CN115161313A - Method for efficiently separating cell mitochondrial genome with high purity - Google Patents

Abstract

The invention belongs to the technical field of DNA extraction, and particularly discloses a method for efficiently separating a cell mitochondrial genome with high purity, which comprises the following steps: pretreating the cell culture by using a cell pretreatment reagent, and collecting cells; cracking the pretreated cells by using a cell mild lysis solution; centrifuging the cracked solution, separating supernatant, and purifying to obtain cell mitochondrial genome; the cell mild lysis solution comprises 0.1-15% of NP-40, 0.001-0.1 mol/L of tris (hydroxymethyl) aminomethane hydrochloride, 0.001-0.2 mol/L of ethylenediamine tetraacetic acid, 0.1-1 mol/L of sodium acetate, 0.1-0.5 mol/L of potassium acetate and 0.001-0.1 mol/L of sodium citrate. The method can efficiently obtain the high-purity mitochondrial genome DNA from a small amount of cultured cells, and has the advantages of short time consumption, low equipment requirement, simple operation and good repeatability.

Description

Method for efficiently separating cell mitochondrial genome with high purity

Technical Field

The invention belongs to the technical field of DNA extraction, and particularly relates to a method for efficiently separating a cell mitochondrial genome with high purity.

Background

Human Mitochondrial DNA (Mitochondrial DNA, mtDNA) is a maternally inherited circular double-stranded DNA consisting of approximately 16569bp, encoding 37 genes, 22 transfer RNAs and 2 ribosomal RNAs, which is an independent source of second large genomic information in cells except the nucleus. The mutation rate of the mitochondrial genome is significantly higher than that of nuclear genomic DNA (ncDNA), and at the same time, mitochondria are inherited as a maternal line, which gives mtDNA a unique advantage in individual recognition specificity. Mitochondria is one of ideal materials for developing human population genetic research, provides unique information for researching human origin, migration, evolution and ethnic relation, and constructs modern genetic archaeology together with nuclear genome analysis. In court science, mitochondrial genome information has unique application value for non-nuclear examination materials (hair and nails), high-degradation samples (high rotting and white ossified corpses), some cases (sister relationship identification) needing to identify maternal genetic relationship and the like, and plays an important role in population property analysis, ethnicity analysis, genetic relationship analysis and the like. Meanwhile, mitochondria also participate in the processes of cell differentiation, cell cycle, signal transduction, apoptosis and the like, and mitochondrial dysfunction has close relation with the occurrence of neurodegenerative diseases (Parkinson's disease and Alzheimer's disease), deafness, diabetes, aging, tumors and the like. Therefore, mitochondrial genome analysis has important value in a plurality of fields such as genetic disease screening, human genetics, forensic science, archaeology and the like.

The current acquisition of mitochondrial genome information relies mainly on high throughput sequencing technologies and bioinformatics analysis. However, the presence of a large number of Nuclear genomic Mitochondrial Sequences (NUMTs) in the Nuclear genome increases the complexity of Mitochondrial assembly. NUMTs are sequence fragments that are widely present on the nuclear genome that are highly similar to mitochondrial genome genes, and hundreds to thousands of NUMTs are present on the human nuclear genome, accounting for 0.87% of the length of the human nuclear genome. Simply taking total DNA as a template, obtaining a DNA sequence by a high-throughput sequencing technology, and then carrying out mitochondrial genome sequence mining and splicing, wherein the obtained mitochondrial genome information has the possibility of nuclear genome pollution to a certain extent, and the accuracy and reliability of the sequence have uncertainty.

