CN115093972A

CN115093972A - Cordyceps militaris strain and application thereof

Info

Publication number: CN115093972A
Application number: CN202210448627.8A
Authority: CN
Inventors: 汪滢; 邹根; 李燕; 陈洪雨; 鲍大鹏
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2022-04-26
Filing date: 2022-04-26
Publication date: 2022-09-23
Anticipated expiration: 2042-04-26
Also published as: CN115093972B

Abstract

The invention discloses a cordyceps militaris strain and application thereof, and relates to the technical field of edible fungi. The invention discloses a Cordyceps militaris strain (Cordyceps militaris), the preservation number of which is CGMCC No. 40061. The strain has golden color of aerial mycelium, vigorous vitality, no fruiting body, high cordycepin and adenosine levels, and high growth speed.

Description

Cordyceps militaris strain and application thereof

Technical Field

The invention relates to the technical field of edible fungi, and particularly relates to a cordyceps militaris strain and application thereof.

Background

As a traditional Chinese medicine, the research and application of cordyceps sinensis are always concerned. Cordyceps is a fungus-worm complex formed by parasitizing spores of a fungus belonging to the genus Cordyceps (Cordyceps) belonging to the family Clavicipitaceae (Clavicipitaceae) of the phylum Ascomycoa (Ascomycoa), order Hypocrea (Hypocrea) on insect larvae and growing fruit bodies from the bodies in summer. Among them, the most notable are Cordyceps sinensis (Ophiophagy cepsciensis) parasitic to larvae of mountain hepialus armoricanus (Hepialus armoricanus) and Cordyceps militaris (Cordycepsmithia) parasitic to pupae of Lepidoptera (Sung et al, 2007). Cordyceps sinensis has various medicinal effects including: has the functions of resisting tumor, regulating immunity, resisting oxidation, resisting inflammation, killing parasite, resisting microorganism, reducing blood fat and blood sugar, resisting aging, protecting nerve, protecting kidney, etc., and has important functions in tumor treatment, organ transplantation, liver and kidney transplantation, heart protection, etc. The main components of the composition comprise four types: 1) nucleotides, 2) polysaccharides, 3) polypeptides and glycoproteins, 4) sterols and terpenes. Wherein polysaccharides are involved in anti-inflammatory, antioxidant, antitumor, immunomodulatory, lipid metabolism, etc., cordycepin is beneficial for antitumor, pesticidal and antimicrobial activities, sterols are endowed with antitumor and immunomodulatory activities (Lee et al, 2011, International Immunopharmacology 11, 1226-1233).

In biotechnology, the group of the Wangchuan project, a mycologist in China, has taken the lead to the whole Genome sequencing of Cordyceps militaris (Zheng et al, 2011, Genome Biology 12, R116). China is also a big country for cultivating cordyceps militaris. According to relevant research, the main producing areas of the artificial cordyceps militaris in China are Jiangmen Xinhui areas and Liaoning areas. The yield of the Liaoning cordyceps militaris accounts for more than seven percent of the national yield, and the market scale of the cordyceps militaris in China is nearly 15 hundred million yuan. Therefore, finding out factors for improving the utilization of energy sources by the cordyceps militaris and shortening the fruiting time has very important significance in production.

Disclosure of Invention

The invention aims to provide a cordyceps militaris strain and application thereof. The cordyceps militaris strain aerial hyphae provided by the invention is golden yellow in color, vigorous in vitality, free of fruiting body, high in cordycepin and adenosine levels and high in growth speed.

The invention is realized by the following steps:

on one hand, the invention provides a Cordyceps militaris strain (Cordyceps militaris), and the preservation number of the Cordyceps militaris strain is CGMCC No. 40061.

The cordyceps militaris strain provided by the invention is obtained by domesticating and mutating a wild type strain. In 2022, 1 month and 14 days, the strain is preserved in the China general microbiological culture Collection center, the preservation address is No. 3 Xilu No.1 Hospital, Beijing, Chaoyang, the North Cheng, the name of Latin: cordyceps militaris with the preservation number of CGMCC NO. 40061.

