CN115044596A

CN115044596A - Method for visually detecting target protein expression and purification by using blue algae ferredoxin Fd

Info

Publication number: CN115044596A
Application number: CN202210715402.4A
Authority: CN
Inventors: 韦佩君; 李西莹; 董春霞; 赵进东
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2022-06-23
Filing date: 2022-06-23
Publication date: 2022-09-13

Abstract

The invention discloses a method for visually detecting target protein expression and purification by using cyanobacteria ferredoxin Fd. Firstly, constructing a fusion gene of a target protein gene and a blue-green algae Fd gene or a homologous gene thereof, transferring an expression vector containing the fusion gene into an expression strain for expression, judging whether the fusion protein is successfully expressed and/or purified by observing the color of a supernatant and/or a purified component of the crushed expression bacterial liquid, and if the supernatant and/or the purified component is brownish red, indicating that the target protein and the blue-green algae Fd protein or the homologous protein thereof are expressed and/or purified together. The method realizes visual detection of target protein expression and purification, has high accuracy, is convenient and quick, and greatly saves the time for verifying the successful expression and purification of the target protein by a conventional method.

Description

Method for visually detecting target protein expression and purification by using blue algae ferredoxin Fd

Technical Field

The invention relates to a method for visually detecting target protein expression and purification, in particular to a method for visually detecting target protein expression and purification by using a protein (ferredoxin Fd) which shows brownish red color in blue-green algae.

Background

Fd (ferredoxin), a soluble iron sulfur protein widely distributed in bacteria, algae and higher plants, has a molecular weight of about 10 KD. Having three types of iron-sulfur centers [2Fe-2S ]]、[3Fe-4S]、[4Fe-4S]Can be used as an electron carrier to transfer electrons. Fd protein is closely related to photosynthesis, and it can transfer electrons to Fd-NADP ⁺ Oxidase (FNR) catalyzes the production of NADPH, and can participate in cyclic electron transfer via the PGR5-PGRL1 and NDH complex. There are many copies of Fd gene in cyanobacteria, for example, there are 9 Fd genes in Nostoc sp.pcc 7120 (hereinafter abbreviated as nosoc 7120), which encode 9 different ferredoxins, and these Fd proteins are conserved in cyanobacteria such as Synechocystis, Cylindrospermum, Anabaena, etc., wherein Fd1 protein is abundant in plants and algae and is ferredoxin necessary for photosynthesis. The iron-sulfur center is the redox center of Fd protein, wherein Fe atom is easy to be oxidized in air to present red brown, and blue algae Fd protein which is expressed in Escherichia coli in a recombination way presents red brown due to the oxidation state.

The expression and purification of target protein in prokaryotic system is an important tool in molecular biology research and biotechnology industrialization development process, is the basis of research on the function and property of target protein, and promotes the rapid development of modern biology science. In each version of the molecular biology experimental guideline, the basic flow of expression and purification of the target protein is as follows: 1. cloning a target gene into a proper expression vector and then introducing the target gene into a prokaryotic cell expression system strain; 2. inducing the expression strain to express the target protein; 3. through fusion tags carried by the target protein, such as His, GST and the like, column materials with different properties are selected to separate the target protein from other proteins, thereby achieving the purpose of protein purification.

However, whether the target protein is expressed or not is detected by small-amount induction or whether the purified target protein is obtained through column chromatography is detected finally, the expression and purification of the target protein are detected by a method of performing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a protein sample and then staining the protein. SDS-PAGE detects the protein sample and needs to make a sample of the protein sample, dispose polyacrylamide gel, then carry on the protein electrophoresis, can know whether the protein of interest has already expressed or purified after dyeing and decolorizing the protein finally, these detection processes are accumulated for 3-4 hours, waste time and energy. In 2017, researchers have proposed a method for rapidly detecting the expression and purification of a target protein by using yellow FNR (ferredoxin reductase) protein as an indication label, but because the supernatant obtained after the escherichia coli liquid is crushed and centrifuged is faint yellow, if the concentration of the expression protein is low, the supernatant obtained after the fusion protein expression liquid with the FNR label is crushed may also be faint yellow, and at the moment, it is difficult to visually judge whether the target protein is successfully expressed and purified. In addition, since it is difficult to define the difference between yellow and pale yellow, it is troublesome to consider the purification with no-load expression vector without FNR tag as a control for each protein purification.

