CN115093457A

CN115093457A - Anticoagulant polypeptide KT12 and application thereof

Info

Publication number: CN115093457A
Application number: CN202210164436.9A
Authority: CN
Inventors: 赖仞; 康巧珍; 宋世豪; 唐小芃
Original assignee: Zhengzhou University; Kunming Institute of Zoology of CAS
Current assignee: Zhengzhou University; Kunming Institute of Zoology of CAS
Priority date: 2022-02-23
Filing date: 2022-02-23
Publication date: 2022-09-23

Abstract

The invention provides an anticoagulant polypeptide KT12 and application thereof, and belongs to the technical field of biomedicine. The polypeptide KT12 provided by the invention has obvious effect of prolonging the plasma recalcification time, and the animal model also proves that the polypeptide KT12 has strong anticoagulation activity, so that the application of the polypeptide KT12 in the preparation of anticoagulation and/or antithrombotic medicaments provides a new means for the clinical treatment of cardiovascular and cerebrovascular diseases.

Description

Anticoagulant polypeptide KT12 and application thereof

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to an anticoagulant polypeptide KT12 and application thereof.

Background

Cardiovascular and cerebrovascular diseases are the general terms of cardiovascular and cerebrovascular diseases related to vasculopathy, mainly including heart failure, atherosclerosis, myocardial infarction, arrhythmia, hypertension, cerebral apoplexy and the like, and although the medicine and apparatus technology is improved in recent years, the cardiovascular and cerebrovascular diseases are still the main causes of death of main non-infectious diseases in the world and are far higher than cancers and other diseases. The research on the drugs for preventing and treating cardiovascular and cerebrovascular diseases has great social demands and important social significance.

The cardiovascular and cerebrovascular diseases are diseases caused by ischemia and infarction of heart and brain due to vascular stenosis and occlusion caused by thrombus in the cardiovascular and cerebrovascular, in a normal organism, the coagulation pathway comprises two aspects of coagulation and anticoagulation, and the interaction between procoagulant factors and anticoagulation factors maintains the dynamic balance of a coagulation system and an anticoagulation system, so that the normal flow of blood in the organism is maintained, and the anticoagulation mechanism has weak advantages under a normal physiological environment. After the blood vessel is damaged, a bleeding part is quickly induced to form a hemostasis plate (a large amount of platelets and fibrin), continuous bleeding of the bleeding part is finally prevented, thrombus is formed similarly to the hemostasis plate, the expression level of procoagulant factors in plasma is increased due to the change of physiological environment in a body caused by factors such as inflammation and the like, high coagulation tendency is further generated, a state prone to thrombus formation is formed, a large amount of thrombin is finally generated through coagulation cascade reaction, and the thrombin converts soluble fibrinogen circulating in the body into insoluble fibrin, so that thrombus is formed. The tendency of hypercoagulability in plasma plays an important role in the process of thrombosis, and therefore, the search for novel drugs for reducing hypercoagulability caused by inflammation and the like is an important means for preventing and treating thrombotic diseases. In the prior art, anticoagulant and antithrombotic drugs comprise antiplatelet drugs (aspirin, dipyridamole, clopidogrel and the like), dicumarol anticoagulant drugs (warfarin) and heparin anticoagulant drugs (common heparin and low molecular heparin). However, in the actual clinical treatment, the anticoagulant effect of the medicine is not good, the onset time is long, and the requirement of the medicine in the acute stage cannot be met.

Disclosure of Invention

In view of the above, the invention aims to provide an anticoagulant polypeptide KT12, which has an obvious anticoagulant effect, obviously inhibits thrombosis and provides a new idea for anticoagulant drugs.

The invention provides an anticoagulant polypeptide KT12, which comprises at least one of the following polypeptides:

(1) the amino acid sequence is shown as SEQ ID NO: 1;

(2) a polypeptide formed by chemically modifying one or more amino acid residues in the polypeptide of item (1);

(3) a salt form of the polypeptide described in the item (1) and/or the item (2).

