CN115161323A - Aptamer for specifically recognizing DEHP and application thereof - Google Patents

Abstract

The invention discloses a nucleic acid aptamer for specifically recognizing DEHP and application thereof, belonging to the technical field of environmental safety biology. The aptamer is any one of the following: (1) The single-stranded DNA sequence is a nucleotide sequence shown as SEQ ID No. 10; (2) The nucleotide sequence shown as SEQ ID No.10 is taken as a core sequence, and the sequence is extended or shortened at two sides or a single side and has the same function as the nucleotide sequence in the (1). The method is based on the Capture-SELEX technology, and the DEHP aptamer SEQ ID No.10 which can be combined with high affinity and high specificity is finally obtained through 10 rounds of repeated screening. The aptamer is applied to the DEHP detection of practical samples, and has important application prospect on the analysis and detection of DEHP in blood samples, cell samples, food and drinking water.

Description

Nucleic acid aptamer for specifically recognizing DEHP and application thereof

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a nucleic acid aptamer for specifically recognizing DEHP and application thereof.

Background

Di (2-ethylhexyl) phthalate (DEHP) is currently the most widely used plasticizer for Phthalates (PAEs) for the production of plastics containing flexible polyvinyl chloride (PVC) with annual yields of about 100 to 400 million tons. The DEHP molecules are linked to the plastic polymer by pure physical bonds rather than chemical bonds, and DEHP is more likely to migrate into the environment during repeated use, heating or cleaning of plastic products and to be absorbed into the body through air, food, water and skin, thus endangering human health. There is increasing evidence that DEHP is considered an endocrine disruptor, and prolonged exposure to DEHP can affect normal development in humans and even induce hormone-related cancers, reproductive problems and metabolic disorders.

DEHP is currently listed by the ministry of ecological environment of the people's republic of china as an environment-preferred pollutant. However, the DEHP leach concentration limit remains at 3mg/kg, according to the hazardous waste leach toxicity identification standard as specified in the national standards of the people's republic of china (GB 5085.3-2007), which may already affect human health. At present, the detection method mainly used for DEHP in plastics comprises a chromatography method and an immunization method. The chromatography includes High Performance Liquid Chromatography (HPLC), gas chromatography-mass spectrometry (GC-MS), high performance liquid chromatography-mass spectrometry (HPLC-MS), etc. However, such chromatography requires cumbersome pretreatment of the sample when detecting DEHP. For example, when detecting DEHP by gas chromatography-mass spectrometry (GC-MS), vortex-assisted liquid-liquid microextraction is required on a sample, but the detection limit of DEHP by such chromatography is only 9x10 ^-6 mu.g/L. Although chromatography exhibits high selectivity and sensitivity, it is expensive, requires pre-complicated pre-treatment of the sample, is time consuming and highly limited in detection, and requires a stable laboratory environment, which severely limits their usefulness to large scaleApplication in scale DEHP assay. However, the immunoassay method is mainly an enzyme-linked immunosorbent assay (ELISA). However, the ELISA kit is very expensive, and the kinds of enzyme-labeled antibodies are limited, and the operation steps are complicated. In order to overcome the limitations of the above detection methods, researchers have also attempted to detect DEHP by electrochemical, surface Enhanced Raman Scattering (SERS), and other methods. For example, developers have developed a DEHP electrochemical sensor based on β -cyclodextrin (β -CD) that uses the β -cyclodextrin cavity as a host to capture polar molecules of appropriate size. The detection limit of the electrochemical sensor is 4.69 multiplied by 10 ² pg/mL. Furthermore, DEHP can also be detected in water samples by electrochemical impedance spectroscopy, which principle consists in recording the change in impedance of the material under test when exposed to different concentrations of DEHP. While impedance sensors have been developed that are easy to install in an industrial environment, they still require the use of high frequency (100 kHz) circuitry and impedance analyzers. In summary, the conventional detection methods have failed to meet the urgent detection requirements, and therefore, a rapid and convenient detection method is urgently needed to be developed.

