CN115093376A

CN115093376A - Double/multiple functional unnatural amino acid, conjugate and application thereof

Info

Publication number: CN115093376A
Application number: CN202210409825.3A
Authority: CN
Inventors: 刘涛; 王永; 韩伯阳; 蔡文康
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2022-04-19
Filing date: 2022-04-19
Publication date: 2022-09-23

Abstract

The invention relates to the technical field of biological medicines, in particular to an unnatural amino acid with double/multiple functions, a recombinant protein thereof and application thereof. The unnatural amino acid with the structure shown in the formula I can be efficiently introduced into any site of the protein in a fixed-point manner, the fixed-point coupling of the protein and effector molecules such as fluorescence, nuclide, medicament, polyethylene glycol (PEG), nucleic acid and the like is realized through rapid, efficient and mild reaction conditions, and the double/multiple conjugates which are modified in a fixed-point manner and have uniform quality are prepared. The dual/multiple function recombinant protein can be applied to high signal-to-noise ratio tumor imaging, bimodal tumor diagnosis and treatment integration, antibody drug coupling mediated tumor killing and other clinical applications.

Description

Double/multiple functional unnatural amino acid, conjugate and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a dual/multiple-function unnatural amino acid, a conjugate and an application thereof.

Background

Therapeutic proteins, such as antibodies, hormones, interferons and the like, play an important role in the field of treatment of various diseases, but some natural therapeutic proteins (native therapeutic proteins) with inherent defects of low curative effect, short half-life, high immunogenicity, complex preparation and the like cannot meet the current requirements of scientific research and clinical application. For decades, with the continuous development of protein engineering, a plurality of protein coupling modification strategies, especially site-selective modification, emerge. Although the site-specific protein single-site labeling has made great progress in studying protein drug expression, intracellular protein localization, transport and conformational changes, with the intensive study of diseases, the understanding of pathogenesis, which is constantly going to be complicated, and the need for precise personalized medicine, single modifications of proteins have not been able to meet current needs, such as single-site protein labeling may not be sufficient when monitoring precise conformational changes of a single protein or studying protein-protein interactions; for example, ADC conjugated to a single type of anticancer drug still has problems of low therapeutic effect, drug resistance, etc., which prevents further application in therapy. In addition, there is an increasing need for new therapeutic strategies for real-time monitoring of protein drug molecules (e.g., antibodies) in combination with imaging agents during therapy. Therefore, double or multiple modifications of proteins become important in the development of multifunctional protein drugs.

At present, protein multi-modification is realized, particularly, the research on a fixed-point multi-modification strategy is relatively few, and random modification (amino or sulfhydryl) on natural protein is mostly adopted; glycosylation modification; fusion expression protein; identification or introduction of specific polypeptide fragments by some enzyme-catalyzed labelling, such as the introduction of affinity tags (SNAP/CLIP-tag); some 'handle molecules' capable of reacting are introduced in a combined mode of methods such as reduction of disulfide bonds and the like, so that the labeling efficiency is low, the product is not uniform in mixing, the modification sites are limited, the reduction of disulfide bonds or the introduction of sulfydryl can cause protein instability and the performance of the introduced product of large-volume labeled protein is influenced, and the further development of the protein instability and large-volume labeled protein is limited to a greater extent. By utilizing a gene codon expansion technology, double insertion or even triple insertion of two or three sets of mutually orthogonal aaRS-tRNA pairs can be realized by three or four sets of stop codons, wherein the two or three sets of mutually orthogonal aaRS-tRNA pairs are subjected to double insertion or even triple insertion of amino acids with two mutually orthogonal functional groups (such as azide and alkynyl, azide and tetrazine, azide and ketone groups, tetrazine and norbornene), but the defects of low efficiency insertion, poor reaction efficiency and continuous introduction of a plurality of stop codons greatly limit the large-scale application of the technology in the field of treating proteins. Examples are as follows:

1. synthetic strategies to achieve protein bifunctional

(1) At two different sites

The separate modification of two rare amino acid residues on the protein surface is the most straightforward way to achieve double modification of proteins, while the combination of two different mono-functional modification methods needs to satisfy strict selectivity to ensure orthogonality, compatibility, and high modification rate of the modifications. Gaunt and colleagues developed a chemical selective labeling method for labeling methionine residue in protein with high-valent iodine reagent, realizing site-specific labeling of methionine, and combining the method with the reaction of maleimide and thiol on cysteine residue to realize the dual functionalization of GTP-binding protein fragment G alpha (Nature 562, 563-568 (2018)). Similarly, Paavola and co-workers combine cysteine modification with pyridoxal phosphate mediated N-terminal transamination of proteins, enabling dual fluorophore labeling of glutamine-binding proteins, and monitoring ligand-mediated conformational changes by FRET efficiency (Biosensors and Bioelectronics,2010,26(1): 55-61).

Yet another alternative strategy is to achieve site-specific double modification of proteins based on the difference in reactivity between free and oxidized cysteines. The Weil group modifies free cysteine by maleimide, generates two free thiol groups from oxidized cysteine by disulfide bond reduction, and modifies the free thiol groups with allyl phenylsulfone. However, this method has a limitation in that the reaction of thiol with maleimide must be carried out before allylphenylsulfone modifies the disulfide bond, otherwise allylphenylsulfone also reacts with free thiol to produce a heterogeneous product (Bioconjugate chemistry,2017,29(1): 29-34.).

Although it is simple to double-modify a protein at two different positions, the availability of proteins containing two orthogonally reactive amino acid residues is very limited, and an alternative approach is to use a multifunctional bioconjugate reagent to target a particular amino acid residue.

(2) Introduction of multifunctional biological agents at a single site

Baker and Caddick and colleagues developed methods for reversible double modification of proteins based on mono-and bis-bromomaleimides. Taking the bisbromomaleimide molecule as an example, a first modification is introduced by the reaction of a bromo-substituted maleimide with a thiol group, and then a bromine atom is substituted with another thiol conjugate, and a second modification is introduced (J.Am.chem.Soc.2010,132, 1960-1965.; chem.Commun.2011,47, 8781-8783.), or a disulfide bridge can be formed with a reduced disulfide bond. Both can be modified by adding excess sulfhydryl reagents, such as glutathione and mercaptoethanol, and the modified protein can be changed into the original unmodified state, thus having the potential of developing prodrugs. The Zhou project group developed another maleimide analog called 3Br-5MPs, which possessed modification efficiencies similar to those of conventional maleimide reagents, but higher specificity for thiol groups on cysteines. First, cysteine on the protein undergoes a michael addition reaction with 3Br-5MPs, and the resulting conjugate can undergo a further secondary michael addition reaction with a thiol reagent, and in order to avoid the slow release of the second conjugate from the reverse michael addition reaction, a stable and active protein double-modification is obtained by reduction with the addition of sodium borohydride (nat. commun.2020,11,1015.).

Bernardes and colleagues combined a bicyclic system with ring tension with a vinylsulfone system to develop an azabicyclic vinylsulfone reagent that achieves the double modification of proteins (chem.sci.2019,10, 4515-. Such a combination allows chemoselective modification of cysteine residues, while dienophiles in the aza-bicyclohedron with ring tension can also undergo a diels-alder reaction with a reverse electron demand, introducing a second modification. Besides vinylsulfone, allylphenylsulfone is a feasible strategy for stepwise double modification due to stronger water solubility and higher reactivity. The Weil group introduced a first modification by the michael addition of allylphenylsulfone to produce a coupled ester by simply adjusting the pH to 6. The conjugate can be further reacted with a second thiol-containing moiety to effect a double modification of the protein by adjusting the pH to 8 (chem. Sci.2016,7, 3234-3239).

In addition to maleimide analogs and sulfone analogs, there are several other strategies for protein double modification. For example, Goncalves and colleagues reported that dichloro-1, 2,4, 5-tetrazine can undergo two consecutive nucleophilic aromatic substitution reactions, introducing thiol-containing charge with high selectivity at the cysteine residue site, and tetrazine structure as another handle for subsequent bio-orthogonal iEDDA reactions, enabling the preparation of site-directed double modified protein conjugates (Angew. chem.2018,130, 10806-10810.). Although this method is simple, when a functional group having a large volume or a high hydrophobicity is to be labeled, the labeling rate is low. Waser and colleagues report a strategy of using ethynyl benzo iodo ketone (EBX) to efficiently and specifically introduce two reactive groups, namely azide group and high-valence iodine, and further realize the bifunctional of protein through SPAAC reaction and Suzuki-Miyaura cross coupling (Chem 2019,5, 2243-2263.). Chudasama et al developed a plug-and-play platform in which dibromopyridazinedione linked to two bio-orthogonal tags was inserted between disulfide bonds in antibodies or antibody fragments Fab, and then achieved double modification of proteins through two sequential steps of bio-orthogonal reactions (SPACC and CuAAC), and did not affect disulfide bonds (Caddick, nat. Commun.2015,6,6645.) that are critical to activity inside antibodies, and had profound guiding significance in the development course of novel multi-modified antibody drug conjugation. In the aforementioned fixed-point modification of methionine by periodate developed by Gaunt, the generated diazosulfonium conjugate can further generate photooxidation-reduction radical cross-coupling reaction with C-4 benzylated hans ester derivative, and a second functional group is introduced to realize double labeling (Nature 562, 563-568 (2018)).

One possible limitation of single-site double modification of proteins is that because two orthogonal reactive groups are linked by a relatively small linker arm and are therefore closer in space, steric effects cause some larger modifying groups, such as polymers, to be less easily attached to the protein.

2. Gene engineering for realizing protein double modification

(1) Introduction of natural amino acids

In the early stage, protein double modification is realized by a genetic engineering method, cysteine is introduced into two sites on a target protein through point mutation, and then double labeling is realized through reaction of two sulfydryl groups and different sulfydryl reaction reagents. Caddick et al reported that two cysteines were introduced on DARPins protein by genetic engineering method, and the two sulfydryl groups have different nucleophilic reactivity, so that double modification of protein can be achieved by two-step method (Caddick, chem. Commun.2014,50, 4898-4900). The bromoacetamide with weaker reactivity firstly reacts with cysteine with stronger nucleophilic ability, and then the maleimide with stronger reactivity reacts with cysteine with weaker nucleophilic ability. Although the concept of achieving double modification of proteins is simple, finding the equilibrium point of thiol reactivity and the most suitable mutation site for cysteine is challenging to avoid product heterogeneity.

Caddick et al also reported that the same thiol reagent was used to react with two cysteines to produce two identical sulfonium ions, and that the more solvated sulfonium ions would undergo β elimination to produce dehydroalanine by virtue of different solvent exposure of the α protons at the two sites, whereas the other sulfonium ions, the α protons in a solvent shielded microenvironment, would not undergo spontaneous elimination, and that azide-containing side chains would be obtained by reaction with azide, thus obtaining proteins that can undergo two orthogonal reactions, and achieving double labeling of the proteins (chem. Sci.2013,4, 3455-. Petelute and colleagues developed a tetrapeptide sequence called FCPF (pi-clamp) to create a specific chemical environment for cysteine in which only the specified cysteine can react with the aromatic fluoride reagent, while the other thiol groups do not participate, and thus this method is compatible with other thiol coupling methods (nat. chem.2016,8, 120-128.).

(2) Introduction of unnatural amino acids

The limitation of introducing natural amino acids by point mutation is that the functions and reactivity of 20 natural amino acids are very limited, so introducing a series of unnatural amino acids with similar structures but diverse functions and bioorthogonal reactive functions to natural amino acids brings more possibilities for protein double modification.

The Benjamin G.Davis project group introduces cysteine based on gene site-directed mutagenesis and introduces azido homoalanine AHA with similar methionine structure on target protein by using auxotrophic strain, and then realizes double modification of protein by using reaction of cysteine and methylthiosulfonate derivative and CuAAC reaction between azide group and acetylene group in AHA (Nature 2007,446, 1105-1109.). This approach has the disadvantage that the binding efficiency of the unnatural amino acid to the natural aminoacyltRNA synthetase in the organism is low and the unnatural amino acid can only replace the natural amino acid site with a similar structure.

The gene codon expanding technology is a technology capable of accurately inserting a series of unnatural amino acids with different structures into any target site, and more than 150 unnatural amino acids containing various 'reaction handles' and functional groups can be realized by the technology. Deniz and colleagues used the amber codon UAG to insert the unnatural amino acid pAcF into T4 lysozyme, incorporate site-directed mutagenesis to introduce cysteine, and achieve double modification of the protein by thiol-maleimide reaction with oxime formation reaction (j.am.chem.soc.2008,130, 17664-17665.). The strategy of introducing cysteine as one of the two sites for protein double modification is simple, but has the limitation that if the protein originally contains cysteine which plays an important role in structure or function, the method is difficult. In addition, cysteine residues may form disulfide bonds, limiting the expression yield of the protein, and the reversibility of the reaction between the thiol-maleimide products may cause problems in the stability of the coupled products.

The introduction of two different unnatural amino acids containing bioorthogonal tags has thus become a solution. Liu and colleagues introduced two orthogonal aaRS/tRNA pairs, encoding two azide-containing AzF and alkynyl-containing PrK unnatural amino acids on glutamine-binding proteins using two different stop codons UAG and UAA, followed by a two-step CuAAC reaction to introduce two chromophores on the protein (angelw. chem.2010,122, 3279-3282). In the following reports, Liu uses a similar method to introduce two amino acids of AzF and AcK, and a SPAAC reaction generated by an azide group and an oxime-forming reaction generated by a carbonyl group realize catalyst-free 'one-pot' double modification, so that protein coagulation and oxidation phenomena caused by a copper catalyst are avoided (ChemBioChem 2012,13, 1405-1408). The same Peter G.Schultz project group introduced azide and carbonyl containing unnatural amino acids into eukaryotic systems, resulting in toxin drugs and fluorescence double modified antibodies (Angew Chem Int Ed Engl.2013Dec23; 52(52): 14080-3.).

