CN115074339A - Coding sequence of peroxidase POD1 and application thereof - Google Patents

Coding sequence of peroxidase POD1 and application thereof Download PDF

Info

Publication number
CN115074339A
CN115074339A CN202110271147.4A CN202110271147A CN115074339A CN 115074339 A CN115074339 A CN 115074339A CN 202110271147 A CN202110271147 A CN 202110271147A CN 115074339 A CN115074339 A CN 115074339A
Authority
CN
China
Prior art keywords
pod1
coding sequence
peroxidase
seq
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202110271147.4A
Other languages
Chinese (zh)
Other versions
CN115074339B (en
Inventor
唐克轩
付雪晴
王玉亮
刘航
刘品
孙小芬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University
Original Assignee
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University filed Critical Shanghai Jiaotong University
Priority to CN202110271147.4A priority Critical patent/CN115074339B/en
Publication of CN115074339A publication Critical patent/CN115074339A/en
Application granted granted Critical
Publication of CN115074339B publication Critical patent/CN115074339B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0065—Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/181—Heterocyclic compounds containing oxygen atoms as the only ring heteroatoms in the condensed system, e.g. Salinomycin, Septamycin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y111/00—Oxidoreductases acting on a peroxide as acceptor (1.11)
    • C12Y111/01—Peroxidases (1.11.1)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The application discloses a coding sequence of peroxidase POD1, which is characterized in that the amino acid sequence coded by the coding sequence comprises an amino acid sequence shown in SEQ ID NO.2 or a functional variant thereof, and the functional variant has homology of more than 70% with the amino acid sequence shown in SEQ ID NO. 2. The application also discloses a polypeptide coded by the coding sequence of peroxidase POD1, which can synthesize artemisinin by using dihydroartemisinin as a substrate and has an important effect on the scale production of artemisinin.