Aptamers are single-stranded DNA (ssDNA) or RNA selected from DNA or RNA libraries using the Exponential Enrichment of Ligands by expression Evolution, SELEX. Aptamers can fold into unique three-dimensional conformations and then bind to cognate targets with high specificity and high affinity by van der waals forces, hydrogen bonding, electrostatic interactions, and the dissociation constant of binding can reach the nmol/L or even pmol/L scale. Furthermore, aptamers, also known as "chemical antibodies", are a new type of molecular recognition technology relative to the traditional "antibody-antigen" model. Compared with antibody, the aptamer has small molecular weight and is easier to penetrate cell membrane and tumor tissue. Meanwhile, the aptamer also has the characteristics of thermal stability, lower immunogenicity, wide target molecule range and the like, and can be quickly obtained in vitro. It has been found that aptamer sequences can be further shortened, retaining functional and binding properties, making them less costly. Meanwhile, the aptamer can be labeled with biotin, a fluorescent dye, carboxyl, amino and other groups to be endowed with new functions. At present, the aptamer has wide application in the fields of environmental detection, disease diagnosis, imaging, targeted therapy and the like. In conclusion, the nucleic acid aptamer is expected to replace antigen-antibody reaction and enzyme-linked immunosorbent assay, and becomes a powerful tool for detecting various chemical substances, molecules or cells.

Disclosure of Invention

An object of the present invention is to provide a nucleic acid aptamer capable of specifically recognizing DEHP and use thereof, which addresses the above-mentioned problems of the prior art. The invention utilizes SELEX technology to screen and characterize single-stranded DNA aptamer sequence capable of combining with DEHP specificity and high affinity. The nucleotide sequence of the aptamer for specifically detecting DEHP is as follows: TTCCGGGCATACGTATCGAATGTTGTAGCCGTGGCTGC (shown in SEQ ID No. 10). The single-stranded DNA aptamer can effectively, compatibly and specifically recognize DEHP.

The second object of the present invention is to provide the application of the aptamer in the separation, enrichment, detection or analysis of DEHP.

The invention also provides the application of the aptamer in preparing products for separating, enriching, detecting or analyzing DEHP.

The fourth object of the invention is to provide a product for detecting DEHP.

The fifth objective of the invention is to provide a method for detecting DEHP.

The purpose of the invention can be realized by the following technical scheme:

a nucleic acid aptamer capable of specifically recognizing DEHP, the nucleic acid aptamer being any one of the following:

(1) The single-stranded DNA sequence is a nucleotide sequence shown as SEQ ID No. 10;

SEQ ID No.10：TTCCGGGCATACGTATCGAATGTTGTGAGCCGTGGGCTGC；

(2) The nucleotide sequence shown as SEQ ID No.10 is taken as a core sequence, and the sequence is extended or shortened at two sides or a single side and has the same function as the nucleotide sequence in the (1).

The aptamer has high affinity and high specificity with DEHP.

As a preferred embodiment, the 5 'end or 3' end of the nucleotide sequence of the aptamer is modified with a functional group or molecule.

Further preferably, the functional group is at least one of a fluorescent group, an amino group, a carboxyl group, a thiol group, biotin, avidin, an electrochemical label and an enzyme label.

The application of the aptamer in the separation, enrichment, detection or analysis of DEHP.

The nucleic acid aptamer is applied to preparation of products for separating, enriching, detecting or analyzing DEHP, and the products are kits, test paper or chips.

A product for detecting DEHP, which contains the aptamer, is a kit, test paper or chip.

The method for detecting DEHP adopts the nucleic acid aptamer or the product to detect DEHP in environment, food, tools, in-vitro samples or biological materials.

The screening method of the aptamer for detecting DEHP comprises the following steps:

(1) ssDNA library design: designing and artificially synthesizing a random single-stranded oligonucleotide library, wherein the front end and the rear end of the random single-stranded oligonucleotide library respectively have 20nt fixed sequences, including restriction enzyme sites, primer binding sites, RNA promoter binding sites and the like, and the middle random sequence has 40 nt. The capacity of the ssDNA library needs to be up to 10 ¹⁴ To ensure that there are aptamers in the library that potentially bind to the target molecule.

(2) Immobilization of ssDNA library: the primer region was labeled with biotin by counting the complementary strand P3 (5 'TCAAGAGAGGTAGACGC-3') complementary to the random ssDNA library primer region. The ssDNA library is then immobilized on magnetic beads by specific binding of avidin to biotin.

(3) And (3) incubation: adding DEHP solution into the magnetic beads of the immobilized ssDNA library, and incubating, so that the ssDNA bound with DEHP is dissociated from the magnetic beads to form DEHP/ssDNA complexes.

(4) PCR amplification, enzyme digestion and purification: and adding a target, incubating, performing magnetic separation, performing PCR amplification by using ssDNA in the supernatant as a template, and performing agarose gel electrophoresis identification, recovery and purification.

(5) Preparation of ssDNA enrichment libraries.

(6) Clone sequencing and sequence analysis.

(7) Affinity and specificity experiments.

Wherein, the PCR reaction conditions are as follows: denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 1min for 30 cycles, and denaturation extension at 72 ℃ for 10min. In ssDNA enrichment library, the present invention increases the screening pressure by reducing the library concentration, shortening the incubation time, and adding a backsize to obtain a nucleic acid aptamer sequence that specifically binds DEHP.

The invention has the beneficial effects that:

the invention utilizes the Capture-SELEX technology to screen out the aptamer DEHP-Apt which is specifically combined with DEHP for the first time, and the sequence of the aptamer DEHP-Apt is shown as SEQ ID No.10. The SEQ ID No.10 is proved to be capable of identifying and binding DEHP with high affinity and high specificity. In addition, the secondary structure of the aptamer of SEQ ID No.10 of the present invention that specifically binds to DEHP has a loop and stem structure with a Gibbs free energy of-9.9 Kcal/mol. Meanwhile, the dissociation constant Kd of the aptamer SEQ ID No.10 to DEHP is: 0.16 + -0.08 μ M. The nucleic acid aptamer SEQ ID No.10 can be marked by groups such as biotin, fluorescent dye, carboxyl, amino and the like to be endowed with new functions, and has wide clinical application and basic application prospect in the fields of environmental detection, disease diagnosis, imaging, targeted therapy and the like.

Drawings

FIG. 1 shows the recovery efficiency of each round of the aptamer screening process.

FIG. 2 is an agarose gel electrophoresis of the products after each round of screening and purification.

FIG. 3 sequence evolutionary tree analysis of aptamers.

Figure 4 predicted DEHP candidate aptamer secondary Structure by rna Structure software.

Figure 5 dehp candidate aptamer sequencing chromatograms.

FIG. 6 shows the optimization of the adsorption conditions of the aptamer and graphene oxide.

FIG. 7 fluorometric determination of dissociation constant K of candidate aptamer sequences _d The value is obtained.

FIG. 8. The specificity of candidate aptamers was verified by fluorescence.

FIG. 9 is a diagram showing the binding mechanism of the aptamer seq.10 to DEHP.

Detailed Description

The following examples are intended to facilitate a better understanding of the invention, but are not intended to limit the invention thereto. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from conventional biochemicals, unless otherwise specified.

Example 1 screening of nucleic acid aptamers enriched for specific binding to DEHP based on SELEX technology

(1) Design and pretreatment of ssDNA libraries

A random single-stranded oligonucleotide library (ssDNA library) is designed and artificially synthesized, and the fixed sequences of 20nt at the front end and the rear end respectively comprise restriction enzyme sites, primer binding sites, RNA promoter binding sites and the like, and the random sequence of 40nt in the middle. The capacity of the ssDNA library needs to be up to 10 ¹⁴ To ensure that there are aptamers in the library that potentially bind to the target molecule.

The sequence of the random single-stranded oligonucleotide library was: 5'-ATAGGAGTCACGACGACCAG-N-TATGTGCGTCTACCTCTTGA-3', wherein N is a 40nt random base sequence.

A complementary strand P3 (5. Random ssDNA libraries were aligned with the designed biotin-labeled complementary short-chain Bio-P3 at 1:1.5 in binding buffer (50 mM Tris-HCl,5mM KCl,100mM NaCl,1mM MgCl) ₂ pH 7.4), denaturing at 95 ℃ for 10min, and incubating at 37 ℃ at 230rpm with shaking for 3h. After the complementary hybridization was completed, the ssDNA concentration in the solution was measured by a microanalyzer.

(2) ssDNA library fixation

And (3) incubating the ssDNA library which is complementary with the short chain with the magnetic beads for 6h at 37 ℃ and 300rpm, wherein the ssDNA is immobilized on the magnetic beads due to the specific binding effect of avidin and biotin. In order to remove unbound ssDNA and ensure the stability and specificity of ssDNA binding, the beads were washed 3 times with binding buffer and the supernatant was separated under the action of an applied magnetic field. The ssDNA concentration in the supernatant was determined to check for library fixation, and the supernatant was then discarded.