In addition to coding for unnatural amino acids with triple stop codons, Chin and colleagues developed twoAn orthogonal aaRS/tRNA pair, using a quadruplex codon and a stop codon, was inserted into calmodulin with two unnatural amino acids containing tetrazine and norbornene structures, and double modification was achieved later by a two-step iEDDA reaction (nat. chem.2014,6,393 403). However, the efficiency of decoding quadruplet codons by natural ribosomes is very low, and Chin has evolved an orthogonal ribosome (ribo-Q1) which is not responsible for synthesizing proteins and is only used for selectively decoding quadruplet codons, by which two unnatural amino groups with azidobenzene and alkynyl groups are successfully introduced into proteins at fixed points, achieving subsequent double modification, but the efficiency and specificity are still low (Nature.2010Mar18; 464(7287): 441-4.). Subsequent chip on PylRS/tRNA _CUA Evolution was carried out to obtain optimized quadruplet coding variant PylRS/tRNA _UACU In contrast, the efficiency was greatly improved, two bioorthogonal labels norbornene and tetrazine were site-selectively introduced into the protein, and the double modification was successfully accomplished by two consecutive iEDDA reactions (Nat chem. 2014May; 6(5): 393. 403.). Under this system, the chi uses the above orthogonal aaRS-tRNA pair to insert unnatural amino acids of alkynes and cyclopropenes into calmodulin, ultimately achieving protein bifunctional. (J.Am.chem.Soc.2014,136,22, 7785-7788). The introduction and modification of bifunctional amino acid can be realized by using unnatural amino acid, and the method has the advantages of small amino acid structure, flexible insertion site, high specificity and rich label library which can be modified. However, challenges remain in this rapidly evolving field, such as low catalytic efficiency of the engineered aaRS, tedious assessment and optimization to improve its performance, low overall expression yields, repeated optimization of protocols for efficient protein engineering, and range and compatibility of insertable functional groups. In addition to the development of recombinant engineering techniques, the bioorthogonal chemical tool libraries should also be expanded to allow more choices in reaction rates, catalyst types, and substrate solubilities for compatible bioorthogonal reactions to meet their intended applications.

(3) Introduction of polypeptide tag

In addition to the introduction of unnatural amino acids containing bioorthogonal reaction handles, the introduction of two artificial polypeptide sequences that can be recognized by specific enzymes and covalently labeled can also effect double modification of proteins. The enzyme-mediated polypeptide marker has the advantages of high specificity, high marking efficiency and small interference on protein structure and function.

To investigate the conformational dynamics of HIV-1 envelope (Env) trimers, motis and coworkers showed the application of a two site-specific labeling and subsequent smFRET technique, first they introduced a Q3 peptide and an a1 peptide in the V1 and V4/V5 loops of gp120 protein, which are recognized by two enzymes TGase and Acps PPTase, respectively, and then catalyzed the introduction of a fluorescent label tag that can undergo fret, which, when not bound to CD4 receptor, does not produce a fret signal and, when bound to CD4, exhibits a high fret signal, confirming the change in protein structure, enabling observation studies of protein dynamics (Nature 455,109-U176 (2008)). Ploegh and colleagues introduced two polypeptide tags LPXTGG and HNV motif on antibody IgG, which can be recognized and labeled by two enzymes Sortase A and Butelase 1 respectively, so as to realize site-directed double modification of antibody (Bioconjugate chem.2018,29, 3245-3249.). Chen and colleagues have demonstrated the binding of LAP peptide (LplA receptor peptide) which can be recognized by lipoic acid ligase (LpIA) to link lipoic acid derivatives and azido bearing pyrrolysine analogs for site-selective dual labeling of Epidermal Growth Factor Receptor (EGFR) on living cells, enabling dual site-specific labeling of EGFR on the surface of living cells and subsequent study of conformational changes. (chembiochem.2014aug 18; 15(12):1738-43.) Geierstanger and coworkers achieved enzyme-mediated IgE-Fc two-site specific fret fluorescent labeling via a small peptide sequence (S6) and genetically encoded pyrrole-carboxy lysine (Pcl). 2-aminobenzaldehyde selectable markers modified by AlexaFluor488 conjugated coenzyme A (PPTase substrate) and AlexaFluor 594, respectively. By performing FRET analysis on the double site specific marker IgE-Fc, the key process of anaphylactic cascade reaction can be observed: formation of the IgE-FceRI complex (Chembiolchem 15,1787-1791 (2014))

Although it is simple to introduce the desired functional group in one step by two reactions independent of each other, the labeling efficiency may be affected by steric effects as well as the hydrophobicity of the introduced probe. This problem can be solved by using molecules that introduce multifunctional "scaffolds" containing bio-orthogonal tags. Distefano et al used farnesyl transferase to transfer the isoprenoid group in farnesyl pyrophosphate to cysteine at the CVIA tetrapeptide sequence, introduced two reactive tags on the model protein GFP, followed by two independent bio-orthogonal reactions to achieve protein double modification (J.Am.chem.Soc.2013,135, 16388-16396).

In some cases, enzyme-mediated protein labeling can occur at specific sites on the surface of a native protein without the need for insertion of artificial polypeptide sequences. Alabi and colleagues use glutamine transaminase of microorganisms to introduce azide groups and methyl tetrazine groups on IgG antibodies, and then react with iEDDA through SPAAC reaction to realize double modification of drugs and PEG on the antibodies (Bioconjugate chem.2019,30, 2452-2457.). However, this strategy is greatly limited by the protein substrate, which requires that the recognition motif of the protein substrate must be displayed at a specific site on the surface.

The Genetic Code Expansion (GCE) is one of the site-directed modification techniques of proteins, and can realize the introduction of ncAAs into a specific site of any target protein in an organism. The technology is to use aminoacyl-tRNA synthetase (aaRS)/tRNA pair which is bio-orthogonal to host cells, and insert ncAAs into the site of a mutated stop codon (UAG/UGA/UAA) in protein to obtain protein of site-specific coding unnatural amino acid. By utilizing the technology, the unnatural amino acid containing the bio-orthogonal reaction group can be introduced into any site of the antibody, and the site-specific coupling of the antibody and effector molecules such as fluorescence, nuclide, medicine, polyethylene glycol (PEG) and nucleic acid can be realized through rapid, efficient and mild reaction conditions, so that the antibody or protein conjugate with site-specific modification and uniform quality can be produced. However, to couple two effector molecules requires the simultaneous introduction of two different bio-orthogonally reactive functional groups on the antibody fragment, which act as a "target" for the coupling. Most of the unnatural amino acids reported in the literature at present only contain one bio-orthogonal reactive group, so that two different unnatural amino acids can only be introduced into a protein by aiming at realizing the site-specific double modification of the protein, and the strategy can greatly reduce the expression yield of the protein and increase the preparation cost.

At present, antibody coupling effector molecules generally adopt full-antibody protein, the full-antibody size is about 150kd, the half-life period in a human body is longer, about 1-2 weeks, the metabolism is slower, the blood retention time is longer, and especially the off-target risk is high in the process of coupling toxin drugs; and the permeability to solid tumors is not high, so the curative effect is limited; in the process of tumor imaging by the fully anti-coupling fluorescent molecules or nuclides, the time for reaching the optimal signal-to-noise ratio is too long, which not only influences the timely diagnosis and treatment of malignant tumors, but also causes the damage of radioactive nuclides to human bodies. Meanwhile, the modification on the antibody generally adopts a large number of amino groups or a plurality of reduced cysteine and other functional natural amino acids to generate a random coupling modified mixture, the average DAR is 5-8, the drug molecules with strong hydrophobicity can cause the aggregation of the antibody, and when the antibody is coupled to a specific antigen binding region, the combination of the antibody and target cells can be influenced, the coupling of a plurality of drugs can cause high immunogenicity, and antibodies and degradation products of the antibody against the multi-conjugate can be generated. Meanwhile, because fixed-point modification cannot be carried out, the uniformity of the prepared medicament (such as ADC) cannot be ensured, and great challenge exists in quality control. In addition, the expression of the full antibody is generally produced by fermentation of eukaryotic cells, and the whole production process is complex, high in cost and low in yield, so that the development of the antibody in the field of biomedicine is limited.

Disclosure of Invention

In view of this, the invention provides a bi/multi-functional unnatural amino acid, a recombinant protein thereof, and applications thereof, wherein the unnatural amino acid can be efficiently introduced into any site of a protein in a targeted manner, the targeted coupling of the protein and an effector molecule is realized through a rapid, efficient and mild reaction, and a bi/multi-conjugate with the targeted modification, which has the advantages of uniform quality, low cost and low immunogenicity, is produced, and the production method is simple and has great potential advantages.

In order to achieve the above object, the present invention provides the following technical solutions:

an unnatural amino acid having the structure of formula I;

or a pharmaceutically acceptable salt, solvate or prodrug thereof:

wherein at least one of Ra, Rb, Rc, Rd and Re is R1 or

Independently selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 haloalkyl, C1-C3 alkoxy, azido-substituted alkanoyl, unsubstituted alkanoyl or alkynyl; r1 is selected from hydrogen, substituted or unsubstituted C1-C10 alkyl, hydroxy, halogen, carboxy, cyanonitro, substituted or unsubstituted C1-C10 alkoxy, azido, hydroxylamino, azido-substituted alkanoyl or unsubstituted alkanoyl; provided that Ra, Rb, Rc, Rd and Re contain together an alkanoyl group, an azido group and

at least two groups of (a).

In some embodiments, the Rb or Re is

The unnatural amino acid has a structure represented by formula I-1 or formula I-2:

the R1 is selected from- (CH) ₂ ) _X N ₃ 、-(CH ₂ CH ₂ O) _X N ₃ 、-(CH ₂ ) _X CO-(CH ₂ ) _X 、-(CH ₂ CH ₂ O) _X CO-(CH ₂ CH ₂ O) _X 、-(CH ₂ ) _X CO-(CH ₂ ) _X N ₃ Or- (CH) ₂ CH ₂ O) _X CO-(CH ₂ CH ₂ O) _X N ₃ ；x＝1-10；

The other substituent groups left on the benzene ring are independently selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 halogenated alkyl, C1-C3 alkoxy, azido, alkanoyl or alkynyl.

In some embodiments, the Rb or Re is R1 and the unnatural amino acid has the structure of formula I-3 or formula I-4:

In some embodiments, the unnatural amino acid has a five carbon atom ring attached to the azido, alkanoyl, or azido group,

At least two groups of (a). The two or more groups are located at different positions on the benzene ring. Provided that n of said Ra, Rb, Rc, Rd and Re areThe substituent A and n are integers of 2-5, and the n substituents are not completely the same; that is, the n substituents A are selected from the group consisting of azido, alkanoyl,

At least two groups of (a);

wherein R1 is selected from hydrogen, methyl and CH ₂ CO-、-(CH ₂ ) _X N ₃ 、-(CH ₂ CH ₂ O) _X N ₃ 、-(CH ₂ ) _X CO-(CH ₂ ) _X 、-(CH ₂ CH ₂ O) _X CO-(CH ₂ CH ₂ O) _X 、-(CH ₂ ) _X CO-(CH ₂ ) _X N ₃ Or- (CH) ₂ CH ₂ O) _X CO-(CH ₂ CH ₂ O) _X N ₃ ；x＝1-10；

The other substituent groups remained on the benzene ring are independently selected from hydrogen, halogen, alkyl of C1-C3, halogenated alkyl of C1-C3, alkoxy or alkynyl of C1-C3.

In some embodiments, the unnatural amino acid has any of the following structures:

the unnatural amino acids of the invention are L-amino acids, D-amino acids, or a combination thereof.

The method for producing the unnatural amino acid of the present invention is not particularly limited, and methods known in the art may be used.

In the present invention, pharmaceutically acceptable salts (including sodium salt, potassium salt, trifluoroacetate, sulfonate, etc.), solvates or prodrugs of the natural amino acids are synthesized according to methods commonly used in the art.

The invention also provides the application of the unnatural amino acid in preparing recombinant protein or recombinant protein conjugate.

The invention provides a recombinant protein, wherein amino acid mutation on at least one site in the sequence of a wild protein is the unnatural amino acid disclosed by the invention.

In the present invention, the protein includes a functional protein having an effect of treating or preventing a disease, a diagnostic protein, an industrial enzyme, or an antibody fragment thereof having an effect of treating and/or preventing a disease.

Gene Codon Expansion (GCE) is one of the techniques for site-directed modification of proteins. The present invention utilizes this technique to introduce the unnatural amino acid containing bio-orthogonal reactive groups of the present invention into the wild-type protein (including functional proteins having disease treatment or prevention effects, diagnostic proteins, industrial enzymes, or antibodies or antibody fragments thereof having disease treatment and/or prevention effects) at a defined site. Through rapid, efficient and mild reaction conditions, site-specific coupling of antibodies with effector molecules such as fluorescence, nuclides, drugs, polyethylene glycol (PEG) and nucleic acids can be achieved, and antibodies or protein conjugates with site-specific modification and uniform quality can be produced.