The invention provides a nucleic acid molecule for encoding the anticoagulant polypeptide KT12, and the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO. 2.

The invention provides application of the anticoagulant polypeptide KT12 or the nucleic acid molecule in preparation of anticoagulant and/or antithrombotic medicines.

Preferably, the anticoagulant polypeptide KT12 is combined with at least one of the following components to prepare a medicine: antiplatelet drugs, dicoumarin anticoagulant drugs, heparin anticoagulant drugs or other anticoagulant polypeptides.

Preferably, the antiplatelet agent comprises aspirin, dipyridamole or clopidogrel.

Preferably, the dicoumarin anticoagulant comprises warfarin.

Preferably, the heparin-based anticoagulant drug comprises normal heparin or low molecular heparin.

The invention provides an anticoagulant and/or antithrombotic medicine, and the active ingredient of the anticoagulant and/or antithrombotic medicine comprises anticoagulant polypeptide KT 12.

Preferably, the dosage of the anticoagulant polypeptide KT12 is not lower than 1mg/kg body weight of the mice.

Preferably, the working concentration of the anticoagulant polypeptide KT12 is not lower than 1 mu M.

The invention provides an anticoagulant polypeptide KT12, the amino acid sequence of which is shown as SEQ ID NO: 1 is shown. According to the invention, the anticoagulant performance of the polypeptide KT12 is evaluated by respectively taking the plasma recalcification time and the animal bleeding time as indexes, and experiments show that the KT12 can prolong the recalcification time, and meanwhile, the KT12 can obviously prolong the tail bleeding time, so that the polypeptide KT12 has the characteristic of inhibiting the blood coagulation reaction.

Hair brushThe application of the anticoagulant polypeptide KT12 or the nucleic acid molecule in preparing anticoagulant and/or antithrombotic medicines is provided. With FeCl ₃ The induced cervical thrombosis mouse model is an experimental object, and the adoption of the polypeptide KT12 can improve FeCl3 to cause reduction of blood flow at the neck of a mouse; meanwhile, a tail thrombus model induced by carrageenan is taken as an experimental object, and the administration of the polypeptide KT12 can obviously shorten the tail thrombus formation length of a mouse. Therefore, the polypeptide KT12 has the effect of inhibiting thrombosis and provides a new idea for the preparation of antithrombotic drugs.

Drawings

Fig. 1 is an anticoagulant experimental determination result of KT12 in example 2 of the present invention, wherein fig. 1A is a curve relating KT12 at different concentrations and plasma recalcification time, and fig. 1B is a statistical result of KT12 at different concentrations and plasma recalcification time; FIG. 1C shows the results of a tail bleeding test in mice;

FIG. 2 shows FeCl in example 3 of the present invention ₃ After KT12 is administrated to an induced cervical thrombosis mouse model, a blood flow result is obtained, wherein a figure 2A shows a laser Doppler detection result of the mouse model; fig. 2B shows blood flow statistics of KT12 at different administration concentrations;

FIG. 3 shows the result of KT12 inhibiting tail thrombosis.

Detailed Description

(1) the amino acid sequence is shown as SEQ ID NO: 1 (RIGKHSRTRYER);

In the present invention, SEQ ID NO: 1 has a molecular weight of 1558.75 daltons. The polypeptide KT12 binds to exocite I of thrombin. The method for producing the polypeptide is not particularly limited, and a method for producing a polypeptide known in the art may be used. In the embodiment of the invention, the polypeptide KT12 is prepared by adopting a chemical synthesis method. The chemical synthesis method preferably uses an automatic polypeptide synthesizer to synthesize the complete sequence, adopts HPLC reverse column chromatography to desalt and purify, and determines that the purity is more than 95%.

In the present invention, the site of said chemical modification is preferably a side chain group to an amino acid residue, an α -carbon atom, a terminal amino group or a terminal carboxylic acid group. The chemically modified species preferably comprises covalently linked one or more modifications. The modifier is bovine serum albumin, human serum albumin, homologous IgG or polyethylene glycol and the like. The method of chemical modification is not particularly limited in the present invention, and a method of chemical modification known in the art may be used.