The cordyceps militaris strain has the advantages that: the aerial hyphae are golden yellow in color, vigorous in vitality, free of fruiting body (the fruiting body free strains can quickly form a large amount of hyphae compared with the fruiting body free strains, most energy is supplied for the growth of the hyphae and the generation of secondary metabolites), high in cordycepin and adenosine level and high in growth speed; when the fermentation is carried out by pure liquid, thick mycelium blocks can be quickly formed; during solid fermentation, the strain can quickly grow into the culture medium, and forms a good adhesive effect on the culture medium. In another aspect, the present invention provides a method for preparing cordycepin or adenosine, comprising: culturing the Cordyceps militaris strain, and collecting the culture product containing cordycepin and/or adenosine.

Alternatively, in some embodiments of the invention, the culture product is cordyceps militaris mycelium.

Optionally, in some embodiments of the invention, the medium for culturing the cordyceps militaris strain is PDA medium, wheat grain solid medium, SDB liquid medium, rice soup liquid medium, or a combination thereof.

Optionally, in some embodiments of the invention, the cultured cordyceps militaris strains comprise:

inoculating the strain of the cordyceps militaris strain to a PDA culture medium for activation, inoculating the activated strain to obtain an SDB liquid culture medium for culture, and standing to obtain cordyceps militaris mycelium containing cordycepin and/or adenosine.

Optionally, in some embodiments of the invention, culturing the cordyceps militaris strain comprises:

inoculating the strain of the cordyceps militaris strain to a PDA culture medium for activation, then inoculating the activated strain to an SDB liquid culture medium to obtain a spore liquid of the cordyceps militaris, and transferring the spore liquid to a rice water culture medium for culture to obtain cordyceps militaris mycelium containing cordycepin and/or adenosine.

inoculating the strain of the cordyceps militaris strain to a PDA culture medium for activation, then inoculating the activated strain to an SDB liquid culture medium to obtain a spore liquid of the cordyceps militaris, and transferring the spore liquid to a wheat solid culture medium for culture to obtain cordyceps militaris mycelium containing cordycepin and/or adenosine.

Alternatively, in some embodiments of the invention, the culture conditions on the rice soup medium or on the wheat grain solid medium are: standing for 13-15 days at 24-26 deg.C and humidity of 75-85%, and irradiating with light: the dark ratio is 11-13h:13-11 h.

In another aspect, the present invention provides a method for identifying the cordyceps militaris strain as described above, comprising: amplifying nucleic acid extracted from the cordyceps militaris strain by using SSR primers.

Alternatively, in some embodiments of the invention, the SSR primer pair comprises: primers shown in SEQ ID NO. 1-60.

The primers shown in SEQ ID NO.1-60 are grouped according to Table 3, amplification is carried out respectively, products after amplification are subjected to electrophoresis, the amplification results of the primer pairs are compared with those in figure 4, and if the amplification results are all consistent, the cordyceps militaris strain CGMCC No.40061 is obtained.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention, and therefore should not be considered as limiting the scope, and it is obvious for those skilled in the art that other related drawings can be obtained from the drawings without inventive efforts.

FIG. 1 is a photograph showing the growth morphology results of the Cordyceps militaris strains in example 3 in the SDB liquid medium.

FIG. 2 is a photograph showing the growth morphology of the Cordyceps militaris strain in example 3 in the rice-water liquid medium.

FIG. 3 is a photograph showing the growth morphology of the Cordyceps militaris strain in example 3 in a wheat grain solid medium.

FIG. 4 shows the result of the amplification of the SSR primer for detecting the strain CGMCC No.40061 designed in example 2.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used are not indicated by the manufacturer, and are conventional products commercially available.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1: domestication of cordyceps militaris strains

The inventor of the invention carries out surface disinfection on the cordyceps militaris fruiting body collected in the field in the period of 7-2020-12 months in 2018, uses 0.1% mercuric chloride solution or 75% alcohol to wash the surface liquid medicine, places the liquid medicine above a container containing PDA culture medium in a suspended mode, carries out standing culture at the temperature of 21-22 ℃, and picks single or multiple colonies in an inoculation box to place the colonies in a test tube slant culture medium for culture when aweto colonies appear on the surface of the culture medium. Purifying after the cordyceps militaris hyphae are covered with the inclined plane. And selecting a small amount of the separated bacterial strains, performing liquid shaking culture, inoculating the bacterial strains on a rice culture medium, and performing a weed emergence test. After the continuous 3-generation grass growing tests are compared, a strain with stable grass growing period of about 50 days, average biotransformation rate of about 80% and average cordycepin content of about 4.5mg/g is obtained, namely the parent strain of the variety to be bred.

In 2019, 1 month to 2019, 5 months, the strain is separated by a method of grafting back living silkworm pupas and separating hyphae from the silkworm pupas, the growth activity of the strain is improved, the growth rate on a culture dish is improved, the feeding speed on a rice culture medium is improved, the biotransformation rate is greatly improved and reaches about 100%, but the cordycepin content is slightly reduced on the contrary, and the average cordycepin content is about 4 mg/g. The method is continuously repeated for breeding, and the domestication improving effect is not obvious.

And further breeding repeatedly by using a tissue separation method in 6 months to 12 months in 2019, wherein the content of the cordycepin is gradually increased to 7mg/g, and the biotransformation rate is maintained at 90%.

And (2) breeding by repeatedly utilizing a tissue separation method of the back-grafting living silkworm pupae and the fruiting body in 1-12 2020 years until the strain shows relatively stable biotransformation rate and cordycepin content, the biotransformation rate can stably reach 95%, the cordycepin content reaches more than 4.5mg/g, and the breeding target is achieved.

Then the strain is subjected to China general microbiological culture collection management center with the collection number of CGMCC No. 40061.

Example 2: identification of Cordyceps militaris strains

(1) ITS identification of strains

With ITS 1: 5'-tccg tagg tgaa cctg cgg-3' (SEQ ID NO.62) and ITS4:5'-tcct ccgc ttat tgat atgc-3' (SEQ ID NO.63), and ITS amplification was performed on the DNA of the test strain (CGMCC No. 40061). PCR reaction (50. mu.L): mix 25. mu.L, forward and reverse primers 2. mu.L each, template DNA 1. mu.L, ddH2O 20. mu.L. And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 1min for 30 cycles; filling the mixture for 5min at 72 ℃. The product is detected by 1% agarose gel electrophoresis to have a single band and is sent to Shanghai biological engineering company Limited for sequencing, the obtained sequence is compared with the cordyceps militaris ITS sequence downloaded from the NCBI website by using DNMAN software, and the result is consistent, which indicates that the strain is the cordyceps militaris strain.

ITS sequence (SEQ ID NO.61) of CGMCC No.40061 strain:

gtcaatcggcggtgtcgccctttcctccgcttattgatatgcttaagttcagcgggtattcctacctgatc cgaggtcaacgttcagagttgggcgttttacggcgtggccacgtcgggttcccggtgcgagttggggtactacgc agaggtcgccgcggacgggccgccacttcatttcgggggcggcggtgtgctgccggtccccaacgccgacatccc ccaggggacgtcgagggttgaaatgacgctcgaacaggcatgcccgccagaatgctggcgggcgcaatgtgcgtt caaagattcgatgattcactgaattctgcaattcacattacttatcgcatttcgctgcgttcttcatcgatgcca gagccaagagatccgttgttgaaagttttgattcatttgttttgccttgcggcggattcagaaaaactggtagat acagtgtttggggcccccgacggccgccgcccaggcccgcgtccaggcgctgggcgagtccgccgaagcaacgat aggtatgttcacaaagggttgggagttggaaaactcgttaatgatccctccgcaggttcacctacggaaagggcg acacgcgattgcagtcaatactgacgatggtcatagctgtttcctgtgtgaaattgttatccgcttccatagcag aaagtcaaaagcctccgaccggaggcttttgacttgatcggcacgtaagaggttccaactttcaccataatgaaa taagatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatgagtattcaac atttccgtgtcgcacttattccgttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtga gagtaaaagatgctgaagatcagttggggtgcacgagtgggttacatcgaactggatctcaacagcgggaagaat ccttgaga。

(2) SSR identification of strains

Downloading a whole genome sequence (NZ _ AEVU00000000.1) of cordyceps militaris from an NCBI (national center for Biotechnology information) gene bank, operating an MISA script program by using Perl software according to a method of Wangying and the like, and searching for the SSR of the cordyceps militaris according to a standard that the single to six bases are repeated for at least 20, 9, 6, 5 and 5 times and the distance between two SSRs is less than 100bp, namely the SSR is regarded as a composite SSR.

Specific primers were designed for SSR batches retrieved by MISA using Primer 3. The main parameters for designing the primers were: the content of (G + C) is 40-60%, the annealing temperature is 55-60 ℃ (55 ℃ is the best), the length of the pre-amplification fragment is 100-500 bp, and the length of the primer is 18-22 bp. The designed primers (Table 3) were synthesized by Shanghai Jieeri Biotech Co., Ltd. The PCR system and procedure were as per Table 1 and Table 2 (one pair of primers was added for each amplification). The specific amplification results are shown in FIG. 4.

TABLE 110. mu.L PCR reaction System

TABLE 2 PCR amplification procedure

TABLE 3 SSR primers for identifying Cordyceps militaris strain (CGMCC No.40061)

Example 3: hyphal characteristics of Cordyceps militaris strains

PDA culture medium: 200g of potato is cleaned, peeled, cut up, added with 1000ml of water, boiled for half an hour, filtered by gauze, added with 10 to 20g of glucose and 17 to 20g of agar, filtered by gauze when the mixture is hot after being fully dissolved, subpackaged and sterilized by high pressure (121 ℃,20 minutes).

Wheat grain solid medium: 30g of wheat, 0.6g of silkworm chrysalis meal and 45mL of water in each bottle.

SDB shake flask broth: each flask contained 3g of Sha's medium and 100mL of water.

Rice water liquid culture medium: adding 100g of rice and 20g of cicada pupa powder into 1L of water, boiling for 15 minutes, and preparing identification medium base solution; mixing the SDB culture medium with the concentration of 24g/L with the prepared rice water culture medium basic solution, subpackaging in triangular flasks, 100-150 mL per flask, and autoclaving.

Strain activation and secondary liquid strain acquisition:

inoculating Cordyceps militaris strains to a PDA (personal digital Assistant) plate, and placing the inoculated strains in an incubator at the temperature of 25 ℃ and the humidity of 80% for activated culture for 7 days; selecting 3-4 activated fungus blocks with the diameter of 1cm, transferring the activated fungus blocks into liquid SDB for liquid culture to obtain secondary liquid strains with the concentration of 1 x 104/mL, filtering to obtain spore liquid of cordyceps militaris, and mixing the two liquid strains according to the ratio of 1: 100 volume ratio, transferring into SDB culture medium, and culturing for 4 days at 25 ℃ and 150rpm with shaking.

SDB liquid culture step and liquid culture hypha characteristics:

(1) inoculating Cordyceps militaris strain (CGMCC No.40061) to PDA plate, and activating and culturing the inoculated strain in an incubator at 25 deg.C and 80% humidity for 7 days; selecting 3-4 activated bacteria blocks with diameter of 1cm, transferring into liquid SDB, and culturing to obtain bacteria blocks with concentration of 1 × 10 ⁴ Filtering the second-level liquid strain per mL to obtain cordyceps militaris spore liquid, and mixing the cordyceps militaris spore liquid with the second-level liquid strain per mL according to the ratio of 1: 100 volume ratio, transferring into SDB culture medium, and shake culturing at 25 deg.C and 150rpm for 4 days;

(2) directly standing the zymophyte liquid obtained by shake culture for 14 days to obtain a fermentation product of pure mycelium, wherein the mycelium is similar to mushroom meat, is lumpy and golden yellow as shown in figure 1, presents texture of velvet, does not generate sporocarp, and grows a large amount of mycelium.

Rice soup liquid culture medium and fermentation hypha characteristics:

(1) inoculating Cordyceps militaris strains to a PDA (personal digital Assistant) plate, and placing the inoculated strains in an incubator at the temperature of 25 ℃ and the humidity of 80% for activation culture for 7 days; selecting 3-4 activated fungus blocks with the diameter of 1cm, transferring the activated fungus blocks into liquid SDB for liquid culture to obtain secondary liquid strains with the concentration of 1 x 104/mL, filtering to obtain spore liquid of cordyceps militaris, and mixing the two liquid strains according to the ratio of 1: transferring the culture medium into an SDB culture medium according to the volume ratio of 100, and performing shake culture for 4 days at the temperature of 25 ℃ and the speed of 150 rpm;

(2) the activated spore liquid obtained in the above way is mixed according to the ratio of 2.5: adding 100 volume ratio of the extract into rice soup culture medium, stirring, placing in an incubator with 25 deg.C and 80% humidity, and irradiating: the dark ratio is 12h to 12h, and the whole fermentation product of the pure mycelium can be obtained after direct standing for 14 days. As shown in FIG. 2, the mycelia had a block shape with a thickness of 1cm, a golden yellow color, a texture of velvet, no generation of fruit body, and a large amount of mycelia were grown.

Culturing a wheat solid culture medium and performing hypha characteristic:

(1) inoculating Cordyceps militaris strains to a PDA (personal digital Assistant) plate, and placing the inoculated strains in an incubator at the temperature of 25 ℃ and the humidity of 80% for activated culture for 7 days; selecting 3-4 activated fungus blocks with the diameter of 1cm, transferring the activated fungus blocks into liquid SDB for liquid culture to obtain secondary liquid strains with the concentration of 1 x 104/mL, filtering to obtain spore liquid of cordyceps militaris, and mixing the two liquid strains according to the ratio of 1: transferring the culture medium into an SDB culture medium according to the volume ratio of 100, and performing shake culture for 4 days at the temperature of 25 ℃ and the speed of 150 rpm;

(2) uniformly adding 5ml of the obtained activated spore solution into a sterilized wheat grain solid culture medium for culture, placing in an incubator with the temperature of 25 ℃ and the humidity of 80%, and illuminating: standing for 14 days in dark ratio of 12h to obtain solid mycelium fermentation product; as shown in FIG. 3, the mycelia completely penetrated into the culture medium to form a whole mycelia block with a golden color, no fruiting body was produced, and a large amount of mycelia were grown.

Example 4: content detection of cordycepin and adenosine in mycelia cultured by fermentation

HPLC is adopted to analyze the content of the cordycepin and the adenosine.

The method comprises the following steps:

chromatographic conditions are as follows:

the chromatographic column was SunfireR C18(4.6 mm. times.250 mm, 5 μm), the mobile phase was methanol-water (20: 80), the flow rate was 1mL/min, the detection wavelength was 260nm, the column temperature was 25. + -. 5 ℃ and the sample size was 10 μ L.

Establishing a standard curve:

respectively and accurately weighing 10mg of cordycepin and adenosine standard substances, dissolving the cordycepin and adenosine standard substances in 50% methanol solution, fixing the volume to 10mL to obtain 1mg/mL of cordycepin and adenosine solution, respectively putting 0, 0.2, 0.4, 0.8, 1.2 and 1.6mL in 6 10mL volumetric flasks, fixing the volume to a scale, carrying out filter pressing through a 0.22 mu m microporous filter membrane, and determining according to chromatographic conditions. And drawing a standard curve by taking the mass concentration (mg/mL) of the standard curve as an X axis and the peak area as a Y axis.

Preparation of a test solution:

freeze-drying and grinding the hypha, taking 0.5g of hypha powder, and adding water to a constant volume of 10 mL; the fermentation broth was centrifuged to obtain 10mL of supernatant, which was repeated 3 times. Ultrasonic extracting (40KHz, 225W) for 60 min, centrifuging at 5000rpm for 15min, collecting supernatant, and filter-pressing with 0.22 μm microporous filter membrane to obtain test solution.

The cordycepin content in the mycelia obtained from different fermentation media in example 3 was measured separately. The results show that the cordycepin content of the SDB liquid culture fermentation mycelia is 5mg/g, the cordycepin content of the solid culture fermentation mycelia is 4.1 thousandth of the solid culture mycelia, the cordycepin content of the rice water liquid culture medium is 4.5mg/g, and the cordycepin content of the wheat solid culture medium is 4.1 mg/g. The cordycepin content of the strain mycelium is high, and completely meets the national regulation on cordycepin content of cordyceps militaris strains.

In conclusion, the cordyceps militaris strain (CGMCC No.40061) obtained by the embodiment of the invention has golden color, vigorous hypha vitality and high growth speed; the mycelium has strong ability to penetrate the culture medium, high utilization efficiency of the substrate, especially no fruiting body, can grow a large amount of mycelium, and the cordycepin content is still kept at a normal level compared with that before domestication.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Shanghai city academy of agricultural sciences

<120> Cordyceps militaris strain and application thereof

<160> 63

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

atgacccaat tggcactttc 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

actggcgtgt tagtcggagt 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

gaatgaccaa gacccaaacc 20

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

caaaccttgg ctcactaacc a 21

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

ggcgtggtag aatcagtggt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

ttgacaaatt cctctgtgcg 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

aggcgctttc ttcttctcct 20

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

gccttaaacc cttataagcc tagt 24

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

taagctagcg aggaagccag 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

ttgctctctg caggacttga 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 11

acgcttcttg tagtgcggat 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 12

aggtccctat aggcgctgtt 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 13

cccgctgttg aagaaaagaa 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 14

gtggacagcc atttgatcct 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 15

tgcgcatctg gtgaatacat 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 16

acacaaggaa aggaggggtt 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 17

acacaaggaa aggaggggtt 20

<210> 18

<211> 18

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 18

gaggcagctg gtcgtgtc 18

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 19

gttattggcg agacggttgt 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 20

cgcatgtcta cggacatcac 20

<210> 21

<211> 26

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 21

tctctctgtc tctctctgtc tctctc 26

<210> 22

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 22

agatggcgag gaaaagcac 19

<210> 23

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 23

tgttagccag gttaggctgc 20

<210> 24

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 24

aaaagctccg tcagagacga 20

<210> 25

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 25

ttctagctat aaaggcccta gtc 23

<210> 26

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 26

gctataaggc gttatttgcc c 21

<210> 27

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 27

acatgcgtct ggcgtctac 19

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 28

ccaaccagct acctcctcag 20

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 29

agccagccta aggaaccaat 20

<210> 30

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 30

gctggctagc ttccttgcta 20

<210> 31

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 31

ctacccccgc atgatttcta 20

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 32

gagtggacgg agcaggttac 20

<210> 33

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 33

ctcctcctct caaccgtcag 20

<210> 34

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 34

gaactggttc ttgagcagcc 20

<210> 35

<211> 25

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 35

tttctttttc tcttcttcct ccttc 25

<210> 36

<211> 25

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 36

gctaataagc taaagcctta gaccc 25

<210> 37

<211> 25

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 37

gctaataagc taaagcctta gaccc 25

<210> 38

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 38

tcagtgaagg catcgtcaag 20

<210> 39

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 39

gcttggctca aagacacaca 20

<210> 40

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 40

cctcatcgcg acatacagaa 20

<210> 41

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 41

aggtattcga cgtcgtttgg 20

<210> 42

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 42

ggcaagaatc ccaacttcaa 20

<210> 43

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 43

agtggcagat ccagaagagc 20

<210> 44

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 44

aatgtcaact tcggctacgg 20

<210> 45

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 45

tggggactag ttatgggcag 20

<210> 46

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 46

tctgcacgcc aaacaataac 20

<210> 47

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 47

tcagacccca acaacaaagc 20

<210> 48

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 48

cagctcgtac ttgacagcgt 20

<210> 49

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 49

agctgagagc agtctgaggg 20

<210> 50

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 50

acgtgtcgtc tctccgtctt 20

<210> 51

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 51

aggcgatagc aaaagcaaaa 20

<210> 52

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 52

cgttggtctt agcctgctct 20

<210> 53

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 53

tgtgtgtgtg tgtgtgtcgc 20

<210> 54

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 54

tgctatacgg attggcatgt 20

<210> 55

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 55

agcaacccga cgattgtaac 20

<210> 56

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 56

tagtttatta gcggcggtgc 20

<210> 57

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 57

aatcaatatg gcaggtggga 20

<210> 58

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 58

ccgttattcg ttcagccact 20

<210> 59

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 59

gagaacgagg caaagtcagg 20

<210> 60

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 60

tggctggctg gcttacttac 20

<210> 61

<211> 979

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 61

gtcaatcggc ggtgtcgccc tttcctccgc ttattgatat gcttaagttc agcgggtatt 60

cctacctgat ccgaggtcaa cgttcagagt tgggcgtttt acggcgtggc cacgtcgggt 120

tcccggtgcg agttggggta ctacgcagag gtcgccgcgg acgggccgcc acttcatttc 180

gggggcggcg gtgtgctgcc ggtccccaac gccgacatcc cccaggggac gtcgagggtt 240

gaaatgacgc tcgaacaggc atgcccgcca gaatgctggc gggcgcaatg tgcgttcaaa 300

gattcgatga ttcactgaat tctgcaattc acattactta tcgcatttcg ctgcgttctt 360

catcgatgcc agagccaaga gatccgttgt tgaaagtttt gattcatttg ttttgccttg 420

cggcggattc agaaaaactg gtagatacag tgtttggggc ccccgacggc cgccgcccag 480

gcccgcgtcc aggcgctggg cgagtccgcc gaagcaacga taggtatgtt cacaaagggt 540

tgggagttgg aaaactcgtt aatgatccct ccgcaggttc acctacggaa agggcgacac 600

gcgattgcag tcaatactga cgatggtcat agctgtttcc tgtgtgaaat tgttatccgc 660

ttccatagca gaaagtcaaa agcctccgac cggaggcttt tgacttgatc ggcacgtaag 720

aggttccaac tttcaccata atgaaataag atcactaccg ggcgtatttt ttgagttatc 780

gagattttca ggagctaagg aagctaaaat gagtattcaa catttccgtg tcgcacttat 840

tccgtttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgagagt 900

aaaagatgct gaagatcagt tggggtgcac gagtgggtta catcgaactg gatctcaaca 960

gcgggaagaa tccttgaga 979

<210> 62

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 62

tccgtaggtg aacctgcgg 19

<210> 63

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 63

tcctccgctt attgatatgc 20

Claims

1. A Cordyceps militaris strain (cordyces militaris) is characterized in that the preservation number is CGMCC No. 40061.

2. A method for preparing cordycepin or adenosine, which comprises the following steps: culturing the Cordyceps militaris strain of claim 1, and collecting a culture product containing cordycepin and/or adenosine.

3. The method of claim 2, wherein the culture product is mycelia of Cordyceps militaris.

4. The method of claim 3, wherein the medium for culturing the Cordyceps militaris strain is PDA medium, wheat grain solid medium, SDB liquid medium, rice water liquid medium, or a combination thereof.

5. The method of claim 4, wherein the cultured Cordyceps militaris strain comprises:

6. The method of claim 4, wherein culturing the Cordyceps militaris strain comprises:

7. The method of claim 4, wherein culturing the Cordyceps militaris strain comprises:

8. The method according to claim 6 or 7, wherein the culture medium conditions on the rice soup medium or on the wheat grain solid medium are: standing for 13-15 days at 24-26 deg.C and humidity of 75-85%, and irradiating with light: the dark ratio is 11-13h:13-11 h.

9. A method of identifying a cordyceps militaris strain according to claim 1, comprising: amplifying nucleic acid extracted from the cordyceps militaris strain by using SSR primers.

10. The method according to claim 9 wherein said SSR primer pair comprises: primers shown in SEQ ID NO. 1-60.