In some embodiments, the protein or active fragment thereof is selected from the group consisting of alpha-1 antitrypsin, angiostatin, anti-hemolytic factor, antibody, apolipoprotein, apoprotein, atrial natriuretic factor, atrial natriuretic polypeptide, atrial peptide, C-X-C chemokine, T397665, NAP-2, ENA-78, gro-a, gro-b, gro-C, IP-10, GCP-2, NAP-4, SDF-1, PF4, MIG, calcitonin, C-kit ligand, cytokine, CC chemokine, monocyte chemokine-1, monocyte chemokine 2, monocyte chemokine-3, monocyte inflammatory protein-1 alpha, monocyte inflammatory protein-1 beta, RANTES, I309, R83733, HCC1, T58847, D31065, T64262, CD40, CD40 ligand, C-kit ligand, collagen, colony stimulating factor, complement factor 5a, complement inhibitors, complement receptor 1, cytokines, epithelial neutrophil activating peptide-78, MIP-16, MIP-1, epidermal growth factor, epithelial neutrophil activating peptide, erythropoietin, exfoliating toxin, factor IX, factor VII, factor VIII, factor X, fibroblast growth factor, fibrinogen, fibronectin, four-helix bundle protein, G-CSF, glp-1, GM-CSF, glucocerebrosidase, gonadotropin, growth factor receptor, hedgehog protein, hemoglobin, hepatocyte growth factor, hirudin, human growth hormone, human serum albumin, ICAM-1 receptor, LFA-1 receptor, insulin, gamma-gamma, Insulin-like growth factor, IGFI, IGF-II, interferon, IFN-alpha, IFN-beta, IFN-gamma, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, keratinocyte growth factor, lactoferrin, leukemia inhibitory factor, luciferase, nerve growth factor, neutrophile inhibitory factor, oncostatin M, osteogenic protein, oncogene products, paractonin, parathyroid hormone, PD-ECSF, PDGF, peptide hormones, pleiotropic growth factor, protein A, protein G, pth, pyrogenic exotoxin A, pyrogenic exotoxin B and pyrogenic exotoxin C, pyy, relaxin, renin, SCF, small biosynthetic proteins, complement soluble receptor I, At least one of soluble I-CAM 1, soluble interleukin receptor, soluble TNF receptor, somatomedin, somatostatin, growth hormone, streptokinase, superantigen, staphylococcal enterotoxin, SEA, SEB, SECT, SEC2, SEC3, SED, SEE, steroid hormone receptor, superoxide dismutase, toxic shock syndrome toxin, thymosin alpha 1, tissue plasminogen activator, tumor growth factor, tumor necrosis factor alpha, tumor necrosis factor beta, tumor necrosis factor receptor, VLA-4 protein, VCAM-1 protein, vascular endothelial growth factor, urokinase, mos, ras, raf, met, p53, tat, fos, myc, jun, myb, rel, estrogen receptor, progestin receptor, testosterone receptor, aldosterone receptor, LDL receptor, and corticosterone.

In some embodiments, the wild-type antibody comprises a full-antibody, scFv, Fab ', F (ab') ₂ At least one of scFv-Fc, Triabody, Diabody, Minibody, Nanobodies, DARPins, or affibody.

The invention also provides a recombinant protein conjugate, which is formed by coupling the recombinant protein and an effector molecule. In the invention, the effector molecules are selected from at least two of markers, polyethylene glycol, small molecule chemical drugs, polypeptides, proteins, enzymes and nucleic acids; the present invention is not particularly limited with respect to the specific type of effector molecule, and may be any type commonly used or used in the art. Wherein, the label includes but not limited to a fluorescent group and/or a nuclide, and the preparation and the structural schematic diagram of the recombinant protein conjugate are shown in FIG. 20. In some embodiments, the effector molecule is a combination of a nuclide and a fluorophore (e.g., a near infrared fluorescent molecule), a PEG and a toxin small molecule, or a PEG and an antibody fragment drug (e.g., an ADC).

The invention also provides the application of the recombinant protein or the recombinant protein conjugate in cell imaging and/or disease diagnosis imaging.

The invention also provides the application of the recombinant protein or the recombinant protein conjugate in preparing a medicament for treating tumors and/or preventing tumor recurrence or in preparing a tumor detection reagent.

The invention also provides a composition comprising the recombinant protein or the recombinant protein conjugate.

When the composition is a medicament, the composition also comprises pharmaceutically acceptable auxiliary materials.

When the composition is a health-care product, the composition also comprises acceptable auxiliary materials in the health-care product.

The pharmaceutically acceptable auxiliary materials and the auxiliary materials acceptable in the health care products are all common types in the field, and the invention is not specially limited.

The double/multiple-function unnatural amino acid provided by the invention can be efficiently introduced into any site of a protein in a fixed-point manner, the fixed-point coupling of the protein and effector molecules including fluorescence, nuclide, medicine, polyethylene glycol (PEG), nucleic acid and the like is realized through a rapid, efficient and mild-condition reaction, and a double/multiple conjugate which is modified in a fixed-point manner and has uniform quality is produced. Specifically, the method comprises the following steps:

1) the unnatural amino acid is introduced to an antibody fragment J591Fab of a targeted prostate cancer PSMA antigen at a fixed point to respectively obtain a single conjugate of the unnatural amino acid and a near-infrared fluorescent molecule and a double conjugate of PEG and the near-infrared fluorescent molecule, the protein imaging effect shows that a coupled PEG modified group is obviously superior to an uncoupled PEG modified group, the half life of the drug is properly prolonged by coupling the PEG, the signal-to-noise ratio is further improved, and the integral coupling has the advantage of low cost;

2) combining the unnatural amino acid with a nuclide (TCO-NOTA-Cu) ⁶⁴ ) The tumor-targeted PSMA antigen is coupled to an antibody fragment J591Fab of a targeted prostate cancer PSMA antigen together with a near infrared molecule (DBCO-Cy5), then the antibody fragment is injected into a mouse body inoculated with the prostate cancer, the detection of a focus is realized through nuclide imaging, then the tumor boundary is defined under the assistance of near infrared light (NIRF) imaging, the accurate excision of the prostate cancer is realized, and finally the purpose of integrating tumor diagnosis and treatment is realized.

3) The unnatural amino acid is introduced into an antibody fragment (scFv/Fab) in a fixed point manner, the fixed point coupling of the antibody fragment, a small molecule drug and PEG can be realized, the FPDC with fixed point modification and uniform quality can be produced, and the conjugate has the potential advantages of low cost, low immunogenicity and high tumor permeability. After the PEG is coupled, the endocytosis and killing effect of cells are not influenced, and the antibody fragment molecule of the coupled PEG is verified to have stronger killing effect at the animal level, so the antibody fragment molecule has extremely high development prospect clinically.

Drawings

FIG. 1 shows pUltra-p-TetN ₃ FRS/tRNA plasmid map;

FIG. 2 shows a map of pET22b-sfGFP-Y151TAG plasmid;

FIG. 3 is p-TetN ₃ SDS gel electrophoresis of F-inserted sfGFP;

FIG. 4 shows p-TetN ₃ Mass spectrum of protein with F inserted sfGFP;

FIG. 5 is a schematic diagram showing the effect of azide group reaction on tetrazine reaction rate

FIG. 6 shows the tetrazine rates before and after the azide reaction;

FIG. 7 is a graph of a tetrazine rate test;

FIG. 8 shows wild type and p-TetN ₃ SDS gel electrophoresis of F insertion into J591-Fab;

FIG. 9 shows flow cytometry verification of J591 and its mutant J591-Fab-121-p-TetN ₃ F targeting;

FIG. 10: J591-Fab-A121-p-TetN ₃ The structural schematic diagram of F antibody fixed-point double-modified fluorescence and nuclide;

FIG. 11: microscopic pet imaging of (a)22Rv1 tumors; (B) ⁶⁴ biodistribution of Cu-labeled J591-Fab-A121-Cy5-NOTA 12 hours after injection. PC3 group N-3, 22Rv1 group N-4; p<0.01. Unpaired two-tailed t-test; data are shown as mean ± s.d. (C) fluorescence imaging guided tumor ablation. (D)22Rv1 tumor tissue pieces were immunofluorescent stained. Tumor tissue was stained with PSMA antibody, showing green, nuclei were stained with DAPI, showing blue, J591-Fab-A121-Cy5-NOTA, showing red;

FIG. 12: J591-Fab-A121-p-TetN ₃ The structural schematic diagram of F antibody fixed-point double-modified fluorescence and PEG;

FIG. 13: the protein is separated by using an AKTA protein purification system to obtain J591Fab-Cy 5;

FIG. 14 is a schematic view of: separating by using an AKTA protein purification system to obtain a J591Fab-Cy5 protein modified by coupling PEG 20K;

FIG. 15: fluorescence imaging of (a)22Rv1 tumors; 0.6nmol of J591-Fab-A121-Cy5 and J591-Fab-A121-Cy5-PEG20K, respectively, was injected intravenously; respectively carrying out

image acquisition

2h, 4h, 6h, 10h, 24h and 36h after injection; white dotted circles indicate the location of the tumor; (B) quantification of fluorescence intensity of group a 22Rv1 tumors; each group had 3 mice. (C) a tumor-to-background ratio (TBR) for group 22Rv1 tumor-bearing mice; meanwhile, the auricles on the same side are drawn as a background; 3 pieces per group; p < 0.01. Data in unpaired two-tailed t-tests B and C are presented as mean ± sd;

FIG. 16: pUltra-m-TetN ₃ FRS/tRNA plasmid map;

FIG. 17: m-TetN ₃ F is inserted into a green fluorescent protein schematic diagram and an SDS gel electrophoresis diagram;

FIG. 18: pCMV-MfPylRS-m-TetN ₃ FRS/tRNA plasmid map;

FIG. 19 is a schematic view of: m-TetN ₃ F, inserting verification in a true nuclear system;

FIG. 20: the bi/multifunctional unnatural amino acid of the invention encodes proteins and mediates the preparation of protein conjugates.

Detailed Description

The invention provides an unnatural amino acid with double/multiple functions, a recombinant protein thereof and application thereof. Those skilled in the art can modify the process parameters appropriately in view of the disclosure herein. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein may be made and utilized without departing from the spirit and scope of the invention.

The double/multiple-function unnatural amino acid provided by the invention can be efficiently introduced into any site of a protein in a fixed-point manner, the protein (including an antibody or an antibody fragment, such as) and an effector molecule are coupled in a fixed-point manner through a rapid, efficient and mild-condition reaction, and a double/multiple conjugate which is modified in a fixed-point manner and has uniform quality is produced, wherein the effector molecule is selected from at least two of a marker, polyethylene glycol, a small-molecule chemical drug, polypeptide, protein, enzyme and nucleic acid; the present invention is not particularly limited with respect to the specific type of effector molecule, and may be any type commonly used or used in the art. Labels include, but are not limited to, fluorophores and/or nuclides, among others. Specifically, the effector molecule is a combination of nuclide and fluorophore (such as near infrared fluorescent molecule), a combination of PEG and toxin small molecule, or a combination of PEG and antibody fragment drug (such as ADC), and is exemplified by antibody fragment J591-Fab against prostate cancer specific membrane antigen PSMA and antibody fragment scFv against HER 2:

(1) antibody coupling fragment of nuclide and near infrared fluorescent molecule (shown in FIG. 10)

Early accurate diagnosis and treatment of cancer has been a hot and difficult problem of medical research. Early accurate diagnosis staging and typing have important significance for selecting cancer treatment modes, and the search for a high-sensitivity and high-specificity imaging diagnosis method is important for solving clinical problems and is also a basisBasic scientific research assists in addressing significant clinical needs and translating product and technology keys. For early prostate cancer, the operation is still the most effective treatment means at present, the accurate removal of the pathological change tissue in the operation process is particularly critical, the prognosis of a patient is directly influenced, and the specific mark identification technology for the pathological change tissue in the operation process can realize effective operation assistance and navigation. Aiming at auxiliary clinical medicine, combining a dominant antibody engineering technology, developing a novel bioorthogonal reaction mediated antibody fixed-point double-labeling technology based on tetrazine and azide, taking prostate cancer as a research target, analyzing a J591 antibody sequence around an antibody fragment J591-Fab aiming at a prostate cancer specific membrane antigen PSMA, selecting a Fab part for antibody engineering transformation, performing engineering design on 2-4 parts far away from an antigen binding site (A121, K169 and S202), optimizing conditions, and using aminoacyl tRNA synthetase/tRNA pairs orthogonal to host cells to carry out tetrazine and azide double-function unnatural amino acid p-TetN ₃ F site-specific high-efficiency introduction into the antibody fragment, and then nuclide (TCO-NOTA-Cu) is introduced in an in vitro environment ⁶⁴ ) The tumor boundary detection kit is coupled to an antibody together with a near infrared molecule (DBCO-Cy5), then injected into a prostate cancer inoculated mouse body, the focus is detected through nuclide imaging, then the tumor boundary is defined under the assistance of near infrared light (NIRF) imaging to realize accurate resection of the prostate cancer, and finally the goal of tumor diagnosis and treatment integration is realized.

(2) Antibody-conjugated fragments of PEG with near-infrared fluorescent molecules (shown in figure 12);

although the above experiment can realize bimodal imaging of tumor, compared with full antibody, the signal-to-noise ratio is relatively weak, considering that the size of the kidney-filtered molecule is about 60kd, the small molecular weight of the antibody fragment also causes the problem of too short half-life in vivo, so that the antibody fragment molecule is rapidly cleared by the kidney, the circulation time in blood is shortened, and the enrichment effect of the antibody fragment in the tumor part is further influenced. Additional site-directed coupling of PEG to proteins is a common method to achieve long half-life of Fab, and we also used the bifunctional unnatural amino acid p-TetN containing tetrazine functional group and azide functional group to address the above problems ₃ F. We have found thatThe method is characterized in that site-directed modified J591Fab-Cy5 and site-directed coupled PEG modified J591Fab-Cy5 proteins are obtained respectively, and the imaging effect of the PEG modified J591Fab-Cy5 protein is proved to be better than that of the unconjugated PEG modified J591Fab-Cy5 protein.

(3) Antibody-conjugated fragment of PEG and drug

By referring to the advantage of realizing high enrichment of tumors by increasing PEG, whether the antibody fragment medicine for increasing PEG has stronger killing effect is verified. We selected a breast cancer model in which Human epidermal growth factor receptor 2(Human epidermal growth factor receptor2, HER2) is low expressed in normal tissues and high expressed in breast cancer, which makes it an effective target in tumor therapy. Antibody-drug conjugates (ADCs) are now a class of therapeutic drugs that combine antigen-specific antibodies with potent cytotoxic payloads. Compared with the traditional micromolecule chemotherapy drugs, the ADC has better targeting property on tumor tissues and smaller toxic and side effects on normal tissues, so the treatment window is wider, and the ADC is safer and more effective. Several drugs are currently on the market and in clinical research, but the traditional ADC drugs still have some disadvantages, such as large molecular weight of monoclonal antibody (about 150kDa), slow metabolism, long retention time in blood, high risk of toxin drug off-target; and the permeability to solid tumors is not high, so the curative effect is limited; meanwhile, the antibody generally adopts a random drug coupling strategy, the average DAR is 5-8, and drug molecules with strong hydrophobicity possibly cause aggregation of the antibody, and meanwhile, because fixed-point modification cannot be carried out, the uniformity of the prepared ADC drug cannot be ensured, and great challenge exists in quality control. Therefore I amThe existing ADC drugs are upgraded and updated by bifunctional unnatural amino acids, and the bifunctional unnatural amino acid p-TetN is introduced into a specific site of an antibody fragment ₃ F, the site-specific coupling of the antibody fragment (scFv/Fab), the micromolecular drug and PEG can be realized through rapid, efficient and mild reaction conditions, and the antibody fragment polyethylene glycol drug conjugate (AFPDC) which is site-specific modified and uniform in quality is produced, and has the potential advantages of low cost, low immunogenicity and high tumor permeability. The coupled PEG product does not influence endocytosis and killing effect, and verifies that the antibody fragment molecule of the coupled PEG has stronger killing effect at animal level, if the effect is better than the ADC molecule on the existing market, the product has great commercial development potential, and meanwhile, the product also has certain development prospect clinically.

The test materials adopted by the invention are all common commercial products and can be purchased in the market.

The invention is further illustrated by the following examples:

example 1 Tetrazine-and azido-containing amino acids p-TetN ₃ Synthesis of F

(1) Synthesis of 4-azidobutyronitrile (4-azidobutanenitrile,2)

Weighing 4-bromobutyronitrile (10g, 68.0mmol) and dissolving in 150mL DMF, adding NaN at room temperature ₃ (5.71g, 87.8mmol), and reacted at 80 ℃ for 12 h. After the reaction, water and ether were added and extracted three times, 150mL each time. Washed with saturated brine for three times and dried over anhydrous sodium sulfate. Suction filtration, spin-drying of the filtrate, three washes with petroleum ether, and characterization of the synthesized product reference (j.med. chem.2010,53,2, 616-.

Reagent: 4-bromobutyronitrile was purchased from Bibei medicine with the product number: BD 95224. DMF, diethyl ether, petroleum ether, anhydrous sodium sulfate and sodium chloride were obtained from Guang Fine chemical company, Beijing.

(2)p-TetN ₃ F-Boc synthesis

tert-Butoxycarbonyl-p-cyano-L-phenylalanine (3) (1g, 3.5mmol) was placed in a 100mL flask, 4-azidobutyronitrile (3g, 27.3mmol) and 3-mercaptopropionic acid (0.36g, 3.4mmol) were added, and the mixture was cooled to 0 ℃ in an ice bath. Hydrazine monohydrate (2.72g, 54.4mmol) was added dropwise and reacted overnight at 40 ℃ under argon. And cooling the reaction liquid to 0 ℃, adding an excessive sodium nitrite solution, stirring, slowly adding 2mol/L dilute hydrochloric acid, and adjusting the pH value to 3-4. Extracted three times with ethyl acetate and dried over anhydrous sodium sulfate overnight. Suction filtration, spin-drying, and silica gel column chromatography (DCM: MeOH ═ 80:1) gave (4) and the product of the synthesis was characterized as follows.

Reagent: Boc-P-cyano-L-phenylalanine was purchased from Bibei medicine with the product number: BD 16025. The 3-mercaptopropionic acid is purchased from Bidu medicine, and the product number is: BD 41154. Hydrazine hydrate is purchased from aladine, and the product number is: H104517. sodium nitrite was purchased from Guang Fine chemical company, Beijing, and the product number was: 106007. hydrochloric acid, ethyl acetate, dichloromethane, methanol and silica gel were purchased from Guang Fine chemical company, Beijing.

(3) Deprotection of the amino acid

The product of the above step was dissolved in TFA/DCM ═ 1: 1(v/v), stirring at room temperature for 4h, and spin-drying the solvent in vacuo. Adding 50mL of diethyl ether, stirring overnight, and performing suction filtration to obtain mauve solid p-TetN ₃ F，HNMR(400MHz,CD3OD)δ10.30(1H,s),8.53(2H,m),7.62-7.64(2H,m),3.53(2H,m),3.45(3H,m),2.70(2H,m),2.26(2H,m).13C NMR(175MHz,CD3OD)δ173.89,169.54,164.02,133.26,132.83,129.69,128.48,126.86.9,50.40,39.03,33.34,32.91,31.56,26.69.ESI-MS calculated for C ₁₄ H ₁₈ N ₇ O ₂ ([M+H]+)329.1,found 329.1

Example 2: containing tetrazine and azido amino acid m-TetN ₃ Synthesis, insertion and characterization of F

(1) Synthesis of 4-azidobutyronitrile (4-azidobutanenitrile,2)

Weighing 4-bromobutyronitrile (10g, 68.0mmol) and dissolving in 150mL DMF, adding NaN at room temperature ₃ (5.71g, 87.8mmol) and reacted at 80 ℃ for 12 h. After the reaction, water and ether were added and extracted three times, 150mL each time. Washed with saturated brine for three times and dried over anhydrous sodium sulfate. Suction filtration, spin-drying of the filtrate, three washes with petroleum ether, and characterization of the synthesized product reference (j.med. chem.2010,53,2, 616-.

Reagent: 4-bromobutyronitrile is purchased from Bidu medicine, and the product number is: BD 95224. DMF, diethyl ether, petroleum ether, anhydrous sodium sulfate and sodium chloride were obtained from Guang Fine chemical company, Beijing.

(2)m-TetN ₃ F-Boc synthesis

(S) -2- ((tert-Butoxycarbonyl) amino) -3- (3-cyanophenyl) propionic acid (5) (1g, 3.5mmol) was placed in a 100mL flask, 4-azidobutyronitrile (3g, 27.3mmol) and 3-mercaptopropionic acid (0.36g, 3.4mmol) were added, and cooled to 0 ℃ in an ice bath. Hydrazine hydrate (2.72g, 54.4mmol) was added dropwise followed by an argon blanket and reaction overnight at 40 ℃. And cooling the reaction liquid to 0 ℃, adding an excessive sodium nitrite solution, stirring, slowly adding 2mol/L dilute hydrochloric acid, and adjusting the pH value to 3-4. Extracted three times with ethyl acetate and dried over anhydrous sodium sulfate overnight. It was filtered off with suction, dried on a silica gel column and isolated (DCM: MeOH: 80:1) to give (6).

Reagent: (S) -2- ((tert-butoxycarbonyl) amino) -3- (3-cyanophenyl) propionic acid was purchased from Bibei medicine and the product number was: BD 16024. 3-mercaptopropionic acid was purchased from Bibei medicine with the product number: BD 41154. Hydrazine hydrate is purchased from alatin, and the product number is: H104517. sodium nitrite was purchased from Guang Fine chemical company, Beijing, and the product number was: 106007. hydrochloric acid, ethyl acetate, dichloromethane, methanol and silica gel were purchased from Guang Fine chemical company, Beijing.

(3) Deprotection of the amino acid

Dissolve the product from the above step in TFA/DCM ═ 1: 1(v/v), stirring at room temperature for 4h, and spin-drying the solvent in vacuo. Adding 50mL of diethyl ether, stirring overnight, and performing suction filtration to obtain mauve solid m-TetN ₃ F。

Construction of p-TetN ₃ F and m-TetN ₃ Aminoacyl tRNA synthetase (RS/tRNA) inserted into green fluorescent protein

We proceed again based on Tet2.0RS (J.Am.chem.Soc.2015,137,10044-10047)The following mutations were used: 65S, 158G, 162G; the constructed mutant successfully converts p-TetN ₃ F is inserted into sfGFP and named as p-TetN ₃ FRS; at the same time, with reference to the latest work of the subject group RyanA.Mehl (J.Am.chem.Soc.2020,142,7245-7249), m-TetN was successfully prepared with reference to Tet-v3.0-RS/tRNA into which Tet-v3.0Bu was inserted ₃ F is inserted into sfGFP. The purified protein was characterized by SDS gel electrophoresis and protein mass spectrometry.

Preparation of site-directed insertion bifunctional amino acid p-TetN ₃ A method of recombining a protein of F, comprising the steps of:

example 3: preparation of helper plasmid pUltra-tet2.0RS/tRNA

According to the reference: J.Am.chem.Soc.2015,137,10044-10047 designed the gene for the aminoacyltRNA synthetase Tet2.0RS of Tet2.0, and the Tet2.0RS gene was synthesized by the company. The CNF fragment in the pUltra-CNF expression vector was replaced with the Tet2.0RS gene to obtain plasmid pUltra-tet 2.0RS/tRNA. Then, mutation of Q at position 65 of Tet2.0RS to S, mutation of S at position 158 to G, and mutation of N at position 162 to G is carried out by utilizing quikchange site-directed mutagenesis, thereby obtaining helper plasmid pUltra-p-TetN ₃ FRS/tRNA。

The specific process is as follows:

1: the Tet2.0RS gene fragment was PCR-amplified from a plasmid carrying the Tet2.0RS gene using Tet2.0RS-F, Tet2.0 RS-R primers, wherein the sequence of the Tet2.0RS-F primer was atggacgaatttgaaatgataaaga, and p-TetN ₃ The sequence of the FRS-R primer is as follows: ttataatctctttctaattggctctaaaatc is added.

The PCR reaction system is shown in Table 1.

TABLE 1

ddH ₂ O	20μL
		KOD One ^TM PCR Master Mix	25μL
Tet2.0RS-F(10μM)	2μL
		Tet2.0RS-R(10μM)	2μL
Plasmid with Tet2.0RS gene (50 ng/. mu.L)	1μL
		Total volume	50μL

The PCR reaction conditions are as follows: 30 cycles of 98 ℃ for 10s, 54 ℃ for 5s, 68 ℃ for 20 s; storing at 4 ℃. And (4) carrying out electrophoresis and purification on the PCR product, and recovering to obtain a Tet2.0RS gene fragment.

2: then, the pUltra-CNF vector is linearized by means of PCR, and cloned by means of Gibson assembly to obtain pUltra-Tet2.0RS/tRNA plasmid.

The specific method for carrying out PCR linearization on the pUltra-CNF vector comprises the following steps: the PCR reaction system of the pUltra-CNF vector linearization is shown in Table 2 by using pUltra-F and pUltra-R primers and pUltra-CNF vector as a template for amplification.

Wherein, the sequence of the pUltra-F primer is as follows: caattagaaagagattataagcggccgcgtttaaacgg, respectively; the sequence of the pUltra-R primer is as follows: atcatttcaaattcgtccatgcggccgcacctcctttgtg are provided.

The PCR reaction system for pUltra-CNF vector linearization:

TABLE 2

ddH ₂ O	20μL
		KOD One ^TM PCR Master Mix	25μL
pUltra-F(10μM)	2μL
		pUltra-R(10μM)	2μL
pUltra-CNF plasmid (50 ng/. mu.L)	1μL
		Total volume	50μL

The PCR reaction conditions were: 30 cycles of 98 ℃ for 10s, 54 ℃ for 5s, and 68 ℃ for 60 s; and storing at 4 ℃, carrying out electrophoresis and purification on the PCR product, and recovering to obtain the linearized pUltra-CNF.

The Gibson reaction system is: Tet2.0RS gene fragment (20 ng/. mu.L): 1.5. mu.L, linearized pUltra-CNF (50 ng/. mu.L): 1 μ L, Gibson reaction: 2.5 μ L, 5 μ L overall.

The Gibson reaction conditions were: 50 ℃ for 1 hour.

The Gibson reaction solution was transformed into E.coli DH10B, spread on LB plates of spectinomycin 50. mu.g/mL, picked the next day on 5mL2YT liquid medium, added with spectinomycin 50. mu.g/mL, shake-cultured at 37 ℃ for 12 hours at 220 rpm, extracted (according to the instructions of the kit), and sequenced to confirm the plasmid as pUltra-Tet2.0RS plasmid.

Example 4: preparation of pUltra-p-TetN ₃ FRS/tRNA plasmids

Tet2 was then site-directed by using quikchangeThe 65-bit Q mutation of 0RS is S, the 158-bit S mutation is G, the 162-bit N mutation is G, so as to obtain the helper plasmid pUltra-p-TetN ₃ FRS/tRNA (see FIG. 1).

The steps of the quikchange site-directed mutagenesis are as follows: carrying out PCR amplification by using 65S-F, 65S-R primers, 158G162G-F and 158G162G-R and taking a pUltra-Tet2.0RS plasmid as a template, carrying out enzyme digestion on a PCR product by using DpnI endonuclease, converting the enzyme-digested product into escherichia coli, selecting a monoclonal extracted plasmid, and carrying out sequencing verification to obtain pUltra-p-TetN ₃ FRS/tRNA plasmid.

Wherein, the sequence of the 65S-F primer is as follows:

gattgatttacaaaatgctggatttgatataattatagcattggctgatttacacgcctatttaaacc；

the sequence of the 65S-R primer is as follows:

ggtttaaataggcgtgtaaatcagccaatgctataattatatcaaatccagcattttgtaaatcaatc；

the sequence of the 158G162G-F primer is:

gctgaagttatctatccaataatgcaggttaatggaattcattatggaggcgttgatgttgcagttgg；

the sequence of the 158G162G-R primer is:

ccaactgcaacatcaacgcctccataatgaattccattaacctgcattattggatagataacttcagc。

the PCR reaction system is shown in Table 3.

TABLE 3 PCR reaction System

The PCR reaction conditions are as follows: 10s at 98 ℃, 5s at 54 ℃, 80s at 68 ℃ and 15 cycles; storing at 4 ℃.

The enzyme digestion reaction system of the DpnI endonuclease is as follows: 50 μ of LPCR reaction solution, 1 μ of LDpnI endonuclease.

The conditions of the DpnI endonuclease digestion reaction are as follows: 2 hours at 37 ℃.

The transformation steps of the escherichia coli are as follows: adding 5 mu of LDpnI enzyme digestion product into Escherichia coli DH10B transformation competence, performing ice bath for 30min, performing heat shock for 45 seconds at 42 ℃, performing ice bath for 3 min, adding 2YT culture medium for incubation for 1 hour at 37 ℃, plating, selecting single clone, extracting plasmid, and performing sequencing verification.

Shown as pUltra-p-TetN in FIG. 1 ₃ Plasmid map of FRS/tRNA plasmid, pUltra-p-TetN ₃ The FRS/tRNA plasmid has spectinomycin resistance, and sequencing determines that the pUltra-p-TetN ₃ FRS/tRNA plasmids differed from the pUltra-Tet2.0RS plasmid only at 65, 158 and 162 sites (65CAG mutated to GCA, 158AGT mutated to GGA, 162AAT mutated to GGA).

