CN115109782B

CN115109782B - Expression and renaturation method of recombinant human CXCL16 protein

Info

Publication number: CN115109782B
Application number: CN202210590506.7A
Authority: CN
Inventors: 余乐; 程威; 程索; 李嘉琪; 郭年华
Original assignee: Wuhan Abclonal Inc
Current assignee: Wuhan Abclonal Inc
Priority date: 2022-05-26
Filing date: 2022-05-26
Publication date: 2023-06-09
Anticipated expiration: 2042-05-26
Also published as: CN115109782A

Abstract

The invention provides a method for expressing and renaturating recombinant human CXCL16 protein, which creatively selects a section of intracellular protein, adopts a prokaryotic expression host and combines special expression conditions to realize the expression of the intracellular protein, effectively carries out the renaturation of inclusion bodies and adopts receptor protein CXCR6 to verify that target protein has biological activity.

Description

Expression and renaturation method of recombinant human CXCL16 protein

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an expression and renaturation method of recombinant human CXCL16 protein.

Background

Chemokines are small molecular proteins composed of a plurality of amino acids, are immune inflammatory factors, not only regulate and control directional migration of immune cells, participate in differentiation and maturation of immune systems and immune monitoring, but also can influence the production, invasion and metastasis of tumors, regulate a plurality of processes of vascular production and the like.

Chemokines can be divided into four families, CXC\CC\CX3C\C, according to structure. Among them, CXCL16 protein exists in the form of both cross-model (TM-CXCL 16) and secretory (sCXCL 16) proteins, and is the second chemokine which has been found to date to exist in a membrane-bound manner. The TM-CXCL16 protein can be cleaved and hydrolyzed by the membrane integrin metalloprotease ADAM 10/ADAM 17, and then shed from the cell surface to form sCXCL16.CXCR6 protein is the only receptor of CXCL16, CXCR6 belongs to a G protein-coupled receptor family member, with a 7-pass transmembrane structure. After CXCL16 interacts with CXCR6, its biological function is shown as: (1) chemotaxis; (2) adhesion; (3) interaction with cytokines. Currently, the CXCL16 protein with biological activity cannot be expressed efficiently using conventional routes.

Disclosure of Invention

Based on this, it is necessary to provide a method for expressing and renaturating recombinant human CXCL16 protein, which can obtain recombinant human CXCL16 protein having biological activity by a prokaryotic expression system.

The invention adopts the following technical scheme:

the invention provides a gene for encoding recombinant human CXCL16 protein, the sequence of which is shown as SEQ ID NO. 1.

The invention also provides a prokaryotic expression vector containing a gene for encoding recombinant human CXCL16 protein.

The invention also provides a method for constructing a prokaryotic expression vector containing a gene for encoding recombinant human CXCL16 protein, comprising the following steps: adopting a primer group shown as SEQ ID NO.2 and SEQ ID NO.3, taking a target gene sequence as a template, and carrying out PCR amplification and product recovery to obtain a target fragment; and carrying out homologous recombination and transformation on the target fragment, and identifying positive clones to obtain the escherichia coli expression system.

The invention provides an expression and renaturation method of recombinant human CXCL16 protein, which comprises the following steps: activating and inoculating prokaryotic expression carrier strain, enlarging culture, inducing expression and collecting thallus; placing thalli into a bacteria breaking liquid for suspension, and performing ultrasonic crushing to obtain inclusion bodies; performing tag purification on the inclusion body to obtain a purified inclusion body solution; and (3) carrying out renaturation treatment on the inclusion body solution: dialyzing with renaturation solution containing Tris, arginine, glycerol, GSSG, GSH and sodium chloride and having pH of 8.0-8.6 to obtain renaturation target protein.

In some of these embodiments, the prokaryotic expression vector strain is placed in LB liquid medium containing ampicillin sodium and chloramphenicol for activation and inoculation.

In some of these embodiments, the steps of expanding culture and inducing expression are: in LB liquid medium containing ampicillin sodium and chloramphenicol, performing expansion culture at 37deg.C and 220rpm, and obtaining OD ₆₀₀ The value is between 0.45 and 0.55, and the culture is induced for 4 hours under the conditions of 0.8mM IPTG, 37 ℃ and 220rpm, and the bacterial cells are collected by centrifugation.

In some of these embodiments, the step of sonicating is: suspending thalli in a first bacteria breaking liquid containing sodium chloride and Tris and having a pH value of 8.0, then placing the first bacteria breaking liquid under the condition of ultrasonic power of 350W for intermittent ultrasonic bacteria breaking, wherein the interval time is 3s, the bacteria breaking time is 5min, then placing the first bacteria breaking liquid in an ice-water mixture for cooling, repeating ultrasonic bacteria breaking, and centrifuging to obtain a precipitate; resuspension is carried out on the sediment by adopting a second bacteria-breaking liquid containing sodium chloride, urea and phosphate and having the pH value of 7.4, ultrasonic bacteria-breaking is carried out again under the same ultrasonic condition as the previous step, and the inclusion body is obtained by centrifugation.

In some embodiments, pure water is used to suspend the inclusion bodies, then centrifugation is performed, then 8M urea PBS buffer is used for dissolution, centrifugation is performed to obtain inclusion body urea buffer, and NI-IDA agarose gel affinity chromatography is used to obtain elution components containing target proteins.

In some of these embodiments, the step of affinity chromatography using NI-IDA agarose gel is: pretreating an NI-IDA agarose gel affinity chromatography column matrix, mixing and culturing a sample and the column matrix, loading the column, eluting the impurity protein, soaking the matrix by adopting imidazole eluents with different concentrations, eluting, and collecting inclusion body elution components containing the target protein.

In some embodiments, the step of renaturating the inclusion body solution comprises: transferring the elution component containing the target protein into a dialysis bag, sequentially adding 6M renaturation solution, 4M renaturation solution, 3M renaturation solution, 2M renaturation solution, 1M renaturation solution and 0.5M renaturation solution at the temperature of 4 ℃ for renaturation, and dialyzing for 4h in each gradient renaturation solution; wherein, 6M renaturation liquid is: 6M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.6; the 4M renaturation solution is as follows: 4M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.5; the 3M renaturation solution is as follows: 3M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.4; the 2M renaturation solution is as follows: 2M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.3; the 1M renaturation solution is as follows: 1M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.1; the 0.5M renaturation solution is: 0.5M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.0.

In some embodiments, the methods of expressing and renaturating recombinant human CXCL16 proteins of the present invention further comprise the step of identifying the biological activity of the renaturated protein.

The recombinant human CXCL16 protein prepared by the expression and renaturation method has the purity of more than 80 percent.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a recombinant human CXCL16 protein with biological activity prepared by a prokaryotic expression system for the first time.

Drawings

FIG. 1 is a CXCL16 sequence-specific assay.

FIG. 2 is a diagram showing CXCL16 sequence conservation analysis.

FIG. 3 is a graph of analysis of transmembrane segments of CXCL16 protein.

FIG. 4 is a graph showing analysis of CXCL16 post-translational modifications.

FIG. 5 is a diagram of a conserved domain analysis of CXCL16.

FIG. 6 is a diagram showing a three-stage structure analysis of CXCL16.

Fig. 7 is a graph showing a secondary structure prediction analysis of CXCL16.

FIG. 8 is a diagram showing epitope prediction by CXCL16.

FIG. 9 is a diagram of PCR extension gel running results during construction of pGEX-4T-AB1-CXCL16 (27-201 aa) vector.

FIG. 10 is an electrophoretogram of inclusion bodies obtained from a prokaryotic expression system containing pGEX-4T-AB1-CXCL16 (27-201 aa).

FIG. 11 is an SDS-PAGE gel of purified fusion proteins.

FIG. 12 is a DS-PAGE gel electrophoresis of renaturated proteins.

Detailed Description

The present invention will be described in further detail with reference to specific examples so as to more clearly understand the present invention by those skilled in the art.

The following examples are given for illustration of the invention only and are not intended to limit the scope of the invention. All other embodiments obtained by those skilled in the art without creative efforts are within the protection scope of the present invention based on the specific embodiments of the present invention.

In the examples of the present invention, all raw material components are commercially available products well known to those skilled in the art unless specified otherwise; in the embodiments of the present invention, unless specifically indicated, all technical means used are conventional means well known to those skilled in the art.

The amino acid sequence of CXCL16 protein is as follows:

MRRGFGPLSLAFFLFLLALLTLPGDGNQGSVAGSCSCDRTISSGTQIPQGTLDHIRKYLKAFHRCPFFIRFQLQSKSVCGGSQDQWVRELVDCFERKECGTGHGKSFHHQKHLPQASTQTPEAAEGTPSDTSTPAHSQSTQHSTLPSGALSLNKEHTQPWEMTTLPSGYGLEARPEAEANEKQQDDRQQEAPGAGASTPAWVPVLSLLAIVFFLTAAMAYVLCNRRATQQNSAGLQLWYTPVEPRP。

the coding gene sequence of CXCL16 protein is as follows:

ATGAGGCGGGGCTTTGGACCCTTGTCTCTTGCGTTCTTCCTTTTCTTGTTGGCGCTGCTGACCCTGCCAGGCGATGGCAACCAGGGCAGTGTCGCTGGAAGTTGTTCTTGTGATCGTACCATTTCTTCTGGCACCCAGATACCGCAGGGTACTTTGGATCACATCCGAAAATACCTGAAAGCATTTCATCGTTGTCCATTCTTTATCAGGTTCCAGTTGCAGTCCAAAAGCGTGTGTGGGGGAAGCCAAGACCAGTGGGTCCGTGAACTAGTGGACTGCTTTGAGCGCAAAGAGTGTGGAACTGGTCATGGGAAGAGTTTTCACCACCAAAAACATTTGCCTCAAGCCAGTACCCAGACCCCTGAGGCCGCAGAGGGGACACCTTCGGACACGAGCACCCCTGCACATAGTCAGAGCACTCAGCACTCCACTCTTCCATCAGGAGCACTGTCCTTAAACAAAGAGCACACCCAACCCTGGGAGATGACCACTCTCCCTTCAGGCTATGGTCTGGAAGCTAGGCCTGAGGCTGAGGCAAATGAGAAACAGCAAGATGACAGACAGCAAGAAGCACCAGGAGCTGGAGCTAGCACACCAGCTTGGGTACCGGTGCTGTCCCTCCTGGCCATTGTCTTCTTCCTCACTGCAGCCATGGCCTATGTGCTGTGCAACAGGAGAGCGACACAGCAGAACTCTGCAGGTTTGCAGCTCTGGTACACTCCTGTTGAACCAAGACCCTAG。

example 1 screening for expressible segments for various analyses of CXCL16

In Mus musculus, the sequence specificity of the gene was analyzed, and as shown in FIG. 1, the gene was found to be more specific.

BLAST against CXCL16 protein sequence in NCBI, results are shown in fig. 2: align found that the protein has relatively high homology in Homo sapiens, rattus norvegicus species, and sequence identity of only 40.2%.

Further analysis of the expressibility of CXCL16 protein: as shown in FIG. 3, CXCL16 protein 1-26aa is a signal peptide and the transmembrane region is 202-222aa. Post-translational modification analysis is shown in FIG. 4. Analysis of the conserved domains is shown in figure 5. The analysis for tertiary structure is shown in fig. 6. The predictions for the secondary structure are shown in fig. 7.

The result of the further analysis of protein antigenicity using the epitope is shown in FIG. 8.

EXAMPLE 2 Synthesis of the Gene of interest

27-201 aa of CXCL16 protein sequence is selected as a target segment, and a target gene for encoding the target segment is designed and synthesized, wherein the specific sequence is as follows:

AACCAGGGCAGTGTCGCTGGAAGTTGTTCTTGTGATCGTACCATTTCTTCTGGCACCCAGATACCGCAGGGTACTTTGGATCACATCCGAAAATACCTGAAAGCATTTCATCGTTGTCCATTCTTTATCAGGTTCCAGTTGCAGTCCAAAAGCGTGTGTGGGGGAAGCCAAGACCAGTGGGTCCGTGAACTAGTGGACTGCTTTGAGCGCAAAGAGTGTGGAACTGGTCATGGGAAGAGTTTTCACCACCAAAAACATTTGCCTCAAGCCAGTACCCAGACCCCTGAGGCCGCAGAGGGGACACCTTCGGACACGAGCACCCCTGCACATAGTCAGAGCACTCAGCACTCCACTCTTCCATCAGGAGCACTGTCCTTAAACAAAGAGCACACCCAACCCTGGGAGATGACCACTCTCCCTTCAGGCTATGGTCTGGAAGCTAGGCCTGAGGCTGAGGCAAATGAGAAACAGCAAGATGACAGACAGCAAGAAGCACCAGGAGCTGGAGCTAGCACACCAGCTTGG(SEQ ID NO.1)。

a plasmid containing the above-mentioned target gene was obtained.

EXAMPLE 3 construction of expression vector pGEX-4T-AB1-CXCL16 (27-201)

The plasmid containing the target gene is used as a template to construct the vector pGEX-4T-1, and since the purification of the protein is considered in the follow-up, an 8his tag is added to the region of the multiple cloning site of the vector pGEX-4T-1, and the vector is named pGEX-4T-AB1.

The specific method comprises the following steps:

s1, specific Primer sequences for Primer design screening using Primer5 are shown in the following table:

s2, obtaining PCR amplified products and recovering products of target fragments.

Wherein, the amplification system of the specific PCR is shown in the following table:

PCR amplification system

The amplification procedure for a specific PCR was as follows: denaturation at 98℃for 5min, denaturation at 98℃for 20s, annealing at 60℃for 30s, extension at 72℃for 1min, cycling for 30 times, incubation at 72℃for 10min, and termination at 16 ℃.

The gel running result of the PCR amplified product is shown in FIG. 9 (pGEX-4T-1-CXCL 16).

Taking recovery of agarose gel DNA recovery kit (product number CW 2302) as an example, the procedure for recovery of the target fragment product is described:

(1) A single DNA band of interest was excised from the agarose gel (excess excised as much as possible), placed into a clean centrifuge tube (self-contained), and the gel weight was weighed (the centrifuge tube weight was recorded in advance).

(2) To the gel block 1 volume Buffer PG was added (e.g. gel weight 100mg, volume can be considered 100. Mu.L, and so on).

(3) And (3) carrying out water bath incubation at 50 ℃, pouring the sol into a centrifuge tube gently at intervals of 3 minutes, and pouring the sol into the centrifuge tube until the sol is yellow, so as to ensure that the gel blocks are fully dissolved. If there is undissolved glue cake, it may be supplemented with a further quantity of glue solution or left for several minutes until the cake is completely dissolved.

It should be noted that the gel solution is yellow after the gel is completely dissolved, and the subsequent operation can be performed; if the gum solution is orange or purple, 10-30 μl of 3M sodium acetate (pH 5.0) can be added to the gum solution to make the color of the solution yellow, and then the subsequent operation is performed. After the gel block is completely dissolved, the temperature of the gel solution is preferably reduced to room temperature and then the gel solution is put on a column, and the DNA binding capacity of the adsorption column is weak at a higher temperature.

(4) Alternatively, when recovering fragments <300bp, 1/2 gel volume of isopropanol should be added and mixed upside down (e.g.gel weighing 100mg, 50. Mu.L of isopropanol is added).

(5) Column balance: 200. Mu.L of Buffer PS was added to the adsorption column (Spin CoLumns DM) loaded in the collection tube, centrifuged at 13000rpm for 1 minute, the waste liquid in the collection tube was discarded, and the adsorption column was replaced in the collection tube.

(6) The solution obtained in

step

3 or 4 is added into an adsorption column filled into a collection pipe, the mixture is placed at room temperature for 2 minutes, and centrifuged at 13000rpm for 1 minute, waste liquid in the collection pipe is poured out, and the adsorption column is placed back into the collection pipe. Note that: the column volume was 750. Mu.L, and if the sample volume was greater than 750. Mu.L, it was added in portions.

(7) 450. Mu.L Buffer PW (before use, check if absolute ethanol has been added) was added to the column, centrifuged at 13000rpm for 1 minute, the waste liquid in the collection tube was decanted, and the column was returned to the collection tube. Note that: if the purified DNA is used in salt sensitive experiments (e.g.blunt end ligation or direct sequencing), it is recommended to add Buffer PW for 2.5 minutes to allow for further centrifugation.

(8) The step 7 is repeated for 2 minutes. The DNA solution was collected by centrifugation at 13000rpm for 1 minute. -20C preserving DNA.

(9) Centrifuge at 13000rpm for 1 minute, pour out waste liquid in the collection tube. Note that: the purpose of this step is to remove the residual ethanol from the column, which can affect subsequent enzymatic reactions (cleavage, PCR, etc.).

(10) The adsorption column was placed in a new 1.5mL centrifuge tube (self-contained), 50uL Buffer EB was suspended and added dropwise to the middle of the adsorption membrane, and the column was left at room temperature for 2 minutes. The DNA solution was collected by centrifugation at 13000rpm for 1 minute. -20C preserving DNA.

It should be noted that, in order to increase the recovery amount of DNA, the solution obtained by centrifugation may be added dropwise to the adsorption column again, and left at room temperature for 2 minutes and centrifuged at 13000rpm for 1 minute. The elution volume should not be less than 30. Mu.L, and too small a volume will affect recovery efficiency. When DNA fragments larger than 10kb are recovered, buffer EB should be preheated in a water bath at 50℃to increase recovery efficiency. The last step uses ddH ₂ O elutes without Buffer EB, which may affect the efficiency of homologous recombination.

S3, homologous recombination and transformation.

Homologous recombination was performed using the product number RM20523 (Botaike organism, wuhan) and the system is shown in the following table:

system of	Volume of
		pGEX-4T-AB1	3μL
Target fragment	2μL
		2X MultiF Seamless Assembly Mix	5μL

In the step, the proportion of the target fragment to the carrier is determined according to the concentration of the recovered product, and the molar ratio is preferably 3:1-10:1, so as to obtain the recombinant product.

Transforming competent cells: taking pre-cooled 1.5ml EP tube, placing on ice box, split charging 100-120 mu L DH5 alpha competence (competence is taken in-80 ℃ refrigerator, put in ice to melt), adding 10 mu L recombined product (better pre-cooling effect) and gently sucking and stirring, placing on ice for 30min after adding (the process is carried out in super clean bench). A hot water bath at 42℃for 90s (strictly controlled time) was placed on ice for 5min, and 800. Mu.L of the antibiotic-free LB/SOB medium was added. Resuscitates for 45min (strictly controlled time) in a 220rmp shaker at 37℃and centrifugation for 3min at 5000rmp, and collects the bacteria. Hot water bath at 42 ℃ for 90s (strictly controlled time), ice for 5min, adding 800 mu L of antibiotic-free LB/SOB culture medium (the process is carried out in an ultra clean bench), resuscitating for 45min (strictly controlled time) in a 220rmp shaking table at 37 ℃, centrifuging for 3min at 5000rmp, and collecting bacteria. Pouring out the supernatant, leaving about 200 mu L of bacterial liquid, sucking and beating the bacterial liquid by a pipettor uniformly, adding the bacterial liquid into a plate with corresponding resistance, pouring 4-6 glass beads, coating the bacterial liquid uniformly by a light shaking plate, pouring out the glass beads, and placing the plate in an incubator at 37 ℃ for overnight culture.

And (5) performing PCR identification on bacterial liquid. Wherein, the identification reaction system is as follows:

PCR instrument amplification reaction procedure: denaturation at 95℃for 5min, denaturation at 95℃for 30s, annealing at 58℃for 30s, elongation at 68℃for 1min, cycling for 35 times, incubation at 68℃for 10min, and termination at 4 ℃.

And selecting correct positive clones, carrying out sequencing verification by adopting a vector universal primer, and carrying out subsequent protein expression by using an expression plasmid after the sequencing is correct.

EXAMPLE 3 prokaryotic expanded expression and purification

S1, inoculating and activating a positive strain:

the antibiotics ampicillin sodium Amp (Shanghai A610028-0025) and chloramphenicol Chl (Shanghai A600118-0050) were added to LB medium.

The method comprises the following specific steps: the inoculation environment and hands are sterilized by 75% alcohol, the operation is carried out around an alcohol lamp, and the liquid LB culture medium is filled with the following components in volume ratio of 1:1000, the corresponding antibiotics Amp (50 mg/ml) and Chl (34 mg/ml) were added respectively, and gently shaken.

The inoculation comprises the following specific steps: taking out 10mL of EP tubes from the sterilization bag, placing the EP tubes on an EP tube rack, placing the EP tubes around an alcohol lamp, marking project information, adjusting the EP tubes to a 2mL gear by using a 5000 mu L pipettor, taking 2mL of LB liquid culture medium containing corresponding antibiotics from corresponding projects in each EP tube, clamping 10 mu L of suction heads to pick single colonies on a plate in the corresponding EP tubes, and culturing at 37 ℃ and 220rpm for overnight after inoculation.

And taking out the EP tube rack from the test tube rack cabinet, taking out the bacterial liquid activated in the shaking table, placing the bacterial liquid on the EP tube rack, and confirming the bacterial liquid state.

S2, performing expansion culture:

taking out 300mL of LB culture medium sterilized in advance, placing the culture medium on a clean and open experiment table, and marking project information. The thawed antibiotics were removed from the 4℃freezer, dried sterilized 1mL pipette tips were removed from the sterile cabinet, and a 1000. Mu.L pipette was selected. The laboratory bench, pipettor and hands were sterilized with 75% alcohol. According to the marked project information, 300 mu L of corresponding antibiotics are added into the culture medium, and then the activated bacterial liquid is shaken uniformly and then poured into LB culture medium. After completion, the culture medium was sequentially transferred to a shaker which had been opened in advance, and cultured at 37℃and 220rpm for 4 hours.

S3, OD value measurement and induction (IPTG: biosharp (BS 119):

the 721 type spectrophotometer was started in advance to preheat for 15min and the wavelength was tuned to 600nm. The thawed inducer IPTG (0.8M/L) was removed from the 4℃refrigerator, and 5mL tips and 1mL tip were removed from the sterile cabinet, ready for 5000. Mu.L and 1000. Mu.L pipettes.

8 2mL EP tubes were removed from the EP tube box and placed sequentially on the EP tube plate, and the 5000. Mu.L pipettor was adjusted to 1.75mL gear for use. Firstly, adjusting the value of T by using a black baffle plate to be 0, then filling pure water into a cuvette to adjust the value of A to be 0, and adjusting for standby.

The 2mL EP tube required for sampling was prepared before and item information was marked. And (3) suspending the shaking table, carefully unwinding aluminum foil paper wrapping the bottle mouth of the conical flask, holding the edge of the aluminum foil paper by a left hand, lifting the aluminum foil paper upwards, holding a 5000-mu L pipettor by a right hand, taking 1.75mL of culture into a corresponding 2mL EP tube according to project information, fastening the aluminum foil paper again after taking out, closing a shaking table cabin door after taking out all the culture, and opening the shaking table. Note that: before the bacterial liquid is absorbed, the turbidity degree of the bacterial liquid is observed, if the bacterial liquid is too clear, the bacterial liquid is continuously cultured, and the bacterial liquid is absorbed for detection.

The OD value is measured by the following steps: washing the cuvette with purified water, sucking the water with paper, and wiping the water and stains on the light surface of the cuvette. Pouring into cuvette according to the sucking sequence, checking whether the light surface is clean and dry, if water stain exists, wiping gently, and measuring OD ₆₀₀ And (5) recording the value and the detection time.

The induction method comprises the following steps: OD (optical density) ₆₀₀ The value is between 0.45 and 0.55, and the culture is carried out for 4 hours at 220rpm at the temperature of 37 ℃ and 0.8mM IPTG.

And (3) bacterial collection: transferring the induced bacterial liquid into a dry 500mL centrifugal bottle, balancing by an electronic scale, adding pure water if the mass is different, centrifuging at 4000rpm for 10min by a horizontal rotor, discarding the supernatant, placing the centrifugal bottle in the normal position, and preserving the bacterial cells at-20 ℃.

S4, ultrasonic bacteria breaking

Suspending thalli: 30mL of the bacterial suspension (1) (50 mM Tris-HCL,300mM Nacl,pH8.0) was used to suspend the cells in a centrifuge bottle. The bacterial liquid is HIS tag protein bacterial liquid.

The method for ultrasonic disruption of cells comprises the following steps:

a) Crushing for the first time: the suspended bacterial liquid was transferred to a 50mL round bottom centrifuge tube, placed in an ice box and fixed with ice. Selecting an amplitude transformer (No. 6), placing the amplitude transformer into a bacteria breaking cabin, wherein the power is 350W, the bacteria breaking time is 3s, the interval time is 3s, the time is counted down for 5min, then placing the amplitude transformer into an ice-water mixture for cooling for 5min, and repeating the steps for breaking bacteria for 5min. After completion, the mixture was packed into two separate tubes and centrifuged at 9000rpm for 10min to obtain supernatant (1) and pellet.

b) Crushing for the second time: 30mL of the bacteria-destroying liquid (2) (2M urea, 1X PBS buffer solution) is measured and poured into the sediment, the sediment is uniformly blown, the sediment is transferred into a 50mL round bottom centrifuge tube, the power is 350W, the bacteria-destroying time is 3s, the interval time is 3s, the bacteria liquid is crushed for 5min (the bacteria liquid is placed in ice cubes), and the supernatant (2) and the inclusion body are obtained by centrifuging at 9000rpm for 10 min.

S5, inclusion body treatment and SDS-PAGE gel electrophoresis detection and analysis:

adding 6mL of pure water to suspend the inclusion body, subpackaging into 42 mL centrifuge tubes, centrifuging at 12000rpm for 2min, and discarding the supernatant. One of the tubes was selected, 1.5mL of 8M urea-PBS buffer was added, and after being blown uniformly with a Pasteur pipette, the solution was shaken on a small shaker for 30min to facilitate dissolution, centrifuged at 12000rpm for 1min, and the supernatant was transferred to a new 2mL EP tube.

And (3) respectively diluting the obtained supernatant (1) by using Loading Buffer for 2 times, diluting inclusion bodies for 2 times, diluting the inclusion bodies for 5 times and diluting the inclusion bodies for 10 times, and marking. The result of the electrophoretic separation is shown in FIG. 10, and the target protein was subjected to tag purification in inclusion bodies.

S7, carrying out protein purification and detection by adopting an NI-IDA agarose gel affinity chromatography column (Tiandi people and Fei En):

a) Taking out Ni-IDA affinity purification matrix (solid matrix) pre-packed column from 4 deg.C refrigerator, placing on purification support, pulling out the lower cover of pre-packed column, connecting with constant flow pump hose, and uncovering the upper cover of pre-packed column. And starting a constant flow pump, and controlling the flow rate to be 2mL/min.

b) Ethanol (commercial packing was stored with 20% ethanol) was washed out of the Ni-IDA affinity purification matrix (pre-cartridge 2 mL) with 30mL pure water.

c) 10mL of a 0.2M nickel sulfate solution was added to the matrix, gently mixed with a Pasteur pipette, and then allowed to stand for 10min, with a flow rate of 2mL/min being controlled, and the liquid was drained. Note that: in all the processes of treating the substrate, the liquid is required to be unable to drain, the mixing action is mild, and no bubbles are required to exist in the substrate.

d) The residual nickel sulfate was washed with 30mL of pure water, the matrix was equilibrated with 30mL of Binding Buffer (Binding Buffer), the flow rate was controlled to 2mL/min, and the liquid was drained.

e) Mixing the supernatant (stored at low temperature of 4 ℃) of inclusion bodies after 8M urea dissolution and centrifugation with a matrix in a 50mL centrifuge tube, combining for 45min on a mixed culture device at 4 ℃, adding the combined liquid into a pre-packed column, controlling the flow rate to be 2mL/min, flowing out the liquid, and collecting the flowing-through liquid.

f) The column was washed with about 30mL of wash Buffer (wash Buffer), the unbound or weakly bound protein from the column was washed off, the flow rate was controlled at 2mL/min, the liquid was drained, and the Washing was terminated when the elution of the protein was complete (G250 285 μl in a 1.5mL EP tube, and the eluting solution was added to a 15 μl tube, e.g. G250 was not blued, i.e. the Washing was completed).

g) And (3) pulling the hose out of the preassembled column, draining the liquid in the hose, adjusting the flow rate to 0.6mL/min, suspending the operation of the constant flow pump, and connecting the hose. The matrix was soaked in 4mL of Elution Buffer (solution Buffer A) for 5-8min, after sufficient reaction, the constant flow pump was turned on to collect the eluate in a 10mL EP tube at a flow rate of 0.6 mL/min. When 1ML of eluent was collected, G250 was used to determine if any protein was eluted (G250 285. Mu.L in a 1.5ML EP tube was added to 10. Mu.L of the eluent being dropped in the tube, if G250 turned blue, then any protein was eluted and the eluent was collected continuously, otherwise no protein was eluted, and the protein was eluted by using Elutation Buffer B as the Elution Buffer, as described above). When the liquid in the preassembled column is about to run out, supplementing an absorption Buffer A into the preassembled column by taking the volume of 2ml as a unit, respectively detecting by using G250 when 4ml, 6ml and 8ml of eluent are collected in an EP tube, judging whether to continuously collect the protein according to the color (see label), and generally receiving 6-8 ml.

h) 15mL of 0.5M EDTA solution was taken and added to the pre-packed column, ni2+ was washed off, the flow rate was controlled at 2mL/min, the liquid was drained, and finally the matrix turned white.

i) The substrate was rinsed with 15mL of 0.2M NaOH solution, the flow rate was controlled to 2mL/min, and the liquid was drained.

j) The substrate was washed with 100mL of water, the flow rate was controlled at 2mL/min, and the effluent was checked with pH paper until the pH was consistent with the pH of the water and washing was stopped.

k) The matrix was rinsed with 50mL of 70% ethanol, the flow rate was controlled at 2mL/min, and the liquid was drained.

l) adding 5ml of 20% ethanol into the pre-packed column, preserving the column material and preserving at 4 ℃.

m) subjecting the collected fluid and eluted target protein to SDS-PAGE.

The washing system of the buffer for purification of His-Tag fusion protein is shown in the following table:

buffer name	Tris(mM)	NaCl(mM)	Imidazole(mM)
				Binding Buffer	50	250	0
Washing Buffer	50	250	50
				Elution Buffer A	50	250	250
Elution Buffer B	50	250	500

The detection result of SDS-PAGE gel electrophoresis of the fusion protein is shown in FIG. 11.

S7, inclusion body renaturation:

transferring the purified inclusion body solution into a dialysis bag, sequentially placing the dialysis bag into 6M, 4M, 3M, 2M, 1M and 0.5M renaturation solution, wherein the renaturation temperature is 4 ℃, and each gradient is dialyzed for 4 hours.

The composition system of the renaturation solution is shown in the following table:

20. Mu.L of the solution after completion of renaturation was added to 20. Mu.L of a 2-charging buffer, and the results are shown in FIG. 12.

After the inclusion body renaturation, the concentration of the target protein is 1.5mg/mL, and the purity reaches 85 percent.

Example 4 biological Activity test

The biological activity of renaturation target protein is tested by adopting an indirect ELISA method in the embodiment:

coating protein CXCL16, coating concentration 1. Mu.g/mL, 100. Mu.l/well.

Receptor protein: CXCR6 (proteontech, ag 27239).

Initial working concentration: 1. Mu.g/mL, 100. Mu.l/well. The dilution setting ratio is as follows: 1:1,1:10,1:20,1:40.

An antibody: anti-CXCR6 Anti-body (abcam, ag 27239). Dilution ratio of anti-dilution: 1:1000.

and (2) secondary antibody: HRP gold Anti-Rabbit IgG (H+L) (AS 014) (abclon al, ag 27239). Secondary antibody dilution ratio: 1:5000.

sealing liquid: 5% BSA solution.

Negative control: the CXCL16 protein was not coated and BSA blocking was performed directly, and subsequent procedures were consistent with the samples.

Positive control: coating CXCR6 protein, and subsequent operation is consistent with the sample.

The results are fed back in the following table (1, 2 is a complex pore, test wavelength 450 nm):

test group	OD ₄₅₀ (1)	OD ₄₅₀ (2)
			1:40	0.2175	0.2201
1:20	0.3128	0.2925
			1:10	0.5827	0.5484
1:1	1.3508	1.2529
			Positive and negative	2.1071	2.177
Negative of	0.0361	0.0339

As can be seen from the table above: the constructed chemokine recombinant human CXCL16 can be combined with the receptor CXCR6 protein thereof, and has the bioactivity function.

It should be noted that the above examples are only for further illustrating and describing the technical solution of the present invention, and are not intended to limit the technical solution of the present invention, and the method of the present invention is only a preferred embodiment and is not intended to limit the scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Wuhan ai Botaike Biotechnology Co.Ltd

<120> expression and renaturation method of recombinant human CXCL16 protein

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 525

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

aaccagggca gtgtcgctgg aagttgttct tgtgatcgta ccatttcttc tggcacccag 60

ataccgcagg gtactttgga tcacatccga aaatacctga aagcatttca tcgttgtcca 120

ttctttatca ggttccagtt gcagtccaaa agcgtgtgtg ggggaagcca agaccagtgg 180

gtccgtgaac tagtggactg ctttgagcgc aaagagtgtg gaactggtca tgggaagagt 240

tttcaccacc aaaaacattt gcctcaagcc agtacccaga cccctgaggc cgcagagggg 300

acaccttcgg acacgagcac ccctgcacat agtcagagca ctcagcactc cactcttcca 360

tcaggagcac tgtccttaaa caaagagcac acccaaccct gggagatgac cactctccct 420

tcaggctatg gtctggaagc taggcctgag gctgaggcaa atgagaaaca gcaagatgac 480

agacagcaag aagcaccagg agctggagct agcacaccag cttgg 525

<210> 2

<211> 46

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ccgcgtggat ccccggaatt caaccagggc agtgtcgctg gaagtt 46

<210> 3

<211> 43

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgatgcggc cgctcgagcc aagctggtgt gctagctcca gct 43

Claims

1. A method for expressing and renaturating recombinant human CXCL16 protein, comprising the steps of:

taking a gene sequence shown as SEQ ID NO.1 as a template, adopting a primer group shown as SEQ ID NO.2 and SEQ ID NO.3 to carry out PCR amplification and product recovery to obtain a target fragment; constructing a plasmid containing a target gene as a template into a vector pGEX-4T-1, adding an 8his tag in a region of a multiple cloning site of the vector pGEX-4T-1, carrying out homologous recombination and transformation on the target fragment, and identifying positive clones to obtain an escherichia coli expression system;

activating and inoculating Escherichia coli strain, placing in LB liquid medium containing ampicillin sodium and chloramphenicol, performing amplification culture at 37deg.C and 220rpm, and culturing at OD ₆₀₀ The value is between 0.45 and 0.55, and the culture is induced for 4 hours under the conditions of 0.8mM IPTG, 37 ℃ and 220rpm, and the thalli are collected by centrifugation;

placing the thalli into a bacteria breaking liquid for suspension, and carrying out ultrasonic breaking: suspending thalli in a first bacteria breaking liquid containing sodium chloride and Tris and having a pH value of 8.0, then placing the first bacteria breaking liquid under the condition of ultrasonic power of 350W for intermittent ultrasonic bacteria breaking, wherein the interval time is 3s, the bacteria breaking time is 5min, then placing the first bacteria breaking liquid in an ice-water mixture for cooling, repeating ultrasonic bacteria breaking, and centrifuging to obtain a precipitate; re-suspending the precipitate by adopting a second bacteria-destroying solution containing sodium chloride, urea and phosphate and having a pH value of 7.4, performing ultrasonic bacteria-destroying under the same ultrasonic conditions as the previous step, and centrifuging to obtain inclusion bodies;

performing tag purification on the inclusion body: suspending inclusion bodies by pure water, centrifuging, dissolving by using 8M urea PBS buffer solution, centrifuging to obtain inclusion body urea buffer solution, and carrying out affinity chromatography by using NI-IDA agarose gel to obtain elution components containing target proteins to obtain purified inclusion body solution;

carrying out renaturation treatment on the inclusion body solution to obtain renaturation target protein; the steps of renaturation treatment on the inclusion body solution are as follows: transferring the elution component containing the target protein into a dialysis bag, sequentially adding 6M renaturation solution, 4M renaturation solution, 3M renaturation solution, 2M renaturation solution, 1M renaturation solution and 0.5M renaturation solution at the temperature of 4 ℃ for renaturation, and dialyzing for 4h in each gradient renaturation solution; wherein, 6M renaturation liquid is: 6M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.6;

the 4M renaturation solution is as follows: 4M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.5;

the 3M renaturation solution is as follows: 3M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.4;

the 2M renaturation solution is as follows: 2M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.3;

the 1M renaturation solution is as follows: 1M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.1;

the 0.5M renaturation solution is: 0.5M urea, tris 50mM, naCl250mM, arginine 500mM, glycerol 1400mM,GSSG 0.2mM,GSH 0.2mM,pH value 8.0.

2. The method of claim 1, wherein the step of affinity chromatography using NI-IDA agarose gel comprises: pretreating an NI-IDA agarose gel affinity chromatography column matrix, mixing and culturing a sample and the column matrix, loading the column, eluting the impurity protein, soaking the matrix by adopting imidazole eluents with different concentrations, eluting, and collecting inclusion body elution components containing the target protein.

3. The method of claim 1 or 2, further comprising the step of identifying the biological activity of the renatured protein.