CN115054693A

CN115054693A - Use of an NKG2D receptor-binding agent for the treatment or prevention of arthritis

Info

Publication number: CN115054693A
Application number: CN202210697074.XA
Authority: CN
Inventors: 周娟
Original assignee: Childrens Hospital of Chongqing Medical University
Current assignee: Childrens Hospital of Chongqing Medical University
Priority date: 2022-06-20
Filing date: 2022-06-20
Publication date: 2022-09-16

Abstract

The application relates to the technical field of cell therapy, in particular to a preparation combined with an NKG2D receptor, in particular to an application of the preparation combined with the NKG2D receptor in medicines for treating or preventing arthritis; the NKG2D is an activation receptor in the interaction process of DC cells and corresponding immune cells, inhibits the activation of NKG2D, reduces the number of NKG2D on the surface of leukocytes and reduces the intensity of inflammatory reaction.

Description

Use of an NKG2D receptor-binding agent for the treatment or prevention of arthritis

Technical Field

The application relates to the technical field of cell therapy, in particular to an agent binding to an NKG2D receptor, and specifically relates to application of the agent binding to the NKG2D receptor in medicines for treating or preventing arthritis.

Background

Juvenile Idiopathic Arthritis (JIA) is a chronic inflammatory disease with diverse clinical symptoms in onset and overall disease. CD4+ T cells play a powerful role in the initiation and spread process, leading to the recruitment of other immune cells, including innate and adaptive immune cells and the production of inflammatory cytokines, including specifically Tumor Necrosis Factor (TNF), Interleukin (IL) -6, IL-17, and Interferon (IFN) γ together, leading to chronic inflammation. Activation of CD4+ T cells relies on interaction with antigen presenting cells, requiring not only T cell receptor involvement, but also costimulatory signals.

Natural killer group 2 member D, NKG2D, is a c-type lectin-like receptor, is a broadly activating immuno-expression receptor that can detect Natural Killer (NK) cells and several T cells, including CD8+ T cells, γ δ T cells, and NKT cells, as well as CD4+ T cells in certain pathological conditions, such as viral infections, cancer, and autoimmune diseases (AID). It can be seen from the information disclosed in the prior art that NK cells have NKG 2D-dependent regulation in the inflammatory response of systemic JIA [ NKG2DSOJIA ]. Furthermore, NKG2D provides a costimulatory signal for the activation of CD4+ T cells, and NKG2D + CD4+ T cells are considered a novel subset of T lymphocytes in many aids diseases, such as rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, crohn's disease, and type 2 diabetes. These cells interact with NKG2D ligand, NKG2DL positive cells, such as synoviocytes, endothelial cells and epithelial cells, resulting in autoreactive T-cell stimulation and AID. To date, studies on NKG2D + CD4+ T cells in JIA are scarce, and biopharmaceuticals based on NKG2D + CD4+ T cells for the therapeutic and diagnostic class of specific diseases have not been described and developed.

Disclosure of Invention

The embodiments herein provide the use of an agent that binds the NKG2D receptor in a medicament for the treatment or prevention of arthritis, resulting in reduction of inflammation and elimination of symptoms for specific arthritis.

In order to achieve the above purpose, the embodiments of the present application employ the following technical solutions:

in a first aspect, the embodiments provide the use of an agent that binds the NKG2D receptor, said NKG2D being an activation receptor during interaction of DC cells with corresponding immune cells, inhibiting NKG2D activation, reducing the number of NKG2D on the surface of leukocytes, reducing the intensity of the inflammatory response, for use in a medicament for the treatment or prevention of arthritis, wherein the arthritis is juvenile idiopathic arthritis.

In alternative embodiments, the agent results in a reduction in ligand-induced activation of NKG 2D.

In alternative embodiments, the agent increases the rate of internalization of cell-surface NKG 2D.

In alternative embodiments, the agent reduces signal activation by the NKG2D-MIC ligand complex.

In alternative embodiments, the juvenile idiopathic arthritis includes juvenile oligoarticular arthritis, juvenile polyarticular idiopathic arthritis, and systemic juvenile idiopathic arthritis.

In alternative embodiments, the immune cell comprises any one of NKG2D + CD4+ T cells, NKG2D + CD8+ T cells, NKG2D + macrophages, NKG2D + NK cells, NKG2D + γ δ T cells.

In alternative embodiments, the immune cell is an NKG2D + CD4+ T cell.

In alternative embodiments, the formulation results in a reduction in the level of IL-15 produced by CD4+ T cells.

In alternative embodiments, the formulation results in a reduction of lymphocytes infiltrating the organ or tissue affected by the arthritis.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 is a comparative graph of a first experiment provided in an example of the present application;

FIG. 2 is a comparative graph of a second experiment provided in an example of the present application;

FIG. 3 is a comparative graph of a third experiment provided in the examples of the present application;

FIG. 4 is a comparative graph of a fourth experiment provided in the examples of the present application;

FIG. 5 is a comparison graph of a fifth experiment provided by the examples of the present application;

FIG. 6 is a comparative graph of a sixth experiment provided in the examples of the present application;

fig. 7 is a comparative graph of a seventh experiment provided in the examples of the present application.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

Cell isolation culture

Peripheral Blood Mononuclear Cells (PBMCs) are used for heparinizing blood, an attaching part derived from Ficoll mononuclear cells is separated, the attaching part is cultured in a Ross Well park memorial institute 1640, a method for stimulating cell maturation by 10% fetal bovine serum (fetal bovine serum) for 7 days and 50ng/ml human recombinant granulocyte macrophage colony stimulating factor, 20ng/ml human rIL4 and 25 ml hTNF-alpha for more than 2 days, and dendritic cells are analyzed by flow cytometry with some modified [ DC preparation ] maturation markers (CD80, CD86, CD83 and HLA-DR) [ DC surface markers ].

CD4+ T cells CD4+ T cells were isolated from PBMCs by magnetic separation using CD4+ T cell isolation kit (mertesil biotechnology) and cell purity was checked by flow cytometry. CD4+ T in purified 6X 105/m1 and DC cells in 2X 105/ml were co-cultured with 0.4 μm hyaline bacteria in 24-well plates on a PET membrane at 3: 1 for 3 days, in the range of 0.1ug/ml human anti-cd 3 and 20ng/ml units of human IL-15. The stimulated cells were irradiated with 25gy before co-incubation.

CD4+ T cells based on the modification of the NKG2D gene were constructed.

Constructing a lentivirus vector containing the NKG2D expression cassette.

The number of the synthetic gene of human NKG2D found in the NCBI website is: AF461811.1, and identifying positive recombinant clones by PCR amplification and sequencing, the specific PCR amplification method including the use of primer pairs, in this example, the normal phase primers of the primer pairs are: 5' AGGGTTCCAAGCTTAAGCGGCCGCGCCACCATGGGGTGGATTCGTG GTCGGAG-3, reverse primer: 5' TCAGTAGAGAGTGTCGGATCCTTACACAGTCCTTTGCATGCAGATGTA 3.

The fragment containing BamHI restriction enzyme and NotI restriction enzyme was inserted into 5 'and 3' ends and inserted into LV5-CMVp-GFP plasmid to digest the same enzyme vector production. Lentiviral vectors expressing GFP and NKG2D were combined by transient co-transfection of 293T cells with four plasmids including LV5, PG-P1-VSVG, PG-P2-REV, PG-P3-RRE.

According to ^TM RNAi designers design gene RNAi target sequences.

Against human NKG2D ^TM The RNAi designer NKG2D sequence (NCBIGeneBAnk: AF461811.1) designed three target sequences:

NKG 2D-siRNA-1: CATATTATTGGATGGGACTAGTACAtt, respectively; NKG 2D-siRNA-2: CCTCGAGCTTTAAAGGCTATATAGAtt, respectively; NKG 2D-siRNA-3: CAGCAAAGAGGACCAGGAUUUACtt, respectively; wherein the negative control: UUCUCCGAACGUGUCACGUtt are provided.

Sirna was transfected into 293T cells using liposome 2000 (seimer feishel science, usa). After 24h, total RNA was isolated using Trizol (Invitrogen, USA), reverse transcription-PCR was performed using RT-PCR system, and NK2D-siRNA was tested for effectiveness and selected higher among them. PCR was performed on the amplified cdna using NKG2D primers as forward 5 '-c-3' and reverse 5 '-c-3'. In this example, the size of the PCR product is 483bp, and the β -actin is used as a control. In this example, the PCR conditions were: 5min at 95 ℃; then enter the circle: 30s at 94 ℃, 30s at 62 ℃ and 1min at 72 ℃; running for 30 circles; then NKG2D-siRNA-3 with the highest effect is selected within 5 minutes at 72 ℃ to construct a lentiviral vector. 293FT cells were co-transfected with 4 plasmids pLVX-NKG2D-RNAi, PG-P1-VSVG, PG-P2, PG-P3-RRE to obtain lentiviral vectors. And (3) annealing the target sequence of the EcoRI and BamHI digested oligomeric DNA to form double-stranded DNA to construct a vector plasmid. Cells were cultured in Dulbecco's modified eagle medium containing 10% fetal bovine serum for 72 hours, and the supernatant was collected, followed by concentration collection and titration.

Purified CD4+ T cells were cultured in 1640 medium and stimulated with anti-CD 3 and anti-CD 28 mabs for 12 h. Following activation, lentiviral vectors encoding NKG2D, NKG2DsiRNA and blank control were added to CD4+ T cells with 100MOI in 24-well plates in the presence of polyalkene in 1x10, generating NKG2D gene modified and controlled CD4+ T cells. The cell and carrier mixture was centrifuged at room temperature for 180min (1000rpm) and then cultured in 1640 medium containing 10% fetal bovine serum for 72 h. Detecting the transfection efficiency by using the positive cell percentage, detecting the genetic modification efficiency by real-time quantitative RT-PCR, and carrying out functional analysis on the transfected cells.

Real-time quantitative PCR

Total rna was extracted from genetically modified or cultured cells using TRIzol reagent (Invitrogen, USA). cDNA was synthesized using RT kit (Qiagen, USA). The relative levels of NKG2D and transcription factors were determined using the SYBR green real-time quantitative reverse transcription-pcr kit (Qiagen, USA) and normalized with β -actin rna. The primer sequences for the genes of interest are listed in Table 1. In this example, the PCR process was 95 ℃ for 4 min; at 94 ℃ for 20 seconds, at 60 ℃ for 30 seconds and at 70 ℃ for 30 seconds, for a total of 35 cycles.

TABLE 1 primer sequences for genes of interest.

Flow cytometry

PBMCs were treated in suspension at a density of 1X 106 cells/mL, stained on the surface with 5. mu.L PE-anti-hCD4, FITTi-hNKG 2D and isotype control in PBS containing 2% fetal bovine serum, and washed twice for CD4+ NKG2D + T cells. After co-culture, 1 × 106 cells/mL unit of CD4+ T cells were surface stained with apc-anti-hCD 25 at 4C for 30min, followed by permeabilization by cell fixation (BD pharmaceutical, usa) and 20 μ L of anti-human Foxp3PE stained in 4C dark for 30 min. Then washed for CD25+ Foxp3+ T cell experiments.

In an intracellular cytokine assay, 1 × 106 cells, with 500ng/mL as the unit; CD4+ T cells were stimulated with ionomycin (1. mu.M) in 50ng/ml units, treated with 5% carbon dioxide for 5 hours, then treated with cell fixation/cell membrane permeabilization, and 20. mu.L of anti-human IFN-. gamma. -PE, anti-human IL4-PE, and anti-human IL17PE were stained in 4C dark for 30 min. Isotype controls were used to achieve the correct compensation and to confirm the specificity of the antibody.

Dendritic cells were analyzed by flow cytometry for expression of NKG2D ligands of Major Histocompatibility Complex (MHC) class i chain associated (MIC) a and MICB in dendritic cells. Dendritic cells were stimulated with 20ng/ml hIL-15 for 24 hours, then 5. mu.l PE-AntihMICB or PE-Anti-hMICB antibody and appropriately matched isotype control were added to 1X 106 dendritic cells, incubated at 4 ℃ for 30min, and then washed with flow cytometry for analysis. All antibodies and isotype controls were purchased from the american electronic biosciences company. Fluorescence Activated Cell Sorting (FACS) was performed using a BDLSR-II flow cytometer (BD biosciences, usa) and data analysis was performed using FlowJo software.

ELISA detection of cytokines and NKG2D ligands

Specific arthritic patients and blood control sera were assayed for soluble mica (smica) and soluble micb (smicb) using ELISA kits (R & D system, USA). After cell culture, supernatants were collected and tested for TGF-. beta.IL-10, IL-12p70 using an ELISA kit (Bio Egypt, USA). Background values were also analyzed as control values. The optical density was read at 450nm and the concentration of cytokine in each sample was determined according to a standard curve.

Based on the above treatments, the results were demonstrated that NKG2D + CD4+ T cells were activated in different subgroups of juvenile idiopathic arthritis patients.

The level of NKG2D + CD4+ T cells in PBMCs of children in JIA activity stage and healthy control children is detected by a flow cytometry method, the level of NKG2D + CD4+ T cells in the children in JIA activity stage is obviously increased (P is less than 0.01) compared with that of the healthy control in the children in JIA activity stage, and the level of NKG2D + CD4+ T cells in the PBMCs of the children in JIA activity stage is further increased after the children in JIA activity stage are cultured for 6 hours in 1640 culture medium containing 15ng/ml of human recombinant IL-15. It is indicated that NKG2D + CD4+ T cells are important immunocompetent cells of JIA children. IL-15 is an important activator of NKG2D and promotes the expression of NKG2D by CD4+ T cells.

The condition that the mononuclear cells (CD14+ cells) of peripheral blood antigen presenting cells of children with JIA activity and healthy control children express the NKG2D ligand MIC is detected by a flow cytometry method, and the condition that the MIC of the children with JIA activity is obviously increased in the mononuclear cells (P is less than 0.01) compared with the healthy control can be seen by referring to fig. 3 and 4, which indicates that the NKG2D ligand is obviously increased in the JIA activity, and indicates that the children with the JIA have the NKG2D-MIC signal activation.

Through flow cytometry detection of peripheral blood Treg cells and Th17 cell levels of JIA children in active stage and remission stage and healthy control children, it can be seen that the proportion of peripheral blood CD4+ CD25+ FOXP3+ cells of JIA children is reduced compared with that of healthy controls, the active stage is reduced more obviously, and the difference is statistically significant (P is less than 0.05). Meanwhile, the ratio of CD4+ IL-17+ cells in peripheral blood is detected by flow cytometry, and the ratio of the cells in the JIA children is obviously higher than that in a healthy control as can be found by referring to fig. 5 and 6. Indicating that the imbalance of Th17/Treg cell function is involved in JIA pathogenesis. In addition, after NKG2D activator human recombinant IL-15(15ng/ml) is used for stimulating PBMC of children patients with JIA activity for 6h, the proportion of CD4+ IL-17+ cells is obviously increased, which shows that the IL-17 secretion and Th17 subgroup proportion of the children patients with JIA are increased through the activation of NKG2D by IL-15.

Peripheral blood NK (natural killer) cells of children with the type of Whole JIA, the type of short joint and the type of multiple joints and healthy control children are detected to secrete cytokines by flow cytometry, the characteristics of cytokines produced by different subtypes are different, referring to fig. 7, compared with the type of whole JIA (systemic JIA), the type of short joint (Pauciannular JIA) and the type of multiple joints (polyarticular JIA), the type of whole JIA secretes IFN-gamma which is higher and the level of secreted TNF is relatively low, but IFN-gamma and TNF-alpha produced by each subtype are both higher than those produced by the healthy control, and the difference has statistical significance (P < 0.05). Thus, different clinical subtypes of JIA secrete different cytokines and have different immunological characteristics.

The present invention relates to pharmaceutical formulations comprising binding to NKG2D, further comprising one or more pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers include any and all suitable solvents, dispersion vehicles, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, which are physiologically compatible with the NKG2D modulators or related compositions or combinations provided herein. Examples of pharmaceutically acceptable carriers include one or more of the following: water, saline, phosphate buffered saline, dextrose, glycerol, and ethanol, and the like, and combinations thereof. In many instances, it may be desirable to include isotonic agents, for example, sugars, polyols such as mannitol or sorbitol, or sodium chloride in the composition. Pharmaceutically acceptable substances may also be minor auxiliary substances, such as wetting or emulsifying agents, preservatives or buffers, which are preferably capable of improving the longevity or effectiveness of the NKG2D receptor-binding formulations and related compositions. Suitable carriers and other ingredients for pharmaceutical compositions are determined by the lack of significant negative impact on the primary relative composition, or the desired biological properties of the combination, to which the NKG2D receptor binds.

The NKG2D receptor-binding formulation compositions or related compositions of the invention may be in a variety of suitable forms. Such forms include, for example, liquid, semi-solid, and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, emulsions, microemulsions, tablets, pills, powders, liposomes, dendrimers and other nanoparticles, microparticles, and suppositories. The optimal form depends on the intended mode of administration, the nature of the composition or combination, and the therapeutic use. Formulations also include, for example, powders, pastes, ointments, gels, waxes, oils, lipids, vesicles containing lipids (cationic or anionic), DNA conjugates, anhydrous absorbent pastes, oil-in-water and water-in-oil emulsions, emulsion carbowaxes (polyethylene glycols of various molecular weights), semi-solid gels, and semi-solid mixtures containing carbowaxes. Any of the above mixtures are suitable for use in the treatment and methods of treatment of the present invention, provided that the active ingredients in the formulation are not inactivated by the formulation, and the formulation is physiologically compatible and tolerable with the route of administration.

Formulation compositions that bind the NKG2D receptor also include compositions comprising any suitable combination of a peptide that binds the NKG2D receptor and a suitable salt thereof. Any suitable salt, such as an alkaline earth metal salt in any suitable form (e.g., a buffer salt), can be used to stabilize the formulation that binds the NKG2D receptor. Suitable salts generally include sodium chloride, sodium succinate, sodium sulfate, potassium chloride, magnesium sulfate, and calcium chloride. Also provided are compositions comprising a base and an agent that binds the NKG2D receptor.

Claims

1. Use of an agent that binds the NKG2D receptor, said NKG2D being an activation receptor during interaction of DC cells with corresponding immune cells, inhibiting NKG2D activation, reducing the number of NKG2D on the surface of leukocytes, reducing the intensity of inflammatory responses, for use in a medicament for treating or preventing arthritis, which is juvenile idiopathic arthritis.

2. The use of claim 1, wherein said agent results in a reduction in ligand-induced activation of NKG 2D.

3. The use of claim 1, wherein said agent increases the rate of internalization of cell-surface NKG 2D.

4. The use of claim 1, wherein the agent reduces signal activation by the NKG2D-MIC ligand complex.

5. The use according to claim 1, wherein said juvenile idiopathic arthritis comprises juvenile oligoarticular arthritis, juvenile polyarticular idiopathic arthritis and systemic juvenile idiopathic arthritis.

6. The use according to claim 1, wherein said immune cells comprise any one of the group consisting of NKG2D + CD4+ T cells, NKG2D + CD8+ T cells, NKG2D + macrophages, NKG2D + NK cells, NKG2D + γ δ T cells.

7. The use of claim 6, wherein said immune cells are NKG2D + CD4+ T cells.

8. Use according to claim 7, characterized in that said preparation results in a reduction in the level of IL-15 produced by CD4+ T cells.

9. The use according to claim 1, wherein said preparation results in a reduction of lymphocytes infiltrating the organ or tissue affected by said arthritis.