CN115058376A

CN115058376A - Recombinant strain and application and method thereof in utilization of formic acid or derivative thereof

Info

Publication number: CN115058376A
Application number: CN202210687506.9A
Authority: CN
Inventors: 祁峰; 黄建忠; 晋豆; 顾苏宜; 苏愉
Original assignee: Fujian Normal University
Current assignee: Fujian Normal University
Priority date: 2022-06-17
Filing date: 2022-06-17
Publication date: 2022-09-16

Abstract

The invention discloses a recombinant strain and application and a method thereof in utilization of formic acid or derivatives thereof, belongs to the field of biotechnology and engineering, and mainly enables Escherichia coli (Escherichia coli) to assimilate formic acid or formate through genetic engineering transformation, namely, formic acid or formate can be used as a carbon source for growth and metabolism. The genetically engineered Escherichia coli used in the present invention comprises formaldehyde dehydrogenase (BmFaldDH) from Burkholderia polyspora (Burkholderia Multivorans), 3-hexulose-6-phosphate synthase (HPS) from Methylobacillus flagellatus (Methylobacillus flagellatus), and 6-phospho-3-hexuloisomerase (PHI) from Methylobacillus flagellatus. Coli intracellular overexpression of the three genes can strengthen ribulose monophosphate (RuMP) circulation, so that the purpose of assimilating formate or formate is achieved.

Description

Recombinant strain and application and method thereof in utilization of formic acid or derivative thereof

Technical Field

The invention belongs to the technical field of biotechnology and engineering, and particularly relates to recombinant escherichia coli.

Background

In recent years, the biofermentation industry using glucose as a single or important carbon source has been seriously impacted due to the superposition of multiple factors such as global energy crisis, grain crisis, and sugar value fluctuation. Meanwhile, carbon sources such as carbon dioxide, methane, formaldehyde, methanol, formate and the like are becoming popular as novel carbon sources in metabolic engineering due to their advantages of large amount and low cost. Formic acid and formate are promising single-carbon substances and can be used for biosynthesis of various high-value-added chemicals. Natural formate-feeding microorganisms are capable of converting formate to biomass or biomass, but because the genes of natural formate-feeding microorganisms are difficult to engineer or because of the low biomass and anabolic product yields, formate as a carbon source in its biosynthetic process is more limited. Therefore, it is important to transform an industrial microorganism having a high growth rate and being easy to metabolize formate. The natural Escherichia coli irreversibly converts formate and formate into carbon dioxide through formate dehydrogenase, but formaldehyde and methanol are a cycle center of single-carbon metabolism, and formate can be introduced into the central metabolic pathway through multiple pathways such as serine cycle, reducing coenzyme A cycle, ribulose monophosphate cycle and the like, so that a theoretical basis is provided for genetic modification and transformation of an anabolic pathway of Escherichia coli by using a genetic engineering means, and formate can be used for biosynthesis in Escherichia coli. In recent years, a number of expert scholars have engineered the relevant genes in E.coli to increase their formate fixation capacity. However, the current research results also have the problems of low utilization rate and slow speed of the transformed strains on the formic acid or the formate, and further improvement is needed.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a recombinant strain and application and a method thereof in utilizing formic acid or derivatives thereof. The invention provides a gene recombinant Escherichia coli, which can efficiently utilize formic acid or formate with cytotoxicity as a carbon source to produce metabolism and produce a target product.

One of the technical schemes adopted by the invention for solving the technical problems is as follows:

a recombinant strain capable of utilizing formic acid or a derivative thereof, which is Escherichia coli E.coli MG1655 into which a BmFaldDH gene shown in SEQ ID No.9 and an HPS + PHI gene shown in SEQ ID No.10 are transferred.

The recombinant strain of the present invention comprises formaldehyde dehydrogenase (BmFaldDH) from Burkholderia polyspora (Burkholderia Multivorans), 3-hexulose-6-phosphate synthase (HPS) from Microbacterium flagellatum (Methylobacillus flagellatus), and 3-hexulose-6-phosphate isomerase (PHI) from Microbacterium flagellatum (Methylobacillus flagellatus). Coli intracellular overexpression of the three genes can strengthen ribulose monophosphate (RuMP) circulation, so that the purpose of assimilating formic acid or derivatives thereof is achieved.

Further, the recombinant strain is prepared by the following method:

1) connecting the BmFaldDH gene shown as SEQ ID No.9 with pTrc99a plasmid, transforming to obtain plasmid pTrc99 a-BmFaldDH;

2) connecting the HPS + PHI gene shown as SEQ ID No.10 with the plasmid pTrc99a-BmFaldDH obtained in the step 1), and transforming to obtain a plasmid pTrc99a-BmFaldDH-HPS + PHI;

3) transforming the plasmid pTrc99a-BmFaldDH-HPS + PHI obtained in the step 2) into Escherichia coli E.coli MG1655 to obtain the recombinant strain.

Preferably, in the step 1), the BmFaldDH gene is obtained by amplification by using a primer BmFaldDH-F shown as SEQ ID No.1 and a primer BmFaldDH-R shown as SEQ ID No.2, and is used for connection and transformation with the pTrc99a plasmid to obtain the plasmid pTrc99 a-BmFaldDH.

Preferably, in the step 1), the pTrc99a plasmid is obtained by amplification by using a primer pTrc99A-F shown as SEQ ID No.3 and a primer pTrc99A-R shown as SEQ ID No.4, and is used for connection and transformation with the BmFaldDH gene to obtain the plasmid pTrc99 a-BmFaldDH.

Preferably, in the step 2), the primer HPS + PHI-F shown in SEQ ID No.5 and the primer HPS + PHI-R shown in SEQ ID No.6 are used for amplification to obtain the HPS + PHI gene, and the HPS + PHI gene is used for connection and transformation with the plasmid pTrc99a-BmFaldDH to obtain the plasmid pTrc99a-BmFaldDH-HPS + PHI.

Preferably, in the step 2), the pTrc99a-BmFaldDH plasmid is obtained by amplification by using a primer pTrc99A-F-1 shown as SEQ ID No.7 and a primer pTrc99A-R-1 shown as SEQ ID No.8, and is used for connection and transformation with the HPS + PHI gene to obtain the plasmid pTrc99a-BmFaldDH-HPS + PHI.

Preferably, in the step 3), the plasmid pTrc99a-BmFaldDH-HPS + PHI is transformed into the Escherichia coli E.coli MG1655 by a heat shock transformation method.

Preferably, the ligation of the BmFaldDH gene to the pTrc99a plasmid is performed in a Gibson seamless ligation manner.

Preferably, the ligation of the HPS + PHI gene to the plasmid pTrc99a-BmFaldDH is performed in a Gibson seamless ligation manner.

The second technical scheme adopted by the invention for solving the technical problems is as follows:

the application of the recombinant strain in the utilization of formic acid or derivatives thereof.

The third technical scheme adopted by the invention for solving the technical problems is as follows:

the method for assimilating formic acid or derivatives thereof by using the recombinant strain comprises the steps of inoculating the recombinant strain into an LB culture medium containing ampicillin resistance, performing multistage amplification culture at 36-38 ℃ to obtain a bacterial liquid, adding an inducer, performing induction culture at 28-32 ℃, and mixing with formic acid or derivatives thereof, wherein the recombinant strain takes the formic acid or derivatives thereof as a carbon source for growth and metabolism, so that the formic acid or derivatives thereof are assimilated.

The use of formic acid or a derivative thereof in the present invention means that the recombinant strain can assimilate formic acid or a derivative thereof, i.e., can use formic acid or a derivative thereof as a carbon source for growth and metabolism. Specifically, the recombinant strain is applied to the utilization of formic acid or derivatives thereof, such as decomposition of formic acid or derivatives thereof, or preparation of methanol, ethanol, formaldehyde, glycine, serine, pyruvic acid and the like by utilizing formic acid or derivatives thereof, but not limited thereto.

Specifically, the formic acid derivative is formate.

A preferred embodiment example of the invention is as follows:

1.pTrc99 a-BmFaldDH-HPS + PHI recombinant plasmid was constructed and transformed into E.coli MG 1655:

synthesizing a target gene by using a gene synthesis service, and performing PCR (polymerase chain reaction) technology by using corresponding primers: the primer BmFaldDH-F (shown as SEQ ID No. 1) and the primer BmFaldDH-R (shown as SEQ ID No. 2), the primer pTrc99A-F (shown as SEQ ID No. 3) and the primer pTrc99A-R (shown as SEQ ID No. 4) are amplified by using high fidelity enzyme and using a target gene BmFaldDH and pTrc99a plasmids as templates to obtain a BmFaldDH gene and a pTrc99a framework, then the BmFaldDH gene fragment and the vector framework fragment pTrc99a are connected in a Gibson seamless connection mode, a connection product is transformed into an Escherichia coli T1 cell, plates are coated, overnight culture is carried out, a positive strain with ampicillin resistance is selected for amplification culture, and a plasmid minikit is used to obtain a recombinant pTrc99a-BmFaldDH (a plasmid map is shown as figure 1). The obtained pTrc99a-BmFaldDH plasmid is transformed into an Escherichia coli competent cell E.coli MG1655 by adopting a 42 ℃ heat shock method, and plasmid sequencing verification is extracted.

Then, a primer HPS + PHI-F (shown as SEQ ID No. 5) and a primer HPS + PHI-R (shown as SEQ ID No. 6), a primer pTrc99A-F-1 (shown as SEQ ID No. 7) and a primer pTrc99A-R-1 (shown as SEQ ID No. 8) are adopted, and the HPS + PHI gene and the pTrc99a-BmFaldDH vector skeleton are obtained by PCR amplification by using high fidelity enzyme. Then, the HPS + PHI gene fragment and the vector backbone fragment pTrc99A were ligated by Gibson seamless ligation, and the recombinant plasmid pTrc99a-BmFaldDH-HPS + PHI was obtained by transformation sequencing as described above (plasmid map is shown in FIG. 2).

(SEQ ID No.1)BmFaldDH-F：agaccatggaattcaggaggatgagcagcaatcgtggtgt

(SEQ ID No.2)BmFaldDH-R：gatccccgggtaccgagctcttaggcggccagcaggccat

(SEQ ID No.3)pTrc99A-F：atggcctgctggccgcctaagagctcggtacccggggatc

(SEQ ID No.4)pTrc99A-R：acaccacgattgctgctcatcctcctgaattccatggtct

(SEQ ID No.5)HPS+PHI-F：aggaggaattaaccaggaggatggaactgcagctggcact

(SEQ ID No.6)HPS+PHI-R：ttgcatgcctgcaggtcgacttattccagattggcatgac

(SEQ ID No.7)pTrc99A-F-1：gtcatgccaatctggaataagtcgacctgcaggcatgcaa

(SEQ ID No.8)pTrc99A-R-1：agtgccagctgcagttccatcctcctggttaattcctcct

(SEQ ID No.9) formate dehydrogenase (BmFaldDH) gene:

ATGAGCAGCAATCGTGGTGTTGTGTATCTGGGTCCGGGTAAAGTTGAAGTGCAGAAAATTGATTATCCGAAAATGGTGGACCCTAGTGGTCGCGCAATTGGCCATGGTGTTATTCTGAAAGTGGTGAGTACCAATATTTGCGGTAGTGATCAGCACATGGTGCGCGGCCGCACCACCGCACCTGTGGGTTTAGTGCTGGGCCATGAAATTACCGGTGAAGTGGTTGAAGTGGGTCGTGATGTTGAAACCCTGAAAATTGGTGATCTGGTTAGTGTTCCGTTTAATGTGGCCTGCGGTCGCTGCGCAATGTGCAAAGAAACCCATACCGGCGTGTGCCTGAATGTGAATCCGAGTCGCGCAGGTGGTGCCTATGGCTATGTTGATATGGGCGGTTGGATTGGCGGCCAGGCAGAATATGTTCTGGTGCCGTATGCCGATTTTAATCTGCTGAAATTTCCGGATCGTGATCAGGCCATGGCCAAAATTCGCGATCTGACCTGTCTGAGTGATATTCTGCCGACCGGCTATCATGGCGCAGTGAGCGCAGGTGTGAAACCGGGCAGCACCGTGTATATTGCAGGCGCAGGTCCGGTTGGTATGGCAGCAGCCGCAAGTGCACGCCTGCTGGGTGCAGCAGTTACCATTGTGGGCGATATGAATGCAGAACGTCTGGCCCATGCAAAAGCAATGGGCTTTGAAACCGTGGATCTGAGCAAAGATGCCACCCTGGGTGAACAGATTGCACAGATTCTGGGCAAACCGGAAATTGATTGCGCCGTTGATTGTGTTGGCTTTGAAGCACATGGTCATGGTAGCAGCGGCCATGCCGAAGAAGCACCTGCAACCGTTCTGAATAGTCTGATGGAAATTACCCGTCCGGCCGGCGCAATTGGTATTCCGGGTCTGTATGTGACCGATGATCCGGGTGCCCAGGATAAAGCCGCACAGCATGGTAGCCTGAGTATTCGCTTTGGTCTGGGCTGGGCCAAAAGTCATAGCTTTTTTACCGGCCAGACACCTGTGCTGAAATATAATCGTAATCTGATGCAGGCAATTCTGTATGATCGTCTGCCGATTGCCAAAATTGTGAATGTTACCGTGATTAGTCTGGATGATGCACCGGAAGGCTATAAAAAATTTGATGGCGGTGCACCGCGTAAATTTGTGATTGATCCGCATGGCCTGCTGGCCGCCTAA

(SEQ ID No.10) 3-hexulose-6-phosphate synthase + 6-phosphate-3-hexulose isomerase (HPS + PHI) gene:

ATGGAACTGCAGCTGGCACTGGATCTGGTGAATATTGAAGAAGCAAAACAGGTTGTGGCCGAAGTGCAGGAATATGTGGATATTGTTGAAATTGGCACACCTGTGATTAAAATTTGGGGCCTGCAGGCCGTTAAAGCCGTTAAAGATGCATTTCCGCATCTGCAGGTGCTGGCAGATATGAAAACCATGGATGCAGCAGCATACGAAGTTGCAAAAGCCGCAGAACATGGTGCCGATATTGTTACCATTCTGGCAGCCGCCGAAGATGTGAGTATTAAAGGTGCAGTGGAAGAAGCAAAGAAACTGGGCAAAAAAATTCTGGTGGATATGATTGCCGTTAAAAATCTGGAAGAACGTGCAAAACAGGTGGATGAAATGGGTGTTGATTATATTTGTGTGCATGCCGGTTATGATCTGCAGGCAGTGGGCAAAAATCCGCTGGATGATCTGAAACGCATTAAAGCCGTGGTTAAAAATGCAAAAACCGCCATTGCCGGTGGTATTAAACTGGAAACCCTGCCGGAAGTTATTAAAGCCGAACCGGATCTGGTTATTGTGGGCGGTGGTATTGCAAATCAGACCGATAAAAAAGCCGCAGCAGAAAAAATTAATAAGCTGGTTAAACAGGGCCTGTAAAAGGAGATGATTAGCATGCTGACCACCGAATTTCTGGCAGAAATTGTGAAAGAACTGAATAGCAGCGTGAATCAGATTGCCGATGAAGAAGCAGAAGCACTGGTTAATGGTATTCTGCAGAGTAAAAAAGTGTTTGTTGCAGGTGCCGGTCGTAGCGGCTTTATGGCCAAAAGTTTTGCAATGCGTATGATGCACATGGGTATTGATGCATACGTTGTTGGCGAAACCGTGACACCTAATTATGAAAAAGAAGATATTCTGATCATCGGCAGCGGTAGCGGCGAAACCAAAAGCCTGGTGAGTATGGCCCAGAAAGCAAAAAGCATTGGTGGCACCATTGCCGCCGTGACCATTAATCCGGAAAGCACCATTGGCCAGCTGGCCGATATTGTGATTAAAATGCCGGGTAGCCCGAAAGATAAAAGTGAAGCCCGCGAAACCATTCAGCCGATGGGTAGTCTGTTTGAACAGACCCTGCTGCTGTTTTATGATGCAGTTATTCTGCGCTTTATGGAAAAAAAAGGTCTGGATACCAAAACCATGTATGGCCGTCATGCCAATCTGGAATAA

transformation of pTrc99a-BmFaldDH-HPS + PHI into E.coli MG 1655:

preparing chemically competent Escherichia coli by adopting a calcium chloride method, transforming a recombinant plasmid pTrc99a-BmFaldDH-HPS + PHI into the chemically competent Escherichia coli by using a 42 ℃ heat shock transformation mode, coating the chemically competent Escherichia coli on an ampicillin-resistant LB (lysogeny broth) plate, culturing overnight, screening a positive strain for amplification culture, selecting a growing clone to an ampicillin-resistant LB liquid culture medium for amplification culture, extracting a positive clone plasmid from 4mL of a bacterial liquid by using a plasmid miniextraction reagent (TIANGEN), and sequencing and verifying.

3. Fermentation culture of transformed escherichia coli engineering strain and analysis of formic acid utilization condition

Screening and culturing the gene recombinant escherichia coli in a screening culture medium, and selecting a colony with good growth vigor to obtain a screening strain; carrying out amplification culture on the obtained screening strain in an LB culture medium containing ampicillin resistance to obtain a seed solution; inoculating the seed liquid into LB culture medium containing ampicillin resistance according to a certain inoculation amount, carrying out amplification culture again to obtain an amplification bacterial liquid, adding an inducer into the amplification bacterial liquid, carrying out induction culture, adding formic acid into fermentation liquor, and selecting different intervals to carry out sampling detection according to different final concentrations of the formic acid in the fermentation liquor.

Except for specific description, the equipment, reagents, processes, parameters and the like related to the invention are conventional equipment, reagents, processes, parameters and the like, and are not implemented.

All ranges recited herein include all point values within the range.

Compared with the background technology, the technical scheme has the following advantages:

1. the invention takes pTrc99a as an overexpression vector, and recombines and expresses a formaldehyde dehydrogenase (BmFaldDH) gene from a Burkholderia polyphagia genome, a 3-hexulose-6-phosphate synthase (HPS) gene from a methylobacterium flagellatum genome and a 6-phosphate-3-hexulose isomerase (PHI) gene from the methylobacterium flagellatum genome in E.coli cells, so as to realize assimilation of formic acid or formate;

2. the invention strengthens the ribulose monophosphate (RuMP) circulation way by high-efficiency expression of three exogenous genes and realizes high-efficiency utilization of formic acid or formate by the engineering strain.

Drawings

FIG. 1 is a map of the pTrc99a-BmFaldDH plasmid construction according to an embodiment of the present invention.

FIG. 2 is a map of the plasmid pTrc99a-BmFaldDH-HPS + PHI constructed in accordance with the present invention.

FIG. 3 shows the results of experiments using formic acid by recombinant strains at a final concentration of 2g/L formic acid in the examples of the present invention.

Detailed Description

The invention is further illustrated by the following figures and examples.

Example 1:

the construction of the genetic engineering Escherichia coli strain capable of effectively utilizing the capability of formic acid comprises the following specific operation steps:

construction of pTrc99a-BmFaldDH vector:

the target gene was synthesized by a commercial gene synthesis service. The synthesized target gene BmFaldDH is amplified by adding high fidelity enzyme into a PCR system by adopting a primer BmFaldDH-F (shown as SEQ ID No. 1) and a primer BmFaldDH-R (shown as SEQ ID No. 2) to obtain the BmFaldDH gene (shown as SEQ ID No. 9). Carrying out PCR amplification on the pTrc99a plasmid vector by using a primer pTrc99A-F (shown as SEQ ID No. 3) and a primer pTrc99A-R (shown as SEQ ID No. 4) and high-fidelity enzyme to obtain a pTrc99a plasmid vector, wherein the PCR conditions are as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min, and 30 cycles.

The BmFaldDH gene obtained by PCR and the pTrc99a plasmid vector were excised and recovered using an agarose gel recovery kit (purchased from Omega) and ligated by the Gibson enzyme ligation method under the conditions: 37 ℃ for 1 h. Transforming the connecting product into T1 competent cells by a 42 ℃ heat shock method, firstly placing T1 competent cells on ice, taking 10 mu L of the connecting product, carrying out ice bath for 10min, placing the connecting product in a 42 ℃ water bath kettle for heat shock for 90s, carrying out ice bath again for 2min, adding 600 mu L of non-resistant LB liquid culture medium, placing the connecting product in a 37 ℃ and 150r/min shaking culture for 60min, then centrifuging for 5min at 5000r/min, removing 400 mu L of supernatant, blowing and uniformly mixing, sucking 100 mu L of the supernatant, coating the mixture on an ampicillin-resistant LB plate, carrying out overnight culture, screening positive strains for amplification culture, selecting growing clones to carry out amplification culture in the ampicillin-resistant LB liquid culture medium, taking 4mL of bacterial liquid, extracting positive clone plasmid pTrc 99-BmFaldDH by using a plasmid miniprep (TIANGEN), and preserving the mixture in a refrigerator at 4 ℃ for later use.

Construction of pTrc99a-BmFaldDH-HPS + PHI vector:

the target gene was synthesized by a commercial gene synthesis service. Adding high fidelity enzyme into a PCR system by adopting a primer HPS + PHI-F (shown as SEQ ID No. 5) and a primer HPS + PHI-R (shown as SEQ ID No. 6) of the synthesized target genome DNA, amplifying to obtain an HPS + PHI gene (shown as SEQ ID No.10), carrying out PCR amplification on the constructed pTrc99a-BmFaldDH plasmid vector by adopting a primer pTrc99A-F-1 (shown as SEQ ID No. 7) and a primer pTrc99A-R-1 (shown as SEQ ID No. 8) by adopting the high fidelity enzyme to obtain a pTrc99a-BmFaldDH plasmid vector, wherein the PCR conditions are as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min, and 30 cycles.

The HPS + PHI gene obtained by PCR and pTrc99a-BmFaldDH plasmid vector were excised and recovered using an agarose gel recovery kit (purchased from Omega) and ligated by Gibson enzyme ligation under the conditions: 37 ℃ for 1 h. The ligation product is transformed into T1 competent cells by a heat shock method at 42 ℃, coated on an LB plate containing ampicillin resistance, cultured overnight, a positive strain is screened for amplification culture, grown clones are selected to be amplified and cultured in an LB liquid culture medium containing ampicillin resistance, 4mL of bacterial liquid is taken, plasmid pTrc99a-BmFaldDH-HPS + PHI is extracted by a plasmid miniextraction reagent (TIANGEN), and the plasmid is preserved in a refrigerator at 4 ℃ for later use.

Transformation of pTrc99a-BmFaldDH-HPS + PHI into E.coli MG 1655:

putting chemically competent Escherichia coli prepared by calcium chloride method on ice, taking 0.5 mu L of pTrc99a-BmFaldDH-HPS + PHI plasmid stored in a refrigerator at 4 ℃ for standby, carrying out ice bath for 10min, putting in a water bath kettle at 42 ℃ for heat shock for 90s, carrying out ice bath for 2min again, adding 600 mu L of non-resistant LB liquid culture medium, putting in 37 ℃ and 150r/min for shaking culture for 60min, then centrifuging for 5min at 5000r/min, discarding 400 mu L of supernatant, blowing and mixing uniformly again, sucking 100 mu L of non-resistant LB liquid culture medium, coating on an ampicillin-resistant LB plate, carrying out overnight culture, screening positive strains for amplification culture, selecting grown clones to 5mL of ampicillin-resistant LB liquid culture medium for amplification culture, extracting positive clone plasmids by using a plasmid miniextract reagent (TIANGEN) from 4mL, and sequencing and verifying.

4. Fermentation culture of transformed escherichia coli engineering strain and analysis of formic acid utilization condition

Screening and culturing the gene recombinant escherichia coli in a screening culture medium, and selecting a colony with good growth vigor to obtain a screening strain; carrying out amplification culture on the obtained screening strain in 3mL LB culture medium containing ampicillin resistance under the conditions of 37 ℃ and 220r/min of rotation speed for 12 hours to obtain seed liquid; inoculating the seed solution into 50mL LB culture medium containing ampicillin resistance according to a certain inoculation amount for amplification culture to obtain an amplification bacterial solution, and culturing in a strain OD ₆₀₀ Is equal to 0.5-0.6 (OD) ₆₀₀ Indicating the light absorption value of the solution at the wavelength of 600 nm), adding an inducer into the enlarged bacterial solution, carrying out induction culture for 12h at the temperature of 30 ℃ and the rotating speed of 150r/min, adding formic acid into the fermentation liquor, and selecting different intervals for sampling detection according to different final concentrations of the formic acid in the fermentation liquor;

HPLC detection results show that the reformed recombinant strain can completely utilize the formic acid with the concentration of 1g/L within 2 hours; when the final concentration of formic acid in the fermentation broth is 2g/L, the formic acid or formate can hardly be assimilated by E.coli without modification, and the recombinant bacteria can rapidly utilize and completely assimilate the formic acid or formate. The results of the experiment with a final concentration of formic acid of 2g/L are shown in FIG. 3.

The above description is only a preferred embodiment of the present invention, and therefore should not be taken as limiting the scope of the invention, which is defined by the appended claims and their equivalents.

Sequence listing

<110> university of Fujian profession

<120> recombinant strain and use and method thereof in utilizing formic acid or derivatives thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

agaccatgga attcaggagg atgagcagca atcgtggtgt 40

<210> 2

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gatccccggg taccgagctc ttaggcggcc agcaggccat 40

<210> 3

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggcctgct ggccgcctaa gagctcggta cccggggatc 40

<210> 4

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acaccacgat tgctgctcat cctcctgaat tccatggtct 40

<210> 5

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aggaggaatt aaccaggagg atggaactgc agctggcact 40

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttgcatgcct gcaggtcgac ttattccaga ttggcatgac 40

<210> 7

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtcatgccaa tctggaataa gtcgacctgc aggcatgcaa 40

<210> 8

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

agtgccagct gcagttccat cctcctggtt aattcctcct 40

<210> 9

<211> 1197

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atgagcagca atcgtggtgt tgtgtatctg ggtccgggta aagttgaagt gcagaaaatt 60

gattatccga aaatggtgga ccctagtggt cgcgcaattg gccatggtgt tattctgaaa 120

gtggtgagta ccaatatttg cggtagtgat cagcacatgg tgcgcggccg caccaccgca 180

cctgtgggtt tagtgctggg ccatgaaatt accggtgaag tggttgaagt gggtcgtgat 240

gttgaaaccc tgaaaattgg tgatctggtt agtgttccgt ttaatgtggc ctgcggtcgc 300

tgcgcaatgt gcaaagaaac ccataccggc gtgtgcctga atgtgaatcc gagtcgcgca 360

ggtggtgcct atggctatgt tgatatgggc ggttggattg gcggccaggc agaatatgtt 420

ctggtgccgt atgccgattt taatctgctg aaatttccgg atcgtgatca ggccatggcc 480

aaaattcgcg atctgacctg tctgagtgat attctgccga ccggctatca tggcgcagtg 540

agcgcaggtg tgaaaccggg cagcaccgtg tatattgcag gcgcaggtcc ggttggtatg 600

gcagcagccg caagtgcacg cctgctgggt gcagcagtta ccattgtggg cgatatgaat 660

gcagaacgtc tggcccatgc aaaagcaatg ggctttgaaa ccgtggatct gagcaaagat 720

gccaccctgg gtgaacagat tgcacagatt ctgggcaaac cggaaattga ttgcgccgtt 780

gattgtgttg gctttgaagc acatggtcat ggtagcagcg gccatgccga agaagcacct 840

gcaaccgttc tgaatagtct gatggaaatt acccgtccgg ccggcgcaat tggtattccg 900

ggtctgtatg tgaccgatga tccgggtgcc caggataaag ccgcacagca tggtagcctg 960

agtattcgct ttggtctggg ctgggccaaa agtcatagct tttttaccgg ccagacacct 1020

gtgctgaaat ataatcgtaa tctgatgcag gcaattctgt atgatcgtct gccgattgcc 1080

aaaattgtga atgttaccgt gattagtctg gatgatgcac cggaaggcta taaaaaattt 1140

gatggcggtg caccgcgtaa atttgtgatt gatccgcatg gcctgctggc cgcctaa 1197

<210> 10

<211> 1206

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atggaactgc agctggcact ggatctggtg aatattgaag aagcaaaaca ggttgtggcc 60

gaagtgcagg aatatgtgga tattgttgaa attggcacac ctgtgattaa aatttggggc 120

ctgcaggccg ttaaagccgt taaagatgca tttccgcatc tgcaggtgct ggcagatatg 180

aaaaccatgg atgcagcagc atacgaagtt gcaaaagccg cagaacatgg tgccgatatt 240

gttaccattc tggcagccgc cgaagatgtg agtattaaag gtgcagtgga agaagcaaag 300

aaactgggca aaaaaattct ggtggatatg attgccgtta aaaatctgga agaacgtgca 360

aaacaggtgg atgaaatggg tgttgattat atttgtgtgc atgccggtta tgatctgcag 420

gcagtgggca aaaatccgct ggatgatctg aaacgcatta aagccgtggt taaaaatgca 480

aaaaccgcca ttgccggtgg tattaaactg gaaaccctgc cggaagttat taaagccgaa 540

ccggatctgg ttattgtggg cggtggtatt gcaaatcaga ccgataaaaa agccgcagca 600

gaaaaaatta ataagctggt taaacagggc ctgtaaaagg agatgattag catgctgacc 660

accgaatttc tggcagaaat tgtgaaagaa ctgaatagca gcgtgaatca gattgccgat 720

gaagaagcag aagcactggt taatggtatt ctgcagagta aaaaagtgtt tgttgcaggt 780

gccggtcgta gcggctttat ggccaaaagt tttgcaatgc gtatgatgca catgggtatt 840

gatgcatacg ttgttggcga aaccgtgaca cctaattatg aaaaagaaga tattctgatc 900

atcggcagcg gtagcggcga aaccaaaagc ctggtgagta tggcccagaa agcaaaaagc 960

attggtggca ccattgccgc cgtgaccatt aatccggaaa gcaccattgg ccagctggcc 1020

gatattgtga ttaaaatgcc gggtagcccg aaagataaaa gtgaagcccg cgaaaccatt 1080

cagccgatgg gtagtctgtt tgaacagacc ctgctgctgt tttatgatgc agttattctg 1140

cgctttatgg aaaaaaaagg tctggatacc aaaaccatgt atggccgtca tgccaatctg 1200

gaataa 1206

Claims

1. A recombinant strain capable of utilizing formic acid or a derivative thereof, characterized in that: the recombinant strain is escherichia coli E.coli MG1655 which is transformed with BmFaldDH gene shown as SEQ ID No.9 and HPS + PHI gene shown as SEQ ID No. 10.

2. The recombinant strain of claim 1, wherein: the recombinant strain is prepared by the following method:

3. The recombinant strain of claim 2, wherein: in the step 1), a primer BmFaldDH-F shown as SEQ ID No.1 and a primer BmFaldDH-R shown as SEQ ID No.2 are adopted to amplify to obtain the BmFaldDH gene, and the BmFaldDH gene is used for connecting and transforming with the pTrc99a plasmid to obtain the plasmid pTrc99 a-BmFaldDH.

4. The recombinant strain of claim 2, wherein: in the step 1), a primer pTrc99A-F shown as SEQ ID No.3 and a primer pTrc99A-R shown as SEQ ID No.4 are adopted to amplify to obtain the pTrc99a plasmid, and the pTrc99a plasmid is used for connecting and transforming with the BmFaldDH gene to obtain the plasmid pTrc99 a-BmFaldDH.

5. The recombinant strain of claim 2, wherein: in the step 2), the HPS + PHI-F gene is obtained by amplification by using the primer HPS + PHI-F shown in SEQ ID No.5 and the primer HPS + PHI-R shown in SEQ ID No.6, and is used for connecting and transforming with the plasmid pTrc99a-BmFaldDH to obtain the plasmid pTrc99a-BmFaldDH-HPS + PHI.

6. The recombinant strain of claim 2, wherein: in the step 2), a primer pTrc99A-F-1 shown as SEQ ID No.7 and a primer pTrc99A-R-1 shown as SEQ ID No.8 are adopted for amplification to obtain the pTrc99a-BmFaldDH plasmid which is used for connection and transformation with the HPS + PHI gene to obtain the plasmid pTrc99a-BmFaldDH-HPS + PHI.

7. The recombinant strain of claim 2, wherein: in the step 3), the plasmid pTrc99a-BmFaldDH-HPS + PHI is transformed into the Escherichia coli E.coli MG1655 by a heat shock transformation method.

8. The recombinant strain of claim 2, wherein: the ligation of the BmFaldDH gene to the pTrc99a plasmid was performed in a Gibson seamless ligation manner; the ligation of the HPS + PHI gene to the plasmid pTrc99a-BmFaldDH was performed in a Gibson seamless ligation manner.

9. Use of a recombinant strain according to any one of claims 1 to 8 for the utilization of formic acid or a derivative thereof.

10. A method for assimilating formic acid or its derivative using the recombinant strain of any one of claims 1 to 8, characterized by: inoculating the recombinant strain into an LB culture medium containing ampicillin resistance, performing multi-stage amplification culture at 36-38 ℃ to obtain a bacterial liquid, adding an inducer, performing induction culture at 28-32 ℃, and mixing with formic acid or derivatives thereof, wherein the recombinant strain takes the formic acid or derivatives thereof as a carbon source for growth and metabolism, so as to realize assimilation of the formic acid or derivatives thereof.