In the present invention, the salt form of the polypeptide preferably includes a hydrochloride, a phosphate or an acetate. The method for preparing the salt form of the polypeptide is not particularly limited, and the method for preparing the salt form of the polypeptide, which is well known in the art, can be used.

The invention provides a nucleic acid molecule for encoding anticoagulant polypeptide KT12, and the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO. 2 (CGCATTGGCAAACATAGCCGCACCCGCTATGAACGC).

Based on the fact that the polypeptide KT12 has high anticoagulation performance and antithrombotic performance, the invention provides application of the anticoagulation polypeptide KT12 or the nucleic acid molecules in preparation of anticoagulation and/or antithrombotic medicines.

In the present invention, the dosage form of the drug is preferably an injection. The injection preferably further comprises pharmaceutically acceptable excipients, such as injection. In the medicine, the working concentration of the polypeptide KT12 is preferably not less than 1 mu M, and more preferably 2-10 mu M. The administration dosage of the anticoagulant polypeptide KT12 is not lower than 1mg/kg of body weight of the mouse, and more preferably 2-5 mg/kg of body weight of the mouse.

In the invention, the anticoagulant polypeptide KT12 is preferably combined with at least one of the following components to prepare a medicament: antiplatelet drugs, dicoumarin anticoagulant drugs, heparin anticoagulant drugs or other anticoagulant polypeptides. The antiplatelet agent preferably comprises aspirin, dipyridamole or clopidogrel. The bishydroxycoumarin anticoagulant drug preferably comprises warfarin. The heparin-based anticoagulant preferably comprises normal heparin or low molecular heparin. The source of the platelet-resistant drug, the dicoumarin anticoagulant drug, the heparin anticoagulant drug or other anticoagulant polypeptides is not particularly limited, and the drug source known in the field can be adopted. When the polypeptide KT12 is combined for pharmaceutical use, the mass ratio of the polypeptide KT12 to the components is 1-100: 1 to 100, more preferably 1 to 50:1: 50.

The invention provides an anticoagulant and/or antithrombotic drug, and the active ingredient of the anticoagulant and/or antithrombotic drug comprises the anticoagulant polypeptide KT 12. The drugs are the same as those in the above application scheme, and are not described herein again.

The anticoagulant polypeptide KT12 and the application thereof provided by the invention are described in detail in the following examples, but the examples should not be construed as limiting the scope of the invention.

Example 1

Synthetic method of anticoagulant polypeptide KT12

The synthesis is carried out by Fmoc-Lys (Boc) -Wang Resin, and the specific steps are as follows:

1. swelling of the resin

5g of Fmoc-Leu-Wang Resin with the substitution degree of 0.3 is weighed and poured into a reaction column, 50ml of DCM is added for swelling, and the mixture is soaked for 30 min.

2. Deprotection of

The DCM in the reaction column was drained, the Fmoc was removed by adding 20% piperidine/DMF solution, nitrogen sparged for 30min, drained, washed 5 times with DMF and drained.

3. Condensation reaction

The condensation is generally carried out by adopting TBTU/DIEA activator combination, TBTU and connecting amino acid weighed by 3 times of feeding amount are dissolved by 50ml of DMF and added into a reaction column, DIEA (1.55ml) is added, nitrogen is blown, and the reaction is carried out for 1 hour.

4. Detecting and washing

Taking a little resin from the reaction column by using a sampling tube, pouring the resin into a small test tube, washing the DMF once, pouring out the DMF, respectively adding 3 drops of solutions A, B and C (solution A: ninhydrin alcohol solution, solution B: 20% alcohol-80% phenol mixed solution, solution C: redistilled pyridine), putting the solution A, B and C into a heater, heating the solution at 120 ℃ for 3 minutes, taking out the solution and the resin to observe the color, wherein the solution is yellow resin and is colorless or light yellow, which shows that the condensation reaction is complete, stopping the reaction in the reaction column, draining the reaction column, and washing the DMF for 3 times.

5. Repeat delivery

If the color of the resin is detected to be other colors, for example, green, blue, purple, etc., the reaction is not complete, the resin is drained and washed for 3 times, and the same amount of the current reaction is weighed and put into the reaction column for re-reaction until the detection reaction is complete.

6. Continued condensation

And repeating the steps 2-5 for the connection of the subsequent amino acid, calculating and weighing the weighed amount of different amino acids by using the same algorithm, and keeping the amount of TBTU/DIEA unchanged.

7. Shrinkage of

After the last amino acid ligation was completed, repeat 2 steps, then DCM wash 3 times, methanol wash 3 times, drain off, pour resin out, oven dry and fill into 500ml beaker.

8. Cutting of

Adding 100ml of cutting fluid (TFA/thioanisole/phenol/EDT/water, volume ratio of 86/5/4/3/2) into a beaker, placing the beaker on a magnetic stirrer, placing magnetons into the beaker, stirring and reacting for 2 hours, filtering the mixture by using a sand core funnel, rinsing resin in a sand core by using TFA for 2 times, pouring the cutting fluid into 600ml of ice ether, separating out polypeptide to form polypeptide ether suspension, respectively repeating centrifugation by using a large-size centrifuge, pouring off supernate, adding ether for washing, repeating the process for 3 times, baking by using a baking lamp, removing ether residues, and obtaining a solid, namely the crude target polypeptide.

9. Purification of

Dissolving the crude product with water, filtering, and separating and purifying by high performance liquid chromatography to obtain refined target polypeptide product with purity of more than 95%.

10. Preparation of

7 g of the crude product are dissolved in a certain proportion of ACN: h ₂ And taking a small sample in the solution with the O ratio of 1:4 to analyze the peak time of the sample. (HPLC analysis in high phase liquid chromatography) in the selection of column for column 100DAC preparation, the sample is introduced into the column, the gradient is selected according to the time of the crude product to peak, separation is carried out, according to the HPLC chartThe impurities are separated and collected, whether the collected product is KT12 is judged by LC-MS, and KT12 is left for sequencing detection, and the detection result is RIGKHSRTRYER. And (3) performing rotary evaporation on a product qualified by HPLC, and performing freeze-drying to obtain white powder polypeptide KT 12.

Example 2

Plasma calcium-replenisher experiment

Mixing 40 μ L of normal human plasma with different concentrations of anticoagulant polypeptide KT12(0.4 μ M, 2 μ M, 10 μ M) in 20 μ L of HEPES buffer solution (10mM HEPES, 150mM NaCl, pH 7.4), incubating at 37 deg.C for 10min, adding 60 μ L of CaCl preheated at 37 deg.C ₂ Mixing the solution immediately, and detecting OD by enzyme labeling ₆₅₀ 。

The plasma recalcification test is a method for determining the defect of an endogenous coagulation system, and is characterized in that plasma anticoagulated by sodium oxalate is used, the anticoagulant is combined with calcium ions in the plasma to interrupt the coagulation process, and after the plasma is added with a proper calcium solution, the coagulation process of the blood is continued to be calcified. Blood from blood clotting disorders can cause prolonged plasma recalcification time. The results of this example are shown in FIGS. 1A and 1B. KT12 has concentration-dependent inhibition effect on plasma recalcification time, and shows that KT12 can prolong the recalcification time and inhibit blood coagulation reaction.

Example 3

Determination of bleeding time at the tail of mice

C57 mice (23-26 g) were used in the experiment and divided into 4 groups, physiological saline group and KT12 administration group (0.2mg/kg, 1mg/kg, 5 mg/kg). The above drugs were administered 20min before tail-off experiment via tail vein. Then, the tail part of the mouse is cut off at a position 1.5mm away from the tip of the mouse by using a small scissors, then the tail part of the mouse is quickly immersed into a buffer solution at 37 ℃, and meanwhile, the tail bleeding time of the mouse is recorded (the judgment standard is that the bleeding stops at the tail part for 30s, the time counted before 30s is the tail bleeding time, and meanwhile, the maximum timing time is controlled not to be more than 10 min.

The results are shown in FIG. 1C. KT12 can remarkably prolong the tail bleeding time and effectively inhibit the blood coagulation reaction.

Example 4

FeCl ₃ Construction of induced cervical thrombosis mouse model and antithrombotic experiment of KT12

C57 mice (23-26 g) were used in the experiment and divided into 4 groups, physiological saline and KT12 administration groups (0.2, 1, 5mg/kg), respectively. FeCl ₃ The induced thrombosis model is prepared by longitudinally cutting neck skin along the midline of neck with sterilizing equipment 20min after administration, separating muscle tissue with hemostatic forceps, exposing trachea, separating common carotid artery from two sides with glass needle, and separating with 10% FeCl ₃ (w/v) the neck artery was induced for 5min, and after 10min, the blood flow in the neck was detected by laser Doppler.

The results are shown in FIGS. 2A and 2B. The detection result of the normal saline group shows that the neck artery of the mouse forms obvious thrombus, which indicates that the neck thrombus mouse model is successfully constructed. KT12(1, 5mg/kg) was able to significantly inhibit FeCl when KT12 was dosed at different doses ₃ The resulting blood flow was reduced, but KT12 (0.2mg/kg) was unable to inhibit FeCl ₃ Resulting in reduced blood flow.

Example 5

Construction of carrageenan-induced tail thrombus model and antithrombus experiment of KT12

Kunming mice (23-26 g) were used in the experiment and divided into 5 groups, namely a normal group and a normal saline group, a KT12 administration group (0.2, 1, 5mg/kg), and after 30min of caudal vein administration, the mice were injected with 0.2% carrageenan prepared from normal saline in the abdominal cavity, and after 30min of caudal vein injection of the normal saline group, the mice were injected with 0.2% carrageenan prepared from normal saline in the abdominal cavity. Then, after 24 hours of hypothermia treatment at 18 ℃, the tail thrombosis of the mice was observed, and the total length of the tail of the mice and the length of the black tail were measured. The normal group of mice did not undergo any intervention.

The results are shown in table 1 and fig. 3.

TABLE 1 statistical length results of KT12 tail vein administration at different concentrations on mouse tail thrombus model

Group of	Black tail length/mm	Relative length of black tail (black tail length/tail length) is multiplied by 100 percent
			Normal group	0	0
Physiological saline group	64.875±5.875	50.22±11.64
			5mg/kg	21.125±10875	24.28±10.15
1mg/kg	45.375±10.375	35.11±9.18
			0.2mg/kg	62.5±13.5	48.75±9.23

From the above results, it was found that the carrageenan-induced tail thrombus mouse model was successfully constructed in comparison with the results of the normal group and the saline group. Meanwhile, the tail thrombus formation length of the mice of the KT12 administration group is obviously reduced, which indicates that the KT12 inhibits the tail thrombus formation (figure 3).

Comparative example 1

TH16 was chemically synthesized by the method described in example 1, based on the anticoagulant polypeptide TH16 (amino acid sequence RIGKHSRTRYERNIEK, SEQ ID NO:3) disclosed in CN 108640979A. Plasma recalcification experiments were performed as described in example 2, substituting TH16 for KT 12.

The plasma recalcification times of KT12 and TH16 were statistically analyzed, and the results are shown in Table 2.

TABLE 2 statistical tables of plasma recalcification times for KT12 and TH16

Group of	Recalcification time/min
		Blank control	8.90±0.20
KT12(0.4μM)	8.60±0.37
		KT12(2μM)	10.73±0.23
KT12(10μM)	14.10±0.30
		TH16(0.4μM)	8.65±0.44
TH16(2μM)	10.69±0.50
		TH16(10μM)	14.49±0.45

The analysis and the comparison of the plasma recalcification time of KT12 and TH16 show that: with increasing concentration, both KT12 and TH16 prolong the recalcification time, but the effect of polypeptides KT12 and TH16 on the plasma recalcification time is not different at the same concentration (P > 0.05).