Description

Coding sequence of peroxidase POD1 and application thereof
Technical Field
The application relates to the field of biosynthesis, in particular to a coding sequence of peroxidase POD1 and application thereof.
Background
The content of secondary metabolites generated in natural plants is extremely low, and the chemical synthesis method is complex in process flow and high in cost, and a lot of secondary metabolites are added into the food and cosmetic industry, so that the natural plant materials are safer to use. Artemisinin is an effective substance for treating malaria at present, and is mainly extracted from plants, but the content of artemisinin in wild type artemisia apiacea is only 0.1% -1% of the dry weight, so that the actual requirement is difficult to meet, and researchers are dedicated to exploring other methods for improving the content of plant secondary metabolites; peroxide bridge containing compounds include cyclic hydroperoxides, chain peroxides, and hydroperoxy compounds, where the cyclic hydroperoxides possess multiple biological activities. The compound with intra-ring peroxy-bridged sesquiterpene is most remarkable as artemisinin compound, and the anti-malarial activity of artemisinin is inseparable from that of "peroxy-bridged". The in-loop peroxybridge synthetase has been reported to a lesser extent, while the mechanism of in-loop peroxybridge synthesis is rather unclear. Therefore, obtaining a synthetase that catalyzes the synthesis of an intra-domain peroxybridge of artemisinin is of great significance to the synthesis pathway of compounds containing a peroxybridge as well as to the heterologous synthesis of compounds containing a peroxybridge.
Disclosure of Invention
In order to overcome the defects in the prior art, the application provides a peroxidase POD1 coding sequence and a protein coded by the coding sequence, and application of the POD1 gene coding sequence and the protein coded by the coding sequence.
In one aspect, the present application provides a coding sequence for peroxidase POD1, wherein the coding sequence encodes an amino acid sequence comprising the amino acid sequence set forth in SEQ ID No.2, or a functional variant thereof, which has greater than 70% homology with the amino acid sequence set forth in SEQ ID No. 2.
In certain embodiments, the functional variant has greater than 90% homology with the amino acid sequence set forth in SEQ ID No. 2.
In certain embodiments, the functional variant has greater than 99% homology with the amino acid sequence set forth in SEQ ID No. 2.
In certain embodiments, the amino acid sequence set forth in SEQ ID No.2, or a functional variant thereof, is capable of catalyzing the synthesis of an artemisinin intra-ring peroxybridge.
In some embodiments, the amino acid sequence shown in SEQ ID No.2 or a functional variant thereof is capable of synthesizing artemisinin with dihydroartemisinic acid as substrate.
In certain embodiments, the functional variant is derived from artemisia apiacea.
In certain embodiments, the coding sequence encodes an amino acid sequence as set forth in SEQ ID No. 2.
In certain embodiments, the nucleotide sequence of the coding sequence is set forth in SEQ ID No. 1.
In another aspect, the present application also provides a polypeptide encoded by the coding sequence of the peroxidase POD1 described herein.
In certain embodiments, the sequence of the polypeptide is set forth in SEQ ID No. 2.
In another aspect, the present application also provides a coding sequence for a peroxidase POD1 as described herein, and the use of a polypeptide as described herein for catalyzing the synthesis of an intra-ring peroxidic bridge.
In certain embodiments, the application comprises the steps of:
connecting a coding sequence of peroxidase POD1 to an escherichia coli prokaryotic expression regulatory sequence pET30a, and constructing a prokaryotic expression vector pET30a-POD 1;
step two, transferring the expression vector pET30a-POD1 in the step one into escherichia coli Rosetta;
step three, inducing the expression of the recombinant protein, and purifying the recombinant protein;
step four, catalyzing the synthesis of the intra-ring peroxide bridge bond by using the recombinant protein obtained in the step three.
In another aspect, the present application also provides the coding sequence of peroxidase POD1 described herein, and the use of the polypeptide described herein in the synthesis of artemisinin using dihydroartemisinic acid.
In certain embodiments, the application comprises the steps of:
connecting a coding sequence of peroxidase POD1 to an escherichia coli prokaryotic expression regulatory sequence pET30a, and constructing a prokaryotic expression vector pET30a-POD 1;
step two, transferring the expression vector pET30a-POD1 in the step one into escherichia coli Rosetta;
step three, inducing the expression of the recombinant protein, and purifying the recombinant protein;
step four, catalyzing the synthesis of the intra-ring peroxide bridge bond by using the recombinant protein obtained in the step three.
In certain embodiments, the fourth step comprises:
a) UPLC-QQQ-MS analyzes the catalytic products; and/or
b) UPLC-QTOF-MS analysis of the catalytic products.
Technical effects
A catalytic experiment in the application shows that a catalytic synthesis product is analyzed by UPLC-QTOF-MS, a compound which has the same peak time with an artemisinin standard appears in a product which catalyzes the synthesis of dihydroartemisinic acid by a coding protein of a POD1 coding sequence, a characteristic ion fragment of the compound is consistent with the artemisinin standard, and the result shows that POD1 can synthesize the artemisinin containing the intra-ring peroxygen bridge bond by using the dihydroartemisinic acid as a substrate; meanwhile, the saccharomyces cerevisiae is used for synthesizing dihydroartemisinic acid, the POD1 coding sequence and the protein coded by the coding sequence play an important role in the large-scale production of artemisinin and the synthesis of artemisinin by using yeast, and have important significance in the synthesis way of compounds containing peroxide bridge bonds and the heterologous synthesis of compounds containing peroxide bridge bonds.