Current methods to obtain finer mitochondrial genomes are primarily by differential centrifugation or density gradient centrifugation. According to the difference of sedimentation coefficients of cell nucleus and mitochondria, the cell nucleus and mitochondria can be conveniently purified in large quantity from different animal tissues, plants or yeast by sequentially passing through differential centrifugation and density gradient centrifugation. However, the differential centrifugation or density gradient centrifugation method is adopted for carrying out the mitochondrial separation, so that the sample is large in demand and high in loss. For rare samples, such as ancient bones, teeth, forensic materials, clinical puncture samples and the like, the sample amount is small, and the aim of homogenizing and then carrying out multi-step centrifugation operation cannot be achieved. Meanwhile, for a large number of tissue samples, complex pretreatment and multi-step separation and purification are also needed, large-scale equipment such as an ultracentrifuge is needed, the operation is complex, the equipment requirement is high, and the time is long. Secondly, there are some reports in the literature that copies of mitochondrial DNA in samples are obtained by means of specific probe hybridization enrichment, long PCR amplification enrichment, and the like, and mitochondrial genome information is obtained by sequencing. However, these methods can only design specific probes or primers for known mitochondrial sequences, and cannot detect unknown mitochondrial sequences. In addition, mutation is introduced by adopting mitochondrial genome specific probe hybridization enrichment and long PCR amplification for enriching mitochondrial genome information, so that the fidelity of the mitochondrial genome information is difficult to ensure, and huge technical risks are brought to the work of fine genetic information tracking and the like. Meanwhile, expensive high-fidelity DNA polymerase is needed for carrying out sequence hybridization enrichment and long PCR amplification, the technical repeatability is poor, and the result among batches is unstable. Therefore, an efficient and high-purity mitochondrial genome separation method is urgently needed for the objective demand of high-precision genetic analysis of mitochondria, provides the most basic and reliable research materials for subsequent mitochondria-related research development, and ensures that mitochondrial genome and nuclear genome information cannot interfere with each other and pollute each other from the source.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a method for separating a cell mitochondrial genome with high efficiency and high purity, and aims to solve the problems of complex pretreatment, complex operation, high equipment requirement, poor fidelity, poor repeatability and the like of the conventional method for separating the mitochondrial genome.

In order to achieve the above object, the present invention provides a method for separating a mitochondrial genome of a cell with high efficiency and high purity, comprising the steps of:

s1, pretreating a cell culture by using a cell pretreatment reagent to remove extracellular impurity DNA, and collecting cells;

s2, cracking the pretreated cells by using a cell gentle lysis solution;

s3, centrifuging the cracked solution, separating supernatant, and purifying to obtain a cell mitochondrial genome;

wherein the cell gentle lysis solution comprises 0.1-15% (v/v) NP-40, 0.001-0.1 mol/L tris (hydroxymethyl) aminomethane hydrochloride, 0.001-0.2 mol/L ethylene diamine tetraacetic acid, 0.1-1 mol/L sodium acetate, 0.1-0.5 mol/L potassium acetate and 0.001-0.1 mol/L sodium citrate.

Preferably, in step S1, the cell pretreatment reagent comprises 0.001mol/L to 0.01mol/L of ethylenediamine tetraacetic acid and 0.01mol/L to 0.1mol/L of tris (hydroxymethyl) aminomethane hydrochloride.

Preferably, step S1 specifically includes: will contain 1X 10 ² ～1×10 ⁵ The cell diameterCentrifuging the cell culture at 1000-2000 rpm for 5-10 min, and discarding the supernatant; then, carrying out suspension rinsing by using normal saline or PBS buffer solution, centrifuging for 5-10 min at 1000-2000 rpm again, and discarding the supernatant; then the cell pretreatment reagent is used for suspension rinsing, standing is carried out for 5min to 10min, centrifugation is carried out for 5min to 10min at 1000rpm to 2000rpm, supernatant is discarded, and precipitation is the pretreated cells.

Preferably, step S2 is specifically: and adding 100-500 mu L of cell gentle lysate into the pretreated cells, gently blowing the cell gentle lysate away, putting the cell gentle lysate on ice for treatment for 15-30 min, and reversely and uniformly mixing the cell gentle lysate and the ice every 5 min.

Preferably, step S3 includes two centrifugation processes, specifically: centrifuging the solution after cracking at 4 ℃ at 3000-3500 rpm for 5-15 min, and collecting the first supernatant; and adding 100 mu L-400 mu L of LPBS buffer solution into the precipitate, blowing, suspending and precipitating, then centrifuging for 5 min-15 min at 3000 rpm-3500 rpm again, collecting the second supernatant, and mixing the first supernatant and the second supernatant.

Preferably, in step S3, the purification process specifically comprises: adding a mitochondrial genome purification reagent with the same volume into the separated supernatant, carrying out vortex oscillation for 1min to 5min, and carrying out water bath treatment at the temperature of between 45 and 60 ℃ for 3min to 10min; then adding isopropanol with one time volume, uniformly mixing, standing at-20 ℃ for 5-20 min, and centrifuging at 10000-15000 rpm for 10-20 min; and removing the supernatant to obtain a precipitate, namely the purified mitochondrial genome DNA.

Further preferably, the mitochondrial genome purification reagent comprises 0.001-0.01 mol/L of ethylenediamine tetraacetic acid, 0.01-0.1 mol/L of tris (hydroxymethyl) aminomethane hydrochloride, 0.02mol/L of sodium acetate, 0.5-5% (v/v) of sodium dodecyl sulfate and 1-5 mug/mug of proteinase K.

Preferably, the method of the present invention further comprises a step S4 of performing a PCR reaction using the isolated mitochondrial genome of the cell as a template and using the mitochondrial genome-specific primer and the nuclear genome-specific primer as primers, respectively, to verify the purity of the isolated mitochondrial genome of the cell.

Further preferably, the mitochondrial genome-specific primers are:

mitoF:AACATACCCATGGCCAACCT；

mitoR:AGCGAAGGGTTGTAGTAGCCC。

further preferably, the nuclear genome-specific primers are:

nF:GAGTTTCCTGGACAAATGAG；

nR:CATTGTTTCATATCTCTGGCG。

generally, compared with the prior art, the above technical solution conceived by the present invention has the following beneficial effects:

the method for separating the cell mitochondria genome provided by the invention firstly utilizes the cell pretreatment reagent to clean the cell, thereby avoiding the pollution of the extracellular DNA to the cell nucleus DNA and the mitochondria DNA in the cell; then, the cell is cracked by using a cell soft cracking solution, the cracking solution can promote the rapid cracking of a cell membrane and a mitochondrial membrane, and the mitochondrial genome is released into the solution, while the cell nuclear membrane is not damaged by the cracking solution, and the cell nucleus can still be kept intact, so that the pollution of chromosomes during the subsequent separation of the mitochondrial genome is prevented; then, the nuclear genome is removed by centrifugation to obtain the mitochondrial genome, and the high-purity mitochondrial genome is obtained after purification. Compared with the traditional differential centrifugation or density gradient centrifugation, the method for separating the mitochondrial genome does not need complicated cell homogenate and strict density gradient ultracentrifugation, has low equipment requirement, low reagent cost, no toxic or harmful reagent, environmental protection, far lower required initial cell amount than other methods for separating the mitochondrial genome, short time consumption, high efficiency, high purity of the mitochondrial genome obtained by final separation, no nuclear genome pollution, good repeatability and high technical stability.

Drawings

FIG. 1 is a microscopic view of TPH-1 cells cultured in the examples of the present invention.

FIG. 2 is a microscopic image of TPH-1 cells after gently lysing for 5min in the examples of the present invention.

FIG. 3 is a microscopic image of TPH-1 cells after gentle lysis for 20min in the examples of the present invention.

FIG. 4 is a microscopic view of the nuclei remaining after the isolation of the mitochondrial genome in an example of the present invention.

Fig. 5 shows the result of detecting the purity of mitochondrial genome DNA by PCR method according to the embodiment of the present invention, where lane 1 is DNA MarkerDL200, lane 2 is the product of PCR amplification using mtDNA as template and using nuclear genome specific primers, lane 3 is the product of PCR amplification using mtDNA as template and using mitochondrial genome specific primers, lane 4 is the product of PCR amplification using nDNA as template and using nuclear genome specific primers, and lane 5 is the product of PCR amplification using nDNA as template and using mitochondrial genome specific primers.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and do not limit the invention.

The invention provides a method for efficiently separating a cell mitochondrial genome with high purity, which comprises the following steps:

s1, pretreating a cell culture by using a cell pretreatment reagent to remove extracellular impurity DNA (deoxyribonucleic acid), including exogenous chromosome or mitochondrial DNA impurities on the cell surface and in a culture medium, and collecting cells;

s2, cracking the pretreated cells by using a cell soft cracking solution to break cell membranes and mitochondrial membranes with consistent physiological and biochemical properties, and releasing mitochondrial genomes, wherein the nuclear membranes are kept intact;

s3, centrifuging the cracked solution, wherein the centrifuged supernatant contains mitochondrial genomes and precipitates the mitochondrial genomes into cell nuclei, separating the supernatant, and purifying to obtain the mitochondrial genomes of the cells;

wherein the cell gentle lysis solution comprises 0.1-15% (v/v) NP-40, 0.001-0.1 mol/L Tris (hydroxymethyl) aminomethane hydrochloride (Tris-HCl), 0.001-0.2 mol/L ethylenediaminetetraacetic acid (EDTA), 0.1-1 mol/L sodium acetate, 0.1-0.5 mol/L potassium acetate and 0.001-0.1 mol/L sodium citrate.

It should be noted that the method of the present invention is not limited to pretreatment of the tissue or biomaterial containing cells prior to pretreatment, and is suitable for subsequent lysis of biological membranes and mitochondrial genome isolation. The pretreatment may be carried out in a manner conventional in the art, and may specifically include one or more of material washing, freezing or thawing, drying, grinding, mechanical shearing, enzymatic or chemical treatment. Wherein the biological material may include at least one of animal and plant individuals, tissues, organs and symbionts, blood and artificially cultured or isolated cells, the biological material further includes one or more of microbial populations including fungi, protozoa, and the like, the biological material also includes a plurality of biological materials including mitochondrial genomes or mixed biological samples of soil, substrate sludge, plant rhizosphere, and the like.

The sample cell type applicable to the present invention is not particularly limited, and the cell line is cultured and passaged according to the representative cell line of cell biology laboratory, such as but not limited to TPH-1, HEK293t, hela, etc., using the special culture medium. For suspension culture cells, the cells can be directly inoculated and cultured, and then subjected to subsequent separation treatment. For adherent culture cells, the cells are firstly dispersed into single individuals by treatment with pancreatin, suspended cells are removed, and then fresh culture medium is added for culture until the cells are fully paved with about 80% of the space, and then subsequent separation treatment can be carried out. The optimal growth state for different cell lines is the state most suitable for developing mitochondrial genome segregation in cells.

In some embodiments, step S1 specifically includes: will contain 1X 10 ² ～1×10 ⁵ Centrifuging the cell culture of each cell at 1000-2000 rpm for 5-10 min, and discarding the supernatant; then, carrying out suspension rinsing by using normal saline or PBS buffer solution, centrifuging for 5-10 min at 1000-2000 rpm again, and discarding the supernatant; then the cell pretreatment reagent is used for suspension rinsing, standing is carried out for 5min to 10min, centrifugation is carried out for 5min to 10min at 1000rpm to 2000rpm, supernatant is discarded, and precipitation is the pretreated cells. The cell pretreatment reagents may include, but are not limited to, 0.001 mol/L-0.01 mol/L of ethylenediamine tetraacetic acid and 0.01 mol/L-0.1 mol/L of tris (hydroxymethyl) aminomethane hydrochloride.

In some embodiments, step S2 specifically includes: and adding 100-500 mu L of the cell gentle lysis solution into the pretreated cells, gently blowing the cells away, putting the cells on ice for treating for 15-30 min, and reversely and uniformly mixing the cells every 5 min.

In order to sufficiently separate the mitochondrial genome from the cell, step S3 may include two centrifugation processes, specifically: centrifuging the solution after cracking at 4 ℃ at 3000-3500 rpm for 5-15 min, and collecting the first supernatant; and adding 100-400 mu L of LPBS buffer solution into the precipitate, blowing, suspending and precipitating to ensure that the mitochondrial genome adsorbed in the precipitate is fully eluted, then centrifuging at 3000-3500 rpm for 5-15 min, collecting the second supernatant, and mixing the first supernatant and the second supernatant to obtain the supernatant containing the mitochondrial genome.

In some embodiments, in step S3, the purification process specifically comprises: adding a mitochondrial genome purification reagent with the same volume into the separated supernatant, carrying out vortex oscillation for 1min to 5min, and carrying out water bath treatment at the temperature of between 45 and 60 ℃ for 3min to 10min; then adding isopropanol with one time volume, uniformly mixing, standing at-20 ℃ for 5-20 min, and centrifuging at 10000-15000 rpm for 10-20 min; and removing the supernatant to obtain a precipitate, namely the purified mitochondrial genome DNA. Specifically, the mitochondrial genome purification reagent comprises 0.001-0.01 mol/L of ethylenediamine tetraacetic acid, 0.01-0.1 mol/L of tris (hydroxymethyl) aminomethane hydrochloride, 0.02mol/L of sodium acetate, 0.5-5% (v/v) of sodium dodecyl sulfate and 1-5 mug/mug of proteinase K. It should be noted that the purification method is not specifically limited in the present invention, and if the processed sample is large, the purification of the nuclear DNA or the mitochondrial DNA may be extracted and purified by using a commercial kit as needed.

In some embodiments, the method further includes a step S4 of performing a PCR reaction using the isolated mitochondrial genome as a template and the mitochondrial genome-specific primer and the nuclear genome-specific primer as primers, respectively, to verify the purity of the isolated mitochondrial genome. The PCR reaction system can be prepared by itself, or a commercially available PCR, qPCR or ddPCR kit or the like can be used.

According to the information of human mitochondrial genome and the information of nuclear genome, the specific primer designed for ND1 gene is selected to amplify mitochondrial genome, and the specific primer designed for ncoa3 gene is selected to amplify nuclear genome. The human mitochondrial genome has 13 protein coding genes, including coding sequences of cytochrome b, 3 subunits of cytochrome oxidase, 2 subunits of ATPase and 7 subunits of NADH dehydrogenase, and ND1 gene is the gene coding NADH dehydrogenase subunit 1; the NCOA3 gene is located in the nuclear genome and encodes nuclear receptor coactivator 3 (NCOA 3), a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activation function.

Specifically, the mitochondrial genome specific primers are:

mitoF:AACATACCCATGGCCAACCT；

mitoR:AGCGAAGGGTTGTAGTAGCCC。

the specific primers of the nuclear genome are as follows:

nF:GAGTTTCCTGGACAAATGAG；

nR:CATTGTTTCATATCTCTGGCG。

the technical solution described above is explained in detail below with reference to specific examples.

For the screening method, the preparation of buffer solution, and the formulation of the common culture medium, etc., which are referred to in this example, reference is made to the contents described in "microbiology experiment" compiled by zhao, shansha jiang, and "guide to molecular cloning experiment" (j. Sambrook et al, 2002, guide to molecular cloning experiment, third edition, jin dong yan et al (translation), scientific publishing agency, beijing). Other various experimental procedures involved in the present invention are all conventional techniques in the art, and those skilled in the art can refer to various common tool books, scientific documents, related specifications, manuals, etc. before the filing date of the present application.

1. Reagent preparation

(1) Cell pretreatment reagents: 0.005mol/L of ethylenediamine tetraacetic acid and 0.01mol/L of tris (hydroxymethyl) aminomethane hydrochloride (pH 7.5).

(2) Cell gentle lysis: 2% (v/v) NP-40,0.1mol/L Tris (hydroxymethyl) aminomethane hydrochloride (pH = 7.5), 0.1mol/L ethylenediaminetetraacetic acid, 0.5mol/L sodium acetate, 0.2mol/L potassium acetate, and 0.05mol/L sodium citrate.

(3) Mitochondrial genome purification reagents: 0.01mol/L tris (hydroxymethyl) aminomethane acetate, 0.005mol/L ethylene diamine tetraacetic acid, 0.02mol/L sodium acetate, 2% (v/v) sodium dodecyl sulfate, and 2 μ g/μ L proteinase K.

2. Cell culture

This example uses TPH-1 to suspend cells and culture and passage in its own dedicated medium. Before the cell culture operation, the cell culture medium is first preheated for 30min in an incubator at 37 ℃. In a sterile biosafety cabinet, 4mL of preheated fresh medium was carefully added to the cell culture flask, and an appropriate amount of suspended cells were inoculated and incubated in an incubator at 37 ℃ for 24h.

FIG. 1 is a microscopic observation of TPH-1 cells after 24h culture, and the boundaries of the nucleus and the cell membrane are clearly visible under a phase contrast microscope.

3. Cell isolation lysis

Collecting 1X 10 ² ～1×10 ⁵ Each cell was cultured in a microcentrifuge tube. Collecting cells, centrifuging at 2000rpm for 5min, and removing supernatant; then, the suspension was rinsed with PBS buffer, centrifuged again at 2000rpm for 5min, and the supernatant was discarded. Then 400. Mu.L of the cell pretreatment reagent was carefully added by a pipette, the suspended cells were carefully blown with a pipette tip, left to stand for 5min, and then centrifuged at 2000rpm for 5min, and the supernatant was carefully aspirated with a pipette tip, and the pellet was the treated cells.

When 400. Mu.L of a gentle cell lysate was added to the precipitated cells and the suspended cells were carefully pipetted, the precipitated cells were rapidly reduced. Treating on ice for 30min, mixing at 5min intervals, and observing under microscope with 1 μ L system to determine whether cells are gently lysed.

FIG. 2 is a microscopic image of TPH-1 cells after gentle lysis for 5 min. In the figure, part of the cell membrane is dissolved, the cell content is released, part of the cell nucleus is clear in edge, and the cell nucleus is kept intact. With increasing degree of gentle lysis of the cells, as shown in FIG. 3, after 20min there were almost no cells containing cell membranes in the whole field, and the nuclei and mitochondria achieved "free" separation.

4. Mitochondrial genomic DNA isolation and purification

And (4) carrying out centrifugal separation on the cracking system in the step (3) to realize the separation of cell nucleus and mitochondrial genome. The specific operation is that the cell soft cracking system is centrifuged for 10min at 3000rpm under the condition of 4 ℃; subsequently, the supernatant (supernatant 1) was carefully transferred to a new centrifuge tube, and then 200. Mu.L of LPBS buffer was added to the pellet, the pellet was carefully pipetted and suspended, and then centrifuged again under the same conditions to combine the supernatant with the supernatant 1. At this point, the combined supernatants contained the isolated mitochondrial genome, while the pellet was predominantly nuclear. FIG. 4 shows a microscopic picture of the nuclei left after the isolation of the mitochondrial genome, and it can be seen that the obtained pellet is mainly smooth-edged nuclei and is largely aggregated.

Adding equal volume of trace nucleic acid purification reagent into the obtained supernatant (mainly containing mitochondrial genome) and precipitate (mainly containing cell nucleus), and vortex shaking for 3min; then treating in water bath at 50 deg.C for 5min; then adding isopropanol with one time volume, mixing uniformly, putting into a refrigerator with the temperature of-20 ℃, and standing for 10min. Then centrifuging for 15min at 12000 rpm; and removing the supernatant, wherein the obtained precipitate is purified mitochondrial DNA or nuclear DNA.

5. Mitochondrial genome purity characterization

This example designed specific amplification primers for mitochondrial genome with ND1 gene; specific amplification primers are designed according to the nuclear genome and the ncoa3 gene. Mitochondrial genome purity analysis was performed according to the following specific primers or probes.

The mitochondrial genome specific amplification primers are:

mitoF:AACATACCCATGGCCAACCT

mitoR:AGCGAAGGGTTGTAGTAGCCC

the specific amplification primers of the nuclear genome are as follows:

nF:GAGTTTCCTGGACAAATGAG

nR:CATTGTTTCATATCTCTGGCG

the mitochondrial genome DNA (mtDNA) was amplified by PCR using both the above mitochondrial genome-specific amplification primers (mitoF, mitoR) and the nuclear genome-specific amplification primers (nF, nR) according to the following procedure:

pre-denaturation at 95 ℃ for 10min;

94℃，30s

60℃，30s

34 cycles

25℃，5min

At the same time, the same PCR amplification reaction was also carried out for nuclear genomic DNA (nDNA).

As a result, as shown in FIG. 5, no amplified products of the nuclear genome appeared in the mitochondrial genome DNA purified by the method of the present invention, but the amplified products of the mitochondrial genome were evident. The method proves that the mitochondrial genome DNA without nuclear genome pollution is obtained under the detection sensitivity based on PCR reaction, and has high purity, high speed and high efficiency. However, in the meantime, in the PCR amplification of nuclear genome, there is still some contamination of mitochondrial genome, but the concentration of nuclear genome is significantly increased. This result of the invention is consistent with the knowledge in the art of the relationship between nuclear genome copy number and mitochondrial genome copy number, i.e., in the same cell, the mitochondrial genome copy number is hundreds to thousands of times that of the nuclear genome. At the same time, mitochondria are smaller and more difficult to completely separate from the nuclear genome than the nuclear genome.

Generally, the method can be used for efficiently obtaining high-purity mitochondrial genome DNA in a small amount of cultured cells, and has the advantages of short time, low equipment requirement, simplicity in operation, good repeatability, high purity of the obtained mitochondrial genome DNA and good effect.

It will be understood by those skilled in the art that the foregoing is only a preferred embodiment of the present invention, and is not intended to limit the invention, and that any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the scope of the present invention.

Claims (10)

1. A method for separating the mitochondrial genome of cells with high efficiency and high purity is characterized by comprising the following steps:

s1, pretreating a cell culture by using a cell pretreatment reagent to remove extracellular impurity DNA, and collecting cells;

s2, cracking the pretreated cells by using a cell soft lysate;

s3, centrifuging the cracked solution, separating supernatant, and purifying to obtain a cell mitochondrial genome;

wherein the cell gentle lysis solution comprises 0.1-15% (v/v) NP-40, 0.001-0.1 mol/L tris (hydroxymethyl) aminomethane hydrochloride, 0.001-0.2 mol/L ethylenediamine tetraacetic acid, 0.1-1 mol/L sodium acetate, 0.1-0.5 mol/L potassium acetate and 0.001-0.1 mol/L sodium citrate.

2. The method of claim 1, wherein: in step S1, the cell pretreatment reagent comprises 0.001 mol/L-0.01 mol/L EDTA and 0.01 mol/L-0.1 mol/L Tris (hydroxymethyl) aminomethane hydrochloride.

3. The method according to claim 1, wherein step S1 is specifically: will contain 1X 10 ² ～1×10 ⁵ Centrifuging the cell culture of each cell at 1000-2000 rpm for 5-10 min, and discarding the supernatant; then, carrying out suspension rinsing by using normal saline or PBS buffer solution, centrifuging for 5-10 min at 1000-2000 rpm again, and discarding the supernatant; and then, carrying out suspension rinsing by using the cell pretreatment reagent, standing for 5-10 min, centrifuging for 5-10 min at 1000-2000 rpm, and discarding the supernatant, wherein the precipitate is the pretreated cell.

4. The method according to claim 1, wherein step S2 is specifically: and adding 100-500 mu L of cell gentle lysate into the pretreated cells, gently blowing the cell gentle lysate away, putting the cell gentle lysate on ice for treatment for 15-30 min, and reversely and uniformly mixing the cell gentle lysate and the ice every 5 min.

5. The method according to claim 1, characterized in that step S3 comprises two centrifugation processes, in particular: centrifuging the solution after cracking at 4 ℃ at 3000-3500 rpm for 5-15 min, and collecting the first supernatant; and adding 100 mu L-400 mu L of LPBS buffer solution into the precipitate, blowing, suspending and precipitating, then centrifuging for 5 min-15 min at 3000 rpm-3500 rpm again, collecting the second supernatant, and mixing the first supernatant and the second supernatant.

6. The method according to claim 1, wherein in step S3, the purification process is specifically: adding a mitochondrial genome purification reagent with the same volume into the separated supernatant, carrying out vortex oscillation for 1min to 5min, and carrying out water bath treatment at the temperature of between 45 and 60 ℃ for 3min to 10min; then adding isopropanol with one time volume, uniformly mixing, standing at-20 ℃ for 5-20 min, and centrifuging at 10000-15000 rpm for 10-20 min; and removing the supernatant to obtain a precipitate, namely the purified mitochondrial genome DNA.

7. The method of claim 6, wherein: the mitochondrial genome purification reagent comprises 0.001 mol/L-0.01 mol/L ethylene diamine tetraacetic acid, 0.01 mol/L-0.1 mol/L tris (hydroxymethyl) aminomethane hydrochloride, 0.02mol/L sodium acetate, 0.5-5% (v/v) sodium dodecyl sulfate and 1 mu g/mu L-5 mu g/mu L proteinase K.

8. The method according to any one of claims 1 to 7, wherein: and step S4, taking the separated cell mitochondrial genome as a template, and respectively carrying out PCR reaction by using a mitochondrial genome specific primer and a cell nucleus genome specific primer as primers to verify the purity of the separated cell mitochondrial genome.

9. The method of claim 8, wherein the mitochondrial genome-specific primers are:

mitoF:AACATACCCATGGCCAACCT；

mitoR:AGCGAAGGGTTGTAGTAGCCC。

10. the method of claim 8, wherein the nuclear genome-specific primers are:

nF:GAGTTTCCTGGACAAATGAG；

nR:CATTGTTTCATATCTCTGGCG。

Images