Comparative example 2

Mice tail bleeding experiments were performed as described in example 3, replacing KT12 with TH16 synthesized as described above.

The tail bleeding of KT12 and TH16 was statistically analyzed and the results are shown in Table 3.

TABLE 3 statistical Table of Tail bleeding of KT12 and TH16

The tail bleeding time of KT12 and TH16 is analyzed and compared to know that: with increasing concentration, both KT12 and TH16 prolonged tail bleeding time, but at the same concentration the tail bleeding times of polypeptides KT12 and TH16 were not significantly different (P > 0.05).

Comparative example 3

A mouse model antithrombotic experiment was carried out by the method of example 4, substituting KT12 with TH16 synthesized as described above.

The cervical blood flow of KT12 and TH16 was statistically analyzed and the results are shown in Table 4.

TABLE 4 statistical tables of cervical blood flow at KT12 and TH16

Group of	Perfusion unit at 5min	Unit of infusion at 10min
			Blank control	373.7±30.59	262.5±19.06
KT12(0.2mg/kg)	367.0±33.75	259.7±16.71
			KT12(1mg/kg)	441.0±21.32	342.5±27.86
KT12(5mg/kg)	471.5±17.92	427.0±19.13
			TH16(0.2mg/kg)	367.8±25.56	244.0±20.16
TH16(1mg/kg)	441.2±21.52	345.2±28.67
			TH16(5mg/kg)	454.8±21.66	418.2±26.90

The carotid blood flow conditions of KT12 and TH16 are analyzed and compared to obtain that: with the increase of the concentration, KT12 and TH16 both inhibit the formation of carotid thrombus and ensure the smoothness of blood flow, but at the same concentration, the cervical thrombus formation of polypeptides KT12 and TH16 at the same time point is not greatly different (P is more than 0.05).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be construed as the protection scope of the present invention.

Sequence listing

<110> Kunming animal research institute of Chinese academy of sciences

Zhengzhou university

<120> anticoagulant polypeptide KT12 and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 12

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Arg Ile Gly Lys His Ser Arg Thr Arg Tyr Glu Arg

1 5 10

<210> 2

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgcattggca aacatagccg cacccgctat gaacgc 36

<210> 3

<211> 16

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Arg Ile Gly Lys His Ser Arg Thr Arg Tyr Glu Arg Asn Ile Glu Lys

1 5 10 15

Claims

1. An anticoagulant polypeptide KT12, comprising at least one of the following polypeptides:

(1) the amino acid sequence is shown as SEQ ID NO: 1;

2. A nucleic acid molecule encoding the anticoagulant polypeptide KT12 of claim 1, wherein the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID No. 2.

3. Use of the anticoagulant polypeptide KT12 of claim 1 or the nucleic acid molecule of claim 2 for preparing anticoagulant and/or antithrombotic drugs.

4. The use of claim 3, wherein the anticoagulant polypeptide KT12 is used for preparing a medicament in combination with at least one of the following components: antiplatelet drugs, dicoumarin anticoagulant drugs, heparin anticoagulant drugs or other anticoagulant polypeptides.

5. The use of claim 4, wherein the antiplatelet agent comprises aspirin, dipyridamole or clopidogrel.

6. The use of claim 4, wherein said dicoumarol anticoagulant comprises warfarin.

7. The use of claim 4, wherein said heparin-based anticoagulant comprises plain heparin or low molecular heparin.

8. An anticoagulant and/or antithrombotic drug, characterized in that an active ingredient comprises the anticoagulant polypeptide KT12 of claim 1.

9. The drug of claim 8, wherein the anticoagulant polypeptide KT12 is administered at a dose of not less than 1mg/kg body weight of the mouse.

10. The medicine of claim 8 or 9, wherein the working concentration of the anticoagulant polypeptide KT12 is not less than 1 μ M.