CN115125334A

CN115125334A - Hepatitis B virus RNA detection kit and method

Info

Publication number: CN115125334A
Application number: CN202210764611.8A
Authority: CN
Inventors: 蒋析文; 刘悦; 杨迪; 董子维; 郑志东; 黄婷婷
Original assignee: Guangzhou Da'an Gene Co ltd
Current assignee: Guangzhou Da'an Gene Co ltd
Priority date: 2022-06-29
Filing date: 2022-06-29
Publication date: 2022-09-30

Abstract

The invention provides a hepatitis B virus RNA detection kit and a method, and particularly develops a kit and a method for detecting hepatitis B virus RNA (HBV RNA) based on multiplex real-time fluorescent quantitative PCR. Can be widely applied to the fields of clinical diagnosis and curative effect tracking of hepatitis B caused by HBV virus, epidemic prevention and control and the like.

Description

Hepatitis B virus RNA detection kit and method

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a hepatitis B virus RNA detection kit and a method.

Background

Hepatitis B Virus (HBV) is a hepatotropic virus, mainly present in and damaging hepatocytes, and is a major causative factor of chronic Hepatitis B, cirrhosis, liver failure, and hepatocellular carcinoma. Hepatitis b virus infection is a global public health problem. The proportion of patients with global cirrhosis and hepatocellular carcinoma caused by HBV infection was 30% and 45%, respectively. In the patients with cirrhosis and hepatocellular carcinoma in China, the proportion caused by HBV infection is 60 percent and 80 percent respectively. The burden of diseases caused by HBV is very heavy, and the prevention and treatment work faces serious challenges.

Hepatitis b virus RNA (HBV RNA) is transcribed from covalently closed circular DNA (cccDNA) in the infected hepatocyte nucleus, so theoretically the presence of HBV RNA virions in blood and the level of their virions can reflect the status of cccDNA, including the level of cccDNA and its transcriptional activity. This makes it possible for HBV RNA detection to replace cccDNA detection as a key point for antiviral therapy. Experiments prove that the cccDNA is transcribed into RNA which is released in the form of virus-like particles after being coated by nucleocapsid, and the process is not blocked by the treatment of nucleotide/nucleoside drugs (NAs), so when HBV RNA can not be detected in the blood of a patient with chronic hepatitis B, the cccDNA in the liver cell of the patient disappears or the transcription silence stops, which means that the drug can be stopped at the moment.

At present, the fluorescence PCR method has two kinds of targets, one is to detect HBV DNA, and the other is to detect HBV RNA. HBV DNA is mainly used for evaluating the virus replication level of HBV infected patients, is an important index for selection of antiviral treatment indications and judgment of curative effect, and is widely applied. However, the oral drugs such as entecavir, lamivudine, nucleosides and nucleotide drugs which are currently applied to treating HBV can effectively reduce the DNA load of peripheral HBV, but have no definite effect on cccDNA in liver cells.

The HBV RNA can reflect the level of cccDNA and its transcriptional activity, and even if HBV DNA is not detected in blood due to the influence of nucleoside (acid) drugs, HBV RNA still exists in blood due to the continuous presence of cccDNA, so HBV RNA in blood has clinical significance in monitoring antiviral efficacy.

Disclosure of Invention

The invention aims to provide an HBV RNA detection kit with high accuracy and sensitivity and a detection method.

In a first aspect of the present invention, a PCR primer set for detecting hepatitis b virus rna (hbv rna) is provided, the primer set comprising a first primer pair comprising a forward primer shown in SEQ ID No. 1, a reverse primer shown in SEQ ID No. 2, and a reverse primer shown in SEQ ID No. 3.

In another preferred example, the primer pair group further comprises a second primer pair, and the second primer pair comprises a forward primer shown as SEQ ID No. 5; and, a reverse primer as set forth in SEQ ID No. 6.

In a second aspect of the present invention, there is provided a probe set for detecting hepatitis b virus rna (hbv rna), the probe set comprising: a specific probe for hepatitis B virus as shown in SEQ ID No. 4.

In another preferred embodiment, the probe set further comprises: an internal standard probe as shown in SEQ ID No. 7.

In a third aspect of the present invention, a kit for detecting hepatitis b virus RNA is provided, the kit comprising the PCR primer pair set according to the first aspect of the present invention.

In another preferred embodiment, the kit further comprises a set of probes according to the second aspect of the invention.

In another preferred embodiment, the kit further comprises an HBV RNA reaction solution a, and the HBV RNA reaction solution a comprises the PCR primer set according to the first aspect of the present invention and the probe set according to the second aspect of the present invention.

In another preferred embodiment, the HBV RNA reaction solution a is prepared from a buffer solution comprising: (NH) ₄ ) ₂ SO ₄ KCl, Tris-HCl, and MgCl ₂ 。

In another preferred embodiment, the kit further comprises an HBV RNA reaction solution B, and the HBV RNA reaction solution B comprises one or more components selected from the group consisting of:

dUTPs, Taq enzyme, reverse transcriptase, UDG enzyme, RNase inhibitor.

In another preferred embodiment, the kit further comprises a DNA digestion reagent, and the DNA digestion reagent comprises dnase I and dnase I buffer.

In another preferred example, the kit further comprises a negative quality control substance, and the negative quality control substance is DEPC water.

In another preferred example, the kit further comprises a positive quality control substance, and the positive quality control substance is a pseudovirion containing hepatitis B virus RNA.

In another preferred example, the kit further comprises an HBV RNA internal standard solution, wherein the HBV RNA internal standard solution is a pseudoviral particle comprising an HBV RNA internal standard fragment (plant-derived nucleic acid sequence).

In a fourth aspect of the present invention, there is provided a method for detecting hepatitis b virus RNA, the method comprising the steps of:

(1) providing a sample to be detected, wherein the sample contains HBV RNA;

(2) digesting the sample nucleic acid DNA by using DNase I;

(3) preparing an amplification reaction system, carrying out amplification reaction, detecting HBV RNA in a sample:

wherein the amplification reaction system comprises the sample to be detected treated in the step (2), the primer pair group of the first aspect of the invention, and the probe group of the second aspect of the invention.

In another preferred embodiment, the method is for non-diagnostic purposes.

In a fifth aspect, the present invention provides the use of the primer pair group of the first aspect and the probe set of the second aspect of the present invention for preparing a detection kit for detecting hepatitis b virus rna (hbv rna).

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 is a diagram showing the result of detection of a reference substance with a minimum detection limit (50copies/mL) according to an embodiment of the present invention;

FIG. 2 is a graph of the results of cross-reactive sample detection according to an embodiment of the present invention;

FIG. 3 shows a reference sample (1.0X 10) for measuring precision according to an embodiment of the present invention ⁴ copies/mL) detection result graph;

FIG. 4 shows a reference substance (5.0X 10) for measuring precision in accordance with an embodiment of the present invention ² copies/mL) detection result graph;

FIG. 5 is a graph showing the results of testing clinical specimens according to the embodiment of the present invention.

Detailed Description

The invention develops a kit and a method for detecting hepatitis B virus RNA (HBV RNA) based on multiplex real-time fluorescent quantitative PCR. Can be widely applied to a plurality of fields of window phase detection, clinical diagnosis, scientific research, curative effect tracking, inspection and quarantine, epidemic prevention and control and the like of hepatitis B caused by HBV virus.

The multiplex real-time fluorescence PCR technology is an advanced technology combining the PCR technology and the multicolor fluorescence labeling probe, has the characteristics of rapidness, specificity, sensitivity, high automation degree and the like, is combined with anti-pollution technology processing, and is particularly suitable for the requirements of large-scale and rapid diagnosis. The technology adopts different fluorescent groups to mark specific probes, and can simultaneously amplify various viruses in the same PCR reaction tube by matching with a multiple PCR technology, wherein fluorescent increase signals and the increase quantity of corresponding PCR products form an equal ratio relationship and are collected by an automatic fluorescence detector, and finally the purpose of detecting pathogen types can be achieved by analyzing a fluorescent increase curve. Because the fluorescent PCR technology has the advantages of short amplified fragment, dual specificity of primers and probes and the like, the multiple real-time fluorescent PCR technology is applied to the rapid detection of the hepatitis B virus, the detection and identification efficiency can be improved, whether suspected cases or suspected vectors infect the hepatitis B virus or not can be judged in a short time, necessary prevention and control and treatment measures can be taken in clinical time conveniently, the viruses are prevented from being continuously spread, the diagnosis and treatment efficiency is improved, and support and basis are provided for rapid diagnosis, effective monitoring and targeted treatment.

