CN115074337B - Application of alpha-ketoglutarate dependent dioxygenase in catalytic synthesis of cyclic peroxy bridge - Google Patents

Application of alpha-ketoglutarate dependent dioxygenase in catalytic synthesis of cyclic peroxy bridge Download PDF

Info

Publication number
CN115074337B
CN115074337B CN202110268423.1A CN202110268423A CN115074337B CN 115074337 B CN115074337 B CN 115074337B CN 202110268423 A CN202110268423 A CN 202110268423A CN 115074337 B CN115074337 B CN 115074337B
Authority
CN
China
Prior art keywords
alpha
ketoglutarate
dependent dioxygenase
artemisinin
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110268423.1A
Other languages
Chinese (zh)
Other versions
CN115074337A (en
Inventor
唐克轩
付雪晴
王玉亮
刘航
刘品
孙小芬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University
Original Assignee
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University filed Critical Shanghai Jiaotong University
Priority to CN202110268423.1A priority Critical patent/CN115074337B/en
Publication of CN115074337A publication Critical patent/CN115074337A/en
Application granted granted Critical
Publication of CN115074337B publication Critical patent/CN115074337B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/04—Oxygen as only ring hetero atoms containing a five-membered hetero ring, e.g. griseofulvin, vitamin C
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
    • C12Y113/12—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of one atom of oxygen (internal monooxygenases or internal mixed function oxidases)(1.13.12)
    • C12Y113/12019—2-Oxuglutarate dioxygenase (ethylene-forming) (1.13.12.19)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention provides an application of alpha-ketoglutarate-dependent dioxygenase in catalyzing and synthesizing a cyclic peroxy bridge, wherein the alpha-ketoglutarate-dependent dioxygenase has an amino acid sequence shown as SEQ ID NO. 1. The invention also provides a method for catalyzing and synthesizing the peroxy bridge bond in the artemisinin, which can be obtained by catalyzing alpha-ketoglutarate dependent dioxygenase. The invention has important significance for the mass production of artemisinin and the synthesis of compounds containing cyclic peroxy bridge bonds.