The conception, specific structure and technical effects of the present application will be further described in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present application.
Drawings
FIG. 1 is a diagram showing the results of SDS-PAGE detection of the purified POD1 recombinant protein in the present application.
Fig. 2 shows the product of UPLC-QQQ-MS analysis of the dioxygenase POD1 catalyzed synthesis of dihydroartemisinic acid in the present application, wherein fig. 2A shows an extracted ion flow diagram of an artemisinin standard, fig. 2B shows an extracted ion flow diagram of POD1 catalyzed synthesis of artemisinin from dihydroartemisinic acid, and fig. 2C shows an extracted ion flow diagram of a boiled POD1 recombinant protein control, wherein the ordinate in the figure represents relative ionic strength and the abscissa represents retention time.
FIG. 3 shows UPLC-QTOF-MS analysis that POD1 catalyzes the synthesis of artemisinin from dihydroarteannuic acid, wherein FIG. 3A shows an ion flow diagram of artemisinin standard extraction; FIG. 3B shows an ion flow diagram of artemisinin extraction by POD1 catalyzed synthesis of dihydroartemisinic acid, FIG. 3C shows mass spectrum results of artemisinin standard, and FIG. 3D shows mass spectrum results of artemisinin by POD1 catalyzed synthesis of dihydroartemisinic acid; in FIGS. 3A and 3B, the ordinate represents relative ion intensity, and the abscissa represents retention time; the ordinate in fig. 3C and 3D indicates relative ion intensity, and the abscissa indicates mass-to-charge ratio m/z.
Detailed Description
The present application will now be further described with reference to examples, which are intended to be illustrative only, and the present application may be embodied in many different forms of embodiments and should not be construed as limited to the embodiments set forth herein.
Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as molecular cloning in Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the conditions recommended by the relevant Material manufacturers.
Example 1 cloning of the Artemisia annua oxidase POD1 Gene
1. Extraction of total RNA of sweet wormwood genome
Taking sweet wormwood leaf tissue, placing the sweet wormwood leaf tissue in liquid nitrogen for grinding, adding the sweet wormwood leaf tissue into a 1.5mL Eppendorf (EP) centrifuge tube containing lysis solution, fully oscillating, and extracting total RNA according to the instruction of a TIANGEN kit. The total RNA quality was determined by agarose gel electrophoresis and the RNA content was determined on a spectrophotometer.
2. Cloning of the Artemisia apiacea POD1 Gene
Synthesizing cDNA under the action of PowerScript reverse transcriptase by taking the extracted total RNA as a template; gene-specific primers were designed based on the sequence of the POD1 gene, and the POD1 gene was amplified from the total cDNA by PCR and sequenced.
Through the steps, a coding sequence (shown as SEQ ID NO: 1) with the POD1 gene length of 1053bp in the sweet wormwood herb is obtained, wherein the initiation codon is ATG, the termination codon is TAA, and the coding amino acid sequence is further obtained as shown in SEQ ID NO: 2, respectively.
TABLE 1 PCR primers
Primer name Primer sequence (5 '→ 3') SEQ ID NO
POD1-FP ATGGGGCTTGTTTCATTTCTCT 3
POD1-RP TCACAACTTGAGTTTTCTGAAAT 4
TABLE 2 reaction System for PCR
Artemisia apiacea cDNA 1μL
10×KOD Plus Buffer 5μL
dNTP 5μL
MgSO 4 2μL
POD1-FP 1μL
POD1-RP 1μL
KOD Plus 1μL
ddH 2 O 34μL
Total volume 50μL
Example 2 construction of prokaryotic expression vector containing POD1 Gene
The POD1 gene was constructed on prokaryotic expression vector pET30a to obtain expression vector pET30a-POD1, in order to facilitate the construction of the expression vector, BamHI cleavage site was introduced into the forward primer, XhoI cleavage site was introduced into the reverse primer, and the primers are shown in Table 3.
TABLE 3 PCR primers for pET30a-AOP1 vector construction
Figure BDA0002974412840000041
Example 3 Induction of expression of recombinant POD1 protein
1. The constructed prokaryotic expression vector pET30a-POD1 is transferred into Rosetta (purchased from Shanghai Weidi Biotechnology Co., Ltd.);
2. the activated E.coli was transferred to 200mL of LB liquid medium (containing 100mg/L kanamycin), cultured at 37 ℃ until OD600 became 0.6, added with 0.5mM of IPTG (stock solution 1M/mL), and induced at 16 ℃ overnight;
3. the cells were collected by centrifugation, and 1/10 volumes (20mL) of lysine buffer (7.8g of NaH2PO4.2H2O, 17.54g of NaCl and 0.68g of Imidazole, pH 8.0) were added to the cells, followed by sonication;
4. centrifuging at 4 deg.C and 13000rpm for 20min, sucking supernatant, and storing on ice;
5. shaking up nickel column filler (purchased from assist in shanghai saint biotechnology limited, cat # 20502ES10), sucking 1-2mL to the filter column, dripping off the liquid in the filler, and washing the column with 2.5-5mL of deionized water;
6. equilibrating the nickel column with 5-10mL lysine buffer (7.8g NaH2PO4.2H2O, 17.54g NaCl and 0.68g Imidazole, pH 8.0), adding the supernatant and filtering;
7. the column was washed with 10mL wash buffer (7.8g NaH2PO4.2H2O, 17.54g NaCl and 1.36g Imidazole, pH 8.0);
8. 250uL of Elution Buffer (7.8g of NaH2PO4.2H2O, 17.54g of NaCl and 17.0g of Imidazole, pH 8.0) was added first, and the wash Buffer in the nickel column was squeezed; then adding 2mL of Elution Buffer, and collecting effluent protein liquid;
9. adding 2-3mL of Elution Buffer again, and collecting effluent protein liquid;
10. the purified protein solution was placed in a dialysis bag and dialyzed into PBS solution.
11. The purified product was checked by SDS-PAGE.
As shown in FIG. 1, the size of the purified POD1 recombinant protein was 38.9 kDa.
Example 4 POD1 in vitro catalysis experiment
Mu.g of purified POD1 recombinant protein and a substrate dihydroartemisinic acid are respectively added into a catalytic reaction system (100mM PBS buffer solution (pH7.0),10mM vitamin C, 10mM MgCl2, 200nM NADPH as a hydrogen ion donor, 0.1mM DTT), a magnetic stirrer is continuously stirred, the reaction is carried out for 24 hours in a dark place at 30 ℃, and boiled purified POD1 recombinant protein is used as a negative control. Extracting the reaction product with n-hexane for three times, drying the extract liquor, dissolving the extract liquor with methanol, analyzing the catalytic product by UPLC-QQQ-MS, and further analyzing the catalytic product by UPLC-QTOF-MS.
The experimental results showed that UPLC-QQQ-MS showed that the product of dioxygenase POD1 catalyzing the synthesis of dihydroartemisinic acid contained artemisinin, while the boiled POD1 recombinant protein control group showed no presence of artemisinin (fig. 2); the results of the UPLC-QTOF-MS experiments show that the POD1 catalyzes a compound with the peak time consistent with that of an artemisinin standard product in the product synthesized by dihydroartemisinic acid, and the characteristic ion fragments of the compound are consistent with that of the artemisinin standard product (figure 3). This result demonstrates that the dioxygenase POD1 is capable of synthesizing artemisinin using dihydroartemisinic acid as substrate.
The foregoing detailed description of the preferred embodiments of the present application. It should be understood that numerous modifications and variations can be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the concepts of the present application should be within the scope of protection defined by the claims.
Sequence listing
<110> Shanghai university of transportation
<120> coding sequence of peroxidase POD1 and application thereof
<130> CN084-21002PICN
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 1053
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> coding sequence for peroxidase POD1
<400> 1
atggggcttg tttcatttct ctcaactgtc ccaactttgc ttccaaatgc ttcatttccc 60
tcaacttaca ttccttccaa atgcccaggt attattagtt gcaaatttga gaataatgct 120
ggtgatagca atgagacaaa tggtgttaaa aggagggatg ttcttaactg ctttggagct 180
gccattagcg tggaactggt ggcaagctca agcccaatct cgagcccttt cattgaggtg 240
gcaaatgctg ctgatttgat acaaagaaga caacgttccg actttttatc aagtataaag 300
acaaccctct atacggccat taaggcaaat caggagctca ttccatcaat attaacttta 360
gctcttaatg attctatgac atatgataag ccaacaaaaa ctggaggccc aaatggatcc 420
atacgcttta gctcggagat taacagacca gaaaacaaag gactttctgc agctttatct 480
ttggttgagg aagcaaaaaa agagatcgat tcttactcga aaggtggacc gatctcatac 540
tcagatctca tccagttagc agctcaaagt gctcttaaag ctacattttt ggcttcggca 600
attaaaaaat gtggtggaaa tgaggaaaaa gggaacttgt tatactccgc ttatggttca 660
agtggacagt ggggattgtt cgataggcaa tttggaaggt cggatagtca agaacctgat 720
cctgagggaa gagtaccaga ctggagtaca gcaagtgtcc aagaaatgaa agataagttt 780
acagccatcg gcttcggtcc tcgtcagcta gcagtaatgt cggcattctt gggtcccgat 840
caattagcaa acgaagcaaa attagcaacg gataaagatg ttactaaatg ggtagagaaa 900
taccaacgga gcagagaaac agtctcacag acggactatg aggttgattt gatcacgacc 960
cttacgaaaa tgagttgttt gggtcaaaac attaactacg aggcatactc atacgctgtc 1020
cccaagattg atttcagaaa actcaagttg tga 1053
<210> 2
<211> 350
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> peroxidase POD1 amino acid sequence
<400> 2
Met Gly Leu Val Ser Phe Leu Ser Thr Val Pro Thr Leu Leu Pro Asn
1 5 10 15
Ala Ser Phe Pro Ser Thr Tyr Ile Pro Ser Lys Cys Pro Gly Ile Ile
20 25 30
Ser Cys Lys Phe Glu Asn Asn Ala Gly Asp Ser Asn Glu Thr Asn Gly
35 40 45
Val Lys Arg Arg Asp Val Leu Asn Cys Phe Gly Ala Ala Ile Ser Val
50 55 60
Glu Leu Val Ala Ser Ser Ser Pro Ile Ser Ser Pro Phe Ile Glu Val
65 70 75 80
Ala Asn Ala Ala Asp Leu Ile Gln Arg Arg Gln Arg Ser Asp Phe Leu
85 90 95
Ser Ser Ile Lys Thr Thr Leu Tyr Thr Ala Ile Lys Ala Asn Gln Glu
100 105 110
Leu Ile Pro Ser Ile Leu Thr Leu Ala Leu Asn Asp Ser Met Thr Tyr
115 120 125
Asp Lys Pro Thr Lys Thr Gly Gly Pro Asn Gly Ser Ile Arg Phe Ser
130 135 140
Ser Glu Ile Asn Arg Pro Glu Asn Lys Gly Leu Ser Ala Ala Leu Ser
145 150 155 160
Leu Val Glu Glu Ala Lys Lys Glu Ile Asp Ser Tyr Ser Lys Gly Gly
165 170 175
Pro Ile Ser Tyr Ser Asp Leu Ile Gln Leu Ala Ala Gln Ser Ala Leu
180 185 190
Lys Ala Thr Phe Leu Ala Ser Ala Ile Lys Lys Cys Gly Gly Asn Glu
195 200 205
Glu Lys Gly Asn Leu Leu Tyr Ser Ala Tyr Gly Ser Ser Gly Gln Trp
210 215 220
Gly Leu Phe Asp Arg Gln Phe Gly Arg Ser Asp Ser Gln Glu Pro Asp
225 230 235 240
Pro Glu Gly Arg Val Pro Asp Trp Ser Thr Ala Ser Val Gln Glu Met
245 250 255
Lys Asp Lys Phe Thr Ala Ile Gly Phe Gly Pro Arg Gln Leu Ala Val
260 265 270
Met Ser Ala Phe Leu Gly Pro Asp Gln Leu Ala Asn Glu Ala Lys Leu
275 280 285
Ala Thr Asp Lys Asp Val Thr Lys Trp Val Glu Lys Tyr Gln Arg Ser
290 295 300
Arg Glu Thr Val Ser Gln Thr Asp Tyr Glu Val Asp Leu Ile Thr Thr
305 310 315 320
Leu Thr Lys Met Ser Cys Leu Gly Gln Asn Ile Asn Tyr Glu Ala Tyr
325 330 335
Ser Tyr Ala Val Pro Lys Ile Asp Phe Arg Lys Leu Lys Leu
340 345 350
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> POD1-FP primer sequence
<400> 3
atggggcttg tttcatttct ct 22
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> POD1-RP primer sequence
<400> 4
tcacaacttg agttttctga aat 23
<210> 5
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> BamHI-POD1-FP primer sequence
<400> 5
gctgatatcg gatccatggg gcttgtttca tttctct 37
<210> 6
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> XhoI-POD1-RP primer sequences
<400> 6
gtggtggtgc tcgagcaact tgagttttct gaaat 35

Claims (10)

1. A coding sequence for peroxidase POD1, wherein the amino acid sequence encoded by said coding sequence comprises the amino acid sequence shown in SEQ ID No.2 or a functional variant thereof, said functional variant having more than 70% homology with the amino acid sequence shown in SEQ ID No. 2.
2. The coding sequence of the peroxidase POD1 according to claim 1, wherein the functional variant has more than 90% homology with the amino acid sequence depicted in SEQ ID No. 2.
3. The coding sequence of the peroxidase POD1 of any one of claims 1 to 2, wherein the amino acid sequence depicted in SEQ ID No.2, or a functional variant thereof, is capable of catalyzing the synthesis of an intra-artemisinin oxo-peroxide bridge.
4. The coding sequence for the peroxidase POD1 according to claim 4, wherein the coding sequence encodes an amino acid sequence as set forth in SEQ ID No. 2.
5. The coding sequence for peroxidase POD1 according to claim 1, wherein the nucleotide sequence of the coding sequence is set forth in SEQ ID No. 1.
6. A polypeptide encoded by the coding sequence of peroxidase POD1 of claims 1-5.
7. The polypeptide of claim 6, wherein the sequence of the polypeptide is as set forth in SEQ ID No. 2.
8. Use of the coding sequence for a peroxidase POD1 according to claims 1-5, the polypeptide according to claims 6-7, for catalyzing the synthesis of an intra-loop peroxide bridge.
9. The application of claim 8, wherein the application comprises the steps of:
connecting a coding sequence of peroxidase POD1 to an escherichia coli prokaryotic expression regulatory sequence pET30a, and constructing a prokaryotic expression vector pET30a-POD 1;
step two, transferring the expression vector pET30a-POD1 in the step one into escherichia coli Rosetta;
step three, inducing the expression of the recombinant protein, and purifying the recombinant protein;
step four, catalyzing the synthesis of the intra-ring peroxide bridge bond by using the recombinant protein obtained in the step three.
10. Use of the coding sequence of the peroxidase POD1 according to claims 1-5, the polypeptide according to claims 6-7 for the synthesis of artemisinin using dihydroartemisinic acid.
CN202110271147.4A 2021-03-12 2021-03-12 Coding sequence of peroxidase POD1 and application thereof Active CN115074339B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110271147.4A CN115074339B (en) 2021-03-12 2021-03-12 Coding sequence of peroxidase POD1 and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110271147.4A CN115074339B (en) 2021-03-12 2021-03-12 Coding sequence of peroxidase POD1 and application thereof