Multiplex PCR (multiplex PCR), also called multiplex PCR or multiplex PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments, and the reaction principle, reaction reagents and operation process are the same as those of ordinary PCR.

There are many factors that affect multiplex PCR reactions, such as:

(1) the imbalance of the reaction system causes some dominant primers and templates thereof to be rapidly amplified in the previous rounds of reactions, and a large amount of amplification products are obtained, and the amplification products are good inhibitors of DNA polymerase. Therefore, the polymerization ability of polymerase is more and more strongly inhibited with the appearance of a large amount of amplification products, and thus, the primer and its template, which are in a bad state at the previous stage, are more difficult to react, and finally, the amount of amplification products is so small that it cannot be detected.

(2) The primer specificity, if the primer has stronger binding force with other non-target gene fragments in the system, the ability of the target gene to bind the primer is contended, thereby leading to the reduction of the amplification efficiency.

(3) The optimal annealing temperatures are different, a plurality of pairs of primers are placed in a system for amplification, and the optimal annealing temperatures of each pair of primers are required to be close to each other because the annealing temperatures for PCR reaction are the same.

(4) Primer dimers, including dimers among primers and hairpin structures formed by the primers, are third-party DNA-mediated dimers, and like non-specific primers, the dimers and the non-specific primers can interfere the competition between the primers and target binding sites, and the amplification efficiency is influenced.

Although several factors affecting amplification efficiency are mentioned above, more are not clear. To date, there is no effective method for clearly predicting amplification efficiency.

In a preferred embodiment of the present invention, the present invention provides a multiplex hepatitis b virus RNA (HBV RNA) detection system, comprising 2 pairs of forward and reverse primers, 1 reverse transcription primer and 2 specific probes, wherein the nucleic acid sequences of the detection system are:

a primer pair for detecting HBV RNA, the nucleic acid sequence of which is shown as SEQ ID NO. 1-2, a reverse transcription primer, the nucleic acid sequence of which is shown as SEQ ID NO. 3, and a probe for detecting HBV RNA, the nucleic acid sequence of which is shown as SEQ ID NO. 4;

detecting an internal standard primer pair, wherein the nucleic acid sequence of the internal standard primer pair is shown as SEQ ID No. 5-6, and the nucleic acid sequence of the internal standard probe is shown as SEQ ID No. 7;

the specific primer probe sequences are as follows:

TABLE 1

Primer and Probe sequence number	Nucleotide sequence (5 '-3')
		HBV RNA upstream primer SEQ ID NO. 1	TTACAGACCACCAAATGCC
HBV RNA downstream primer SEQ ID NO. 2	GCGAGGGAGTTCTTCTTCTAG
		HBV RNA probe SEQ ID NO. 3	FAM-CCGGAAACTACTGTTGTTAGAC-MGB
Reverse transcription primer SEQ ID NO. 4	TTGAGATTCCCGAGATTGAGA
		Internal standard upstream primer SEQ ID No. 5	GATCCAAACCATAATACGACT
Internal standard downstream primer SEQ ID No. 6	TGATGTTTTACGGGAGTGACA
		Internal standard probe SEQ ID No. 7	VIC-AGAGGCCTGCCCGAGAATGTC-BHQ1

Further, the 5 'end of the nucleotide sequence of SEQ ID No. 4 is marked with FAM and the 3' end is marked with MGB, and the 5 'end of the nucleotide sequence of SEQ ID No. 7 is marked with VIC and the 3' end is marked with BHQ 1.

Preferably, the final concentration of the upstream primer in the reaction system is 0.15. mu. mol/L, the final concentration of the downstream primer in the reaction system is 0.15. mu. mol/L, the final concentration of the reverse transcription primer in the reaction system is 0.20. mu. mol/L, and the final concentration of the probe for detecting HBV RNA in the reaction system is 0.03

Mu mol/L, and the final concentration of the probe of the detection internal standard in the reaction system is 0.05 mu mol/L.

In another preferred embodiment of the present invention, the present invention provides a kit for detecting hepatitis b virus RNA (HBV RNA), the kit comprises HBV RNA reaction solution a, the HBV RNA reaction solution a comprises the PCR primer set and probe set, in another preferred example, the HBV RNA reaction solution a further comprises 10 × HBV RNA buffer, and the 10 × HBV RNA buffer of the PCR reaction solution comprises the following components, as shown in table 2:

TABLE 2

Preferably, the kit further comprises the HBV RNA reaction solution B, which comprises one or more components selected from the following table:

TABLE 3

Preferably, the kit further comprises a DNA digestion reagent comprising dnase I and dnase I buffer.

Preferably, the kit further comprises a negative quality control material, and the negative quality control material is DEPC water.

Preferably, the kit further comprises a positive quality control product, and the positive quality control product is a pseudovirion containing hepatitis B virus RNA.

Preferably, the kit further comprises an HBV RNA internal standard solution, which is a pseudoviral particle comprising an HBV RNA internal standard fragment (plant-derived nucleic acid sequence).

In another preferred embodiment of the present invention, the present invention provides a method for detecting hepatitis B virus RNA, the method comprising the steps of:

(1) providing a sample to be detected, and extracting nucleic acid of the sample to be detected;

(2) performing sample nucleic acid DNA digestion by using DNase I;

(3) preparing an amplification reaction system, carrying out amplification reaction, and detecting HBV RNA in a sample.

Wherein the amplification reaction system comprises the sample to be detected provided in step (1), the primer pair group and the probe group according to the first aspect of the invention.

The method may be for non-diagnostic purposes.

The invention adopts fluorescent quantitative PCR technology to detect hepatitis B virus RNA (HBV RNA).

Preferably, the specific implementation method is as follows:

1. PCR reagent preparation

And taking the HBV RNA reaction solution A, the HBV RNA reaction solution B and the HBV RNA internal standard solution out of the kit, melting at room temperature, shaking, uniformly mixing, and centrifuging at 8,000rpm for several seconds for use.

Taking N (N is the number of samples to be detected plus negative quality control substances plus HBV RNA positive quality control substances) reaction tubes,

the single-person PCR amplification system is prepared as follows 4:

TABLE 4

Fully mixing the components, centrifuging at 8,000rpm for several seconds, completely centrifuging the liquid on the tube wall to the tube bottom, and subpackaging 15 mu L of amplification system into PCR tubes. If the packaged PCR reaction solution is not used immediately, the PCR reaction solution is placed at the temperature of 2-8 ℃ for no more than 4 hours, and the PCR reaction solution is placed at room temperature for no more than 1 hour.

2. Nucleic acid extraction

Collecting venous blood of a detected person by using a blood collection tube without anticoagulant, standing at room temperature, spontaneously and completely agglutinating to separate out serum or directly centrifuging by using a horizontal centrifuge, wherein the upper layer is the serum. Collecting venous blood of a detected person by using a blood collecting tube containing ethylenediamine tetraacetate (EDTA-salt) or sodium citrate anticoagulant, immediately and slightly inverting the blood collecting tube for mixing to fully and uniformly mix the anticoagulant and the venous blood, and centrifugally separating collected anticoagulated whole blood into plasma. The prepared serum and plasma are used for extracting nucleic acid of a sample. The nucleic acid extraction or purification reagent (Yuejie mechanical device No. 20170668) produced by Guangzhou Daan Gen Kunji is adopted, and the specific operation steps are carried out according to the guidance of a kit instruction. The template nucleic acid can be used directly in subsequent experiments.

3. DNA digestion

According to the sample to be detected, the negative quality control product and the HBV RNA positive quality control product, the DNA digestion proportions of the human parts in the following table are mixed:

TABLE 5

Components	Extracted nucleic acid	DNase I buffer	DNase I
				Amount of the composition	34μL	4μL	2μL

Incubate at 27 ℃ for 35 minutes.

Inactivation of DNA digestive enzyme: the DNA digested product was incubated at 65 ℃ for 10 minutes to inactivate DNase I.

4. Sample application

Adding 35 mul of DNA enzyme I treated nucleic acid of the sample to be detected, negative quality control material and HBV RNA positive quality control material into a PCR reaction tube which is separately filled with 15 mul of amplification system, so that the total volume of each reaction is 50 mul. The tube cap is tightly covered, the mixture is evenly mixed by oscillation, and the mixture is transferred to an amplification detection area after instantaneous centrifugation at 1,500 rpm.

5. PCR amplification

And placing the PCR reaction tube into a sample groove of the instrument.

ABI 7500 instrument settings: the computer is firstly turned on, then the power supply of the host of the quantitative PCR instrument is turned on, and finally the ABI 7500 software is started. Click on the menu File → select Advanced setup in New Experimental, open a blank File, edit the Name of the Experiment in "Experimental Name". Opening a 'Plate step' window, clicking an Add New Taget button, newly building a probe, and setting a probe detection mode as follows: reporter Dye 1: FAM, Quencher Dye 1: none, Reporter Dye 2: VIC, Quencher Dye 2: none; clicking an "Assign Target Samples" button, setting negative quality control (NTC), positive quality control and Unknown Sample (Unknown) according to the corresponding sequence of the Sample, and setting the Sample Name in the column of "Sample Name", Passive Reference: none. Open Run Method window, set reaction volume to 60 μ L, and set cycling conditions as follows:

TABLE 6

And after the setting is finished, saving the file and operating the program.

6. Analysis of results

And automatically storing the result after the operation is finished, adjusting the Start Value, the End Value and the Threshold of Baseline according to the analyzed image (the Start Value can be adjusted by a user according to the actual situation, the End Value can be 3-15, the End Value can be 5-20, the Value of the Threshold is set in a Log map window, the Threshold line is positioned in the exponential phase of the amplification curve, the amplification curve of the negative quality control material is straight or lower than the Threshold line), clicking Analysis to automatically obtain the Analysis result, viewing the result on a Report interface, and recording the Ct Value of the unknown sample.

7. Quality control

Negative quality control product: the FAM channel has no amplification curve, the VIC channel has an obvious amplification curve, and the Ct value is less than or equal to 27; HBV RNA positive quality control: the FAM channel has an obvious amplification curve, the Ct value is within the range of 15-21, the VIC channel has an amplification curve, and the Ct value is less than or equal to 27; under the condition that the above items are met simultaneously, the detection experiment is effective, otherwise, all the experiments should be carried out again.

8. Result judgment

According to the detection result of the sample, the positive judgment value of the kit is determined to be that the Ct value is equal to 33.

9. Interpretation of results

(1) Before each experiment, a negative quality control product and an HBV RNA positive quality control product need to be detected, and the detection result can be judged when the quality control product result meets the quality control requirement. Otherwise, the test is invalid, and the detection is recommended to be carried out again.

(2) The test is only used for clinical reference, and if the patient needs to be diagnosed, clinical symptoms or other detection means are combined.

TABLE 7

The main advantages of the invention are:

(1) the invention obtains a double detection system with extremely high sensitivity and extremely high stability performance when detecting a low-concentration sample.

(2) The invention adopts DNase I to process the sample, thereby avoiding the interference of genome DNA to the detection result.

(3) The detection system comprises an internal standard quality control system, and can monitor the whole process of nucleic acid extraction and PCR amplification, thereby reducing the occurrence of false negative results.

The present invention will be described in further detail with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, Beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

Example 1: hepatitis B virus RNA (HBV RNA) detection kit

The inventor designs dozens of PCR amplification primers targeting HBV RNA, and the screening result shows that most of the primers have low sensitivity or poor specificity, or have prominent system competition phenomenon in a dual detection system, so that the clinical detection requirement cannot be met.

The primer probe sequences of the finally obtained HBV RNA dual detection system are shown in the following table 8:

TABLE 8

On this basis, the present example provides a kit for detecting hepatitis b virus rna (hbv rna), which comprises the following components, packages and quantities (24 reaction/cassette), as shown in table 9:

TABLE 9

Example 2: minimum detection limit detection

The lowest detection limit sample is pseudovirus containing HBV RNA target fragment, and is diluted to 5.0X 10 ¹ copies/mL as the lowest detection limit reference, designated M1; the positive quality control substance is an extracting solution of a pseudovirus of the HBV RNA target fragment, and the negative quality control substance is a DEPC water extracting solution;

DNA digestion treatment is carried out on the extracted nucleic acids of the positive quality control product, the negative quality control product and the minimum detection limit reference product by using DNase I, and the digested nucleic acids are loaded into eight connecting tubes of the PCR reaction system prepared by the implementation method 1, so that the total volume of each tube of the PCR reaction system is 50 mu L; and tightly covering the eight-connection pipe cover. Fully mixing the mixture evenly, and centrifuging the mixture at a high speed for 10 seconds; for PCR amplification;

amplification conditions for PCR:

5 minutes at 50 ℃ for 1 cycle; 2 minutes at 95 ℃ for 1 cycle; 30 seconds at 95 ℃, 45 seconds at 58 ℃ and 35 cycles;

the reaction tube after PCR reaction is placed on an ABI 7500 instrument, the lowest detection limit of the invention is detected, and the result is as follows:

watch 10

Repeatedly detecting the minimum detection limit reference M1 of the kit for 20 times, wherein the detection results are positive; accordingly, the present inventionHas a minimum detection limit of 5.0 × 10 ¹ copies/mL。

Example 3: cross-reaction detection

The cross reaction detection sample is human cytomegalovirus, EB virus, human immunodeficiency virus 1 type, influenza A virus, hepatitis A virus and hepatitis C virus clinical samples; the positive quality control product is an extracting solution of a pseudovirus of the HBV RNA target fragment, and the negative quality control product is a DEPC water extracting solution;

DNA digestion treatment is carried out on the extracted positive quality control product, negative quality control product and cross reaction sample nucleic acid by using DNase I, and the digested nucleic acid is added into eight connecting tubes of the PCR reaction system prepared by the implementation method 1, so that the total volume of each tube of the PCR reaction system is 50 mu L; and tightly covering the eight-connection pipe cover. Fully mixing the mixture evenly, and centrifuging the mixture at a high speed for 10 seconds; for PCR amplification;

amplification conditions for PCR:

TABLE 11

Cross-reactive sample	The result of the detection
		Human cytomegalovirus clinical specimens	Negative of
EB virus clinical sample	Negative of
		Human immunodeficiency virus type 1 clinical sample	Negative of
Influenza A virus clinical specimen	Negative of
		Hepatitis A virus clinical sample	Negative of
Clinical samples of hepatitis C Virus	Negative of
		Negative quality control product	Negative of
Positive quality control product	Positive for

Example 4: detection of precision

The sample is detected with precision as pseudovirus containing HBV RNA target segment and diluted to 1.0X 10 ⁴ copies/mL and 5.0X 10 ² copies/mL as precision references, designated R1 and R2, respectively; the positive quality control substance is an extracting solution of a pseudovirus of the HBV RNA target fragment, and the negative quality control substance is a DEPC water extracting solution;

DNA digestion treatment is carried out on the extracted nucleic acids of the positive quality control product, the negative quality control product and the precision reference product by using DNase I, and the digested nucleic acids are loaded into eight connecting tubes of the PCR reaction system prepared by the implementation method 1, so that the total volume of each tube of the PCR reaction system is 50 mu L; and tightly covering the eight-connection pipe cover. Fully mixing uniformly, and centrifuging at high speed for 10 seconds; for PCR amplification;

amplification conditions for PCR:

the reaction tube after PCR reaction is placed on an ABI 7500 instrument, the precision of the invention is detected, and the result is as follows:

TABLE 12

Example 5 clinical sample testing

Collecting venous blood of a detected person by using a blood collection tube without an anticoagulant, placing the blood collection tube at room temperature, spontaneously and completely agglutinating to separate out serum or directly centrifuging by using a horizontal centrifuge, wherein the upper layer is the serum. Collecting venous blood of a detected person by using a blood collecting tube containing ethylenediamine tetraacetate (EDTA-salt) or sodium citrate anticoagulant, immediately and slightly inverting the blood collecting tube for mixing to fully and uniformly mix the anticoagulant and the venous blood, and centrifugally separating collected anticoagulated whole blood into plasma. The prepared serum and plasma are used for extracting nucleic acid of a sample. The nucleic acid extraction or purification reagent (Yuejie mechanical device No. 20170668) produced by Guangzhou Daan Gen Kunji is adopted, and the specific operation steps are carried out according to the guidance of a kit instruction. The template nucleic acid can be used directly in subsequent experiments.

Adding the extracted positive quality control product, negative quality control product and sample nucleic acid into eight connected tubes of the PCR reaction system prepared by implementing the method 1 by using the DNA enzyme I, so that the total volume of each tube of the PCR reaction system is 50 mu L; and covering the eight-connection pipe cover tightly. Fully mixing the mixture evenly, and centrifuging the mixture at a high speed for 10 seconds; for PCR amplification;

amplification conditions for PCR:

and (3) placing the reaction tube after the PCR reaction on an ABI 7500 instrument, and detecting and analyzing HBV RNA in the sample.

The detection result is as follows: the 50 samples are positive, and the detected result is consistent with the positive result of the clinical sample DNA.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes or modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the appended claims of the present application.

Sequence listing

<110> Guangzhou Daan Gene GmbH

<120> hepatitis B virus RNA detection kit and method

<130> 030104

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Hepatitis B Virus (Hepatitis B virus)

<400> 1

ttacagacca ccaaatgcc 19

<210> 2

<211> 21

<212> DNA

<213> Hepatitis B Virus (Hepatitis B virus)

<400> 2

gcgagggagt tcttcttcta g 21

<210> 3

<211> 22

<212> DNA

<213> Hepatitis B Virus (Hepatitis B virus)

<400> 3

ccggaaacta ctgttgttag ac 22

<210> 4

<211> 21

<212> DNA

<213> Hepatitis B Virus (Hepatitis B virus)

<400> 4

ttgagattcc cgagattgag a 21

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

gatccaaacc ataatacgac t 21

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

tgatgtttta cgggagtgac a 21

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

agaggcctgc ccgagaatgt c 21

Claims

1. A PCR primer pair group for detecting hepatitis b virus rna (hbv rna), the primer pair group comprising a first primer pair comprising a forward primer as shown in SEQ ID No. 1, a reverse primer as shown in SEQ ID No. 2, and a reverse transcription primer as shown in SEQ ID No. 3;

preferably, the primer pair group further comprises a second primer pair comprising a forward primer as shown in SEQ ID No. 5; and, a reverse primer as shown in SEQ ID No. 6.

2. A probe set for detecting hepatitis b virus rna (hbv rna), the probe set comprising: a probe specific for hepatitis b virus as set forth in SEQ ID No. 4;

preferably, the set of probes further comprises: an internal standard probe as shown in SEQ ID No. 7.

3. A kit for detecting hepatitis b virus RNA, comprising the PCR primer set of claim 1.

4. The kit of claim 3, further comprising a set of probes according to claim 2.

5. The kit of claim 3, further comprising an HBV RNA reaction solution A comprising the PCR primer set of claim 1 and the probe set of claim 2.

6. The kit according to claim 5, wherein the kit further comprises an HBV RNA reaction solution B comprising one or more components selected from the group consisting of:

dUTPs, Taq enzyme, reverse transcriptase, UDG enzyme, RNase inhibitor.

7. The kit of claim 6, further comprising DNA digestion reagents comprising DNase I and DNase Ibuffer.

8. The kit of claim 3, further comprising a negative quality control and a positive quality control.

9. A method for detecting hepatitis b virus RNA, said method comprising the steps of:

(1) providing a sample to be detected, wherein the sample contains HBV RNA;

(2) digesting the sample nucleic acid DNA by using DNase I;

(3) preparing an amplification reaction system, carrying out amplification reaction, and detecting HBV RNA in a sample:

wherein the amplification reaction system comprises the sample to be detected treated in the step (2), the primer set group in claim 1, and the probe set in claim 2.

10. Use of the primer pair set of claim 1, and the probe set of claim 2, for the preparation of a test kit for the detection of hepatitis b virus rna (hbv rna).