(3) Positive sieve incubation

Adding 1ml of DEHP solution with the concentration of 0.1mmol/L and magnetic beads immobilized with ssDNA (1 nmol) libraries, oscillating and incubating for 2h at 37 ℃ and 300rpm, competing with complementary short chains to bind ssDNA, leaving ssDNA which is not or weakly bound with a target on the magnetic beads, and shedding the ssDNA bound with the target into a supernatant; the free DEHP can compete and dissociate the aptamer from the magnetic beads, the aptamer is specifically combined with the DEHP to form a DEHP/ssDNA complex, the DEHP/ssDNA complex is retained in the supernatant, then the magnetic beads are removed by using magnetic separation, and the collected supernatant is used as a template for PCR amplification.

(4) PCR amplification

After incubation, the supernatant was collected under the action of an applied magnetic field as a template for PCR amplification. The total PCR amplification system (50. Mu.L) was: ssDNA 10ng (volume determined by ssDNA concentration), forward primer f1 (5 'ATAGGAGTCCACGACCAG-3') 2 μ L; phosphorylated reverse primer r1 (5 'TCAAGAGAGGTAGACGCACATA-3') 2. Mu.L, 10 XPCR buffer 5. Mu.L, mg ²⁺ 3 μ L, dNTP 4 μ L, taq Plus DNA polymerase 1 μ L, add ddH ₂ O to 50. Mu.L. The PCR reaction conditions are as follows: denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 1min for 30 cycles, and denaturation extension at 72 ℃ for 10min.

(5) Digestion and purification of the PCR product

ssDNA was prepared using Lambda exonuclease. mu.L of Lambda exonuclease and 1/10 volume of 10 × Lambda Exo Buffer were added to the PCR product, and after 30min of cleavage at 37 ℃ the PCR product was denatured and inactivated at 75 ℃ for 10min. Then, 1/10 volume of 3M sodium acetate solution and 2 volumes of absolute ethanol were added to the enzyme-cleaved product, and the mixture was allowed to stand in a refrigerator at-20 ℃ for 12 hours. After the standing is finished, placing the solutionCentrifuging at 14000rpm for 15min at 4 deg.C in a low temperature high speed centrifuge, discarding the supernatant, adding 200 μ L70% ethanol solution, resuspending, centrifuging under the same conditions for 15min, and discarding the supernatant. Then, the EP tube was placed at room temperature to completely volatilize ethanol, and 10-20. Mu.L of ddH was added ₂ And O, measuring the ssDNA concentration by using a trace nucleic acid tester, and calculating the recovery rate. And (4) storing the secondary library subjected to enzyme digestion and purification in a refrigerator at the temperature of-20 ℃.

(6) Circular screening

From round 2, the screening incubation system was changed to 300. Mu.L, and in order to obtain higher affinity aptamers, the screening pressure was increased, the amount of ssDNA used was decreased, the target concentration was decreased, and the incubation time was shortened. From round 5 onwards, a reverse screen was required to eliminate interference by the target analogue. Adding DBP (dibutyl phthalate) as a reverse screening target, placing on a shaking table at 300rpm, oscillating and incubating at 37 ℃ for 2h, removing a supernatant containing ssDNA specifically bound with the reverse screening target, washing magnetic beads for 3 times by using a binding buffer solution, adding a positive screening target, incubating, and performing positive screening under the condition completely the same as the reverse screening. After each incubation combination, ssDNA concentration in the supernatant is collected and measured, so as to facilitate the subsequent establishment of a PCR amplification system. Specific screening conditions are shown in table 1.

TABLE 1 Capture-SELEX screening conditions

(7) Calculation of recovery

The ssDNA was recovered by ethanol precipitation in each round, the concentration of ssDNA (ng/. Mu.L) was measured using a nucleic acid protein analyzer, and the recovery was calculated by calculating the ratio of the recovered ssDNA to the input ssDNA. After several rounds of screening, ssDNA which can not be combined with DEHP or has weak combining ability is continuously removed, ssDNA which has high affinity with DEHP is gradually enriched, the recovery rate is continuously increased, and the screening process is ended when the recovery rate is stable. The purpose of this improvement mode using positive and negative sieve alternation is to suppress nonspecific physical adsorption of low affinity DNA caused by electrostatic action of magnetic beads themselves, and to reduce cross-reaction of aptamers to other DEHP analogs (DBP (dibutyl phthalate), DNOP (di-n-octyl phthalate), DEP (diethyl phthalate)). The amount of DNA affinity binding increases with increasing progress of the screen. As shown in FIG. 1, the elution rate of DNA in the 8 th round of elution is close to saturation, and the elution rate of DNA continues to the 10 th round, and the DNA elution rate still does not show obvious increasing trend, so that the tenth round of PCR product is determined to be sent to sequencing, and the work of the screening stage is completed.

(8) Validation of products from each round of screening

Verifying PCR amplification products by using 2.5% agarose gel electrophoresis, carrying out agarose gel electrophoresis on the enzyme digestion purification products in the 1-10 screening processes, and obtaining the products shown in figure 2, wherein the bands of the screened products are all 80bp, have correct sizes and obvious bands, and the screened products in the final round can be used for subsequent connection transformation.

Example 2 DEHP aptamer cloning, sequencing and structural analysis

(1) DEHP aptamer cloning sequencing

The eluent from the tenth screening round is selected to carry out symmetric PCR amplification by using a downstream primer (5-. The main operation steps are as follows:

a. the ssDNA pooled in the last round of selection was amplified by PCR, PCR amplified with the upstream primer f1 (5;

b. and (3) loading the whole amount of the PCR amplification product to 2.5% agarose gel for agarose gel electrophoresis, and recovering the PCR product by adopting a gel recovery kit.

c. The purified PCR product was ligated to the vector according to the T vector instructions, transformed into E.coli competent cells, and cultured overnight.

d. The correct transformants were verified by colony PCR and agarose gel, and 50 positive clones were picked and sent to tokenidae bio-corporation of tokenidae for sequence determination.

Then, DNAMAN software is used for analyzing the sequences, wherein 38 nucleic acid aptamer sequences are selected from the non-monoclonal sequences and the error sequences after being removed for further detailed analysis, 25 sequences are obtained in total and named as seq.1-seq.25, and the sequence results are shown in Table 2.

TABLE 2 tenth round aptamer sequences

(2) Preliminary characterization of candidate aptamers

According to the RNA structure software, the secondary structure of the aptamer is predicted and the value of the delta G is calculated, wherein the smaller the delta G is, the more stable the secondary structure formed by the DEHP-ssDNA is. Then, the results of the evolutionary tree analysis of these sequences are shown in fig. 3, and according to the results of the homology analysis of the evolutionary tree, non-homologous sequences among them are selected to perform affinity and specificity analysis tests, and finally 6 sequences are determined, which are seq.10, seq.13, seq.14, seq.18, seq.19 and seq.22 respectively. The 6 representative aptamer median random sequences and the number of repeats are shown in Table 3. Meanwhile, fig. 4 and 5 show the secondary structure diagram and the sequencing chromatogram of the 6 aptamer sequences, respectively.

TABLE 3 candidate aptamer sequences

Example 3 aptamer affinity and specificity assays

(1) Optimization of adsorption conditions of aptamer and graphene oxide

The fluorescence quenching of the Graphene Oxide (GO) solution to the aptamer is different under different concentrations, as shown in fig. 6, when the amount of the aptamer is fixed, the fluorescence quenching efficiency effect of GO to the aptamer is more obvious with the increase of the concentration of the GO solution. When the mass ratio of GO to the aptamer reaches 100:1, GO is saturated in adsorbing the aptamer, fluorescence is basically quenched, and the effect is good. Thus, the mass ratio of GO to aptamer in subsequent affinity assays remained at 100:1.

(2) Fluorometric determination of dissociation constant K of candidate aptamer sequences _d Value of

6 aptamer sequences with stable secondary structures modified by fluorescent group 6-carboxyfluorescein (FAM) are subjected to FAM labeling, and affinity analysis tests are carried out to verify the affinity of the sequences with DEHP. The specific experimental steps are that firstly, the FAM marked aptamer is pre-denatured for 10min at 95 ℃, ice-bathed for 10min, and placed for 10min at room temperature. The treated FAM-labeled aptamer was added to DEHP (0, 0.4, 1.2, 1.6, 4, 12. Mu.M) solutions of various concentrations, and incubated at 37 ℃ for 1.5h with shaking in the dark. After the reaction is finished, according to the mass ratio of GO to the aptamer of 100:1, adding a certain amount of GO, and incubating for 30min under the same conditions. After the incubation, the solution was centrifuged at 14000rpm for 15min, the supernatant was collected, and the fluorescence intensity values (emission wavelength 520nm, excitation wavelength 494 nm) of each group were measured using a microplate reader. And finally, performing nonlinear fitting on the fluorescence value corresponding to the DEHP concentration by adopting GraphPad-Prism8 software, and analyzing and calculating to obtain the dissociation constant K of each aptamer _d The value is obtained. K of these 6 aptamer sequences _d Values were between 0.1-1.0. Mu.M, indicating that the aptamers we screened were of higher affinity for DEHP. Wherein K of SEQ ID No.10 and SEQ ID No.19 _d The values are relatively low, indicating a strong affinity for the target DEHP. The affinity of these sequences for binding their target, DEHP, is derived primarily from the fact that the aptamer surface has many sites for binding targets, and that they form a unique complex three-dimensional conformation through intermolecular interactions. In addition, the dissociation constant curves of 6 aptamers are shown in FIG. 7, and the fluorescence intensity also becomes stable at a DEHP concentration of 4. Mu.M, and the binding reaction is saturated.

(3) Verification of candidate aptamer specificity by fluorescence method

In determining the structural analysis and dissociation constant (K) of aptamers _d ) After the value, we need further verification of the specificity of the aptamer. Because the aptamer obtained by SELEX screening needs to have high affinity and sensitivity with a target and better specific recognition capability. Thus, the 6 aptamers obtained above were subjected to specificity evaluation. The specific operation is as follows: first, 500. Mu.L of ddH was added to each of the 6 FAM-labeled aptamers described above at the same concentration (500 ng/mL) ₂ O, then pre-denatured at 95 ℃ for 10min, ice-bathed for 10min, and left at room temperature for 10min. Then, 1.2. Mu.M of DEHP, DBP (dibutyl phthalate), DNOP (di-n-octyl phthalate) and DEP (diethyl phthalate) were added to the above-mentioned reaction solutions, and incubated at 37 ℃ for 1.5 hours with shaking in the dark. Subsequently, 50 μ L GO was added and incubated under the same conditions for 30min. The mixture was centrifuged at high speed (14000 rpm) for 15min. The supernatant was collected, and the fluorescence intensity values (emission wavelength 520nm, excitation wavelength 494 nm) of each group were measured using a microplate reader. DEHP aptamers react competitively with graphene oxide mixtures with DBP, DNOP and DEP, respectively. Finally, with the GO solution with DEHP added as a background value, it can be seen that the larger the fluorescence value, the stronger the binding capacity with the aptamer. As shown in FIG. 8, DEHP binds most strongly to SEQ ID No.10, another DEHP structural analogue, DBP, shows a slight binding to SEQ ID No.10, while DNOP and DEP are negligible. Finally, it was concluded that SEQ ID No.10 is the best aptamer.

(4) Molecular docking analysis of Seq-10 with DEHP

The molecular docking analysis of the aptamer SEQ ID No.10 obtained above and DEHP is carried out, and the specific operations are as follows: the primary structure of the sequence of SEQ ID No.10 was analyzed by DNAMAN and SnapGene. The secondary Structure of the aptamers was simulated and analyzed by RNA Structure software. The 3D rna-2.0 software was then used to mimic the tertiary structure of the aptamer SEQ ID No.10, saved as a pdb file, and the 3D structure of DEHP was obtained from the Pubchem Project website, saved in pdb format. Then, molecular docking is carried out between the aptamer SEQ ID No.10 and DEHP by using molecular docking software Auto Dock Tools 1.5.6, and then, the result of the molecular docking is analyzed by PyMoL1.7.6 software, and the docking result is exported to be a stick model schematic diagram. The docking results are shown in FIG. 9, which speculates the passage between the aptamer and the targetNon-covalent interactions bind, and targets enter the active site of the aptamer through hydrophobic forces, van der waals forces, hydrogen bonding, and the like. In addition, the results show that the oxygen atom of the ligand is capable of forming a hydrogen bond with the oxygen atom of T-10 on DNA, the hydrogen bond being as long as

The formation of hydrogen bonds enhances the ability of the ligand to target DNA. The results of the molecular docking of SEQ ID No.10 and DEHP show that active sites A-9, T-10 and G-18 of the aptamer interact with DEHP, and the analysis of the sites can provide technical support for subsequent application.

Sequence listing

<110> university of Chinese pharmacy

<120> nucleic acid aptamer for specifically recognizing DEHP and application thereof

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tcacgtagag aaaggggacg tgggggagct gtgcggtcgg 40

<210> 2

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggcccacaga tagtagaacc acggcgggcg aatgggggcg 40

<210> 3

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccggcgccaa gaccccctcg tgtcgacata ccgtgcgtgc 40

<210> 4

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cccgcgaggg ctccgtcagg gctgccagga cgtgctgccg 40

<210> 5

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccccggcagg cggtggagcc caggctgacg tagcgagttg 40

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cggcccgcta ccttccggag ggtttactag tgcgccgcgg 40

<210> 7

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcaacgacct gagcgccaac acggttaatg gatatgccgc 40

<210> 8

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gagcgggggg agacacccgc acccgaactt gattcggatg 40

<210> 9

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctcgacaggg gtaatcggga tggaaaggat cgtggtggcg 40

<210> 10

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ttccgggcat acgtatcgaa tgttgtgagc cgtgggctgc 40

<210> 11

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gggcggaatg gatacggtgg atgtgacgcg aggctagaga 40

<210> 12

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggcgcagagg aactcaggca cgccttcgga ccgcagcctg 40

<210> 13

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gcgtctgcgt gcgccgaagg cacaggcctc gggcagagac 40

<210> 14

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cgcccaacag gacagacgtc agtgtttcgt caggcggccc 40

<210> 15

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gggggcggga gatgacgtat agtggcgacg cggcgtgggc 40

<210> 16

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cggggtgtgc gtgagtgatc tccccctgcg ccgccgagcc 40

<210> 17

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gcacgaaggg aggtgatttg gcaggatggt cgcgggcgtg 40

<210> 18

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gggtgatcgc ctggggtccc gggacgcccg tagcggtctg 40

<210> 19

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gccagcgttc ggggaatcgc cgctggtgtg tggtgcgggc 40

<210> 20

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gccggcggac gggcgctcaa acaggaggtg aagtggcgac 40

<210> 21

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gcccgcaacg gaccagacct caccctcgaa cggggggatg 40

<210> 22

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

gcaatgtcac gggagcggat ggtgaaatcg gcgtgggctc 40

<210> 23

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cgggacgatc gggtcgagtg gcacatcggg cgttgtggtg 40

<210> 24

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ccagcaacac ggtccacatc ttgtaagggc gggcgggctg 40

<210> 25

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

cgggggggac cacagaggat gatcgggcgc tggcggtggg 40

<210> 26

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

tcaagaggta gacgc 15

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

ataggagtca cgacgaccag 20

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

tcaagaggta gacgcacata 20

Claims (7)

1. An aptamer specifically recognizing DEHP, which is characterized in that the aptamer is any one of the following:

(1) The single-stranded DNA sequence is a nucleotide sequence shown as SEQ ID No. 10;

(2) The nucleotide sequence shown as SEQ ID No.10 is taken as a core sequence, is a sequence which is extended or shortened at two sides or a single side and has the same function as the nucleotide sequence in the (1).

2. The aptamer according to claim 1, wherein the 5 'end or the 3' end of the nucleotide sequence of the aptamer is modified with a functional group or molecule.

3. The aptamer according to claim 2, wherein the functional group is at least one of a fluorophore, an amino group, a carboxyl group, a thiol group, biotin, avidin, an electrochemical label, and an enzyme label.

4. Use of the aptamer according to any of claims 1 to 3 for the isolation, enrichment, detection or analysis of DEHP.

5. Use of the nucleic acid aptamer of any one of claims 1 to 3 in the preparation of a product for isolating, enriching, detecting or analyzing DEHP, said product being a kit, strip or chip.

6. A product for detecting DEHP, comprising the aptamer of any one of claims 1 to 3, wherein the product is a kit, strip or chip.

7. A method for detecting DEHP, characterized in that DEHP is detected on an environment, a food product, a tool, an ex vivo sample or a material of biological origin using an aptamer according to any one of claims 1 to 3, or a product according to claim 6.

Images