Example 5: preparation of plasmid containing Y151TAG mutant sfGFP-pET 22b-sfGFP-Y151TAG

Obtaining a plasmid with sfGFP gene by gene synthesis, carrying out PCR linearization on a pET22b vector, cloning the sfGFP gene into a pET22b vector by a Gibson assembly mode to obtain a pET22b-sfGFP plasmid, and mutating Y at position 151 of the sfGFP into TAG by a quikchange site-directed mutagenesis mode to obtain a pET22b-sfGFP-Y151TAG plasmid (shown in figure 2).

The specific process is as follows: amplifying sfGFP gene fragments from plasmids with sfGFP genes by using sfGFP-F and sfGFP-R primers, wherein the sequences of the sfGFP-F primers are as follows: CACACAGAATTCATTAAAGAGGAGAAATTACATATGAGCAAAGGAGAAGAACTTTTCACT, respectively; the sequence of sfGFP-R primer is: GTCCAAGCTCAGCTAATTAAGCTTTTAGTGGTGGTGGTG GTGGTGGGATC, the underlined part is a 6XHis tag. The PCR reaction system for amplifying sfGFP gene fragments is shown in Table 4.

TABLE 4 PCR reaction System for amplifying sfGFP gene fragments

The PCR reaction conditions are as follows: 10s at 98 ℃, 5s at 54 ℃,15 s at 68 ℃ and 30 cycles; and storing at 4 ℃, carrying out electrophoresis and purification on the PCR product, and recovering to obtain the sfGFP gene fragment.

The pET22b plasmid is linearized through a PCR method, and the specific process is as follows: PCR reaction systems for pET22b plasmid were shown in Table 5, using pET22b-sfGFP-F and pET22b-sfGFP-R primers and pET22b plasmid as template for amplification.

The sequence of the pET22b-sfGFP-F primer is as follows: AAGCTTAATTAGCTGAGCTTGGAC, respectively; pET22b-sfGFP-R primer sequence is: ATGTAATTTCTCCTCTTTAATGAATTCTGTGTG is added.

TABLE 5 PCR reaction System for pET22b plasmid

The PCR reaction conditions are as follows: 30 cycles of 98 ℃ for 10s, 54 ℃ for 5s, and 68 ℃ for 60 s; storing at 4 ℃. The PCR product was electrophoresed, purified, and recovered to obtain linearized pET22b plasmid.

The Gibson reaction system is: sfGFP gene fragment (20 ng/. mu.L): 1.5 μ L, linearized pET22b plasmid (50 ng/. mu.L): 1 μ L, Gibson reaction: 2.5 μ L, 5 μ L overall.

The Gibson reaction conditions were: 50 ℃ for 1 hour.

The Gibson reaction solution was transformed into E.coli DH10B, spread on LB plates with 50. mu.g/mL ampicillin, and the next day single colonies were picked up on 5mL of 2YT liquid medium, ampicillin was added to the medium at a concentration of 50. mu.g/mL, shake-cultured at 37 ℃ for 12 hours at 220 rpm, and plasmids were extracted (according to the kit instructions) and confirmed by sequencing to be pET22b-sfGFP plasmids. The plasmid sequence of pET22b-sfGFP was sequenced as shown in Seq ID No. 33.

The steps of the quikchange site-directed mutagenesis are as follows: and performing PCR amplification by using sfGFP-151-F and sfGFP-151-R primers and pET22b-sfGFP plasmid as a template, performing enzyme digestion on a PCR product by using DpnI endonuclease, converting the enzyme-digested product into escherichia coli, selecting a monoclonal extracted plasmid, and performing sequencing verification to obtain pET22b-sfGFP-Y151TAG plasmid.

Wherein the sequence of the sfGFP-151-F primer is as follows:

TTTAACTCACACAATGTATAGATCACGGCAGACAAACAAAAGAATG；

the sequence of sfGFP-151-R primer is:

GTTTGTCTGCCGTGATCTATACATTGTGTGAGTTAAAGTTGTACTCGAG, respectively; the PCR reaction system is shown in Table 9.

The part of the horizontal line is the mutation site, and the codon TAC originally encoding tyrosine (Y) is mutated into the stop codon TAG.

TABLE 6 PCR reaction System

ddH ₂ O	20μL
		KOD One ^TM PCR Master Mix	25μL
sfGFP-151-F(10μM)	2μL
		sfGFP-151-R(10μM)	2μL
pET22b-sfGFP plasmid (50 ng/. mu.L)	1μL
		Total volume	50μL

The PCR reaction conditions were: 10s at 98 ℃, 5s at 54 ℃, 80s at 68 ℃ and 15 cycles; storing at 4 deg.C.

The transformation steps of the escherichia coli are as follows: adding 5 mu of LDpnI enzyme digestion product into escherichia coli DH10B transformation competence, carrying out ice bath for 30min, carrying out heat shock for 45 s at 42 ℃, carrying out ice bath for 3 min, adding 2YT culture medium, incubating for 1h at 37 ℃, plating, picking single clone, extracting plasmid, and carrying out sequencing verification.

As shown in FIG. 2, the plasmid map of pET22b-sfGFP-Y151TAG plasmid, pET22b-sfGFP-Y151TAG plasmid has ampicillin resistance, and sequencing confirms that pET22b-sfGFP-Y151TAG plasmid only has difference from pET22b-sfGFP plasmid at Y151TAG site (TAC is mutated into TAG).

Example 6: preparation of site-directed mutant sfGFP-expressing Strain

The helper plasmid pUltra-p-TetN prepared in example 4 was used ₃ Two plasmids, namely FRS/tRNA plasmid (spectinomycin resistance) and expression plasmid pET22b-sfGFP-Y151TAG (ampicillin resistance) obtained in example 5, were co-transformed into E.coli BL21(DE3) strain, and positive strains transformed with both plasmids were selected by double-resistant plates (spectinomycin and ampicillin resistance), and named expression strains BL21-pET22b-sfGFP-Y151TAG-pUltra-p-TetN ₃ FRS/tRNA。

Example 7: site-specific insertion of unnatural amino acid sfGFP-p-TetN ₃ F expression purification and mass spectrometry verification

BL21-pET22b-sfGFP-Y151TAG-pUltra-p-TetN in example 6 ₃ Culturing FRS/tRNA single colony overnight with 5mL2YT culture medium containing spectinomycin and ampicillin, transferring to 50mL fresh 2YT culture medium containing spectinomycin and ampicillin at 1:100 volume ratio the next day, adding 1mM p-TetN into the culture medium when the culture reaches the initial stage of exponential growth ₃ F, adding IPTG to induce when OD is about 0.6-0.8, expressing at 37 deg.C for 8-10 hr, and collecting thallus.

Resuspending the collected expression bacteria with PBS, and ultrasonication at 0-4 deg.C for 1-2 min. The disrupted product was subjected to high-speed centrifugation (12000rpm, 30 minutes, 4 ℃ C.), and the supernatant was aspirated. The supernatant samples were incubated with Ni affinity columns for 30min at 4 ℃ and then washed 5-10 column volumes with 25mM imidazole, 3 column volumes with 40mM imidazole, eluted with 250mM imidazole and concentrated, after which the purity and approximate molecular weight of the purified protein was determined by SDS-PAGE protein electrophoresis.

The site-specific insertion of the unnatural amino acid was confirmed by Mass spectrometry (electrophoresis Ionization Mass Spectroscopy) using purified green fluorescent protein containing the unnatural amino acid, and the insertion of the unnatural amino acid was confirmed by protein Mass spectrometry. SDS gel electrophoresis analysis and mass spectrometry characterization of sfGFP with sequential insertion of unnatural amino acids as shown in FIGS. 3-4 indicate that unnatural amino acids are indeed inserted into sfGFP proteins. The engineering strain of colibacillus prepared by the method provided by the invention can express green fluorescent protein with unnatural amino acid.

Example 8: sfGFP-p-TetN ₃ F and sfGFP-p-TetN ₃ Determination of reaction rate constant of F-DBCO-Amine and sTCO

We use the unnatural amino acid p-TetN ₃ F, for example, was determined if the reaction rate of tetrazine inserted on sfGFP with TCO was affected by azide or after reaction with a specific molecule on azide. The tetrazine is closer to the azide molecular group, and the default rate is not greatly influenced because the azide group extends out through a flexible aliphatic chain, so whether the reaction rate of TCO and tetrazine is influenced after the azide molecule and DBCO-amino are completely reacted or not is verified. sfGFP emits strong green fluorescence (528nm) under specific excitation light (488nm), and fluorescence at 528nm is greatly reduced after tyrosine at position 151 in sfGFP is replaced by tetrazine amino acid. Meanwhile, after the tetrazine amino acid at the 151 th site reacts with sTCO, sfGFP can restore strong green fluorescence at 528 nm. According to this principle, sfGFP and sTCO were mixed in PBS at 25 ℃ in a 1:1 and detecting the change of 528nm fluorescence intensity in a system under 488nm of exciting light with time by using a microplate reader to calculate a corresponding rate constant.

1. Preparation of the solution

The purified sfGFP solution was diluted to 2mM PBS solution and the DMSO solution of 20mM sTCO was diluted to 2mM PBS solution. With DBCO-NH ₂ Reacted with 1mM sfGFP stock for 24h and concentrated by ultrafiltration before formulating a 2mM sfGFP-DBCO solution in PBS.

2. Establishment of fluorescence Standard Curve

The sfGFP stock solutions were prepared as 200uL PBS solutions of 200nM, 400nM and 800nM, respectively, and their fluorescence intensity at 528nM was measured under 488nM excitation light, and then 1uL of 20mM sTCO DMSO solution was added thereto for reaction for one hour, and the fluorescence values were measured, respectively. The sfGFP-DBCO assay was the same as described above.

3. Determination of Rate constants

Respectively according to the following steps of 1: the sfGFP solution and the sTCO solution with the concentrations of 400nM, 800nM and 1600nM being mixed in PBS at a ratio of 400nM, 400nM and 800nM and the final volume of 200uL being 1, after mixing for ten seconds, the fluorescence intensity change at 528nM under 488nM excitation light is detected by a microplate reader at 25 ℃, and the time-dependent change curve of the fluorescence intensity is shown in FIG. 6.

The fluorescence intensity at each time can be converted into (1/c-1/c) by the fluorescence standard curve obtained as described above ₀ ) (wherein c represents the concentration of sfGFP-Tet at a certain time, c ₀ Initial concentration of sfGFP-Tet) according to the equation of the rate of the two-stage reaction when the concentrations of the reactants are the same, integral formula 1/c-1/c ₀ (ii) kt, 1/c-1/c ₀ The slope obtained by plotting t is the corresponding rate constant. It should be noted that, because the reaction system is not the same secondary reaction system at the standard concentration in the subsequent time due to the artificial operation error, the point at the start of the reaction is used as much as possible in the dot plot. The final result is shown in fig. 7:

finally, the final second order reaction rate constants were obtained by averaging the rate constants obtained in the different systems at each concentration, as shown in FIG. 7:

example 9: construction of wild type J591 antibody fragment plasmid-PET 22b-J591-Fab and mutant plasmid

According to the research, Prostate cancer (Prostate cancer) is taken as a tumor model, the Prostate cancer is the most common malignant tumor of the male genitourinary system, radical treatment can be realized through an operation under the condition of accurate stage division of early Prostate cancer, and an effective Prostate cancer stage division auxiliary method has important clinical value. Specificity of prostateMembrane Antigen (PSMA) was found to be overexpressed in almost all Prostate cancer patient samples, while protein expression from normal tissues is restricted to the kidneys, salivary glands and central nervous system, and PSMA can be used to specifically direct signaling molecules to achieve molecular imaging of Prostate cancer. Monoclonal antibody J591 has high sensitivity and specificity (Current radiopharmaceuticals 9,44-53 (2016)). Aiming at the limitation of the antibody, the research introduces unnatural amino acid p-TetN into the Fab non-antigen binding region by using a gene codon expansion technology ₃ F, and marking the same is realized.

The variable region (VL and VH) sequences of J591 were obtained from WO 2011/069019A2, based on the combination of herceptin fragments (CL and CH) sequences as J591Fab genes, and were synthesized by Gene Script to obtain a plasmid containing the pUC vector containing the sequence.

The light chain sequence was:

ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAACGCGTACGCT GACATCGTGATGACCCAGTCCCCCTCCTCCCTGTCTGCCTCCGTGGGCGACAGAGTGACCATCACATGCAAGGCCTCCCAGGATGTGGGCACCGCCGTGGACTGGTATCAGCAGAAGCCTGGCAAGGCCCCTAAGCTGCTGATCTACTGGGCCTCCACCAGACACACCGGCGTGCCTGACAGATTCACCGGCTCCGGCTCTGGCACCGACTTCACCCTGACCATCTCCAGCCTGCAGCCTGAGGACTTCGCCGACTACTTCTGCCAGCAGTACAACTCCTACCCTCTGACCTTCGGCGGAGGCACCAAGCTGGAAATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTCGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCTAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGTCCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGT

the heavy chain sequence is:

ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAACGCGTACGCT GAAGTGCAGCTGGTGCAGTCTGGCGCCGAAGTGAAGAAACCTGGCGCCTCCGTGAAGATCTCCTGCAAGACCTCCGGCTACACCTTCACCGAGTACACCATCCACTGGGTGAAACAGGCCTCCGGCAAGGGCCTGGAATGGATCGGCAACATCAACCCTAACAACGGCGGCACCACCTACAACCAGAAGTTCGAGGACCGGGCCACCCTGACCGTGGACAAGTCCACCTCCACCGCCTACATGGAACTGTCCTCCCTGCGGTCTGAGGACACCGCCGTGTACTACTGCGCCGCTGGCTGGAACTTCGACTACTGGGGCCAGGGCACCACAGTGACAGTCTCGAGCTGATCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACTGTGCCCTCTAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACA

because the J591Fab structure has disulfide bonds and is unstable in cytoplasm, the sequence is added at the N end of the target protein: KKNIAFLLASMFVFSIATNAYA, secreted into the matrix during expression, and used for assisting correct folding of Fab by specific molecular chaperone of the matrix; then, a 6 × His affinity tag is added to the C end by using a molecular cloning technology, and the mixture is subsequently used for nickel column purification. pET22B, which is commonly used in Escherichia coli, is used as an expression vector, T7 promoter, and is expressed in DE3 strain. The specific cloning steps are as follows:

(a) designing a primer J591-FW: gaaaaagaatatcgcatttcttcttgctagcatgttcg and Gib-J591-RV: ggtggtggtgctcgagtgcggccgctgtgtgagttttgtcacaagatttgggctc are provided. The J591-Fab gene fragment was amplified from a J591-Fab plasmid with a StII signal peptide. And (3) carrying out electrophoresis and purification on the PCR product, and recovering to obtain a J591-Fab gene fragment containing a 6xHis gene tag and a StII signal peptide. PCR conditions and procedures for the construction of the Herceptin-Fab (StII) fragment are shown in Table 7:

TABLE 7

(b) The pET22b plasmid was PCR linearized. Design primer pET22 b-Fab-F: gatccggctgctaacaaagc and pET22 b-Fab-R: aaatcacctcaaccttagataccc. PCR amplification was performed using plasmid pET22b as a template. And (5) carrying out electrophoresis and purification on the PCR product, and recovering to obtain the vector. The PCR conditions and procedures for pET22b vector construction are shown in Table 8.

TABLE 8

(c) The J591-Fab gene fragment was cloned into pET22b vector by Gibson assembly to obtain pET22b-J591-Fab plasmid. PCR conditions and procedures for construction of pET22b-J591-Fab plasmid are shown in Table 9.

TABLE 9

(d) The Gibson reaction solution was transformed into E.coli DH10B, spread on LB plates with 50. mu.g/mL ampicillin, and the next day single colonies were picked up in 5mL of 2YT liquid medium, supplemented with 50. mu.g/mL ampicillin, shake-cultured at 37 ℃ and 220 rpm for 12 hours, and plasmids were extracted (according to the kit instructions) and confirmed by sequencing to be PET22b-J591-Fab plasmid.

Example 10: construction of the mutant J591 antibody fragment plasmids pET22b-J591-Fab-A121TAG, pET22b-J591-Fab-K169TAG and pET22b-J591-Fab-S202TAG

The resulting PET22b-J591-Fab plasmid was mutated at the A121 position to the A121 TAG. Design primer 121 TAG-F: gggcaccagtgacagtctcgagctgatcaccaaggcccatcggtc, and 121 TAG-R: gaccgatgggcccttggtggatcagctcgagactgtcactgtggtgccc (also can be changed into K1699 TAG at K169. design primer 169 TAG-F: gttcagagagcaggagctaggagcacctacagcccagcacgcc. and 169 TAG-R: gctgaggctgtaggtgctgtcctagctgtcctgctctgtgacac; and changed into S202TAG at S202. design primer S202-F: gcgaagtcacccatcagggcctgtcctcgcccgtcacaaagagc and S202-R: gctctttgtgacgggcgaggacaggccctgatgggtgacttcgc) using PET22b-J591-Fab plasmid as template to carry out PCR amplification, the PCR product is digested for 4h at 37 ℃ by DpnI endonuclease, and the digested product is transformed into DH10B strain: the specific conversion steps are as follows: mu.L of the DpnI digest was added to E.coli DH10B to be chemocompetent, ice-washed for 30min, heat-shocked at 42 ℃ for 45 sec, ice-washed for 3 min, incubated with 1ml of 2YT medium at 37 ℃ for 1h, and then applied to ampicillin-resistant plates, and single clones were picked the next day for sequencing, resulting in the mutant plasmid pET22b-J591-Fab-A121TAG (pET22b-J591-Fab-K169TAG was obtained in the same manner as pET22b-J591-Fab-S202TAG mutant plasmid). PCR conditions and procedure for the pET22b-J591-Fab-A121TAG mutation are shown in Table 10:

watch 10

Example 11: preparation of site-directed mutated J591-Fab expression strain

The helper plasmid pUltra-p-TetN prepared in example 4 was used ₃ Two plasmids, namely FRS/tRNA plasmid (spectinomycin resistance) and expression plasmid pET22b-J591-Fab-A121TAG (ampicillin resistance) obtained in example 9, were co-transformed into E.coli BL21(DE3) strain, and positive strains, which were simultaneously transformed with both plasmids, were selected by double-resistant plates (spectinomycin and ampicillin resistance), and named expression strain BL21-pET22b-J591-Fab-A121TAG-pUltra-p-TetN ₃ FRS/tRNA。

Example 12: containing the unnatural amino acid p-TetN ₃ Preparation of J591-Fab of F

BL21-pET22b-J591-Fab-A121TAG-pUltra-p-TetN in example 10 ₃ Culturing FRS/tRNA single colony overnight with 5mL2YT culture medium containing spectinomycin and ampicillin, transferring to 50mL fresh 2YT culture medium containing spectinomycin and ampicillin at 1:100 volume ratio the next day, adding 1mM p-TetN into the culture medium when the culture reaches the initial stage of exponential growth ₃ F, adding IPTG to induce when OD is about 0.6-0.8, and collecting thallus after intercellular substance expression at 37 deg.C for 8-10 hr. Resuspending the collected expression bacteria with PBS, and ultrasonicating at 0-4 deg.C for 1-2 min. The disrupted product was subjected to high-speed centrifugation (12000rpm, 30 minutes, 4 ℃ C.), and the supernatant was aspirated. The supernatant samples were incubated with Ni affinity columns for 30min at 4 ℃ and then washed 5-10 column volumes with 25mM imidazole, 3 column volumes with 40mM imidazole, eluted with 250mM imidazole and concentrated, after which the purity and approximate molecular weight of the purified protein was determined by SDS-PAGE protein electrophoresis. As shown in FIG. 8, the mass spectrometry results indicated that the unnatural amino acid was indeed inserted into the J591-Fab protein. By adopting the inventionThe engineering strain of Escherichia coli prepared by the method can indeed express the J591-Fab protein-J591-Fab-121-p-TetN with unnatural amino acid ₃ F。

Example 13: validation of J591-Fab-121-p-TetN ₃ F does not affect the binding to the receptor

The same was conducted in order to verify that J591-Fab-121-p-TetN obtained in example 11 ₃ F does not affect the function of a targeted receptor, NHS-Fluorescein is used for randomly modifying fluorescent molecules on amino groups of Fab wild type and Fab mutant, and cells PC3 (low expression) and LNCaP (high expression) with different PSMA expression levels are stained. Flow analysis results demonstrated that the J591Fab wild type was PSMA targeted (FIG. 9), and that the insertion of an unnatural amino acid did not affect this property.

The specific method comprises the following steps:

1) fab was fluorescently labeled 80. mu.M NHS-Fluorescein (4equiv.) with 20. mu.M Fab (1equiv.) at 5. mu.L of 100mM NaHCO ₃ And reacting for 4 hours after uniform mixing. The Fab was labeled with FITC fluorescent molecule. After the labeling is completed, desalting is performed by using a SpinDesalt Column, which is specifically referred to in the specification.

2) PC3, 22rv1 and LNCaP were three cells with different degrees of expression of PSMA. The culture medium required for the culture is RPMI-1640 containing 10% FBS, 2mM L-glutamine and 1% dual antibiotic. When the cell density reached about 90%, the supernatant medium was aspirated. Gently add sterile PBS along the wall, wet the cells, and wash 2 times; then 0.25% of Trypsin-EDTA is added, and the mixture is digested in an incubator at 37 ℃ until the cells become round; adding a culture medium (containing 10% FBS) with the volume more than 2 times of Trypsin for neutralization, blowing down the cells at the bottom of the dish by using a sterile dropper, blowing the cells into single cells, and transferring the single cells into a 15mL centrifuge tube; sucking 10 mul into an EP tube, adding trypan blue dye solution with the same volume, blowing, beating and mixing evenly, and counting by a cell counter; according to the counted number of cells, appropriate amount of cells were aspirated and aliquoted into sterile EP tubes of about 1.2X 10 cells per tube ⁶ And (4) cells. And (3) washing the cells: centrifuge at 500g speed at 4 deg.C for 5min, and discard the supernatant. Adding 200 μ l PBS to resuspend the cells, gently blowing and mixing, centrifuging at 500g rotation speed and 4 deg.C for about 5min, discarding PBS, and repeating for 1 time; and (3) sealing: 1mL PBS resuspended cells containing 1% FBS were incubated on ice for about 1 h; washing fineCell: centrifuging at 4 deg.C for 5min at 500g rotation speed, and washing off the blocking solution. Adding 200 μ l PBS to resuspend the cells, gently blowing and mixing, centrifuging at 500g rotation speed and 4 deg.C for about 5min, discarding PBS, and repeating for 1 time; and (3) incubation: fab was diluted to 10. mu.g/mL with PBS, 200. mu.l of resuspended cells were taken and incubated on ice for 1h in the dark. PBS, wild type Fab, Fab with introduced unnatural amino acids were incubated with PC3 and LNCaP, respectively. Washing cells: 500g, centrifuged at 4 ℃ for 5min and the supernatant discarded. Adding 200 μ l PBS to resuspend the cells, gently blowing, mixing, centrifuging at 4 deg.C for 5min, discarding PBS, and repeating for 2 times; resuspending the cells in 200. mu.l PBS, placing on ice, and storing in dark place; fluorescence analysis was performed using a Beckman flow cytometer. The results are shown in FIG. 9.

Example 14: J591-Fab-121-p-TetN ₃ F antibody fixed-point double-modification fluorescence and nuclide to realize integration of tumor diagnosis and treatment

Early accurate diagnosis and treatment of cancer have been a hot and difficult problem of medical research. Early accurate diagnosis staging and typing have important significance for selecting cancer treatment modes, and the search of a high-sensitivity and high-specificity imaging diagnosis method is crucial to solving clinical problems and is also key to assisting in solving important clinical requirements and transforming products and technologies through basic scientific research. For early prostate cancer, the operation is still the most effective treatment means at present, the accurate removal of the pathological change tissue in the operation process is particularly critical, the prognosis of a patient is directly influenced, and the specific mark identification technology for the pathological change tissue in the operation process can realize effective operation assistance and navigation. Aiming at auxiliary clinical medicine and combining with a dominant antibody engineering technology, a novel bioorthogonal reaction mediated antibody fixed-point double-labeling technology based on tetrazine and azide is developed, prostate cancer is taken as a research target, based on the above embodiment, an antibody fragment J591-Fab aiming at a prostate cancer specific membrane antigen PSMA is surrounded, a J591 antibody sequence is analyzed, a Fab part is selected for antibody engineering, the engineering design is carried out on 2-4 parts far away from an antigen binding site (A121, K169 and S202), conditions are optimized, an aminoacyl tRNA synthetase/tRNA pair mutually orthogonal with a host cell is utilized, and tetrazine and azide bifunctional unnatural amino acid p-TetN are subjected to antibody engineering ₃ F fixed point high efficiency is introduced toIn the antibody fragment, the nuclide (TCO-NOTA-Cu) is then bound in an in vitro environment ⁶⁴ ) The tumor suppressor is coupled to an antibody (shown in figure 10) together with a near infrared molecule (DBCO-Cy5), then injected into a prostate cancer-inoculated mouse body, detected for a focus through nuclide imaging, and then with the assistance of near infrared light (NIRF) imaging, a tumor boundary is defined to realize accurate resection of the prostate cancer, and finally, the goal of tumor diagnosis and treatment integration is realized. The method comprises the following specific steps:

(1) prostate cancer cell line and mouse model establishment

LNCaP, 22Rv1, and PC3 human prostate cancer cell lines were purchased from the chip Academy of Sciences Typical Culture Collection (Shanghai, China). LNCaP cells were cultured in RPMI1640 medium containing 10% Fetal Bovine Serum (FBS), 1% penicillin-streptomycin, 1% GlutaMAX-, and 1% sodium pyruvate. 22Rv1 and PC3 cells were maintained in RPMI1640 medium containing 10% Fetal Bovine Serum (FBS) and 1% penicillin-streptomycin. All cells were incubated at 37 ℃ with 5% CO ₂ The culture was carried out in the air. All animal experiments were performed according to the rules of laboratory animals in Beijing. All procedures and protocols were approved by the animal ethics committee of the first hospital of Beijing university (Beijing, China) under approval No. J201987. BALB/c nude mice were obtained from the animal center at the first hospital, university of Beijing. Mice were housed in groups (up to 5 mice per cage) maintained in a room at 20-25 ℃ and humidity control for a12 hour light/dark cycle. All mice were acclimated for at least 7 days prior to further experiments. Subcutaneous injection of 5X 10 with 100. mu. LPBS buffer ⁶ Cell suspension induction of BALB/c male nude mice to generate PSMA ⁺ 22RV1 and PSMA-PC3 tumors. When the xenograft reaches about 500mm ³ At the time, these mice were used for in vivo imaging.

(2) TCO-PEG3-NOTA preparation (custom synthesized by Seisanry Rexi Bio Inc.) can be used to couple nuclide molecules.

(3) High-resolution near-infrared imaging of tumor by coupling J591Fab of DBCO-Cy5 and TCO-NOTA

20μM J591-Fab-121-p-TetN ₃ Mixing the protein F with 80 mu M DBCO-Cy5(4equiv.) and 200 mu M TCO-PEG3-NOTA (10equiv.), reacting at room temperature in PBS buffer solution with the pH value of 7.4 overnight, and after the reaction and the marking, desalting by using a SpInDesalt Column, wherein the specific reference instruction is provided, and J591-121-Cy5-NOTA is obtained.

(4) ⁶⁴ Cu marker

⁶⁴ Cu was produced using HM-20 medical cyclotron (20MeV, Sumitomo, Japan) at Beijing university tumor Hospital. ⁶⁴ The Cu labeling experiment used 80. mu.L of a solution containing 92.5MBq activity ⁶⁴ Cu]CuCl ₂ 65 μ L of 0.1M sodium acetate and 600 μ g (12nmol) of ofJ591-121-Cy5-NOTA at 37 ℃ and pH 4.0-5.0 were incubated for 30 min. PD-10 columns are used for the purification of radiotracers. The radiochemical yield is over 90% as determined by radioactive thin-layer chromatography (n-3).

(5) ⁶⁴ Cu-labeled J591-121-Cy5-NOTA ImmunoPET imaging

22Rv1 tumor-bearing mice are injected intravenously with 3.96-4.07MBq [ ([ 2 ] ]) ⁶⁴ Cu]J591-121-Cy5-NOTA 100. mu.L PBS buffer. Before the corresponding imaging time, the mice were anesthetized with 2.5L/min of isoflurane and placed in a PET scanner (C/D)

PINGSHENG, Shanghai, China). PET/CT imaging was performed at 1h, 6h, 12h, 24h and 36h post-injection, respectively. The image is reconstructed using an Ordered Subset Expectation Maximization (OSEM) method and the attenuation corrected image is subjected to MMWKS software processing.

(6) ⁶⁴ Biodistribution of Cu-labeled J591-121-Cy 5-NOTA.

22Rv1 and PC3 tumor-bearing mice are injected intravenously with 148kbq ⁶⁴ Cu-labeled J591-121-Cy5-NOTA 100. mu.L PBS buffer. Mice were sacrificed 12h after injection. Organs of interest (kidney, liver, spleen, intestine, lung, stomach, muscle, blood, brain and tumor) were dissected and weighed. Radioactivity was measured using a gamma counter (Packard, Meriden, CT) and expressed as the percentage absorption of injected activity per gram of tissue (% IA/g).

(7) Tumor resection based on PSMA immunofluorescence

After IVIS imaging, 22Rv1 tumors were dissected and optimal cutting temperature embedding medium (OCT) was instilled. The tumor tissue was cut into 20 μm thick sections and fixed with acetone at 4 ℃ for 20 minutes. After the slide was blocked with BSA at room temperature for 1 hour, it was incubated with a primary anti-PSMA antibody (ab 19071; Abcam, Cambridge, UK; 1:300 dilution) overnight at 4 ℃ and allowed to stand with a fitc-labeled secondary antibody (ZF-0312; ZSBB-Bio, Beijing, China; 1:150 dilution) for 1 hour at room temperature. Finally, counterstaining was performed with hochest 33342. FluoView1000 confocal microscope (Olympus, Japan) scans stained slides.

(8) Results

The results are shown in FIG. 11.

Example 15: J591-Fab-121-p-TetN ₃ F antibody fixed-point double-modified fluorescence and PEG (polyethylene glycol) to realize high signal-to-noise ratio imaging of mouse tumor

Although the above experiment can realize bimodal imaging of tumor, compared with full antibody, the intensity of signal to noise ratio is relatively weak, considering that the size of the kidney-filtered molecule is about 60kd, the small molecular weight of the antibody fragment also causes the problem of too short half-life in vivo, so that the antibody fragment molecule is rapidly cleared by the kidney, the circulation time in blood is shortened, and the enrichment effect of the antibody fragment in tumor position is further influenced. Additional site-directed coupling of PEG to proteins is a common method to achieve long half-life of Fab, and we also used the bifunctional unnatural amino acid p-TetN containing tetrazine functional group and azide functional group to address the above problems ₃ F. We respectively obtain the J591Fab-Cy5 modified by fixed-point modification and the J591Fab-Cy5 protein modified by fixed-point coupling PEG (figure 12), which proves that the imaging effect of the J591Fab-Cy5 protein modified by coupling PEG is better than that of the J591Fab-Cy5 protein modified by unconjugated PEG, the half-life period of the J591Fab is increased by conjugating PEG, the enrichment on tumor is further increased, and then a set of economic, long half-life period and high signal-to-noise ratio antibody fragment Fab small animal imaging system is developed, thereby embodying the advantages of the bifunctional amino acid in the field of medical protein and the potential in producing homogeneous double-modified therapeutic protein.

The method comprises the following specific steps:

(1) prostate cancer cell line and mouse model establishment

LNCaP, 22Rv1, and PC3 human prostate cancer cell lines were purchased from Chinese Academy of Sciences type Culture Collection (Shanghai, China.) LNCaP cells were cultured in RPMI1640 medium containing 10% Fetal Bovine Serum (FBS), 1% penicillin-streptomycin, 1% GlutaMAX-, and 1% sodium pyruvate. 22Rv1 and PC3 cells were maintained in RPMI1640 medium containing 10% Fetal Bovine Serum (FBS) and 1% penicillin-streptomycin. All cells were incubated at 37 ℃ with 5% CO ₂ The culture was carried out in the air. All animal experiments were performed according to the provisions of laboratory animals in Beijing. All procedures and protocols were approved by the animal ethics committee of the first hospital of the university of beijing (beijing, china) under the approval number J201987. BALB/c nude mice were obtained from the animal center at the first hospital, university of Beijing. Mice were housed in groups (up to 5 mice per cage) maintained in a room at 20-25 ℃ and humidity control for a12 hour light/dark cycle. All mice were acclimated for at least 7 days prior to further experiments. Subcutaneous injection of 5X 10 with 100. mu. LPBS buffer ⁶ Cell suspension induction of BALB/c male nude mice to generate PSMA ⁺ 22RV1 and PSMA ^- PC3 tumor. When the xenograft reaches about 500mm ³ At the time, these mice were used for in vivo imaging.

(2) Preparation of J591 Fab-coupled DBCO-Cy5 protein

20μM J591-Fab-121-p-TetN ₃ The F protein was reacted with 80. mu.M DBCO-Cy5(4equiv.) in PBS buffer pH 7.4 overnight at room temperature. After the above reaction, unreacted DBCO-Cy5 was removed by separation using AKTA to obtain a protein of J591Fab-Cy5 (as shown in FIG. 13), and the fluorescence labeling rate was calculated to be 80% using nanodrop.

The general purification steps of J591Fab-Cy5AKTA obtained by AKTA separation are adopted, Superdex 75 molecular sieve is selected to separate and purify a reaction system, and the specific operation steps are as follows:

1) preparing a buffer solution: the solutions used in the AKTA purification system all had to be dosed with ddH2O, Buffer: PBS. And the excess insoluble impurities were removed by filtration through a 0.2 μm filter.

2) And (3) purification process:

a) and (5) inspecting the instrument and starting the machine. The software is UNICON 6.3, before use, the Pump A is flushed by a Pump push Wash and a function SystemWash and ddH2O, and the set flow rate is 0.5 ml/min;

b) the pump A is flushed with PBS so that the pump passage is filled with buffer solution in advance

c) Superdex 75 molecular sieve column was loaded on AKTA protein purification instrument without introducing air bubbles and checked for leakage.

d) Washing a purification column with water: through the A pump channel, set the flow rate of 2ml/min, Alarm system pressure 1.5MPa, using ddH2O to flush the purification column for about 1 column volume, i.e. 24 ml;

e) PBS washing of the purification column: wash 1 column volume;

f) sampling: centrifuging the protein at a high speed, and collecting a sample peak solution in a sample loading manner;

g) after all sample peaks are collected, eluting residual components on the purification column by PBS until the ultraviolet absorption approaches a baseline;

h) and (3) cleaning the column: insert pump a into ddH2O, wash 10 column volumes; if no longer used within three days, the column and the channel are preserved by washing 10 column volumes with 20% ethanol;

i) disassembling the column, washing A1, A2 and B1 with ddH2O, washing with 20% ethanol again, and shutting down; the pump head needs to be stored in 20% ethanol.

(3) Preparation of protein with J591Fab simultaneously coupled with DBCO-Cy5 and TCO-mPEG20K

20μM J591-Fab-121-p-TetN ₃ The F protein was mixed with 80. mu.M DBCO-Cy5(4equiv.) and 80. mu.M TCO-mPEG20K (4equiv.), reacted overnight at room temperature in PBS buffer at pH 7.4, and after the above reaction, the unreacted J591-Fab-121-p-TetN was removed by separation using AKTA ₃ Protein F, J591-Fab-121-p-TetN not labeled with PEG ₃ The F protein, free PEG and DBCO-Cy5, yielded a more pure J591Fab-Cy5-PEG20K protein coupled simultaneously with PEG and Cy5 modifications (as shown in FIG. 14). The labeling rate was calculated to be 80% using nanodrop.

(4) In vivo fluorescence imaging of 22RV1 and PC3 mice of prostate tumors

Mice were injected intravenously with 30ug J591Fab-Cy5 or J591Fab-Cy5-PEG20K 100. mu.L PBS buffer, and images were then acquired at 2h, 4h, 6h, 10h, 24h, and 36h using the IVIS spectroscopic imaging system (Caliper life Sciences, Hopkinton, Mass.). The bright field depicts the tumor area and the fluorescence intensity is quantified. The ipsilateral auricle is also depicted and is used as a background. Tumor imaging effects of mice with both proteins were compared.

(5) Results

The results are shown in FIG. 15. The result shows that the imaging effect of the PEG-modified J591Fab-Cy5 protein is better than that of the PEG-unmodified J591Fab-Cy5 protein, and the PEG coupling is used for proving that the enrichment of the J591Fab-Cy5 on the tumor is increased, so that the high-resolution near-infrared mouse tumor imaging is realized.

Example 16: preparation of pUltra-m-TetN ₃ FRS/tRNA plasmid.

According to the reference: J.am.chem.Soc.2020,142,16, 7245-7249, the mutation site of the Tet-v3.0 RS is corresponding to Methanosarcina flavescens (Mf) PylRS, the 268-bit L of the Tet-v3.0 RS is mutated into G, the 309-bit N is mutated into G, the 311-bit C is mutated into S by utilizing the qucikchange site-directed mutagenesis mode, and the 347-bit Y is mutated into F according to experience, thereby obtaining the plasmid pUultra-m-TetN ₃ FRS/tRNA (see FIG. 16).

The steps of the quikchange site-directed mutagenesis are as follows: PCR amplification is carried out by using primers 268G-F, 268G-R,309G311S-F, 309G311S-R, 347F-F and 347F-R and taking a pUltra-MfPylRS plasmid as a template, the PCR product is cut by using DpnI endonuclease, the cut product is transformed into escherichia coli, a monoclonal extracted plasmid is selected, and the pUltra-m-TetN is obtained by sequencing verification ₃ FRS/tRNA plasmid.

Wherein the 268G-F primer has a sequence as follows:

GCGTCCGATGCTGGCGCCGAACGGCTACAACTATCTGCGTAAACTGGACCGTG；

the 268G-R primer has the sequence:

CACGGTCCAGTTTACGCAGATAGTTGTAGCCGTTCGGCGCCAGCATCGGACGC；

the 309G311S-F primer has the sequence:

GAGCACCTGGAGGAATTCACCATGCTGGGCTTTAGCCAGATGGGTAGCGGCTGCACCC；

the 309G311S-R primer has the sequence:

GGGTGCAGCCGCTACCCATCTGGCTAAAGCCCAGCATGGTGAATTCCTCCAGGTGCTC；

the sequence of the 347F-F primer is:

GTGGGTGACAGCTGCATGGTTTTTGGCGACACCCTGGATGTGATG；

the sequence of the 347F-R primer is:

CATCACATCCAGGGTGTCGCCAAAAACCATGCAGCTGTCACCCAC

the PCR reaction system is shown in Table 11.

TABLE 11 PCR reaction System

ddH ₂ O	12μL
		KOD One ^TM PCR Master Mix	25μL
268G-F(10μM)	2μL
		268G-R(10μM)	2μL
309G311S-F(10μM)	2μL
		309G311S-R(10μM)	2μL
347F-F(10μM)	2μL
		347F-R(10μM)	2μL
pUltra-MfPylRS plasmid (50 ng/. mu.L)	1μL
		Total volume	50μL

The PCR reaction conditions are as follows: 10s at 98 ℃, 5s at 58 ℃, 60s at 68 ℃ and 15 cycles; storing at 4 ℃.

The enzyme digestion reaction system of the DpnI endonuclease is as follows: 50. mu.L of PCR reaction solution, and 1. mu.L of DpnI endonuclease.

The transformation steps of the escherichia coli are as follows: adding 5 mu L of DpnI enzyme digestion product into escherichia coli DH10B transformation competence, carrying out ice bath for 30min, carrying out heat shock for 45 s at 42 ℃, carrying out ice bath for 3 min, adding 2YT culture medium, incubating for 1h at 37 ℃, plating, picking single clone, extracting plasmid, and carrying out sequencing verification.

Shown in FIG. 16 as pUltra-m-TetN ₃ Plasmid map of FRS/tRNA plasmid, pUltra-m-TetN ₃ The FRS/tRNA plasmid has spectinomycin resistance, and the pUltra-m-TetN is determined by sequencing ₃ FRS/tRNA plasmid only has differences with pUltra-MfPylRS plasmid at 268, 309, 311 and 347 sites (268CTG mutation to GGC, 309AAC mutation to GGC, 311TGC mutation to AGC, 347TAT mutation to TTT).

Example 17: preparation of site-directed mutant sfGFP-expressing Strain

The helper plasmid pUltra-m-TetN prepared in example 14 was used ₃ Two plasmids, namely FRS/tRNA plasmid (spectinomycin resistance) and expression plasmid pET22b-sfGFP-Y151TAG (ampicillin resistance) obtained in example 5, were co-transformed into E.coli BL21(DE3) strain, and positive strains transformed with both plasmids were selected by double-resistant plates (spectinomycin and ampicillin resistance), and named expression strains BL21-pET22b-sfGFP-Y151TAG-pUltra-m-TetN ₃ FRS/tRNA。

Example 18: site-specific insertion of non-nativeAmino acid sfGFP-m-TetN ₃ F expression purification

BL21-pET22b-sfGFP-Y151TAG-pUltra-m-TetN obtained in example 15 ₃ Culturing FRS/tRNA single colony overnight with 5mL2YT culture medium containing spectinomycin and ampicillin, transferring to 50mL fresh 2YT culture medium containing spectinomycin and ampicillin at 1:100 volume ratio the next day, adding 1mM m-TetN into the culture medium when the culture reaches the initial stage of exponential growth ₃ F, adding IPTG to induce when the OD is about 0.6-0.8, expressing at 37 ℃ for 8-10 hours, and collecting the thalli.

Resuspending the collected expression bacteria with PBS, and ultrasonicating at 0-4 deg.C for 1-2 min. The disrupted product was subjected to high-speed centrifugation (12000rpm, 30 minutes, 4 ℃ C.), and the supernatant was aspirated. The supernatant samples were incubated with Ni affinity columns for 30min at 4 ℃ and then washed 5-10 column volumes with 25mM imidazole, 3 column volumes with 40mM imidazole, eluted with 250mM imidazole and concentrated, after which the purity and approximate molecular weight of the purified protein was determined by SDS-PAGE protein electrophoresis.

FIG. 17 is an SDS gel electrophoresis analysis of the insertion of unnatural amino acids into sfGFP. The engineering strain of colibacillus prepared by the method can express green fluorescent protein with unnatural amino acid

Example 19: preparation of pCMV-MfPylRS-m-TetN ₃ FRS/tRNA plasmid.

Using HindIII-gib-FW, BamHI-gib-RV primers from pUltra-m-TetN ₃ PCR amplification of m-TetN in FRS/tRNA plasmid ₃ The FRS gene segment, wherein the HindIII-gib-FW primer has a sequence of ccactcccaggtccaactgcacggAAGCTTGCCACCATGGACAAGAAACCGCTGGATGTGC, BamH I-gib-RV primer: cagtcgaggctgatcagcgggtGGATCCTCACAGGCTGGTGCTAATGCCG are provided.

The PCR reaction system is shown in Table 12.

TABLE 12

ddH ₂ O	20μL
		KOD One ^TM PCR Master Mix	25μL
HindⅢ-gib-FW(10μM)	2μL
		BamHⅠ-gib-RV(10μM)	2μL
pUltra-m-TetN ₃ FRS/tRNA(50ng/μL)	1μL
		Total volume	50μL

The PCR reaction conditions were: 10s at 98 ℃, 5s at 58 ℃,20 s at 68 ℃ and 30 cycles; storing at 4 ℃. The PCR product is electrophoresed, purified and recycled to obtain m-TetN ₃ FRS gene fragment.

Then cutting the pCMV-MbPylRS by restriction enzymes Hind III and BamH I, electrophoresing and purifying the enzyme digestion product, and recovering to obtain a pCMV vector fragment. The cleavage system is shown in Table 13.

Watch 13

ddH ₂ O	18μL
		Cutsmart	5μL
HindⅢ	1μL
		BamH	1μL
pCMV-MbPylRS(200ng/μL)	25μL
		Total volume	50μL

m-TetN ₃ The FRS gene fragment and the pCMV vector fragment are subjected to Gibson assembly to obtain pCMV-MfPylRS-m-TetN ₃ FRS/tRNA plasmid.

The Gibson reaction system is: m-TetN ₃ FRS Gene fragment (20 ng/. mu.L): 1.5 μ L, pCMV vector fragment (50 ng/. mu.L): 1 μ L, Gibson reaction: 2.5 μ L, 5 μ L total.

The Gibson reaction conditions were: 50 ℃ for 1 hour.

Transforming Escherichia coli DH10B with Gibson reaction solution, coating on LB plate of 50. mu.g/mL ampicillin, picking single colony in 5mL2YT liquid culture medium the next day, adding ampicillin 50. mu.g/mL in the culture medium, shake culturing at 37 deg.C and 220 rpm for 12 hr, extracting plasmid (operating according to kit instructions), and sequencing to confirm that pCMV-MfPylRS-m-TetN ₃ FRS/tRNA plasmid, pCMV-MfPylRS-m-TetN as shown in FIG. 18 ₃ Plasmid map of FRS/tRNA plasmid.

Example 20: m-TetN ₃ F insertion verification in true nuclear system

The day before transfection 1.3X 10^5 HEK293T cells were seeded in 24-well plates in 500. mu.L DMEM + 10% FBS medium and transfected the next day at a cell density of approximately 80-90% of the dish. The amount of plasmid added to each well was 0.8ug, pcDNA3.1-EGFP-Y39TAG:pCMV-MfPylRS-m-TetN ₃ FRS/tRNA PEI-1: 1: 6. Each of the two plasmids was 0.4. mu.g, diluted to 25. mu.L with Opti-mem serum-reduced medium, and allowed to stand for 5 minutes. Another tube was added with 2.4. mu.g PEI, diluted to 25. mu.L with Opti-mem serum-reduced medium and left to stand for 5 minutes. Then adding diluted PEI into the plasmid, mixing uniformly, standing for 15min, slowly adding the PEI into a 24-well plate after adherence, placing at 37 ℃ and 5% CO ₂ Was incubated in the incubator for 4 h. The old medium was discarded and replaced with a medium containing 0.25mM m-TetN ₃ DMEM + 10% FBS medium of F, placed in an incubator. After 2d observation was performed under a fluorescent microscope. Shown in FIG. 19 as m-TetN ₃ F was successfully introduced in eukaryotic cells.

The foregoing is only a preferred embodiment of this invention and it should be noted that those skilled in the art can make various modifications and adaptations without departing from the principle of the invention and such modifications and adaptations should be considered as the scope of the invention.

<110> Beijing university

<120> a bi/multi-functional unnatural amino acid, its conjugates and uses

<130> MP21037413

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 711

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaaaaaga atatcgcatt tcttcttgca tctatgttcg ttttttctat tgctacaaac 60

gcgtacgctg acatcgtgat gacccagtcc ccctcctccc tgtctgcctc cgtgggcgac 120

agagtgacca tcacatgcaa ggcctcccag gatgtgggca ccgccgtgga ctggtatcag 180

cagaagcctg gcaaggcccc taagctgctg atctactggg cctccaccag acacaccggc 240

gtgcctgaca gattcaccgg ctccggctct ggcaccgact tcaccctgac catctccagc 300

ctgcagcctg aggacttcgc cgactacttc tgccagcagt acaactccta ccctctgacc 360

ttcggcggag gcaccaagct ggaaatcaaa cgaactgtgg ctgcaccatc tgtcttcatc 420

ttcccgccat ctgatgagca gttgaaatct ggaactgcct ctgtcgtgtg cctgctgaat 480

aacttctatc ccagagaggc caaagtacag tggaaggtgg ataacgccct ccaatcgggt 540

aactcccagg agagtgtcac agagcaggac agctaggaca gcacctacag cctcagcagc 600

accctgacgc tgagcaaagc agactacgag aaacacaaag tctacgcctg cgaagtcacc 660

catcagggcc tgtcctcgcc cgtcacaaag agcttcaaca ggggagagtg t 711

<210> 2

<211> 738

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgaaaaaga atatcgcatt tcttcttgca tctatgttcg ttttttctat tgctacaaac 60

gcgtacgctg aagtgcagct ggtgcagtct ggcgccgaag tgaagaaacc tggcgcctcc 120

gtgaagatct cctgcaagac ctccggctac accttcaccg agtacaccat ccactgggtg 180

aaacaggcct ccggcaaggg cctggaatgg atcggcaaca tcaaccctaa caacggcggc 240

accacctaca accagaagtt cgaggaccgg gccaccctga ccgtggacaa gtccacctcc 300

accgcctaca tggaactgtc ctccctgcgg tctgaggaca ccgccgtgta ctactgcgcc 360

gctggctgga acttcgacta ctggggccag ggcaccacag tgacagtctc gagctgatcc 420

accaagggcc catcggtctt ccccctggca ccctcctcca agagcacctc tgggggcaca 480

gcggccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt gtcgtggaac 540

tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 600

tactccctca gcagcgtggt gactgtgccc tctagcagct tgggcaccca gacctacatc 660

tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agaaagttga gcccaaatct 720

tgtgacaaaa ctcacaca 738

Claims

1. An unnatural amino acid having the structure of formula I;

or a pharmaceutically acceptable salt, solvate or prodrug thereof:

wherein at least one of Ra, Rb, Rc, Rd and Re is R1 or

Independently selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 haloalkyl, C1-C3 alkoxy, azido-substituted alkanoyl, unsubstituted alkanoyl or alkynyl; r1 is selected from hydrogen, substituted or unsubstituted C1-C10 alkyl, hydroxy, halogen, carboxy, cyano nitro, substituted or unsubstituted C1-C10 alkoxy, azido, hydroxylamino, azido-substituted alkanoyl or unsubstituted alkanoyl; provided that Ra, Rb, Rc, Rd and Re contain together an alkanoyl group, an azido group and

at least two groups of (a).

2. The unnatural amino acid of claim 1, wherein Rb or Re is

3. The unnatural amino acid of claim 1, wherein Rb or Re is R1, and wherein the unnatural amino acid has the structure from formulas I-3 to I-4:

4. The unnatural amino acid of claim 1, wherein n of Ra, Rb, Rc, Rd, and Re are substituents a, n is an integer from 2 to 5; the substituent A is selected from azido, alkanoyl or

And the n substituents are not all identical;

5. The unnatural amino acid of claim 1, wherein said unnatural amino acid has the structure of any of:

6. the unnatural amino acid according to any one of claims 1 to 5, wherein said unnatural amino acid is an L-form amino acid, a D-form amino acid, or a combination thereof.

7. Use of the unnatural amino acid of any one of claims 1 to 6 for the preparation of a recombinant protein or a recombinant protein conjugate.

8. A recombinant protein characterized in that an amino acid at least one site in the sequence of the wild-type protein is mutated to the unnatural amino acid described in any one of claims 1 to 7.

9. The recombinant protein according to claim 8, wherein the wild-type protein comprises a functional protein having a disease treatment or prevention effect, a diagnostic protein, an industrial enzyme, or an antibody fragment thereof having a disease treatment and/or prevention effect.

10. The recombinant protein according to claim 8, wherein said unnatural amino acid is site-directed introduced into said wild-type protein using gene codon expansion techniques.

11. The recombinant protein of claim 8, wherein said wild-type protein is selected from the group consisting of alpha-1 antitrypsin, angiostatin, anti-hemolytic factor, antibody, apolipoprotein, apoprotein, atrial natriuretic factor, atrial natriuretic polypeptide, atrial peptide, C-X-C chemokine, T393939767, NAP-2, ENA-78, gro-a, gro-b, gro-C, IP-10, GCP-2, NAP-4, SDF-1, PF4, MIG, calcitonin, C-kit ligand, cytokine, CC chemokine, monocyte chemokine-1, monocyte chemokine 2, monocyte chemokine-3, monocyte inflammatory protein-1 alpha, monocyte inflammatory protein-1 beta, RANTES, I309, R915, R91733, 1 HCC, HCC-kit ligand, HCC-1, monocyte inflammatory protein-3, monocyte inflammatory protein-1 alpha, monocyte inflammatory protein-1 beta, RANTES, I309, R915, R91733, 1 HCC, T58847, D31065, T64262, CD40, CD40 ligand, C-kit ligand, collagen, colony stimulating factor, complement factor 5a, complement inhibitor, complement receptor 1, cytokine, epithelial neutrophil activating peptide-78, MIP-16, MIP-1, epidermal growth factor, epithelial neutrophil activating peptide, erythropoietin, exfoliating toxin, factor IX, factor VII, factor VIII, factor X, fibroblast growth factor, fibrinogen, fibronectin, four helix bundle protein, G-CSF, glp-1, GM-CSF, glucocerebrosidase, gonadotropin, growth factor receptor, hedgehog protein, hemoglobin, hepatocyte growth factor, hirudin, human growth hormone, human serum albumin, ICAM-1 receptor, LFA-1, LFC-kit ligand, collagen, colony stimulating factor, complement factor 5a, complement inhibitor, complement receptor 1, cytokine, epithelial neutrophil activating peptide-78, MIP-16, MIP-1, epidermal growth factor, epidermal growth, LFA-1 receptor, insulin-like growth factor, IGFI, IGF-II, interferon, IFN- α, IFN- β, IFN- γ, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, keratinocyte growth factor, lactoferrin, leukemia inhibitory factor, luciferase, nerve growth factor, neutrophilic granulocyte inhibitory factor, oncostatin M, osteogenic protein, oncogene products, paractonin, parathyroid hormone, PD-ECSF, PDGF, peptide hormones, pleiotropic growth factor, protein A, protein G, pth, pyrogenic exotoxin A, pyrogenic exotoxin B, and pyrogenic exotoxin C, pyy, relaxin, renin, SCF, small biosynthetic proteins, At least one of soluble complement receptor I, soluble I-CAM 1, soluble interleukin receptor, soluble TNF receptor, somatomedin, somatostatin, growth hormone, streptokinase, superantigen, staphylococcal enterotoxin, SEA, SEB, SECT, SEC2, SEC3, SED, SEE, steroid hormone receptor, superoxide dismutase, toxic shock syndrome toxin, thymosin alpha 1, tissue plasminogen activator, tumor growth factor, tumor necrosis factor alpha, tumor necrosis factor beta, tumor necrosis factor receptor, VLA-4 protein, VCAM-1 protein, vascular endothelial growth factor, urokinase, mos, ras, raf, met, p53, tat, fos, myc, jun, myb, rel, estrogen receptor, progestin receptor, testosterone receptor, aldosterone receptor, LDL receptor, and corticosterone.

12. The recombinant protein of claim 9, wherein said antibody or antibody fragment thereof comprises a whole antibody, scFv, Fab ', F (ab') ₂ At least one of scFv-Fc, Triabody, Diabody, Minibody, Nanobodies, DARPins, or affibody.

13. A recombinant protein conjugate obtained by conjugating the recombinant protein of any one of claims 8 to 12 to two or more effector molecules.

14. The conjugate of claim 13, wherein the effector molecule is selected from at least two of a fluorophore, a nuclide, polyethylene glycol, a small molecule chemical drug, a polypeptide, a protein, an enzyme, a nucleic acid;

the label includes a fluorophore and/or a nuclide.

15. Use of a recombinant protein according to any one of claims 8 to 12 or a recombinant protein conjugate according to claim 13 or 14 for cellular imaging and/or diagnostic imaging of disease.

16. Use of the recombinant protein according to any one of claims 8 to 12 or the recombinant protein conjugate according to claim 13 or 14 for the preparation of a medicament for treating tumors and/or preventing tumor recurrence, or for the preparation of a tumor detection reagent.

17. A composition comprising the recombinant protein of any one of claims 8 to 12 or the recombinant protein conjugate of claim 13 or 14.