Disclosure of Invention

The invention aims to provide a method for visually detecting target protein expression and purification in real time, which is used for solving the technical problems that the conventional in-vitro expressed and purified target protein needs to be detected by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), so that the operation is complex, the time consumption is long, the real-time visual detection cannot be carried out along with the purification process, and the conventional indication label (such as FNR protein) is difficult to identify in color and low in sensitivity. The invention provides a convenient and visual method for detecting the expression and purification of target protein by fusion expression of the target protein and blue algae colored protein.

In order to solve the technical problems, the target protein and the blue algae ferredoxin Fd or homologous protein thereof are subjected to fusion expression, and the Fd protein is combined with an iron atom and is brownish red, so that the whole fusion protein is also brownish red. Whether the target protein is successfully expressed and/or purified can be judged by observing the color of the fusion protein, so that a convenient method for intuitively detecting the expression and purification of the target protein in real time is constructed. Specifically, the technical scheme of the invention is as follows:

a method for visually detecting the expression and purification of a target protein comprises the steps of constructing a fusion gene expression vector of the target protein gene and a blue-green algae Fd gene or a homologous gene thereof, transferring the fusion gene expression vector into an expression strain for expression, judging whether the fusion protein is successfully expressed and/or purified by observing the color of a supernatant and/or a purified component of the supernatant after crushing an expression bacterial liquid, and indicating that the target protein and the blue-green algae Fd protein or the homologous protein thereof are expressed and/or purified together if the supernatant and/or the purified component thereof is brownish red.

Further, in the process of column purification of the expressed fusion protein, whether the target protein is bound to the column material can be judged by observing whether the column material becomes brownish red.

In the above method, the cyanobacteria Fd gene or its homologous gene encodes ferredoxin having a [2Fe-2S ] iron sulfur center that confers absorption properties to Fd protein in the visible range, so that Fd solution appears reddish-brown in the oxidized state.

The blue algae Fd gene is preferably a blue algae Fd1 gene, the number of the blue algae Fd1 gene is all4148 in Nostoc 7120 of Nostoc, and the encoded protein is Fd 1. The amino acid sequence of Fd1 protein in Nostoc 7120 is shown as SEQ ID No. 1 in the sequence table, and consists of 99 amino acids, and is noteworthy that the Fd1 protein has four conserved cysteine (Cys, C) sites: the four cysteine residues are combined with an oxidation-reduction center [2Fe-2S ] of Fd1 protein, are important for the Fd1 protein to play an electron transfer function, and are also key for ensuring that the [2Fe-2S ] iron-sulfur center can be stably combined to enable the protein to develop color. Correspondingly, the fd1 gene sequence is shown as SEQ ID No. 2 in the sequence table, and in addition, other DNA molecules which are homologous with the nucleotide sequence shown as SEQ ID No. 2 and encode the same amino acid sequence can also be used for constructing the fusion protein of the invention due to the degeneracy of codons.

The Fd1 protein is well conserved in blue-green algae, except Nostoc 7120 of Nostoc, other blue-green algae also have homologous genes corresponding to the Fd1, such as Ava _0756 gene in the Trichormus variabilis ATCC 29413, the similarity of nucleotide sequences reaches 94.4%, and the similarity of amino acid sequences of encoded proteins reaches 94.95%; for example, the gene ssl0020 in Synechocystis sp.PCC 6803 has the nucleotide sequence similarity of 75 percent and the amino acid sequence similarity of the coded protein reaches 73.74 percent; for example, the gene SYNPCC7002_ A2326 in Synechococcus sp.PCC 7002 has 73.3 percent of nucleotide sequence similarity and 73.74 percent of amino acid sequence similarity of the encoded protein. DNA molecules which have homology with any one of the genes and encode the same amino acid sequence can also be applied to the method for visually detecting the expression and purification of the target protein.

The fusion gene of the blue algae fd gene or the homologous gene and the target protein gene is expressed under the drive of a promoter, wherein the promoter can be a constitutive promoter or an inducible promoter, such as an inducible promoter consisting of a T7 promoter and a lac operator.

In order to facilitate purification of the fusion protein, a His tag may be further attached to the N-terminus or C-terminus of the fusion protein, so that the fusion protein may be purified using a Ni affinity chromatography column. Accordingly, in constructing the fusion protein gene, a coding sequence of His tag is ligated to the 5 'end or 3' end thereof.

Further, a coding sequence of a thrombin cleavage site may be inserted between the Fd gene or its homologous gene and the target gene, and the Fd or its homologous protein may be cleaved from the target protein by thrombin after purification of the fusion protein.

The invention also provides an expression cassette for intuitively detecting the expression and purification of the target protein, which comprises a promoter, the blue algae fd gene or homologous gene thereof, a Multiple Cloning Site (MCS) and a terminator, wherein the multiple cloning site is used for inserting the target gene, and the inserted target gene and the blue algae fd gene or the homologous gene thereof are in the same reading frame.

Further, the expression cassette also comprises a coding sequence of a thrombin (thrombin) enzyme cutting site, wherein the coding sequence of the thrombin enzyme cutting site is positioned between the blue algae fd gene or the homologous gene thereof and the multiple cloning site.

Preferably, the expression cassette is also connected with a polynucleotide sequence for coding a His tag at the upstream of the blue algae Fd gene or homologous gene thereof, and expresses the Fd protein with the His tag or the homologous protein thereof.

Further, the expression cassette also has an operator, such as the lac operator, that controls inducible expression.

In one embodiment of the invention, an expression cassette is constructed, which comprises an inducible expression element (T7 promoter + lac operator), a cyanobacteria fd gene with a His tag coding sequence or a homologous gene thereof (6 x His-fd gene), a coding sequence of a thrombin cleavage site, a multiple cloning site (containing Nde I and BamH I cleavage sites for inserting foreign genes), and an expression terminator (T7 terminator) from upstream to downstream. The gene X of the target protein X can be connected between Nde I and BamH I enzyme cutting sites of the expression cassette by enzyme cutting connection to form the fd-X fusion protein gene. And (2) constructing the expression cassette on an expression vector, then transferring the expression vector into an expression strain for induced expression, and detecting whether the target protein X is expressed or not by observing whether the color of a supernatant fluid is brownish red after the expression bacterial liquid is crushed. Filtering the brownish red supernatant through a 0.45 mu m filter membrane, purifying the 6 XHis-Fd-thrombin-X fusion protein by using a nickel column, wherein the column material is brownish red, which indicates that the protein X is expressed and combined with the column material, then performing enzyme digestion by using thrombin, wherein the target protein X exists in eluent after elution, and the 6 XHis-Fd remains on the column material, thus obtaining the purified target protein X.

Vectors (including intermediate vectors and expression vectors) and host cells containing the expression cassette are all within the scope of the present invention.

The method utilizes the fusion and the common expression of the cyanobacteria ferredoxin Fd or the homologous protein thereof and the target protein, judges whether the target protein is expressed or not by detecting whether the color of the supernatant is brownish red after the crushing of the expression bacterial liquid, and can detect whether the column material of the purified protein is brownish red or not to detect whether the target protein is combined on the column material, thereby realizing the visual detection of the expression and the purification of the target protein, being convenient and quick, and greatly saving the time for the successful expression and the purification of the target protein by the conventional verification. And the brownish red bacterial liquid successfully expressing the fusion protein has quite distinct color difference with the faint yellow bacterial liquid which does not successfully express the fusion protein, the observation accuracy is high, and whether the target protein is successfully expressed or not can be quickly and intuitively judged.

Drawings

FIG. 1 is a schematic diagram of construction of the intermediate vector 15b-Fd (A) and the expression vector 15b-Fd-x (B) in example 1, and a schematic diagram (C) of purification of a target protein from a fusion protein of Fd and the target protein.

FIG. 2 is a picture (A) of the supernatant of a crushed expression bacterial solution containing pet-15B control plasmid and a picture (B) of the supernatant of a crushed expression bacterial solution containing 15B-fd-ccbp expression vector, wherein the supernatant of the bacterial solution A is in common light yellow, and the supernatant of the bacterial solution B is in obvious brownish red.

FIG. 3 is a picture (A) of a crushed expression bacterial liquid containing pet-15B control plasmid and a picture (B) of a crushed expression bacterial liquid containing 15B-fd-ccbp expression vector and a crushed supernatant through a nickel column, wherein the nickel column material of A has a constant color and is light blue, and the nickel column material of B has a brownish red color.

FIG. 4 is an SDS-PAGE pattern after sampling each step of purifying a target protein in example 2 of the present invention.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Coli strains DH5 alpha and BL21(DE3) used in the experiments were purchased from Beijing Okinawa Kabushiki Kaisha, cultured in a conventional LB medium, and selected to grow with an antibiotic concentration of 100. mu.g/mL Amp ⁺ . The original plasmid pet-15b used in the experiment was purchased from a commercial biotech company. Cloning of vectors and expression purification of proteins see molecular biology guidelines.

Example 1: construction of integration vector and screening of Positive Strain

(1) Construction of intermediate vector 15b-fd

The construction process of the intermediate vector 15b-Fd is shown in FIG. 1A, wherein T7 promoter and lac operator constitute inducible expression elements (T7 promoter + lac operator), and His-tag can make Fd protein expressed by Fd gene carry histidine tag. Thrombin represents a Thrombin cleavage site, and is designed to be used for cleaving Fd in the fusion protein and the target protein by using Thrombin after the fusion protein is combined with a column material, so that the purified target protein can be obtained by eluting from a nickel column. The NdeI and BamHI enzyme cutting sites are multiple cloning sites, and a target gene (namely the gene x) can be connected into an intermediate vector through the enzyme cutting sites so as to be expressed. The elements T7 promoter, lac operator, His Tag, thrombomin, multiple cloning site and T7terminator in FIG. 1A were PCR derived from the pet-15b plasmid. A fragment containing all the components 15b-1 of 15b-fd except for the fd gene was amplified using the primer pair P1/P2 and pet-15b plasmid as a template. The fd1 gene was amplified by primer pair P3/P4 using the total genomic DNA of Nostoc 7120 of Nostoc, a wild type Nostoc, as a template, to obtain the fd1 fragment. The 15b-1 fragment and the fd1 fragment were then ligated together using the seamless ligation Kit (pEASY-Universal Cloning and Assembly Kit) from Kyoto Kanji to obtain the intermediate vector 15 b-fd.

(2) Construction of expression vector 15b-fd-x

The coding gene X of the target protein X is connected between NdeI and BamHI enzyme cutting sites of the intermediate vector to form an expression vector 15b-fd-X of the target protein X.

Example 2: detection of feasibility of the invention Using Ccbp protein as protein of interest

(1) Construction of expression vector 15b-fd-ccbp

The construction scheme of 15B-fd-ccbp is shown in B in FIG. 1. The Ccbp is a calcium ion binding protein in the blue algae, and has an important effect on the formation of the format of the blue algae, and the embodiment adopts the Ccbp protein as a target protein to test the feasibility of the invention. The wild Nostoc 7120 genome total DNA is used as a template, a ccbp gene is amplified by using a primer pair P5/P6, and then an expression vector 15b-fd-ccbp is obtained by enzyme digestion of Nde I and BamH I and ligation into an intermediate vector 15 b-fd.

(2) Visual detection of Ccbp protein expression

Because the 6 XHis-Fd-thrombin-Ccbp fusion protein is reddish brown, the color change of the supernatant after the crushing of the expression bacterial solution can be used for directly detecting whether the target protein is fused and expressed. Transferring the expression vector 15B-fd-ccbp into an escherichia coli expression strain BL21(DE3), adding 0.5mM IPTG to induce expression for 16h at the temperature of 18 ℃, taking a bacterial solution, crushing the bacterial solution for 3 times by using a cell crusher JNBIO N-mini under the pressure of 1000bar, centrifuging for 30min at 18,000rpm after crushing, and observing the supernatant of the crushed bacterial solution, wherein the supernatant of the bacterial solution is brownish red as shown in B in figure 2. In FIG. 2, A is the color of the supernatant obtained after disruption of the plasmid-expressing bacterial fluid containing pet-15b alone, and is seen as a normal pale yellow color. Comparing a and B in fig. 2, we can verify that: if the expression vector is transferred into an expression strain, after induction expression, the supernatant of the crushed bacterial liquid presents a brownish red color, and the target protein can be visually judged to be expressed.

(3) Purification of Ccbp protein by visual detection

Whether the target protein is combined with the column material can be detected by visually detecting whether the color of the column material turns brown red, so that the purification is convenient. After confirming that the protein of interest has been successfully expressed, we purified the 6 XHis-Fd-thrombin-Ccbp fusion protein using a nickel column. Since the 6 XHis-Fd-thrombin-Ccbp fusion protein was reddish brown, the purified nickel column was dark reddish brown as indicated by the arrow B in FIG. 3, indicating that the protein Ccbp had bound to the nickel column. And the arrow A in FIG. 3 indicates the color of the column material after the supernatant fluid containing only the crushed pet-15b plasmid flows through the column material, and the color of the nickel column material is unchanged and still light blue. Comparing A and B in FIG. 3, we can visually check whether the target protein has bound to the column material by observing the color change of the column material, and prepare for the next step of purifying the target protein.

(4) Purification of the target protein Ccbp

Since we expressed the 6 XHis-Fd-thrombin-Ccbp fusion protein by the expression vector, we also needed to purify the homozygous Ccbp target protein by the steps shown in FIG. 1C. After the column material is digested with thrombin at normal temperature for 2h, the liquid eluted by the eluent is the purified Ccbp target protein. The 6 XHis-Fd protein remained on the nickel column. FIG. 4 shows an SDS-PAGE pattern of the protein of interest that we purified by the procedure shown in FIG. 1C. Fd-Ccbp represents a sample prepared by a column material before enzyme digestion, and a protein band with the size of 27KD can be presumed to be 6 XHis-Fd-thrombin-Ccbp fusion protein; ccbp is a sample prepared from an eluent, and a protein band with the size of 17KD can be presumed to be Ccbp protein, and the presumption is verified by mass spectrometry. As shown in FIG. 4, the Fd-Ccbp sample and the Ccbp sample both had bands of about 23kD, and the mass spectrometry results showed that they were cAMP-activated viral transcriptional regulator (CRP) which is a protein in Escherichia coli and may be caused by the purification process. Therefore, through the steps shown in fig. 1C, we can not only visually detect the expression and purification process of the target protein, but also remove the 6 × His-Fd tag through thrombin cleavage, thereby obtaining the pure target protein.

TABLE 1 primer sequences used in the present invention

Primer and method for producing the same	DNA Sequence (5 '-3')	Number in sequence listing
			P1	acaaagaagaagacctctacagcagcggcctggtgccgcg	SEQ ID No:3
P2	aatgtaactttaaaggttgcgtgatgatgatgatgatggc	SEQ ID No:4
			P3	gccatcatcatcatcatcacgcaacctttaaagttacatt	SEQ ID No:5
P4	cgcggcaccaggccgctgctgtagaggtcttcttctttgt	SEQ ID No:6
			P5	catatggccagtgtagaacgcga	SEQ ID No:7
P6	ggatcctaaaatttgtatcccctag	SEQ ID No:8

SEQUENCE LISTING

<110> Beijing university

<120> method for visually detecting target protein expression and purification by using cyanobacteria ferredoxin Fd

<130> WX2022-03-122

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 99

<212> PRT

<213> Nostoc sp. PCC 7120

<400> 1

Met Ala Thr Phe Lys Val Thr Leu Ile Asn Glu Ala Glu Gly Thr Lys

1 5 10 15

His Glu Ile Glu Val Pro Asp Asp Glu Tyr Ile Leu Asp Ala Ala Glu

20 25 30

Glu Gln Gly Tyr Asp Leu Pro Phe Ser Cys Arg Ala Gly Ala Cys Ser

35 40 45

Thr Cys Ala Gly Lys Leu Val Ser Gly Thr Val Asp Gln Ser Asp Gln

50 55 60

Ser Phe Leu Asp Asp Asp Gln Ile Glu Ala Gly Tyr Val Leu Thr Cys

65 70 75 80

Val Ala Tyr Pro Thr Ser Asp Val Val Ile Gln Thr His Lys Glu Glu

85 90 95

Asp Leu Tyr

<210> 2

<211> 300

<212> DNA

<213> Nostoc sp. PCC 7120

<400> 2

atggcaacct ttaaagttac attgatcaac gaagctgaag gaacaaagca tgaaattgaa 60

gttcctgatg atgagtatat tttagacgct gccgaagaac agggttatga cctacccttt 120

tcctgtcggg ctggtgcttg ctcaacctgc gccggtaaac tagtatctgg tactgttgac 180

caatctgacc aatcattctt ggatgacgat caaatcgaag ctggatacgt attgacctgt 240

gttgcttatc caacttctga tgtagtcatc caaacccaca aagaagaaga cctctactaa 300

<210> 3

<211> 40

<212> DNA

<213> Artificial sequence

<400> 3

acaaagaaga agacctctac agcagcggcc tggtgccgcg 40

<210> 4

<211> 40

<212> DNA

<213> Artificial sequence

<400> 4

aatgtaactt taaaggttgc gtgatgatga tgatgatggc 40

<210> 5

<211> 40

<212> DNA

<213> Artificial sequence

<400> 5

gccatcatca tcatcatcac gcaaccttta aagttacatt 40

<210> 6

<211> 40

<212> DNA

<213> Artificial sequence

<400> 6

cgcggcacca ggccgctgct gtagaggtct tcttctttgt 40

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence

<400> 7

catatggcca gtgtagaacg cga 23

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence

<400> 8

ggatcctaaa atttgtatcc cctag 25

Claims

1. A method for visually detecting the expression and purification of a target protein comprises the steps of constructing a fusion gene of the target protein gene and a blue-green algae Fd gene or a homologous gene thereof, transferring an expression vector containing the fusion gene into an expression strain for expression, judging whether the fusion protein is successfully expressed and/or purified by observing the color of a supernatant and/or a purified component of the crushed expression bacterial liquid, and indicating that the target protein and the blue-green algae Fd protein or the homologous protein thereof are expressed and/or purified together if the supernatant and/or the purified component is brownish red.

2. The method of claim 1, wherein the blue algae fd gene is a DNA molecule encoding an amino acid sequence shown as SEQ ID No. 1 in the sequence Listing.

3. The method of claim 2, wherein the nucleotide sequence of the blue algae fd gene is shown as SEQ ID No. 2 in the sequence table.

4. The method of claim 1, wherein the cyanobacteria fd gene or homologous gene thereof is selected from one of the following genes: all4148 gene in Nostoc sp.pcc 7120, Ava _0756 gene in trichomonas varilabilis ATCC 29413, ssl0020 gene in synechocystis sp.pcc 6803, SYNPCC7002_ a2326 gene in Synechococcus sp.pcc 7002; or a DNA molecule encoding the same amino acid sequence as one of the above genes.

5. The method of claim 1, wherein a His-tag is attached to the N-terminus or C-terminus of the fusion protein; and/or inserting a coding sequence of a thrombin enzyme cutting site between the blue algae fd gene or the homologous gene thereof and the target protein gene.

6. The method of claim 1, wherein whether the protein of interest binds to the column material is determined by observing whether the column material turns a brownish red color during column purification of the expressed fusion protein.

7. The method of any one of claims 1 to 6, wherein the method is carried out by constructing an expression cassette for visually detecting the expression and purification of the target protein, wherein the expression cassette comprises a promoter, the blue algae fd gene or homologous gene thereof, a multiple cloning site and a terminator, wherein the multiple cloning site is used for inserting the target gene, and the inserted target gene and the blue algae fd gene or homologous gene thereof are in the same reading frame.

8. The method of claim 7, wherein the expression cassette comprises, in order: inducible expression element composed of T7 promoter and lac operator, blue algae fd gene with His label coding sequence or its homologous gene, coding sequence of thrombin cutting site, multiple cloning site and T7 terminator.

9. The method of claim 8, wherein the gene X for the protein X of interest is ligated into the multiple cloning site of an expression cassette to form an fd-X fusion protein gene; constructing the expression cassette on an expression vector, then transferring the expression vector into an expression strain for induced expression, and detecting whether the target protein X is expressed or not by observing whether the color of a supernatant is brownish red after the expression bacterial liquid is crushed; purifying the fusion protein with the supernatant of the brownish red by using a nickel column, wherein if the column material is brownish red, the protein X is expressed and combined with the column material; then, the mixture is digested by thrombin, the target protein X exists in an eluent after elution, and the His tag-Fd remains on a column material, thereby obtaining the purified target protein X.

10. An expression cassette for visually detecting the expression and purification of target protein or a vector or a host cell containing the expression cassette is disclosed, wherein the expression cassette comprises a promoter, a blue algae fd gene or a homologous gene thereof, a multiple cloning site and a terminator, wherein the multiple cloning site is used for inserting the target gene, and the inserted target gene and the blue algae fd gene or the homologous gene thereof are in the same reading frame.