Publications (2)

Publication Number Publication Date
CN115074339A true CN115074339A (en) 2022-09-20
CN115074339B CN115074339B (en) 2024-06-21

Family

ID=83241216

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110271147.4A Active CN115074339B (en) 2021-03-12 2021-03-12 Coding sequence of peroxidase POD1 and application thereof

Country Status (1)

Country Link
CN (1) CN115074339B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110106209A (en) * 2019-05-09 2019-08-09 山东大学 A method of synthesis terpenoid is positioned using Yarrowia lipolytica approach

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110106209A (en) * 2019-05-09 2019-08-09 山东大学 A method of synthesis terpenoid is positioned using Yarrowia lipolytica approach

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PWA81314.1: "thylakoid lumenal 29 kDa protein [Artemisia annua]", GENBANK *
张超: "基于植物基因工程的方法合成青蒿素的研究进展", 中国中药杂志, vol. 44, no. 19, pages 4285 - 4292 *

Also Published As

Publication number Publication date
CN115074339B (en) 2024-06-21

Similar Documents

Publication Publication Date Title
Ezaki et al. Expression of a moderately anionic peroxidase is induced by aluminum treatment in tobacco cells: possible involvement of peroxidase isozymes in aluminum ion stress
Miller et al. First isolation of an isoprene synthase gene from poplar and successful expression of the gene in Escherichia coli
Wang et al. Purification, characterization, and cloning of an extracellular laccase with potent dye decolorizing ability from white rot fungus Cerrena unicolor GSM-01
Einax et al. Oligonucleotide primers for the universal amplification of β-tubulin genes facilitate phylogenetic analyses in the regnum Fungi
US6093563A (en) Chondroitin lyase enzymes
Coton et al. Histidine carboxylase of Leuconostoc oenos 9204: purification, kinetic properties, cloning and nucleotide sequence of the hdc gene
Klonowska et al. LAC3, a new low redox potential laccase from Trametes sp. strain C30 obtained as a recombinant protein in yeast
Chen et al. Cloning and expression of a new manganese peroxidase from Irpex lacteus F17 and its application in decolorization of reactive black 5
TWI410492B (en) Novel fungal laccases and uses thereof
CN104928310B (en) Methionine lyases and its encoding gene and biological synthesis method
US7381810B2 (en) Polyphenol oxidase genes from lettuce
CN115074339A (en) Coding sequence of peroxidase POD1 and application thereof
DK2550293T3 (en) BACILLUS PUMILUS BILIRUBIN OXIDASE AND APPLICATIONS THEREOF
EP1748073B1 (en) Recombinant d-amino acid oxidase
Nagasaki et al. Purification, characterization, and gene cloning of Ceriporiopsis sp. strain MD-1 peroxidases that decolorize human hair melanin
Rebrikov et al. Laccase of the lignolytic fungus Trametes hirsuta: purification and characterization of the enzyme, and cloning and primary structure of the gene
Mura et al. Catalase and antiquitin from Euphorbia characias: Two proteins involved in plant defense?
US9005939B2 (en) Protoilludene synthase
CN115074337B (en) Application of alpha-ketoglutarate dependent dioxygenase in catalytic synthesis of cyclic peroxy bridge
US7700358B2 (en) Coffee mannanase
Johansson et al. Isozymes of the manganese (II)-dependent peroxidase in the white-rot basidiomycete Trametes versicolor
CN109790553B (en) Production method of sesaminol or sesaminol glucoside
Zhang et al. Molecular cloning of a classical plant peroxidase from Artemisia annua and its effect on the biosynthesis of artemisinin in vitro
Preger et al. Ascorbate-independent electron transfer between cytochrome b 561 and a 27 kDa ascorbate peroxidase of bean hypocotyls
US6627794B1 (en) Polyphenyl oxidase genes from banana

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant