mice was more loaded with pathogenic bacteria than wild-type mice. However, there are no reports of the role of GPR34 in demyelination-related diseases.

Experimental Autoreactive Encephalomyelitis (EAE) is an animal model widely used to study multiple sclerosis (constantinesucu et al, 2011 xu et al, 2018), middle cerebral artery reperfusion (MCAO) is an animal model widely used to study ischemic stroke (Joy et al, 2019 liu et al, 2019), and the cyclohexanodihydrazone-induced demyelination model is an animal model widely used to study demyelination and repair of the myelin sheath (Vega-Riquer et al, 2019 wolf et al, 2018.

Disclosure of Invention

In one aspect, the invention provides the use of GPR34 and inhibitors thereof for the manufacture of a medicament for the treatment of demyelination-related diseases.

In another aspect, the invention provides the use of a substance that reduces the level of Gpr34 gene expression and/or an inhibitor and/or antagonist of Gpr34 protein function in the manufacture of a medicament for the treatment of a demyelination-related disease.

Further, the demyelination-related diseases include, but are not limited to: multiple sclerosis, ischemic stroke, transverse myelitis, hilde's disease, neuromyelitis optica, HTLV-I associated myelopathy, guillain Barre syndrome, barlow disease, acute disseminated encephalomyelitis, central pontocerebral myelination, extrapontocerebral myelination, progressive multifocal leukoencephalopathy, post-reversible encephalopathy syndrome, kanawan disease, alexander's disease, lyme disease, heterogeneous leukocyte dystrophy, adrenoneuropathy, globuloleukodystrophy, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, epilepsy.

Further, the demyelination-related disease is selected from the group consisting of multiple sclerosis, ischemic stroke, transverse myelitis, hildergart's disease, neuromyelitis optica, HTLV-I-related myelopathy, guillain barre syndrome, barlow's disease, acute disseminated encephalomyelitis, central pontine myelinolysis, extrapontine myelinolysis, progressive multifocal leukoencephalopathy, post-reversible encephalopathy syndrome, canavan disease, alexander disease, lyme disease, heterogeneous leukodystrophy, adrenal neuropathy, globuloleukodystrophy, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia and epilepsy.

Further, the functional inhibitor and/or antagonist of GPR34 protein is a GPR34 antibody or a small molecule inhibitor and/or antagonist of GPR34, preferably tyrosine, N- [ ((2E) -3- (4 '-chloro [1,1' -biphenyl ] -4-yl) -1-oxo-2-propen-1-yl ] -O- (benzyl) or a structural analogue thereof.

Further, the GPR34 antibodies include chimeric antibodies, monoclonal antibodies, polyclonal antibodies, humanized antibodies, bispecific antibodies, and multispecific antibodies.

Further, the agent that reduces the expression level of the Gpr34 gene includes a small interfering RNA that promotes degradation of Gpr34 messenger RNA.

Further, the small interfering RNA is an RNAi fragment or siRNA fragment targeting the Gpr34 gene, or a CRISPR gRNA that promotes degradation of Gpr34 messenger RNA.

In another aspect, the invention provides a pharmaceutical composition for the treatment of a demyelination-related disease, the pharmaceutical composition comprising as active ingredient a substance that decreases the level of Gpr34 gene expression and/or an inhibitor and/or antagonist of Gpr34 protein function.

In one embodiment, the pharmaceutical composition comprises a pharmaceutically acceptable excipient.

In one embodiment, the functional inhibitor and/or antagonist of GPR34 protein is a GPR34 antibody or a small molecule inhibitor and/or antagonist of GPR34, preferably tyrosine, N- [ ((2E) -3- (4 '-chloro [1,1' -biphenyl ] -4-yl) -1-oxo-2-propen-1-yl ] -O- (benzyl) or a structural analog thereof.

In one embodiment, the agent that reduces the expression level of the Gpr34 gene comprises a small interfering RNA that promotes degradation of Gpr34 messenger RNA.

In one embodiment, the small interfering RNA is an RNAi fragment or siRNA fragment targeting the Gpr34 gene.

In one embodiment, the demyelination-related diseases include, but are not limited to: multiple sclerosis, ischemic stroke, transverse myelitis, hilde's disease, neuromyelitis optica, HTLV-I associated myelopathy, guillain Barre syndrome, barlow disease, acute disseminated encephalomyelitis, central pontocerebral myelination, extrapontocerebral myelination, progressive multifocal leukoencephalopathy, post-reversible encephalopathy syndrome, kanawan disease, alexander's disease, lyme disease, heterogeneous leukocyte dystrophy, adrenoneuropathy, globuloleukodystrophy, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia, epilepsy.

In one embodiment, the demyelination-related disease is selected from the group consisting of multiple sclerosis, ischemic stroke, transverse myelitis, hildergar's disease, neuromyelitis optica, HTLV-I associated myelopathy, guillain barre syndrome, barlow's disease, acute disseminated encephalomyelitis, central pontine myelinolysis, extrapontocerebral myelinolysis, progressive multifocal leukoencephalopathy, post-reversible encephalopathy syndrome, canavan disease, alexander disease, lyme disease, heterogeneous leukodystrophy, adrenal neuropathy, globuloleukodystrophy, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia and epilepsy.

In one embodiment, the pharmaceutical composition may be presented in unit dosage form containing a predetermined amount of active ingredient per unit dose. Preferred unit dosage compositions are those containing a daily dose or sub-dose, or an appropriate fraction thereof, of the active ingredient. Thus, such unit doses may be administered more than once a day. Preferred unit dosage compositions are those containing a daily dose or sub-dose (for more than one administration per day) or an appropriate fraction thereof of an active ingredient as described herein above.

In one embodiment, the pharmaceutical composition may be adapted for administration by any suitable route, for example by the oral, inhalation, parenteral (including subcutaneous, intramuscular, intravenous or intradermal) route.

In one embodiment, the pharmaceutical composition is in a dosage form selected from the group consisting of tablets, capsules, pills, lozenges, powders, syrups, elixirs, suspensions, solutions, emulsions, aerosols.

In one embodiment, the pharmaceutical composition is in a dosage form selected from the group consisting of tablets, capsules, pills, lozenges, powders, syrups, elixirs, suspensions, solutions, emulsions and aerosols.

In one embodiment, the pharmaceutically acceptable excipients include the following types of excipients: diluents, fillers, binders, disintegrants, lubricants, glidants, granulating agents, coating agents, wetting agents, solvents, co-solvents, suspending agents, emulsifiers, sweeteners, flavoring agents, odor masking agents, colorants, anti-caking agents, humectants, chelating agents, plasticizers, viscosity increasing agents, antioxidants, preservatives, stabilizers, surfactants, buffering agents. One skilled in the art will appreciate that certain pharmaceutically acceptable excipients may provide more than one function and may serve alternate functions, depending on how many excipients are present in the formulation and which other excipients are present in the formulation.

In one embodiment, the pharmaceutically acceptable excipient is selected from the group consisting of diluents, fillers, binders, disintegrants, lubricants, glidants, granulating agents, coating agents, wetting agents, solvents, co-solvents, suspending agents, emulsifying agents, sweetening agents, flavoring agents, odor masking agents, colorants, anti-caking agents, humectants, chelating agents, plasticizers, viscosity increasing agents, antioxidants, preservatives, stabilizers, surfactants, and buffers.

In another aspect, the present invention provides a method of treating or lessening the severity of a demyelination-related disease comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition as described above.

In one embodiment, the dosage of the pharmaceutical composition is, for example, 5mg/kg, 6mg/kg, 7mg/kg, 8mg/kg, 9mg/kg, 10mg/kg, 11mg/kg, 12mg/kg, 13mg/kg, 14mg/kg, 15mg/kg, 16mg/kg, 17mg/kg, 18mg/kg, 19mg/kg, 20mg/kg, 21mg/kg, 22mg/kg, 23mg/kg, 24mg/kg, 25mg/kg, 26mg/kg, 27mg/kg, 28mg/kg, 29mg/kg, 30mg/kg or more.

In one embodiment, the dosage of the pharmaceutical composition is, for example, 5-30mg/kg, 6-30mg/kg, 7-30mg/kg, 8-30mg/kg, 9-30mg/kg or more.

In another aspect, the invention provides a method of treating or lessening the severity of a demyelination-related disease comprising knocking out the Gpr34 gene or inhibiting the expression of Gpr34 gene in a subject in need thereof.

Advantageous effects

According to the invention, by determining the effect of GPR34 in experimental self-reactive encephalomyelitis, cerebral middle artery reperfusion and cyclohexanoyl dihydrazone induced demyelination diseases, a treatment thought and a theoretical basis can be provided for demyelination-related diseases, and a molecular target and a preparation thought can be provided for screening and preparing drugs for demyelination-related diseases.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

Fig. 1 is a graph showing the results of example 1 in which wild-type mouse-derived microglia cells were stimulated with wild-type mouse-derived myelin fragments and Gpr 34-deficient mouse-derived microglia cells, respectively, and then the expression of cytokines interleukin 1b (Il 1 b) and interleukin 6 (Il 6) were detected by a real-time fluorescent quantitative PCR instrument.

Fig. 2 is a graph showing the results of measuring the expression level of Gpr34 in microglia, astrocytes, neuronal cells, celiac macrophages, monocytes, and bone marrow-derived macrophages by the real-time fluorescent quantitative PCR instrument in example 2.

Fig. 3 is a graph showing the results of the studies of changes in EAE models in the mice with the specific knockout of microglia in example 3, wherein fig. 3A shows that clinical scores of the mice with the specific knockout of microglia are significantly reduced as compared with the control mice, fig. 3B shows that infiltration of lymphocytes in spinal cord tissues of the mice with the specific knockout of microglia is significantly reduced as compared with the control mice, fig. 3C shows that demyelination in spinal cord tissues of the mice with the specific knockout of microglia is significantly reduced as compared with the control mice, and fig. 3D shows that expression levels of cytokines Il1B and Il6 are significantly reduced in spinal cord tissues of the mice with the specific knockout of microglia as compared with the control mice.

Fig. 4 shows a graph of the results of the study of changes in MCAO model in the microglial-specific knockout Gpr34 mice in example 3, in which fig. 4A shows a significant decrease in clinical score of the microglial-specific knockout Gpr34 mice as compared to the control mice, fig. 4B and 4C show a significant decrease in the infarct zone of the brain tissue in the microglial-specific knockout Gpr34 mice as compared to the control mice, and fig. 4D shows a significant decrease in the expression levels of cytokines Il1B and Il6 in the infarct tissue in the microglial-specific knockout Gpr34 mice as compared to the control mice.

Fig. 5 shows graphs investigating the changes in the cyclohexyoldizone-induced demyelination model in the microglial-specific knockout Gpr34 mouse in example 3, wherein fig. 5A shows that the microglial-specific knockout Gpr34 mouse has reduced demyelination in the cyclohexyoldizone-induced model compared to the control mouse, fig. 5B shows that the myelin basic protein (Mbp), 2',3' -cyclic nucleotide-3 ' -phosphodiesterase (Cnp), myelin lipid protein (Plp) expression levels are significantly reduced in the myelin sheath-associated synthetic genes in the brain corpus callosum tissue in the cyclohexyoldizone-induced model in the microglial-specific knockout Gpr34 mouse compared to the control mouse, and fig. 5C shows that the cytokine Il1B and Il6 expression levels are significantly reduced in the brain corpus callosum tissue in the cyclohexyoldizone-induced model in the microglial-specific knockout Gpr-induced mouse compared to the control mouse.

Fig. 6 is a graph showing the results of investigating the changes in the plantar repetitive shock-induced anxiety model in the microglia-specific knockout Gpr34 mouse of example 4, in which fig. 6A shows that the total moving distance of the microglia-specific knockout Gpr34 mouse in the open field box is not significantly changed compared to the control mouse, fig. 6B shows that the moving distance of the microglia-specific knockout Gpr34 mouse in the central field is not significantly changed compared to the control mouse, fig. 6C shows that the percentage of the moving time of the microglia-specific knockout Gpr34 mouse in the central field is not significantly changed compared to the control mouse, and fig. 6D shows that the number of times the microglia-specific knockout Gpr34 mouse enters the central field is not significantly changed compared to the control mouse.

Fig. 7 is a graph showing the results of example 5 in which changes in food intake of the systemic knockout Gpr34 mouse in a high fat-induced chronic inflammation-mediated obesity model are explored, where fig. 7A shows no significant change in food intake of the systemic knockout Gpr34 mouse compared to a control mouse, fig. 7B shows no significant change in body weight of the systemic knockout Gpr34 mouse compared to a control mouse, fig. 7C shows no change in fasting blood glucose measurement of the systemic knockout Gpr34 mouse compared to a control mouse, fig. 7D shows no significant change in random blood glucose measurement of the systemic knockout Gpr34 mouse compared to a control mouse, fig. 7E shows no significant change in insulin sensitivity measurement of the systemic knockout Gpr34 mouse compared to a control mouse, and fig. 7F shows no significant change in glucose tolerance measurement of the systemic knockout Gpr34 mouse compared to a control mouse.

Fig. 8 is a graph showing the results of example 5 in exploring changes in systemic knockout Gpr34 mice in a lipopolysaccharide-induced acute inflammation-mediated sepsis model.

FIG. 9 shows the structural formula of the GPR34 inhibitor in example 6, abbreviated as T602.

Fig. 10 is a graph showing the results of investigating the effect of GPR34 inhibitor treatment in EAE model in example 6, in which fig. 10A shows a significant decrease in clinical score in the mice of the inhibitor-treated group compared to the control mice, fig. 10B shows a significant decrease in lymphocyte infiltration in spinal cord tissue in the mice of the inhibitor-treated group compared to the control mice, fig. 10C shows a significant decrease in demyelination in spinal cord tissue in the mice of the inhibitor-treated group compared to the control mice, and fig. 10D shows a significant decrease in the expression levels of cytokines Il1B and Il6 in spinal cord tissue in the mice of the inhibitor-treated group compared to the control mice.

Fig. 11 shows a graph of the results of investigating the effect of GPR34 inhibitor treatment in MCAO model in example 6, where fig. 11A shows a significant reduction in clinical score in the inhibitor-treated mice compared to the control mice, fig. 11B, 11C show a significant reduction in brain tissue infarct size in the inhibitor-treated mice compared to the control mice, and fig. 11D shows a significant reduction in the expression levels of cytokines Il1B and Il6 in infarct tissue in the inhibitor-treated mice compared to the control mice.

Statistical analysis of data

As used herein, unless otherwise noted in the figures, statistics are statistically analyzed using GraphPad Prism (software version number 6) using two-tailed unpaired students't-test; * P <0.05, P <0.01, P <0.001, ns: there was no significant difference.

Detailed Description

In order that the objects, technical solutions and advantages of the present invention will become more apparent, the present invention will be further described in detail with reference to the accompanying drawings in conjunction with the following specific embodiments.

The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental procedures in the following examples are all conventional ones unless otherwise specified. The test materials used in the following examples, unless otherwise specified, were all available from conventional biochemical stores.

MOG _35-55 Peptide (Met-Glu-Val-Gly-Trp-Tyr-Arg-Ser-Pro-Phe-Ser-Arg-Val-Val-His-Leu-Tyr-Arg-Asn-Gly-Lys): synthesized by Shanghai Qiaozao Biotechnology, inc.

GPR34 inhibitor: synthesized by Shanghai ceramic Biochemical technology, inc., cat No.: t8848.

Pertussis toxin: list Biological, #181, 181238A1;

inactivating mycobacterium tuberculosis: difico,231141, 9347411.

Freund's incomplete adjuvant: difico,263910, 8008624.

MCAO wire tying: doccol.

High-fat food: jiangsu American Dissen biomedicine, inc., MD1203.

Lipopolysaccharide: invitrogen, LPS-EK Ultrapire.

Glucose: sigma.

Insulin: nova Nordisk.

Experimental animals: wild type C57BL/6J mice were purchased from Shanghai Spiker laboratory animals, inc., gpr34 ^fl/fl Mouse and CX ₃ CR ₁ Cre mice were purchased from seike biotechnology limited. Gpr34 ^fl/fl Mouse and CX ₃ CR ₁ Mating Cre mice to propagate CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl A mouse. Since Gpr34 is specifically and highly expressed in microglia, it is hardly expressed in peripheral mononuclear macrophages, while CX ₃ CR ₁ Is expressed predominantly in monocytes macrophages, so CX is believed to be ₃ CR ₁ -Cre.Gpr34 ^fl ^/fl The mice were microglial-specific deficient Gpr34 mice as described in detail below: gpr34 ^fl/fl The mouse is constructed by inserting a 34bp (ATAACTTCGTATAGCATATTACATACGAAGTTAT) DNA sequence (containing two 13bp inverted repeat sequences and an 8bp core sequence) at each end of the No. 4 exon of the Gpr34 gene, wherein the No. 4 exon of the Gpr34 gene is an expression region of GPR34 protein, the 34bp sequence is a recombinase recognition site and is called loxP site, and the loxP sites inserted at the two ends of the No. 4 exon of the Gpr34 gene are consistent in direction. Cre recombinase is a monomeric protein consisting of 343 amino acids and can initiate DNA recombination at loxP sites. DNA of any sequence, which is located between the loxP sites in the same orientation, is deleted by Cre recombinase. Since Cre recombinase is specifically expressed in monocytes and Gpr34 is highly specifically expressed in microglia and hardly expressed in peripheral monocytes, CX is considered to be expressed in monocytes ₃ CR ₁ -Cre.Gpr34 ^fl/fl The mice were microglial-specific deficient Gpr34 mice. CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Gpr propagated from mice34 ^fl/fl The mice are experimental control mice, CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl The mice are mice with glia cell-specific deletion of Gpr34. The systemic knockout Gpr34 mouse is obtained by a Crispr-Cas9 technology by technicians of animal experiment centers of Life sciences academy of sciences of Chinese science and technology. Systemic knockout of Gpr34 propagated from Gpr34 mice ^+/+ The mice are experimental control mice, gpr34 ^-/- The mice were Gpr34 deficient mice. All experimental animals were housed in an SPF facility.

Example 1 myelin debris stimulation upregulation of cytokines Il1b and Il6 expression in microglia dependent GPR34

1. Microglial cell separation: taking newly born mouse brains of 1-2 days, removing meninges, shearing, digesting for 10 minutes at 37 ℃ by 0.25% pancreatin, adding a serum-containing culture medium to stop the reaction, filtering by using a 40-micron filter screen, transferring to a 15ml centrifuge tube, centrifuging for 10 minutes at 1500rpm, resuspending the precipitate by using serum-containing DMEM, transferring to a suspension culture flask, and replacing the culture medium every 3 days. After 2 weeks, the cells were placed in a shaker, shaken vigorously at 220rpm at 37 ℃ for 1 hour, the supernatant was collected and transferred to a 15ml centrifuge tube, centrifuged at 1500rpm for 10 minutes, and the pellet was collected as microglia.

2. Myelin fragment preparation: in order to avoid contamination, the following experimental procedures were carried out in a clean bench, sucrose solution was prepared with sterile water, treated with ToxinEraser (TM) endotoxin removal kit (Kinsley, cat # L00308), and the prepared sucrose solution was detected with endotoxin detection kit (Kinsley, cat # L00350) to give a lower result than the lowest detection value. The mice were sacrificed by dislocation of the cervical vertebrae, then 10ml of precooled 1x PBS was perfused into the heart, the brain tissue and the spinal cord tissue were peeled off, placed in a disruption tube, added with 1 ml of 0.32M sucrose solution for tissue disruption, then transferred to an ultracentrifuge tube containing 4 ml of 0.32M sucrose solution, blown evenly, sucked 4 ml of 0.85M sucrose solution with a sterile pasteur pipette and slowly added to the bottom of the ultracentrifuge tube, 75,000g,30 minutes, 4 ℃. The intermediate white layer was aspirated with a pasteur pipette and added to an ultracentrifuge tube containing 8ml of sterile water, ice-cooled for 10 minutes, 75,000g,30 minutes, and centrifuged at 4 ℃. The supernatant was discarded, and 8ml of sterile water was added thereto, ice-cooled for 10 minutes, 75,000g,30 minutes, and centrifuged at 4 ℃. The supernatant was discarded, 5ml of 0.32M sucrose solution was added, 4 ml of 0.85M sucrose solution was sucked up with a Pasteur pipette and slowly added to the bottom of an ultracentrifuge tube, 75,000g,15 minutes, and centrifuged at 4 ℃. The middle layer was aspirated, added to an ultracentrifuge tube containing 8ml of 0.32M sucrose solution, and centrifuged at 75,000g for 10 minutes at 4 ℃. The supernatant was discarded, resuspended in 300. Mu.l of sterile water, lyophilized and weighed.

3. Placing the separated microglia into a serum-free DMEM culture medium for overnight culture, removing the culture medium the next day, stimulating the microglia by using myelin sheath fragments with the concentration of 1mg/ml, collecting the cells after 4 hours, and detecting the expression conditions of the cytokines Il1b and Il6 by using a real-time fluorescence quantitative PCR instrument.

Fig. 1 shows that when the wild-type mouse-derived microglia is stimulated by myelin sheath fragments derived from the wild-type mouse, the expression levels of cytokines Il1b and Il6 are up-regulated, but when the microglia lacks Gpr34, the expression levels of cytokines Il1b and Il6 which are up-regulated by myelin sheath fragments are obviously reduced compared with the expression levels of cytokines Il1b and Il6 in the wild-type mouse microglia, wherein the expression level of the cytokine Il1b of the Gpr 34-deleted microglia is about 37% of the expression level of the cytokine Il1b of the wild-type mouse microglia, and the expression level of the cytokine Il6 is about 31% of the expression level of the cytokine Il6 of the wild-type mouse microglia, which indicates that the myelin sheath fragments stimulate the up-regulation of the microglia cytokines Il1b and Il6 depending on Gpr34.

Example 2 Gpr34 specific high expression in microglia

1. Astrocyte isolation: the brain of a mouse born for 1-2 days was removed, the brain membranes were minced, digested at 37 ℃ for 10 minutes in 0.25% pancreatin, then quenched by addition of serum-containing DMEM (Gibco, C11965500 BT) medium, filtered using a 40 micron filter screen and transferred to a 15ml centrifuge tube, centrifuged at 1500rpm for 10 minutes, resuspended in serum-containing DMEM and transferred to a suspension flask, and replaced with fresh DMEM medium every 3 days. After 2 weeks, the cells were placed on a shaker and shaken vigorously at 220rpm,37 ℃ for 1 hour,the supernatant was discarded, and then digested with 0.25% trypsin, the resulting cells were labeled with flow antibodies APC-ACSA1 (Co., miltenyi Biotec, cat # 130-098-803) and FITC-CD11b (Co., eBioscience, cat # 11-0112-82, clone # M1/70), and CD11b was sorted by flow ^- ACSA1 ⁺ The cells are astrocytes.

2. Neuron isolation and culture: coating cell culture plate with polylysine (Co., thermo Fisher Scientific, cat. No. A3890404), separating newborn 1-2 days mouse brain, removing meninges and separating cerebral cortex, digesting cortex with 0.25% pancreatin for 10 min, adding serum-containing DMEM medium to terminate reaction, slightly blowing and filtering through 40 μm filter screen, transferring suspension to 15ml centrifuge tube, centrifuging at 1500rpm for 10 min, precipitating with serum-containing DMEM, and precipitating at 5.0 × 10 ⁶ Cell mass was plated in 6-well plates. After 24 hours, the medium was replaced with a neuron matrix medium (Inc.: thermo Fisher Scientific, cat # 21103049) containing B-27 (Inc.: thermo Fisher Scientific, cat # 17504044), and the neuron matrix medium was replaced every 3 days, and the cells obtained after 2 weeks were neuron cells.

3. Separating abdominal cavity macrophages: mice were sacrificed and the peritoneal cavity was washed with 20ml of pre-cooled 1 × PBS containing 1mM EDTA. The peritoneal lavage fluid was collected and then labeled with flow-through antibodies FITC-CD11b (Co.: eBioscience, cat # 11-0112-82, clone # M1/70) and APC-F4/80 (Co.: eBioscience, cat # 17-4801-82, clone # BM 8) by flow-sorting CD11b ⁺ F4/80 ⁺ The cells are peritoneal macrophages.

4. Monocyte separation: blood from mice was collected into centrifuge tubes containing anticoagulants, and after lysis of erythrocytes, flow antibody FITC-CD11b was labeled: eBioscience, cat #: 11-0112-82, clone number: m1/70) and APC-Ly6C (company: biolegend, cat No.: 128016, clone No.: HK 1.4) by flow sorting of CD11b ⁺ Ly6C ⁺ The cells are monocytes.

5. Bone marrow-derived macrophage isolation: bone marrow was isolated from wild type mice, and after lysing erythrocytes, monocytes were incubated with M-CSF (Novus, cat. No.: NBP1-99791, used at a concentration of 10 ng/ml) in DMEM medium containing 10% fetal bovine serum for 4 days, to differentiate the cells into bone marrow-derived macrophages.

6. Collecting microglia, astrocytes, neuronal cells, peritoneal macrophages, monocytes and bone marrow-derived macrophages, and detecting the expression condition of Gpr34 by using a real-time fluorescent quantitative PCR instrument.

Fig. 2 shows that the real-time fluorescence quantitative PCR apparatus detects the expression level of Gpr34 in microglia, astrocytes, neuronal cells, peritoneal macrophages, monocytes, and bone marrow-derived macrophages, and Gpr34 is specifically highly expressed in microglia.

Example 3 microglial-specific knockout Gpr34 mice have a significant reduction in clinical symptoms in a demyelination-related disease model

A microglial cell-specific knockout Gpr34 mouse has obviously relieved clinical symptoms in an EAE model

1. Day 0, age and sex matched 8 week old Gpr34 was prepared ^fl/fl And CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mouse of which Gpr34 ^fl/fl Control mice derived from the same parent. Dissolving pertussis toxin in physiological saline, dissolving inactivated mycobacterium tuberculosis in Freund's incomplete adjuvant to prepare Freund's complete adjuvant containing 2.5mg/ml inactivated mycobacterium tuberculosis, then dissolving MOG in the prepared Freund's complete adjuvant, and repeatedly blowing and beating into milky liquid by using an injector. Pertussis toxin 150ng was injected intravenously, followed by injection of 150 μ g each of the fully emulsified MOG peptides subcutaneously on both sides of the thigh.

2. On day 2, pertussis toxin was administered again intravenously at 150ng, and the status of the mice was monitored daily for clinical scoring. Score 0, no clinical symptoms; 1 minute, tail weakness; 2 points, tail paralysis and weakness of hind limbs; 3 minutes, paralysis of hind limbs; 4 minutes, paralysis of the front and rear limbs; and 5 points of death.

The results in fig. 3A show that the clinical score of the microglia-specific knockout Gpr34 mice is significantly reduced compared to the wild-type mice in the EAE model, wherein the clinical score of the microglia-specific knockout Gpr34 mice is 0.9 point and the clinical score of the wild-type mice is 2.8 points.

3. Day 0, age and gender matched 8 week old Gpr34 was prepared ^fl/fl And CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mouse of which Gpr34 ^fl/fl Control mice derived from the same parent. Dissolving pertussis toxin in physiological saline, dissolving inactivated mycobacterium tuberculosis in Freund's incomplete adjuvant to prepare Freund's complete adjuvant containing 2.5mg/ml inactivated mycobacterium tuberculosis, then dissolving MOG in the prepared Freund's complete adjuvant, and repeatedly blowing and beating into emulsion liquid by using an injector. Pertussis toxin 150ng was injected intravenously, followed by injection of 150 μ g each of the fully emulsified MOG peptides subcutaneously on both sides of the thigh.

2. On day 2, pertussis toxin was administered again intravenously 150ng.

3. On day 13, mice were sacrificed and then spinal cord tissues were isolated, H & E stained, LFB stained and expression levels of spinal cord tissue cytokines Il1b and Il6 were detected.

3.1H and E staining: spinal cord tissue was paraffin embedded and spinal cord sections of 4 microns thickness were dissected for pathological staining. Placing the slices into an environment-friendly tissue clearing agent for 20 minutes, removing paraffin on the surface of the tissue, namely absolute ethyl alcohol for 20 minutes, 90% ethyl alcohol for 5 minutes, 80% ethyl alcohol for 5 minutes, 70% ethyl alcohol for 5 minutes, washing distilled water for 5 minutes, dyeing hematoxylin for 5 minutes, washing residual hematoxylin on the surface of the tissue by using tap water, then checking whether the tissue is washed clean or not by using a microscope, treating the tissue by using the 80% ethyl alcohol for 2 minutes, dyeing the tissue by using an eosin dye solution for 2 minutes, dyeing the tissue by using the 80% ethyl alcohol for 5 minutes, dyeing the tissue by using 95% ethyl alcohol for 5 minutes, carrying out the absolute ethyl alcohol for 10 minutes, and using the environment-friendly tissue clearing agent for 2 minutes to enhance the dyeing effect, sealing the slices by using neutral gum, and observing the infiltration condition of lymphocytes under an air-dried mirror.

3.2LFB staining: sequentially putting the slices into an environment-friendly tissue clearing agent for 20 minutes, removing paraffin on the surface of the tissue, absolute ethyl alcohol for 20 minutes, 90% ethyl alcohol for 5 minutes, 80% ethyl alcohol for 5 minutes, 70% ethyl alcohol for 5 minutes, distilled water washing for 5 minutes, putting the slices into 0.1% LFB dye solution, incubating overnight at 60 ℃, and washing with tap water; placing the slices into 70% ethanol for 5 minutes, immersing the slices into 0.05% lithium carbonate, controlling the color separation time under a microscope until the color separation is complete (the color of the gray matter part can be seen to be lightened), if the differentiation is not good, alternately performing the two steps for several times until the microscopic examination is satisfied, washing with water, re-dyeing with 0.1% eosin for 20 seconds, washing with water, and using an environment-friendly tissue clearing agent for 2 minutes to enhance the dyeing effect, sealing the slices with neutral gum, and observing the myelin sheath shedding condition under the microscope.

3.3 detecting the expression level of the cell factors Il1b and Il6 of the spinal cord tissues by a real-time fluorescent quantitative PCR instrument.

Fig. 3B shows that in the EAE model, the spinal cord tissue of the mouse with the specific knockout of the microglia, gpr34, had significantly reduced lymphocyte infiltration compared to the wild-type mouse, wherein the number of infiltrating lymphocytes of the mouse with the specific knockout of the microglia, gpr34, was about 30% of the number of infiltrating lymphocytes of the wild-type mouse (shown in the enlarged box area and with the scale bar of 100 μm), indicating that the central nervous system inflammation of the mouse with the specific knockout of the microglia, gpr34, was significantly reduced compared to the control mouse.

The results in fig. 3C show that demyelination in spinal cord tissue is significantly reduced in the glia-specific knockout Gpr34 mice compared to wild-type mice in the EAE model, where demyelination in the glia-specific knockout Gpr34 mice accounts for about 20% of demyelination in wild-type mice (enlarged boxes indicate 100 microns in scale), indicating that clinical symptoms are significantly reduced in the glia-specific knockout Gpr34 mice.

Fig. 3D shows that, in the EAE model, the expression of cytokines Il1b and Il6 in the spinal cord tissue of the Gpr34 mouse specifically knocked out by microglia is significantly reduced compared with that of the wild-type mouse, wherein the expression level of the cytokine Il1b in the spinal cord tissue of the Gpr34 mouse specifically knocked out by microglia accounts for about 21% of that of the cytokine Il1b in the spinal cord tissue of the wild-type mouse, and the expression level of the cytokine Il6 in the spinal cord tissue accounts for about 21% of that of the cytokine Il6 in the spinal cord tissue of the wild-type mouse, indicating that the inflammation of the central nervous system of the Gpr34 mouse specifically knocked out by microglia is significantly reduced compared with that of the control mouse.

The experimental results show that the clinical symptoms of the microglial cell specific knockout Gpr34 mouse are obviously relieved in an EAE model.

Second, the clinical symptoms of the microglial cell-specific knockout Gpr34 mouse in the MCAO model are obviously relieved

1. Preparation of age and gender matched 8 week old Gpr34 ^fl/fl And CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mouse of which Gpr34 ^fl/fl Control mice derived from the same parent. After isoflurane anaesthesia of the mouse, a small incision was made in the left side of the mouse neck and the left external carotid artery and internal carotid artery were isolated. Electrocoagulation of the distal end of the external carotid artery and the upper thyroid artery. A silicone wire plug (head diameter 0.23 mm) was inserted into the internal carotid artery from the external carotid artery, approximately 10mm apart, embolizing the middle cerebral artery. The temperature of the anus of the mouse is maintained at about 37 ℃ by a heating pad during the operation. After 60 minutes of embolization, the wire plug was withdrawn to allow reperfusion of the middle cerebral artery.

2. Clinical scores were performed 12 hours, 24 hours, 48 hours post-surgery: 0: no nerve damage; 1: during tail lifting, the ischemic brain cannot be completely straightened in the adduction of the contralateral forelimb; 2: the phenomenon of rear-end collision occurs during walking; 3: the body is dumped contralaterally to the ischemic brain; 4: without spontaneous or roller-like motion.

3. Mice were sacrificed 48 hours post-surgery and perfused with 1 × PBS via the heart. Removing olfactory bulb and cerebellum from brain, cutting brain into 2 mm thick brain slices, 0.5%2,3, 5-triphenyltetrazolium chloride (TTC for short, sigma-Aldrich, cat # T8877) staining in dark at 37 deg.C for 15 minutes, fixing with 4% paraformaldehyde for 6 hours, taking pictures, and calculating infarction proportion with Image J software.

Fig. 4A shows that the clinical score of the microglia-specific knockout Gpr34 mouse is significantly reduced in the MCAO model compared to the wild-type mouse, wherein the clinical score of the microglia-specific knockout Gpr34 mouse is 1.3 points and the clinical score of the wild-type mouse is 3.5 points.

Fig. 4B and fig. 4C show that, compared with the wild type mouse, the area of the brain infarct region of the microglia-specific knockout Gpr34 mouse is significantly reduced in the MCAO model, where the area of the brain infarct region of the microglia-specific knockout Gpr34 mouse is about 21% on average, and the area of the brain infarct region of the wild type mouse is about 45% on average.

4. Preparation of age and gender matched 8 week old Gpr34 ^fl/fl And CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mouse of which Gpr34 ^fl/fl Control mice derived from the same parent. After isoflurane anaesthesia of the mouse, a small incision was made in the left side of the mouse neck and the left external carotid artery and internal carotid artery were isolated. Electrocoagulation of the distal end of the external carotid artery and the upper thyroid artery. A silicone wire plug (head diameter 0.23 mm) was inserted into the internal carotid artery from the external carotid artery, approximately 10mm apart, embolizing the middle cerebral artery. The temperature of the anus of the mouse is maintained at about 37 ℃ by a heating pad during the operation. After 60 minutes of embolization, the wire plugs were withdrawn to achieve middle cerebral artery reperfusion.

4.1 post-operative 48 hours, mice were sacrificed and perfused with 1 × PBS via the heart. Removing olfactory bulb and cerebellum from brain, separating infarcted semi-brain tissue, and detecting the expression level of infarcted semi-brain tissue cytokines Il1b and Il6 by a real-time fluorescent quantitative PCR instrument.

Fig. 4D shows that, compared to the wild type mouse, the expression levels of cytokines Il1b and Il6 in the half brain tissue of the infarct in the MCAO model of the mouse with glial cell-specific knockout of Gpr34 mice are significantly reduced, wherein the expression level of cytokine Il1b in the half brain tissue of the infarct in the mouse with glial cell-specific knockout of Gpr34 mice accounts for about 25% of the expression level of cytokine Il1b in the half brain tissue of the infarct in the wild type mouse, and the expression level of cytokine Il6 in the half brain tissue of the infarct in the wild type mouse accounts for about 27% of the expression level of cytokine Il6 in the half brain tissue of the infarct in the wild type mouse.

The experimental results show that the clinical symptoms of the microglial cell specific knockout Gpr34 mouse in the MCAO model are obviously relieved.

Third, the clinical symptoms of the microglial cell-specific knockout Gpr34 mouse in the model of the demyelination induced by the cyclohexanehydrazone are obviously relieved

1. Preparation of age and sex matched 8 week old Gpr34 ^fl/fl And CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mouse of which Gpr34 ^fl/fl Control mice derived from the same parent. Is divided into four groups of the components with different sizes,

first group, 8 weeks old Gpr34 ^fl/fl Mice were 6 and given normal diet for 6 weeks.

Second group, 8 week old CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice were 6 and fed with normal diet for 6 weeks.

Third group, 8 weeks old Gpr34 ^fl/fl 6 mice were fed with a diet containing 0.2% cyclohexadihydrazone (Sigma-Aldrich, cat. No. C9012, manufactured and synthesized by Australian cooperative fodder Co., ltd., beijing, family) for 6 weeks.

Fourth group, 8 week old CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl 6 mice were fed with a diet containing 0.2% (i.e. 0.2g cyclohexadihydrazone in 100g diet) cyclohexadihydrazone for 6 weeks.

2. After feeding for 6 weeks, brain tissue of the mice was isolated, paraffin-embedded, and brain sections of 6 μm thickness were cut out for LFB staining, followed by statistics of demyelination. Wherein a first set of data presentations are represented by filled circles, a second set of data presentations are represented by open circles, a third set of data presentations are represented by open squares, and a fourth set of data presentations are represented by filled inverted triangles.

FIG. 5A shows the results of the experiment with 8 weeks old Gpr34 under physiological conditions ^fl/fl And CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl The myelin status of the mice did not change significantly. After 6 weeks of cyclohexadihydrazone induction, gpr34 ^fl/fl Gpr34 in more physiological conditions in mice ^fl/fl The demyelination in mice was markedly severe, indicating the rationality of the cyclohexanone dihydrazone-induced demyelination model. However, 6 weeks after cyclohexadihydrazone induction, CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice had a decreased demyelination compared to Gpr34 ^fl/fl The mice had significantly reduced demyelination, with Gpr34 ^fl/fl Myelin content of mice 50% of myelin content of mice fed normal diet, CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Myelin content in mice accounts for 80% of myelin content in mice fed normal diet. The result shows that the microglial cell specific knockout Gpr34 mouse obviously reduces the demyelination in a cyclohexanoyl dihydrazone induced demyelination model.

3. Preparation of age and gender matched 8 week old Gpr34 ^fl/fl And CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mouse of which Gpr34 ^fl/fl Control mice derived from the same parent. Is divided into four groups of the components with different sizes,

first group, 8 weeks old Gpr34 ^fl/fl Mice were 6 and fed with normal diet for 6 weeks.

Second group, 8 week old CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mice were 6 and given normal diet for 6 weeks.

Third group, 8 weeks old Gpr34 ^fl/fl 6 mice were fed with a diet containing 0.2% cyclohexadihydrazone for 6 weeks.

Fourth group, 8 week old CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl 6 mice were fed with a diet containing 0.2% cyclohexadihydrazone for 6 weeks.

4. After 6 weeks of feeding, the mouse brain callus tissue was isolated and the expression levels of myelin basic protein (Mbp), 2',3' -cyclic nucleotide-3 ' -phosphodiesterase (Cnp), myelin lipid protein (Plp), and cytokines Il1b and Il6, which are myelin-associated synthetic genes, were examined. Wherein a first set of data presentations are represented by filled circles, a second set of data presentations are represented by open circles, a third set of data presentations are represented by open squares, and a fourth set of data presentations are represented by filled inverted triangles.

FIG. 5B shows the results of the experiment showing that Gpr34 is physiologically 8 weeks old ^fl/fl And CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Myelin basic protein (Mbp), 2',3' -cyclic nucleotide-3 ' -phosphodiesterase (Cnp), myelin lipid protein (Plp) expression of myelin-associated synthetic genes in mice were not significantly changed. After 6 weeks of cyclohexoyl dihydrazone induction, gpr34 ^fl/fl The expression of myelin basic protein (Mbp), 2',3' -cyclic nucleotide-3 ' -phosphodiesterase (Cnp) and myelin lipid protein (Plp) of mouse myelin-associated synthetic genes is more physiological than Gpr34 ^fl/fl The mice were significantly reduced, indicating the rationality of the cyclohexanodihydrazone-induced demyelination model. However, 6 weeks after cyclohexadihydrazone induction, CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Myelin-associated synthesis in miceThe expression level of the gene myelin basic protein (Mbp) accounts for 51% of that of the Mbp in mice fed with normal food, but Gpr34 ^fl/fl The expression level of Mbp in mice is only 13% of that in mice fed normal diet. CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl The expression level of myelin sheath related synthetic gene 2',3' -cyclic nucleotide-3 ' -phosphodiesterase (Cnp) in mice accounts for 60% of the Cnp expression level in mice fed with normal food, but Gpr34 ^fl/fl Cnp expression of mice accounts for only 20% of Cnp expression of mice fed with normal food, CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Myelin sheath associated synthetic gene myelin lipoprotein (Plp) expression level of mice accounts for 51% of Plp expression level of mice fed with normal food, but Gpr34 ^fl/fl The expression level of Plp of the mice only accounts for 21% of the expression level of Plp of the mice fed with normal food, and the result shows that the mice with the microglia-specific knockout Gpr34 have less demyelination and less symptoms in the model of the demyelination induced by cyclohexanehydrazone.

FIG. 5C shows the results of the experiment showing that Gpr34 is physiologically 8 weeks old ^fl/fl And CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl The expression level of cytokines Il1b and Il6 in mice did not change significantly. After 6 weeks of cyclohexadihydrazone induction, gpr34 ^fl/fl The expression level of cytokines Il1b and Il6 of the mice is higher than that of Gpr34 under physiological conditions ^fl/fl The mouse is obviously up-regulated, wherein the expression level of the cell factor Il1b is up-regulated by 28 times, and the expression level of the cell factor Il6 is up-regulated by 9 times, which indicates the rationality of the model for inducing demyelination by cyclohexadihydrazone. However, 6 weeks after cyclohexadihydrazone induction, CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl The mouse has the expression level of cytokines Il1b and Il6 which is up-regulated by more than Gpr34 ^fl/fl The up-regulation fold of the expression level of the cytokines Il1b and Il6 of the mice is obviously reduced, wherein CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl The expression level of the cytokine Il1b of the mouse is up-regulated by 12 times, and the expression level of the cytokine Il6 is up-regulated by 4 times. Demonstrating that microglial-specific knockout Gpr34 mice have reduced inflammation in brain tissue in a cyclohexanoyl dihydrazone-induced demyelination model.

The experimental results show that the clinical symptoms of the microglial cell specific knockout Gpr34 mouse in the cyclohexanediazone induced demyelination model are obviously relieved.

Summarizing example 3, the above experimental results show that the clinical symptoms of the microglial cell specific knockout Gpr34 mouse are obviously relieved in demyelination-related disease models such as experimental autoreactive encephalomyelitis, middle cerebral artery reperfusion and cyclohexyl dihydrazone induced demyelination.

Example 4 microglia-derived GPR34 did not play a role in a plantar repetitive shock-induced anxiety model

One, there was no significant change in behavioral characterization of microglia-specific knockout Gpr34 mice compared to control mice in the planta repetitive shock induced anxiety model

1. Preparation of age and sex matched 8 week old Gpr34 ^fl/fl And CX ₃ CR ₁ -Cre.Gpr34 ^fl/fl Mouse of which Gpr34 ^fl/fl Control mice derived from the same parent. Prior to the experiment, the mice were placed in the laboratory for 1 hour acclimation in advance, and then placed individually in a chamber with a grid floor connected to an impact generator. After being placed in the compartment for 2 minutes, the mice were randomly exposed to 0.6mA foot shocks 5 times within 120 seconds, 3 seconds each, for 8 consecutive days. Before and after each experiment, the compartment was cleaned with 75% alcohol to avoid any olfactory induced experimental error.

2. After 8 continuous days of sole electric shock, the mice are transferred from the breeding area to the room of the experimental area to adapt for 1 hour, and then open field experiments are carried out. The mice were placed from one corner in the open field box, allowed to move freely in the open field box, the movement trajectories of the free movement of the mice for 5 minutes were recorded, and the total moving distance of the mice in the open field box, the moving distance in the central field, the percentage of the moving time in the central field, and the number of times of entering the central field were analyzed, and the results are shown in fig. 6. After the experiment of each mouse is finished, the open field box is wiped by 75% alcohol, so that the influence of odor on the mouse is eliminated.

Fig. 6A shows that in the planta repetitive shock induced anxiety model, the total distance traveled by the microglial-specific knockout Gpr34 mice in the open field chamber did not change significantly during the experiment compared to the control mice.

The results of the experiment of fig. 6B show that in the planta repetitive shock induced anxiety model, there was no significant change in the distance traveled by the central field in the microglial-specific knockout Gpr34 mice during the course of the experiment compared to the control mice.

Figure 6C shows that in the planta repetitive shock induced anxiety model, the percentage of time active in the central field was not significantly changed during the experiment in the microglia-specific knockout Gpr34 mice compared to the control mice.

Fig. 6D shows that in the planta repetitive shock induced anxiety model, there was no significant change in the number of times the mice, which were specific for microglia knockout Gpr34, entered the central field during the course of the experiment compared to the control mice.

The above experimental results show that microglia-derived GPR34 does not play a role in a plantar repetitive shock-induced anxiety model.

Example 5 systemic knockout Gpr34 mice have no apparent pathological changes in a model of peripheral acute/chronic induced inflammation

In a high-fat food-induced chronic inflammation-mediated obesity model, the obesity-related index of a systemic knockout Gpr34 mouse is not obviously changed compared with that of a control mouse

1. Preparation of age and sex matched 6 week old Gpr34 ^+/+ And Gpr34 ^-/- Mouse of which Gpr34 ^+/+ Wild type control mice, derived from the same parent, were then fed with high fat diet for 19 weeks and body weight, diet was recorded. After 19 weeks, mice were subjected to fasting blood glucose test, random blood glucose test, insulin sensitivity test, and glucose tolerance test.

2. Insulin sensitivity assay: after fasting for 4 hours, the mice were tested for blood glucose at 0 min, followed by injection of insulin at 0.75U/kg, and blood glucose was tested at 15 min, 30 min, 60 min, 90 min, and 120 min. The blood glucose was measured by tail vein bleeding using the onetouch ultra blood glucose test system kit (from qiangsheng).

3. Glucose tolerance test: after fasting for 14 hours, the mice were measured for blood glucose at 0 minute, followed by injection of 1.5g/kg of glucose, and blood glucose was measured at 15 minutes, 30 minutes, 60 minutes, 90 minutes, and 120 minutes.

Fig. 7A shows that there was no significant change in food intake of systemic knockout Gpr34 mice compared to control mice in a high fat food-induced chronic inflammation-mediated obesity model.

Fig. 7B shows that the body weight of the systemic knockout Gpr34 mice did not change significantly compared to control mice in a high fat diet-induced chronic inflammation-mediated obesity model.

Fig. 7C shows that fasting plasma glucose measurements of systemic knockout Gpr34 mice did not change significantly compared to control mice in a high fat food-induced chronic inflammation-mediated obesity model.

Fig. 7D experimental results show that there was no significant change in random blood glucose measurements in systemic knockout Gpr34 mice compared to control mice in a high fat food-induced chronic inflammation-mediated obesity model.

Fig. 7E experimental results show that there was no significant change in the insulin sensitivity assay of systemic knockout Gpr34 mice compared to control mice in a high fat food-induced chronic inflammation-mediated obesity model.

Fig. 7F experimental results show that there was no significant change in glucose tolerance measurements in systemic knockout Gpr34 mice compared to control mice in a high fat food-induced chronic inflammation-mediated obesity model.

The results of the above experiments indicate that GPR34 is not involved in the high fat diet-induced chronic inflammation-mediated obesity process.

Second, in the lipopolysaccharide-induced acute inflammation-mediated sepsis model, the survival rate of the systemic knockout Gpr34 mice was not significantly changed compared to the control mice

1. Preparation of age and sex matched 8 week old Gpr34 ^+/+ And Gpr34 ^-/- Mouse of which Gpr34 ^+/+ Wild type control mice derived from the same parent were then intraperitoneally injected with 20mg/kg lipopolysaccharide and the survival of the mice was monitored every 12 hours.

Fig. 8 shows that the survival rate of the systemic knockout Gpr34 mice was not significantly changed compared to the control mice in the lipopolysaccharide-induced acute inflammation-mediated sepsis model, indicating that Gpr34 is not involved in the lipopolysaccharide-induced acute inflammation-mediated sepsis process.

Summary example 5, gpr34 is not involved in the hyperlipidemic food-induced chronic inflammation-mediated obesity process and the lipopolysaccharide-induced acute inflammation-mediated sepsis process.

Example 6 gpr34 inhibitors can effectively alleviate the progression of demyelination-related diseases

The structural formula of the GPR34 inhibitor is abbreviated as T602, and is shown in figure 9 (Schoneberg et al, 2018).

T602 molecular formula: c ₃₁ H ₂₆ ClNO ₄ ；

T602 chemical name: tyrosine, N- [ ((2E) -3- (4 '-chloro [1,1' -biphenyl ] -4-yl) -1-oxo-2-propen-1-yl ] -O- (benzyl).

GPR34 inhibitor can effectively relieve the pathogenesis progress of EAE

1. On day 0, 8-week-old wild-type C56BL/6J mice with similar body weight are randomly grouped into two groups of 5 mice each, and the specific grouping treatment is as follows:

a first group: intraperitoneal injection of 1xPBS containing 10% DMSO on

days

0, 2, 4, 6, 8, 10, and 12, i.e. control group.

Second group: the GPR34 inhibitor was intraperitoneally injected on

days

0, 2, 4, 6, 8, 10, and 12 (the injection amount was 10mg/kg, the GPR34 inhibitor was dissolved in 1xPBS containing 10% dmso), i.e., inhibitor-treated group.

Then EAE induction is carried out, pertussis toxin is dissolved in physiological saline, inactivated mycobacterium tuberculosis is dissolved in Freund's incomplete adjuvant to prepare Freund's complete adjuvant containing 2.5mg/ml inactivated mycobacterium tuberculosis, MOG is dissolved in the prepared Freund's complete adjuvant, and the emulsion is repeatedly blown and beaten by a syringe. Pertussis toxin 150ng was injected intravenously, followed by injection of 150 μ g each of the fully emulsified MOG peptides subcutaneously on both sides of the thigh.

2. On day 2, pertussis toxin was administered again intravenously at 150ng, and the status of the mice was monitored daily for clinical scoring. Score 0, no clinical symptoms; 1 minute, tail weakness; 2 minutes, paralysis of the tail and weakness of hind limbs; 3 minutes, hind limb paralysis; 4 minutes, paralysis of the front and rear limbs; and 5 points, dying.

Figure 10A shows that in the EAE model, the clinical symptom score of the inhibitor-treated mice was significantly reduced compared to the control mice, where the clinical score of the inhibitor-treated mice was 1.2 points and the clinical score of the control mice was 3 points, indicating that GPR34 inhibitor was effective in alleviating the progression of EAE.

3. On day 0, 8-week-old wild-type C56BL/6J mice with similar body weight are randomly grouped into two groups of 5 mice each, and the specific grouping treatment is as follows:

a first group: intraperitoneal injection of 1xPBS containing 10% DMSO, i.e., control group, was performed on

days

0, 2, 4, 6, 8, 10, and 12.

Second group: the GPR34 inhibitor was intraperitoneally injected on

days

4. On day 2, pertussis toxin was administered again intravenously 150ng.

5. On day 13, mice were sacrificed and then spinal cord tissues were isolated, H & E stained, LFB stained and expression levels of spinal cord tissue cytokines Il1b and Il6 were detected.

5.1H and E staining: spinal cord tissue was paraffin embedded and spinal cord sections of 4 microns thickness were dissected for pathological staining. Sequentially placing the slices into an environment-friendly tissue clearing agent for 20 minutes, removing paraffin on the surface of the tissue, absolute ethyl alcohol for 20 minutes, 90% ethyl alcohol for 5 minutes, 80% ethyl alcohol for 5 minutes, 70% ethyl alcohol for 5 minutes, distilled water washing for 5 minutes, hematoxylin dyeing for 5 minutes, tap water microscopic blue returning for 10 minutes, 80% ethyl alcohol treating for 2 minutes, eosin dyeing liquid dyeing for 2 minutes, 80% ethyl alcohol for 5 minutes, 95% ethyl alcohol for 5 minutes, absolute ethyl alcohol for 10 minutes, and an environment-friendly tissue clearing agent for 2 minutes to enhance the dyeing effect, sealing the slices with neutral gum, and airing the observation of lymphocyte infiltration under a microscope.

5.2LFB staining: placing the slices into an environment-friendly tissue clearing agent for 20 minutes in sequence, removing paraffin on the surface of the tissues, absolute ethyl alcohol for 20 minutes, 90% ethyl alcohol for 5 minutes, 80% ethyl alcohol for 5 minutes, 70% ethyl alcohol for 5 minutes, distilled water for 5 minutes, placing the slices into 0.1% LFB dye liquor for incubation overnight at 60 ℃, washing with tap water, placing the slices into 70% ethyl alcohol for 5 minutes, soaking the slices into 0.05% lithium carbonate, controlling color separation time under a mirror until color separation is complete (color of gray matter part can be seen to be light), and if differentiation is not good, alternately performing the two steps for several times until the mirror examination is satisfactory, washing with water, re-dyeing with 0.1% eosin for 20 seconds, washing with water, using the environment-friendly tissue clearing agent for 2 minutes, sealing with neutral gum, and observing myelin sheath falling under the mirror.

5.3 detecting the expression level of the cell factors Il1b and Il6 of the spinal cord tissues by a real-time fluorescent quantitative PCR instrument.

Fig. 10B shows that in the EAE model, the number of infiltrating lymphocytes in the spinal cord tissue of the inhibitor-treated mice was significantly reduced compared to the control mice, wherein the number of infiltrating lymphocytes in the inhibitor-treated mice was about 20% of the number of infiltrating lymphocytes in the control mice (shown in the enlarged box area, and the scale bar of the image is 100 μm), indicating that the inflammation of the central nervous system of the inhibitor-treated mice was significantly reduced compared to the control mice.

Fig. 10C shows that demyelination in spinal cord tissue was significantly reduced in the EAE model compared to control mice, where demyelination in the inhibitor-treated mice accounted for approximately 30% of the demyelination in the control mice (shown in enlarged boxes at a 100 μm scale), indicating that clinical symptoms were significantly reduced in the inhibitor-treated mice.

Fig. 10D shows that, in the EAE model, the expression of cytokines Il1b and Il6 in the spinal cord tissue of the mice in the inhibitor-treated group was significantly reduced compared to the mice in the control group, wherein the expression level of cytokine Il1b in the spinal cord tissue of the mice in the inhibitor-treated group was about 25% of the expression level of Il1b in the spinal cord tissue of the mice in the control group, and the expression level of cytokine Il6 in the spinal cord tissue of the mice in the inhibitor-treated group was about 19% of the expression level of Il6 in the spinal cord tissue of the mice in the control group, indicating that the inflammation of the central nervous system of the mice in the inhibitor-treated group was significantly reduced compared to the control mice.

The experimental results show that the GPR34 inhibitor can effectively relieve the disease course of EAE.

The GPR34 inhibitor can effectively relieve the attack progress of MCAO

1. Wild type C56BL/6J mice with similar weights at 8 weeks are randomly grouped into two groups, each group comprises 5 mice, and the specific grouping treatment is as follows:

a first group: intraperitoneal injection of 1XPBS containing 10% DMSO was performed 12 hours, 0 hours before MCAO induction, and 12 hours after MCAO induction, i.e., control group.

Second group: the GPR34 inhibitor (injection amount 10mg/kg, GPR34 inhibitor dissolved in 1xPBS containing 10% dmso) was intraperitoneally injected 12 hours, 0 hours before MCAO induction, and 12 hours after MCAO induction, i.e., inhibitor treatment group.

MCAO induction was performed, and after the mice were anesthetized with isoflurane, a small incision was made in the left side of the neck of the mice, and the left external carotid artery and internal carotid artery were isolated. Electrocoagulation of the distal end of the external carotid artery and the upper thyroid artery. A silicone wire plug (head diameter 0.23 mm) was inserted into the internal carotid artery from the external carotid artery, approximately 10mm apart, embolizing the middle cerebral artery. The anal temperature of the mice was maintained at about 37 ℃ with a heating pad during the surgery. After 60 minutes of embolization, the wire plugs were withdrawn to achieve middle cerebral artery reperfusion.

3. After 48 hours of operation, sacrifice mice, perfuse 1 × PBS through heart, take brain and remove olfactory bulb and cerebellum, cut brain into 2 mm thick brain slice, 0.5% TTC 37 deg.C dark staining for 15 minutes, 4% paraformaldehyde fixed 6 hours after photographing, use Image J software to calculate infarct ratio.

The results of the experiment in FIG. 11A show that the clinical score of the mice in the inhibitor-treated group was significantly reduced in the MCAO model compared to the mice in the control group, which was 1.4 points and 3.8 points, respectively.

Fig. 11B and 11C show that the area of the brain infarct area of the inhibitor-treated mice in the MCAO model is significantly reduced compared to the control mice, wherein the area of the brain infarct area of the inhibitor-treated mice is about 17% on average, and the area of the brain infarct area of the control mice is about 45% on average.

4. Wild type C56BL/6J mice with similar body weights at 8 weeks are randomly grouped into two groups, each group comprises 5 mice, and the specific grouping treatment is as follows:

a first group: 1xPBS containing 10% DMSO was intraperitoneally injected 12 hours, 0 hours before MCAO induction, and 12 hours after MCAO induction, i.e., control group.

MCAO induction was performed, and after mice were anesthetized with isoflurane, a small opening was cut in the left side of the neck of the mice, and the left external carotid artery and the internal carotid artery of the mice were isolated. Electrocoagulation of the distal end of the external carotid artery and the upper thyroid artery. A silicone wire plug (head diameter 0.23 mm) was inserted into the internal carotid artery from the external carotid artery, the distance of the insertion of the wire plug was about 10mm, and the middle cerebral artery was embolized. The temperature of the anus of the mouse is maintained at about 37 ℃ by a heating pad during the operation. After 60 minutes of embolization, the wire plugs were withdrawn to achieve middle cerebral artery reperfusion.

5. After 48 hours of operation, mice are sacrificed, brains are taken to remove olfactory bulbs and cerebellum after being perfused with 1XPBS (phosphate buffered saline) through hearts, infarct semi-brain tissues are separated, and the expression levels of cell factors Il1b and Il6 of the infarct semi-brain tissues are detected by a real-time fluorescence quantitative PCR (polymerase chain reaction) instrument.

Fig. 11D shows that compared with the control group mice, the expression levels of cytokines Il1b and Il6 in the infarcted hemibrain tissue of the inhibitor-treated mice were significantly reduced in the MCAO model, wherein the expression level of cytokine Il1b in the infarcted hemibrain tissue of the inhibitor-treated mice was about 32% of the expression level of Il1b in the infarcted hemibrain tissue of the control group mice, and the expression level of cytokine Il6 in the infarcted hemibrain tissue of the inhibitor-treated mice was about 25% of the expression level of Il6 in the infarcted hemibrain tissue of the control group mice.

The experiments show that the GPR34 inhibitor can effectively relieve the attack progress of MCAO.

Summary example 6, gpr34 inhibitors are effective in alleviating the progression of demyelination-related diseases such as EAE and MCAO.

The experiments further prove that a medicine taking GPR34 as a target point can be developed and designed, and a new strategy is provided for treating demyelination-related diseases.

The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the methods and compositions of the present invention as set forth herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention.

While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.

Reference to the literature

1.Schoneberg,T.,Meister,J.,Knierim,A.B.,and Schulz,A.(2018).The G protein-coupled receptor GPR34-The past 20years of a grownup.Pharmacology&therapeutics 189,71-88.

2.Adamo,A.M.(2014).Nutritional factors and aging in demyelinating diseases.Genes&nutrition 9,360.

3.Bedard,A.,Tremblay,P.,Chernomoretz,A.,and Vallieres,L.(2007).Identification of genes preferentially expressed by microglia and upregulated during cuprizone-induced inflammation.Glia 55,777-789.

4.Butovsky,O.,Jedrychowski,M.P.,Moore,C.S.,Cialic,R.,Lanser,A.J.,Gabriely,G.,Koeglsperger,T.,Dake,B.,Wu,P.M.,Doykan,C.E.,et al.(2014).Identification of a unique TGF-beta-dependent molecular and functional signature in microglia.Nature neuroscience 17,131-143.

5.Chen,D.,Huang,Y.,Shi,Z.,Li,J.,Zhang,Y.,Wang,K.,Smith,A.D.,Gong,Y.,and Gao,Y.(2020).Demyelinating processes in aging and stroke in the central nervous system and the prospect of treatment strategy.CNS neuroscience&therapeutics 26,1219-1229.

6.Clarner,T.,Diederichs,F.,Berger,K.,Denecke,B.,Gan,L.,van der Valk,P.,Beyer,C.,Amor,S.,and Kipp,M.(2012).Myelin debris regulates inflammatory responses in an experimental demyelination animal model and multiple sclerosis lesions.Glia 60,1468-1480.

7.Colonna,M.,and Butovsky,O.(2017).Microglia Function in the Central Nervous System During Health and Neurodegeneration.Annual review of immunology 35,441-468.

8.Constantinescu,C.S.,Farooqi,N.,O'Brien,K.,and Gran,B.(2011).Experimental autoimmune encephalomyelitis(EAE)as a model for multiple sclerosis(MS).British journal of pharmacology 164,1079-1106.

9.Doyle,K.P.,and Buckwalter,M.S.(2020).Immunological mechanisms in poststroke dementia.Curr Opin Neurol 33,30-36.

10.Engemaier,E.,Rompler,H.,Schoneberg,T.,and Schulz,A.(2006).Genomic and supragenomic structure of the nucleotide-like G-protein-coupled receptor GPR34.Genomics 87,254-264.

11.Franklin,R.J.,and Ffrench-Constant,C.(2008).Remyelination in the CNS:from biology to therapy.Nature reviews Neuroscience 9,839-855.

12.Gilman,A.G.(1987).G proteins:transducers of receptor-generated signals.Annual review of biochemistry 56,615-649.

13.Gong,T.,Liu,L.,Jiang,W.,and Zhou,R.(2020).DAMP-sensing receptors in sterile inflammation and inflammatory diseases.Nature reviews Immunology，95-112.

14.Heneka,M.T.(2019).Microglia take centre stage in neurodegenerative disease.Nature reviews Immunology 19,79-80.

15.

R.,and Lassmann,H.(2017).Inflammatory demyelinating diseases of the central nervous system.Handbook of clinical neurology 145,263-283.

16.Joy,M.T.,Ben Assayag,E.,Shabashov-Stone,D.,Liraz-Zaltsman,S.,Mazzitelli,J.,Arenas,M.,Abduljawad,N.,Kliper,E.,Korczyn,A.D.,Thareja,N.S.,et al.(2019).CCR5 Is a Therapeutic Target for Recovery after Stroke and Traumatic Brain Injury.Cell 176,1143-1157.e1113.

17.Kierdorf,K.,Masuda,T.,

M.J.C.,and Prinz,M.(2019).Macrophages at CNS interfaces:ontogeny and function in health and disease.Nature reviews Neuroscience 20,547-562.

18.Liu,Q.,Johnson,E.M.,Lam,R.K.,Wang,Q.,Bo Ye,H.,Wilson,E.N.,Minhas,P.S.,Liu,L.,Swarovski,M.S.,Tran,S.,et al.(2019).Peripheral TREM1 responses to brain and intestinal immunogens amplify stroke severity.Nature immunology 20,1023-1034.

19.Makide,K.,and Aoki,J.(2013).GPR34 as a lysophosphatidylserine receptor.Journal of biochemistry 153,327-329.

20.Neumann,H.,Kotter,M.R.,and Franklin,R.J.(2009).Debris clearance by microglia:an essential link between degeneration and regeneration.Brain:a journal of neurology 132,288-295.

21.O'Hayre,M.,Vázquez-Prado,J.,Kufareva,I.,Stawiski,E.W.,Handel,T.M.,Seshagiri,S.,and Gutkind,J.S.(2013).The emerging mutational landscape of G proteins and G-protein-coupled receptors in cancer.Nature reviews Cancer13,412-424.

22.Poliani,P.L.,Wang,Y.,Fontana,E.,Robinette,M.L.,Yamanishi,Y.,Gilfillan,S.,and Colonna,M.(2015).TREM2 sustains microglial expansion during aging and response to demyelination.The Journal of clinical investigation 125,2161-2170.

23.Shimizu,T.,Smits,R.,and Ikenaka,K.(2016).Microglia-induced activation of non-canonical Wnt signaling aggravates neurodegeneration in demyelinating disorders.Molecular and cellular biology 36:2728–2741.

24.Sugo,T.,Tachimoto,H.,Chikatsu,T.,Murakami,Y.,Kikukawa,Y.,Sato,S.,Kikuchi,K.,Nagi,T.,Harada,M.,Ogi,K.,et al.(2006).Identification of a lysophosphatidylserine receptor on mast cells.Biochemical and biophysical research communications 341,1078-1087.

25.Sun,X.,Wang,X.,Chen,T.,Li,T.,Cao,K.,Lu,A.,Chen,Y.,Sun,D.,Luo,J.,Fan,J.,et al.(2010).Myelin activates FAK/Akt/NF-kappaB pathways and provokes CR3-dependent inflammatory response in murine system.PloS one 5,e9380.

26.Vega-Riquer,J.M.,Mendez-Victoriano,G.,Morales-Luckie,R.A.,and Gonzalez-Perez,O.(2019).Five Decades of Cuprizone,an Updated Model to Replicate Demyelinating Diseases.Current neuropharmacology 17,129-141.

27.Wang,X.,Cao,K.,Sun,X.,Chen,Y.,Duan,Z.,Sun,L.,Guo,L.,Bai,P.,Sun,D.,Fan,J.,et al.(2015).Macrophages in spinal cord injury:phenotypic and functional change from exposure to myelin debris.Glia 63,635-651.

28.Werneburg,S.,Jung,J.,Kunjamma,R.B.,Ha,S.-K.,Luciano,N.J.,Willis,C.M.,Gao,G.,Biscola,N.P.,Havton,L.A.,Crocker,S.J.,et al.(2020).Targeted Complement Inhibition at Synapses Prevents Microglial Synaptic Engulfment and Synapse Loss in Demyelinating Disease.Immunity 52,167-182.e167.

29.Williams,K.,Ulvestad,E.,Waage,A.,Antel,J.P.,and McLaurin,J.(1994).Activation of adult human derived microglia by myelin phagocytosis in vitro.Journal of neuroscience research 38,433-443.

30.Wolf,Y.,Shemer,A.,Levy-Efrati,L.,Gross,M.,Kim,J.S.,Engel,A.,David,E.,Chappell-Maor,L.,Grozovski,J.,Rotkopf,R.,et al.(2018).Microglial MHC class II is dispensable for experimental autoimmune encephalomyelitis and cuprizone-induced demyelination.European journal of immunology 48,1308-1318.

31.Xu,L.,Zhang,C.,Jiang,N.,He,D.,Bai,Y.,and Xin,Y.(2018).Rapamycin combined with MCC950 to treat multiple sclerosis in experimental autoimmune encephalomyelitis.Journal of cellular biochemistry，120(4)：5160-5168.

32.Zhou,T.,Zheng,Y.,Sun,L.,Badea,S.R.,Jin,Y.,Liu,Y.,Rolfe,A.J.,Sun,H.,Wang,X.,Cheng,Z.,et al.(2019).Microvascular endothelial cells engulf myelin debris and promote macrophage recruitment and fibrosis after neural injury.Nature neuroscience 22,421-435.

Claims

1. Use of a substance that decreases the expression level of Gpr34 gene and/or an inhibitor and/or antagonist of Gpr34 protein function in the preparation of a medicament for the treatment of a demyelination-related disease.

2. The use according to claim 1, said demyelination-related disease being selected from the group consisting of multiple sclerosis, ischemic stroke, transverse myelitis, hildergard's disease, neuromyelitis optica, HTLV-I-related myelopathy, guillain barre syndrome, barlow's disease, acute disseminated encephalomyelitis, central pontine myelinolysis, extrapontine myelinolysis, progressive multifocal leukoencephalopathy, post-reversible encephalopathy syndrome, canavan disease, alexander disease, lyme disease, heterogeneous leukodystrophy, adrenal neuropathy, globuloleukodystrophy, parkinson's disease, alzheimer's disease, spinal cord injury disease, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia and epilepsy.

3. The use according to claim 1 or 2, wherein the inhibitor and/or antagonist of GPR34 protein function is a GPR34 antibody or a small molecule inhibitor and/or antagonist of GPR34, preferably tyrosine, N- [ ((2E) -3- (4 '-chloro [1,1' -biphenyl ] -4-yl) -1-oxo-2-propen-1-yl ] -O- (benzyl) or a structural analogue thereof.

4. The use of claim 1 or 2, wherein the agent that reduces the expression level of the Gpr34 gene comprises a small interfering RNA that promotes degradation of Gpr34 messenger RNA.

5. The use of claim 4, the small interfering RNA is an RNAi fragment or siRNA fragment targeting the Gpr34 gene, or a CRISPR gRNA that promotes degradation of Gpr34 messenger RNA.

6. A pharmaceutical composition for the treatment of a demyelination-related disease comprising an active ingredient which is a substance that decreases the expression level of the Gpr34 gene and/or a functional inhibitor and/or antagonist of Gpr34 protein, and a pharmaceutically acceptable excipient.

7. The pharmaceutical composition according to claim 6, wherein the inhibitor and/or antagonist of the function of GPR34 protein is a GPR34 antibody or a small molecule inhibitor and/or antagonist of GPR34, preferably tyrosine, N- [ ((2E) -3- (4 '-chloro [1,1' -biphenyl ] -4-yl) -1-oxo-2-propen-1-yl ] -O- (phenylmethyl) or a structural analogue thereof.

8. The pharmaceutical composition of claim 6, wherein the agent that reduces the expression level of the Gpr34 gene comprises a small interfering RNA that promotes degradation of the Gpr34 messenger RNA.

9. The pharmaceutical composition of claim 8, wherein the small interfering RNA is an RNAi fragment or siRNA fragment targeting the Gpr34 gene.

10. The pharmaceutical composition of claim 6, wherein the demyelination-related disease is selected from the group consisting of multiple sclerosis, ischemic stroke, transverse myelitis, hildebrand disease, neuromyelitis optica, HTLV-I associated myelopathy, guillain Barre syndrome, barlow's disease, acute disseminated encephalomyelitis, central pontine myelination, extrapontine myelination, progressive multifocal leukoencephalopathy, post-reversible encephalopathy syndrome, kanakawain's disease, alexandria disease, lyme disease, heterogeneous leukodystrophy, adrenoneuropathy, globuloleukodystrophy, parkinson's disease, alzheimer's disease, spinal cord injury, traumatic brain injury, amyotrophic lateral sclerosis, frontotemporal dementia, schizophrenia and epilepsy.