Description

Application of alpha-ketoglutarate dependent dioxygenase in catalytic synthesis of cyclic peroxy bridge
Technical Field
The invention relates to an application of alpha-ketoglutarate dependent dioxygenase in catalyzing and synthesizing a ring peroxy bridge bond, and relates to the technical field of molecular biology.
Background
The in-ring peroxy compound refers to a compound comprising a peroxy bridge bond in the ring, and has various biological activities, so that with more and more applications of the in-ring peroxy compound, in-vitro catalytic synthesis of the in-ring peroxy compound becomes a new research direction, wherein one of the difficulties in the synthesis of the in-ring peroxy compound is the catalytic synthesis of the ring and the peroxy bridge bond.
For example, artemisinin is a compound of a sesquiterpene with a cyclic peroxy bridge, and its antimalarial activity is indistinguishable from a "peroxy bridge". The main source of artemisinin is plant extraction, but the content of artemisinin in wild artemisinin only accounts for 0.1% -1% of dry weight, so that the research and development of an in vitro synthesis method of artemisinin is very important, and the difficulty of in vitro synthesis of artemisinin is the synthesis of a ring peroxy bridge bond.
Disclosure of Invention
The invention provides an application of alpha-ketoglutarate dependent dioxygenase in catalyzing and synthesizing a ring peroxy bridge bond and a method for catalyzing and synthesizing the peroxy bridge bond in artemisinin.
The first aspect of the invention provides the use of an alpha-ketoglutarate-dependent dioxygenase having an amino acid sequence as shown in SEQ ID NO.1 for the catalytic synthesis of a cyclic peroxy bridge.
In a second aspect, the invention provides the use of an enzyme having homology of more than 70% with an alpha-ketoglutarate-dependent dioxygenase having an amino acid sequence as shown in SEQ ID NO.1 for the catalytic synthesis of a cyclic peroxy bridge.
In a third aspect, the invention provides the use of an alpha-ketoglutarate-dependent dioxygenase having an amino acid sequence as shown in SEQ ID NO.1 for the catalytic synthesis of an artemisinin ring peroxy bridge.
Further, the gene encoding the alpha-ketoglutarate dependent dioxygenase has a sequence as shown in SEQ ID NO. 2.
Further, in the catalytic synthesis process, vitamin C, mgCl is also added 2 NADPH, DTT and arteannuic acid.
Further, the catalytic synthesis process specifically includes the following steps:
in 100mM PBS buffer, 100 μg of alpha-ketoglutarate dependent dioxygenase, 10mM vitamin C, 10mM MgCl were added 2 200nM NADPH, 0.1mM DTT, 200. Mu.M arteannuic acid, and reacted at 30℃for 24 hours in the absence of light to give artemisinin.
In a fourth aspect, the present invention provides a method for preparing an α -ketoglutarate-dependent dioxygenase comprising the steps of:
extracting total RNA of sweet wormwood herb, and synthesizing to obtain cDNA by taking the total RNA as a template;
extracting a nucleotide sequence shown as SEQ ID NO.2 from the cDNA;
introducing the nucleotide sequence into an expression vector pET30a, and constructing to obtain a recombinant vector;
and (3) introducing the recombinant vector into escherichia coli for expression to obtain the alpha-ketoglutarate-dependent dioxygenase.
Further, the recombinant vector is introduced into escherichia coli for expression, and specifically comprises the following steps:
e.coli after being introduced with the recombinant vector is cultured at 37 ℃ until the OD600 is 0.6, 0.5mM IPTG is added, the culture is continued for 12 hours at 16 ℃, after the culture is finished, thalli are collected, lysate is added, and the alpha-ketoglutarate dependent dioxygenase is obtained by purification.
The fifth aspect of the invention provides a method for catalyzing and synthesizing a peroxy bridge bond in artemisinin, which is obtained by catalyzing alpha-ketoglutarate-dependent dioxygenase, wherein the alpha-ketoglutarate-dependent dioxygenase has an amino acid sequence shown as SEQ ID NO. 1.
Further, the method comprises the following steps:
in 100mM PBS buffer, 100 μg of alpha-ketoglutarate dependent dioxygenase, 10mM vitamin C, 10mM MgCl were added 2 200nM NADPH, 0.1mM DTT, 200. Mu.M arteannuic acid, and reacted at 30℃for 24 hours in the absence of light to give artemisinin.
The implementation of the invention has at least the following advantages:
1. the invention provides a method for catalyzing and synthesizing a ring-in-peroxy bridge bond, and takes the synthesis of the ring-in-peroxy bridge bond in artemisinin as an example, which shows that alpha-ketoglutarate dependent dioxygenase can catalyze and synthesize the ring-in-peroxy bridge bond, and has important significance for the in-vitro synthesis of compounds containing the ring-in-peroxy bridge bond.
2. The synthetic method of the artemisinin provided by the invention is simple, has low cost and is suitable for mass production of the artemisinin.
Drawings
FIG. 1 is a SDS-PAGE diagram of alpha-ketoglutarate dependent dioxygenase;
FIG. 2 is a comparison of UPLC-QQQ-MS of the catalytic product of this example with an artemisinin standard;
FIG. 3 is a UPLC-QTOF-MS comparison of the catalytic product of this example with an artemisinin standard;
FIG. 4 is a graph showing the primary and secondary mass spectra of the catalytic product of this example compared to an artemisinin standard.
Detailed Description
For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions in the embodiments of the present invention will be clearly and completely described in the following in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
EXAMPLE 1 preparation of alpha-ketoglutarate dependent dioxygenase
Step 1, extracting total RNA of sweet wormwood genome
Taking sweet wormwood leaf tissue, placing the sweet wormwood leaf tissue in liquid nitrogen for grinding, adding the sweet wormwood leaf tissue into a 1.5mL centrifuge tube containing lysate, and extracting sweet wormwood total RNA according to the specification of a TIANGEN kit after full oscillation.
Step 2 cloning of the Gene encoding alpha-ketoglutarate dependent dioxygenase
Synthesizing cDNA under the action of PowerScript reverse transcriptase by taking the extracted total RNA as a template; designing a specific primer according to a gene encoding alpha-ketoglutarate dependent dioxygenase, amplifying the gene from total cDNA by PCR, and sequencing;
the gene encoding the alpha-ketoglutarate dependent dioxygenase has a sequence shown as SEQ ID NO. 2.
The specific primers and reaction systems used in the PCR process are shown in Table 1 and Table 2, respectively:
TABLE 1 PCR primers
Primer name Primer sequence (5 '. Fwdarw.3')
AOP1-FP ATGGCCTCCCTTATCTTACCTAA
AOP1-RP TTAAACACCACAGAAGTCTTTG
TABLE 2 reaction System for PCR
Artemisia apiacea cDNA 1μL
10×KOD Plus Buffer 5μL
dNTP 5μL
MgSO 4 2μL
AOP1-FP 1μL
AOP1-RP 1μL
KOD Plus 1μL
ddH 2 O 34μL
Total volume of 50μL
Step 3, constructing a sequence shown as SEQ ID NO.2 on a prokaryotic expression vector pET30a, wherein in order to facilitate construction of the expression vector, a BamHI enzyme cutting site is introduced into a forward primer, and an XhoI enzyme cutting site is introduced into a reverse primer, wherein the primers are shown in the table 3;
TABLE 3 primers used in recombinant vector construction
Step 4, transferring the constructed expression vector into an escherichia coli competent cell Rosetta (purchased from Shanghai Weidi biotechnology Co., ltd.);
step 5, transferring the activated escherichia coli into 200mL LB (containing 100mg/L kanamycin) liquid culture medium, culturing at 37 ℃ until the OD600 is 0.6, adding 0.5mM IPTG (stock solution 1M/mL), and inducing at 16 ℃ for 12h;
and 6, after the culture is finished, centrifugally collecting thalli, adding 1/10 volume (20 mL) of Lysis buffer, performing ultrasonic crushing, then centrifuging at 13000rpm for 20min at 4 ℃, sucking the supernatant, loading the supernatant onto a nickel column for protein purification, collecting protein effluent and performing SDS-PAGE detection.
The protein purification process specifically comprises the following steps: shaking up the nickel column filling material, sucking 1-2mL into a filtering column, dripping the liquid in the filling material, adding 2.5-5mL deionized water, and washing the column; with 5-10mL of Lysis buffer (7.8 g NaH) 2 PO 4 ·2H 2 O,17.54g NaCl and 0.68g Imidazole,pH 8.0), adding supernatant and filtering; with 10mL wash buffer (7.8 g NaH) 2 PO 4 ·2H 2 O,17.54g NaCl and 1.36g Imidazole,pH 8.0) washing the column; 250. Mu.L of an Elimination Buffer (7.8 g NaH) 2 PO 4 ·2H 2 O,17.54g NaCl and 17.0g Imidazole,pH 8.0), the flash buffer in the nickel column was pressed; adding 2mL Elution Buffer again, collecting the effluentA protein solution; adding 2-3mL Elution Buffer again, and collecting effluent protein liquid;
FIG. 1 is a SDS-PAGE diagram of an alpha-ketoglutarate dependent dioxygenase, as shown in FIG. 1, the enzyme is 35.4kDa in size and is deduced from its nucleotide sequence to give an amino acid sequence as shown in SEQ ID NO. 1.
Example 2 in vitro catalytic experiments with alpha-ketoglutarate dependent dioxygenase
Into a reaction system of 100mM PBS buffer (pH 7.0), 100. Mu.g of alpha-ketoglutarate-dependent dioxygenase, 200. Mu.M substrate arteannuic acid, 10mM vitamin C, 10mM MgCl were added 2 200nM NADPH as hydrogen ion donor and 0.1mM DTT, magnetic stirrer was continuously stirred, the reaction product was collected and extracted three times with n-hexane at 30℃in the absence of light, the extract was dried and dissolved with methanol, and the catalytic product was analyzed using UPLC-QQ-MS, UPLC-QTOF-MS.
A negative control was boiled alpha-ketoglutarate dependent dioxygenase.
FIG. 2 is a comparison chart of the UPLC-QQ-MS of the catalytic product and the arteannuin standard in the present example, wherein A is a chart of the UPLC-QQ-MS test result of the arteannuin standard, B is a chart of the UPLC-QQ-MS test result of the catalytic product, and as shown in FIG. 2, the product of the catalytic arteannuin synthesis by the alpha-ketoglutarate-dependent dioxygenase contains arteannuin; FIG. 3 is a UPLC-QTOF-MS comparison chart of a catalytic product and an artemisinin standard product in the embodiment, A is an ion flow chart of the artemisinin standard product, B is an ion flow chart of the catalytic product, C is a characteristic ion fragment schematic diagram of the artemisinin standard product, D is a characteristic ion fragment schematic diagram of the catalytic product, and as shown in FIG. 3, the result of UPLC-QTOF-MS experiment shows that a compound with the peak time consistent with that of the artemisinin standard product appears in the product of catalytic synthesis of the artemisinin by the alpha-ketoglutarate-dependent dioxygenase, and the characteristic ion fragment of the compound is consistent with that of the artemisinin standard product, so that the alpha-ketoglutarate-dependent dioxygenase can actually catalyze synthesis of the artemisinin.
Example 3 validation of alpha-ketoglutarate dependent dioxygenase catalyzed product of Artemisia acid
The preparation liquid phase separation and purification are used for catalyzing and synthesizing a product with the same peak time as that of an artemisinin standard substance by using alpha-ketoglutarate dependent dioxygenase, the purified product is analyzed by AcquisyUPLC/UPC 2/Xevo and G2-XS QTOFMS/MS, and the primary mass spectrum and secondary mass spectrum fragment information of the compound is compared with the primary mass spectrum and secondary mass spectrum characteristic fragment of the artemisinin standard substance. FIG. 4 is a graph comparing the primary mass spectrum and the secondary mass spectrum characteristic fragments of the catalytic product and the artemisinin standard in the embodiment, wherein A is the primary mass spectrum of the artemisinin standard, B is the primary mass spectrum of the catalytic product, C is the secondary mass spectrum of the artemisinin standard, and D is the secondary mass spectrum of the catalytic product, and as shown in FIG. 4, the catalytic product can be determined to be artemisinin through further comparison, which indicates that the alpha-ketoglutarate-dependent dioxygenase can catalyze the synthesis of artemisinin from artemisinin, namely, the alpha-ketoglutarate-dependent dioxygenase can catalyze the synthesis of peroxy bridge bonds in the artemisinin ring.
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.
Sequence listing
<110> Shanghai university of transportation
<120> use of alpha-ketoglutarate dependent dioxygenase in catalytic synthesis of cyclic peroxy bridges
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 314
<212> PRT
<213> Artemisia annua
<400> 1
Met Ala Ser Leu Ile Leu Pro Lys Leu Leu Val Val Asp Phe Thr Asn
1 5 10 15
Glu Asn Leu Lys Pro Gly Thr Ser Val Trp Ser Ser Thr Cys Asn Asp
20 25 30
Ile Arg Val Ala Leu Glu Asn His Gly Cys Phe Ile Ala Leu Tyr Asp
35 40 45
Gly Val Ser Ser Lys Leu Gln Asp Ser Val Phe Arg Ala Ala Glu Glu
50 55 60
Leu Phe Asp Leu Pro Thr Glu Thr Lys Ile Lys Asn Ile Gly Glu Lys
65 70 75 80
Pro Tyr His Gly Tyr Leu Gly Gln Lys Pro Ile Ile Pro Leu His Glu
85 90 95
Gly Leu Gly Ile Asp Tyr Ala Thr Asp Leu Glu Gly Ala Gln Ser Phe
100 105 110
Thr Asp Ile Met Trp Pro Asp Gly Asn Gln Ser Phe Cys Glu Ala Ser
115 120 125
Leu Ser Phe Ser Arg Ala Val Ala Lys Leu Asp Gln Thr Val Val Arg
130 135 140
Met Leu Phe Glu Ser Tyr Gly Val Glu Lys Gln Ser Ala Ser His Ile
145 150 155 160
Glu Ser Thr Thr Tyr Leu Leu Arg Tyr Leu Lys Tyr Arg Ala Pro Glu
165 170 175
Thr Asn Glu Thr Thr Ile Ala Met Pro Ser His Thr Asp Lys Thr Phe
180 185 190
Leu Ser Ile Leu His Gln Asn Gln Val Ser Gly Leu Glu Ile Arg Ser
195 200 205
Arg Asp Glu Glu Trp Ile Ser Val Gln Phe Pro Ala Ser Ser Phe Val
210 215 220
Val Met Ala Gly Asp Val Cys Lys Ala Trp Ser Asn Asn Arg Val Leu
225 230 235 240
Ser Pro Asn His Lys Val Thr Met Asp Lys Gln Gly Lys Glu Thr Arg
245 250 255
Tyr Thr Ile Ala Leu Phe Ser Tyr Leu Ser Lys Lys Val Gln Ile Pro
260 265 270
Asp Glu Leu Val Asp Ala Asp His Pro Leu Gln Phe Lys Pro Phe Asp
275 280 285
His Ile Asp Leu Leu Asn Phe Tyr Val Thr Glu Asn Gly Arg Lys Ser
290 295 300
Gln Asn Leu Leu Lys Asp Phe Cys Gly Val
305 310
<210> 2
<211> 945
<212> DNA
<213> Artemisia annua
<400> 2
atggcctccc ttatcttacc taaacttctt gtagtagact tcacaaatga aaacctaaag 60
cccggtacaa gtgtctggtc ttccacatgt aacgatatca gggttgccct cgaaaaccat 120
ggctgtttca ttgcactata tgatggagtt tcctccaagc ttcaagattc cgtgttccga 180
gctgcagaag aattgtttga tctcccaact gaaaccaaga ttaaaaacat tggcgaaaag 240
ccttaccatg gatatctagg acagaagccc attattccac ttcacgaagg cttggggatc 300
gactatgcca cagatcttga aggtgctcaa agttttacag acatcatgtg gccagacgga 360
aaccagtcat tctgcgaagc atcgctgtca ttttcaaggg ctgtggcaaa attagaccag 420
acggtggtaa ggatgttgtt tgaaagctac ggtgttgaga aacaaagtgc atctcatatc 480
gaatctacaa cctatcttct tcggtatctg aaatacagag cacctgagac gaacgagacc 540
acaatagcca tgccttctca tacagataaa actttcttga gcattcttca tcagaatcaa 600
gtttcaggct tggaaataag atcaagagat gaagaatgga tttctgtcca attccctgct 660
tcttcctttg tggtcatggc aggcgatgtt tgcaaggcct ggagtaacaa cagggtgctt 720
tcaccgaacc acaaagtcac catggacaag caggggaaag aaacaagata tactattgca 780
ttgttttctt acttaagtaa gaaggtgcaa atacccgatg agcttgttga cgctgaccac 840
cctctacagt ttaagccatt tgatcatatt gatctcctta atttctatgt gaccgaaaat 900
ggaagaaaat cacaaaacct cctcaaagac ttctgtggtg tttaa 945

Claims (3)

1. The application of alpha-ketoglutarate-dependent dioxygenase in catalytic synthesis of artemisinin ring peroxy bridge is characterized in that the alpha-ketoglutarate-dependent dioxygenase has an amino acid sequence shown as SEQ ID NO.1, and a gene for encoding the alpha-ketoglutarate-dependent dioxygenase has a sequence shown as SEQ ID NO. 2;
the catalytic synthesis process specifically comprises the following steps:
into a reaction system of 100mM PBS buffer solution, 100 μg of alpha-ketoglutarate dependent dioxygenase, 10mM vitamin C, 10mM MgCl were added 2 200nM NADPH, 0.1mM DTT, 200. Mu.M arteannuic acid, and reacted at 30℃for 24 hours in the absence of light to give artemisinin.
2. A method for preparing alpha-ketoglutarate-dependent dioxygenase, comprising the steps of:
extracting total RNA of sweet wormwood herb, and synthesizing to obtain cDNA by taking the total RNA as a template;
extracting a nucleotide sequence shown as SEQ ID NO.2 from the cDNA;
introducing the nucleotide sequence into an expression vector pET30a, and constructing to obtain a recombinant vector;
introducing the recombinant vector into escherichia coli for expression to obtain the alpha-ketoglutarate-dependent dioxygenase;
the recombinant vector is introduced into escherichia coli for expression, and specifically comprises the following steps:
e.coli after being introduced with the recombinant vector is cultured at 37 ℃ until the OD600 is 0.6, 0.5mM IPTG is added, the culture is continued for 12 hours at 16 ℃, after the culture is finished, thalli are collected, lysate is added, and the alpha-ketoglutarate dependent dioxygenase is obtained by purification.
3. A method for catalyzing and synthesizing a peroxy bridge bond in artemisinin is characterized by being obtained by catalyzing alpha-ketoglutarate-dependent dioxygenase, wherein the alpha-ketoglutarate-dependent dioxygenase has an amino acid sequence shown as SEQ ID NO. 1;
the method comprises the following steps:
in 100mM PBS buffer, 100. Mu.g of alpha-ketoglutarate-dependent dioxygenase, 10mM vitamin C, 10mM MgCl were added 2 200nM NADPH, 0.1mM DTT, 200. Mu.M arteannuic acid, and reacted at 30℃for 24 hours in the dark to give artemisinin.
CN202110268423.1A 2021-03-12 2021-03-12 Application of alpha-ketoglutarate dependent dioxygenase in catalytic synthesis of cyclic peroxy bridge Active CN115074337B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110268423.1A CN115074337B (en) 2021-03-12 2021-03-12 Application of alpha-ketoglutarate dependent dioxygenase in catalytic synthesis of cyclic peroxy bridge

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110268423.1A CN115074337B (en) 2021-03-12 2021-03-12 Application of alpha-ketoglutarate dependent dioxygenase in catalytic synthesis of cyclic peroxy bridge

Publications (2)

Publication Number Publication Date
CN115074337A CN115074337A (en) 2022-09-20
CN115074337B true CN115074337B (en) 2023-11-28

Family

ID=83240491

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110268423.1A Active CN115074337B (en) 2021-03-12 2021-03-12 Application of alpha-ketoglutarate dependent dioxygenase in catalytic synthesis of cyclic peroxy bridge

Country Status (1)

Country Link
CN (1) CN115074337B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102372769A (en) * 2011-11-03 2012-03-14 中国科学院研究生院 Artemisia apiacea bHLH transcription factor as well as encoding gene and application thereof
WO2017159795A1 (en) * 2016-03-16 2017-09-21 国立研究開発法人産業技術総合研究所 Tentoxin synthesis-related gene, dihydrotentoxin or tentoxin production method using same, and transformant having same
CN107881205A (en) * 2017-11-23 2018-04-06 中国科学院上海有机化学研究所 The function of oxidizing ferment and its application in bicyclomycin biosynthesis

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102372769A (en) * 2011-11-03 2012-03-14 中国科学院研究生院 Artemisia apiacea bHLH transcription factor as well as encoding gene and application thereof
WO2017159795A1 (en) * 2016-03-16 2017-09-21 国立研究開発法人産業技術総合研究所 Tentoxin synthesis-related gene, dihydrotentoxin or tentoxin production method using same, and transformant having same
CN107881205A (en) * 2017-11-23 2018-04-06 中国科学院上海有机化学研究所 The function of oxidizing ferment and its application in bicyclomycin biosynthesis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
青蒿素生物合成分子调控研究进展;王红,叶和春,刘本叶,李振秋,李国凤;生物工程学报(第06期);全文 *

Also Published As

Publication number Publication date
CN115074337A (en) 2022-09-20

Similar Documents

Publication Publication Date Title
Miller et al. First isolation of an isoprene synthase gene from poplar and successful expression of the gene in Escherichia coli
CN108048417B (en) Ketoreductase mutant and application thereof
Gerwin et al. An oligonucleotide affinity column for RNA-dependent DNA polymerase from RNA tumor viruses
CN106520745B (en) Two diterpene synthase TwGES1 of tripterygium wilfordii and its encoding gene and application
CN109136203A (en) A kind of P450BM3 mutant and its application in hydroquinone is being synthesized using benzene or phenol as substrate
CN108239618A (en) Co-express genetic engineering bacterium and its application of cyclohexanone monooxygenase and dehydrogenation of isopropanol enzyme
CN113736763B (en) Myrosinase Rmmr and application thereof in preparation of sulforaphane and sulforaphane
CN115074337B (en) Application of alpha-ketoglutarate dependent dioxygenase in catalytic synthesis of cyclic peroxy bridge
CN112680483B (en) Application of sanshool dehydrogenase LcADH31 in preparation of citral or product with citral as active substance
CN110819601B (en) Reductive amination enzyme, coding gene, recombinant vector, recombinant cell and application thereof
CN111499759A (en) Zinc finger protein-lactoferrin fusion protein with cell membrane penetrating property and preparation and application thereof
CN108795915A (en) Radix Salviae Miltiorrhizae sesquiterpene synthase gene SmTPS21, its cloning primer, expression vector, catalysate and application
CN106987578A (en) A kind of Terpene synthase for producing koraiol and its application
CN112080479A (en) 17 beta-hydroxysteroid dehydrogenase mutant and application thereof
CN105132400B (en) The enzyme and preparation method thereof of C3H6O3 function is synthesized with catalysis formaldehyde
CN111718911B (en) FAD-dependent oxidase Ma-2 in Diels-Alder adduct anabolic pathway and application
CN114277024B (en) Novel triterpene synthase and application thereof
CN109355271A (en) A kind of epoxide hydrolase and its application in ocean rhodotorula source
CN115074339B (en) Coding sequence of peroxidase POD1 and application thereof
CN112760298A (en) Cytochrome P450BM3 oxidase mutant and preparation method and application thereof
CN106480074A (en) A kind of Monopterus albus (Zuiew) aldehyde ketone reductase gene and its vivoexpression method
CN111718910B (en) FAD-dependent oxidase Ma-1 in Diels-Alder adduct anabolic pathway and application
CN108866142B (en) Cytochrome P450, nicotinamide adenine dinucleotide-cytochrome P450 reductase and application thereof
CN106676079B (en) 7alpha-Hydroxysteroid dehydrogenase gene S1-a-2
CN108707590A (en) A kind of Pictet-Spengler enzymes and its encoding gene and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant