CN114350632A

CN114350632A - Fructosyl amino acid oxidase mutant and application thereof, product, gene, plasmid and genetically engineered bacterium

Info

Publication number: CN114350632A
Application number: CN202210274365.8A
Authority: CN
Inventors: 刁含文
Original assignee: Nanjing Jujiang Biotechnology Co ltd
Current assignee: Nanjing Jujiang Biotechnology Co ltd
Priority date: 2022-03-21
Filing date: 2022-03-21
Publication date: 2022-04-15

Abstract

The invention provides a fructosyl amino acid oxidase mutant and application thereof, and a product, a gene, a plasmid and a genetic engineering bacterium, relating to the technical field of biology. The fructosyl amino acid oxidase mutant provided by the invention cuts 6 amino acids at the C end of the fructosyl amino acid oxidase. The fructosyl amino acid oxidase mutant has the advantages of obviously improved specific enzyme activity, better thermal stability and storage stability, and can be used for measuring glycated protein, especially glycated hemoglobin.

Description

Fructosyl amino acid oxidase mutant and application thereof, product, gene, plasmid and genetically engineered bacterium

Technical Field

The invention relates to the field of biotechnology, in particular to a fructosyl amino acid oxidase mutant and application thereof, and a product, a gene, a plasmid and a genetic engineering bacterium.

Background

Diabetes is one of the common diseases at present, and the detection method for diabetes is continuously updated in medicine. Since the advent of the method for enzymatically measuring glycated hemoglobin (HbA1c), tests based thereon have been developed. The method is characterized in that glycated proteins contained in blood proteins are used as markers for blood glucose control. Glycated proteins are produced by reacting D-glucose present in blood with amino acid residues constituting blood proteins. The major glycosylation sites in blood proteins are the epsilon-amino group of lysine residues and the alpha-amino group of the amino-terminal amino acid of blood proteins. In the measurement of HbA1c, the amount of glycated protein produced by binding D-glucose to the α -amino group of valine, which is the amino terminal amino acid of the β chain of hemoglobin, is measured.

Fructosyl amino acid oxidase and a method for using the same are one of the main core enzyme raw materials for detecting diabetes at present, a method for detecting glycated protein in blood developed based on the fructosyl amino acid oxidase has high efficiency and simplicity, and a plurality of commercial detection kits are available at present. In the enzyme assay, first, a glycated protein is hydrolyzed by a protease; subsequently, the thus produced glycated amino acids such as fructosyl valine, fructosyl lysine, and fructosyl valyl histidine are oxidatively hydrolyzed by fructosyl amino acid oxidase (hereinafter referred to as "FAOD"); finally, the hydrogen peroxide produced by the oxidase reaction is colorimetrically measured by a peroxidase-chromogen reaction system. In the case of enzymatically assaying glycated proteins, the substrate specificity and stability of FAOD, which is a main reaction enzyme, are important factors. For example, in the measurement of HbA1c, an enzyme having high specificity for fructosyl valine is required. In addition, an enzyme acting on fructosyl valyl histidine is required to perform β -chain specific assay of glycated hemoglobin. This is because the amino terminal amino acids of both the α chain and β chain of hemoglobin are valine. Therefore, identification is required for specific measurement of 2 amino acid residues (i.e., fructosyl valyl histidine) at the β chain and the amino terminus.

At present, the oxidase acting on fructosyl valyl histidine (fructosyl valyl histidine oxidase) has been purified from several filamentous fungi or genetic recombinants thereof. Also disclosed is a gene encoding the fructosyl valyl histidine oxidase. However, conventional fructosyl valyl histidine oxidase has poor thermal stability, and further improvement in long-term storage stability of diagnostic reagents is required.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first object of the present invention is to provide a fructosyl amino acid oxidase mutant to solve at least one of the above problems.

The second purpose of the invention is to provide the application of the fructosyl amino acid oxidase mutant in preparing a glycated protein assay product.

The third object of the present invention is to provide a glycated protein assay product.

The fourth object of the present invention is to provide a gene encoding a fructosyl amino acid oxidase mutant.

The fifth object of the present invention is to provide a recombinant plasmid.

The sixth purpose of the invention is to provide a genetically engineered bacterium.

In a first aspect, the present invention provides a fructosyl amino acid oxidase mutant, wherein 6 amino acids at the C-terminus of the fructosyl amino acid oxidase are cleaved;

the amino acid sequence of the fructosyl amino acid oxidase is shown in SEQ ID NO. 1.

As a further technical scheme, the amino acid sequence of the fructosyl amino acid oxidase mutant is shown in SEQ ID NO. 2.

As a further technical scheme, the nucleotide sequence for expressing the fructosyl amino acid oxidase mutant is shown in SEQ ID NO. 3.

In a second aspect, the invention provides an application of a fructosyl amino acid oxidase mutant in glycated protein detection;

the glycated proteins include glycated hemoglobin.

In a third aspect, the present invention provides a glycated protein assay product comprising the above fructosyl amino acid oxidase mutant.

In a fourth aspect, the present invention provides a gene encoding the above fructosyl amino acid oxidase mutant.

In a fifth aspect, the present invention provides a recombinant plasmid comprising a vector and the above gene encoding a fructosyl amino acid oxidase mutant.

As a further technical scheme, the vector comprises pET-22 b.

In a sixth aspect, the invention provides a genetically engineered bacterium containing the recombinant plasmid.

As a further technical scheme, the genetic engineering bacteria comprise escherichia coli;

the Escherichia coli comprises BL 21.

Compared with the prior art, the invention has the following beneficial effects:

the fructosyl amino acid oxidase mutant provided by the invention cuts 6 amino acids at the C end of the fructosyl amino acid oxidase. The fructosyl amino acid oxidase mutant has the advantages of obviously improved specific enzyme activity, better thermal stability and storage stability, and can be used for measuring glycated protein, especially glycated hemoglobin.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a test of the decay of the activity under the heating condition at 50 ℃ of FAOD;

FIG. 2 shows the results of FAOD mutant purification;

FIG. 3 shows the change in specific enzyme activity under storage conditions at 25 ℃.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to embodiments and examples, but those skilled in the art will understand that the following embodiments and examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. Those who do not specify the conditions are performed according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

the amino acid sequence of the fructosyl amino acid oxidase is shown in SEQ ID NO. 1:

mdrntrilivgagcfgtstayhlaqrgftsirvldrypapsceaastdiskiirsdyneplyarlgieaiaawkssdlfrglyhvpgwvlsayklscafvegsietctklgveglerlstqqiherfplvtgeldgwninvwnptagwaaagealrrmavaaqeqgveyisgeegwvkrllfdeekhctgvitadgsthvadlvvvaagawtptlldvagqltakghsvahiqlspaetahysalpimdnlelgyffppqadgvfkmahsqfitnmqtdtrsgnkssvphtfvdnpqddlpleieaqmrrnlrrvlpeladrpfcytrlcwdadtadrhflisphpnhqglyvaaggsahgfkflpvlgkyiadllegnlesdiarqwqwragqtvtaknlahqdpeselsdltgwkgrktrergprl（SEQ ID NO.1）。

the invention firstly carries out rational design (SWISS MODEL modeling analysis) based on an original amino acid sequence, carries out an amino acid truncation test on a long C end of the mutant, and finally selects FAOD (fatty acid dehydrogenase) for cutting 6 amino acids from the C end as a final fructosyl amino acid oxidase mutant, wherein the fructosyl amino acid oxidase mutant has better thermal stability and high specific enzyme activity.

In some preferred embodiments, the fructosyl amino acid oxidase mutant has an amino acid sequence as set forth in SEQ ID No. 2:

mdrntrilivgagcfgtstayhlaqrgftsirvldrypapsceaastdiskiirsdyneplyarlgieaiaawkssdlfrglyhvpgwvlsayklscafvegsietctklgveglerlstqqiherfplvtgeldgwninvwnptagwaaagealrrmavaaqeqgveyisgeegwvkrllfdeekhctgvitadgsthvadlvvvaagawtptlldvagqltakghsvahiqlspaetahysalpimdnlelgyffppqadgvfkmahsqfitnmqtdtrsgnkssvphtfvdnpqddlpleieaqmrrnlrrvlpeladrpfcytrlcwdadtadrhflisphpnhqglyvaaggsahgfkflpvlgkyiadllegnlesdiarqwqwragqtvtaknlahqdpeselsdltgwkgrktr（SEQ ID NO.2）。

in some preferred embodiments, the nucleotide sequence expressing the fructosyl amino acid oxidase mutant is as set forth in SEQ ID No. 3:

ATGGATCGTAATACCCGTATCCTGATCGTGGGCGCAGGCTGTTTTGGCACCTCTACCGCTTACCATCTGGCCCAGCGTGGTTTCACCTCCATTCGTGTTCTGGATCGCTACCCGGCACCATCTTGCGAAGCGGCATCTACCGATATCTCTAAAATCATCCGCTCTGATTACAATGAACCGCTGTATGCACGCCTGGGTATTGAGGCAATCGCGGCCTGGAAATCTAGCGACCTGTTTCGTGGCCTGTACCACGTACCGGGCTGGGTTCTGTCTGCGTACAAGCTGTCTTGCGCGTTCGTTGAAGGCTCCATCGAAACTTGCACCAAGCTGGGTGTTGAAGGTCTGGAACGCCTGTCCACCCAGCAGATCCACGAACGCTTCCCGCTGGTTACCGGTGAACTGGATGGCTGGAACATTAACGTTTGGAACCCAACGGCTGGTTGGGCTGCAGCGGGTGAAGCTCTGCGTCGTATGGCAGTCGCGGCTCAGGAACAGGGTGTTGAATACATCAGCGGCGAGGAAGGCTGGGTTAAACGTCTGCTGTTTGATGAAGAAAAACATTGTACCGGTGTAATCACCGCTGATGGTAGCACCCATGTTGCTGACCTGGTTGTGGTTGCTGCTGGTGCTTGGACTCCAACCCTGCTGGACGTAGCTGGTCAGCTGACCGCGAAGGGTCACTCCGTTGCGCACATCCAGCTGTCTCCGGCTGAAACTGCTCACTATAGCGCTCTGCCGATCATGGATAATCTGGAACTGGGCTACTTCTTCCCGCCGCAAGCGGATGGTGTTTTCAAAATGGCGCACTCCCAGTTTATCACCAACATGCAGACCGACACCCGTAGCGGTAATAAATCTTCTGTTCCGCACACCTTCGTAGATAATCCGCAGGACGACCTGCCTCTGGAAATCGAGGCACAGATGCGTCGTAACCTGCGTCGCGTTCTGCCGGAACTGGCAGATCGTCCGTTCTGTTACACTCGCCTGTGTTGGGATGCAGACACGGCGGACCGTCATTTTCTGATCTCTCCACACCCAAACCATCAAGGCCTGTATGTCGCAGCTGGCGGTTCTGCGCACGGTTTTAAATTCCTGCCGGTACTGGGTAAATACATCGCGGATCTGCTGGAAGGTAACCTGGAATCTGACATCGCTCGTCAGTGGCAGTGGCGTGCTGGTCAGACGGTAACTGCAAAAAACCTGGCACACCAGGACCCGGAAAGCGAACTGAGCGATCTGACCGGTTGGAAA（SEQ ID NO.3）。

the glycated proteins include glycated hemoglobin.

The fructosyl amino acid oxidase mutant provided by the invention has better thermal stability and high specific enzyme activity, and can be used for measuring glycated protein, especially glycated hemoglobin.

In a third aspect, the present invention provides a glycated protein assay product comprising the above fructosyl amino acid oxidase mutant. The product has long storage time, and can be used for detecting glycated protein.

In a fourth aspect, the present invention provides a gene encoding the fructosyl amino acid oxidase mutant.

In some preferred embodiments, the vector includes, but is not limited to, pET-22b, or other vectors described by those skilled in the art, and the vector of the present invention is preferably pET-22 b.

In some preferred embodiments, the genetically engineered bacteria include, but are not limited to, escherichia coli;

the E.coli comprises BL21, preferably BL21 (rosseta).

The invention is further illustrated by the following specific examples and comparative examples, but it should be understood that these examples are for purposes of illustration only and are not to be construed as limiting the invention in any way.

Example 1

The FAOD mutant is constructed and expressed by taking pET-22b (+) as a vector, in order to quickly and accurately construct and obtain a recombinant vector and take escherichia coli as a final host, a PCR primer is designed by adopting a Golden gate assembly technology.

1) The specific implementation is as follows: according to the original amino acid sequence of the FAOD, inputting the original amino acid sequence into Codon Optimizer software, and simultaneously inputting specific information of escherichia coli, and deriving a nucleic acid sequence corresponding to the FAOD, such as SEQ ID NO. 4.

ATGGACCGTAACACCCGCATTCTGATCGTTGGTGCAGGCTGTTTCGGCACCTCTACCGCTTATCATCTGGCTCAGCGTGGCTTCACCTCCATTCGCGTTCTGGACCGTTACCCAGCTCCGTCTTGCGAAGCTGCCTCCACTGATATCTCTAAAATTATCCGCTCCGATTATAACGAGCCTCTGTACGCGCGCCTGGGCATTGAAGCAATCGCGGCTTGGAAATCCTCTGACCTGTTTCGTGGTCTGTACCACGTACCGGGCTGGGTGCTGTCTGCTTATAAACTGTCTTGTGCCTTTGTCGAAGGTAGCATCGAAACCTGCACTAAACTGGGTGTTGAGGGTCTGGAACGTCTGTCTACTCAACAGATCCACGAACGTTTCCCGCTGGTAACCGGTGAACTGGATGGCTGGAACATCAACGTCTGGAACCCGACCGCAGGTTGGGCAGCAGCAGGTGAAGCACTGCGTCGCATGGCAGTGGCAGCACAGGAACAGGGCGTTGAATACATCAGCGGTGAAGAAGGCTGGGTAAAACGTCTGCTGTTCGATGAAGAAAAACACTGTACCGGTGTAATTACCGCTGATGGTAGCACCCACGTTGCAGACCTGGTTGTCGTTGCAGCAGGTGCATGGACTCCAACCCTGCTGGATGTAGCAGGCCAGCTGACCGCTAAAGGCCATTCTGTTGCTCATATCCAGCTGTCCCCTGCGGAAACTGCCCACTACTCCGCTCTGCCGATCATGGACAACCTGGAACTGGGCTATTTTTTCCCTCCACAAGCGGATGGTGTGTTCAAAATGGCTCACAGCCAGTTCATCACCAACATGCAGACCGATACCCGCAGCGGCAACAAATCCTCTGTTCCGCATACCTTTGTGGACAACCCGCAGGATGACCTGCCGCTGGAAATCGAAGCGCAAATGCGTCGTAACCTGCGCCGTGTTCTGCCGGAACTGGCAGACCGTCCGTTCTGCTACACTCGTCTGTGCTGGGACGCAGATACCGCAGATCGTCACTTTCTGATCTCCCCGCACCCGAACCATCAGGGTCTGTACGTGGCTGCAGGCGGTTCTGCACATGGTTTTAAATTTCTGCCAGTTCTGGGCAAGTACATCGCCGACCTGCTGGAGGGTAACCTGGAGTCTGATATCGCTCGTCAGTGGCAGTGGCGCGCAGGTCAAACCGTTACTGCGAAAAACCTGGCTCATCAGGACCCGGAATCCGAGCTGAGCGACCTGACCGGTTGGAAGGGCCGTAAAACCCGT（SEQ ID NO.4）。

2) Primers were designed based on the FAOD nucleic acid sequence.

F：ATGGACCGTA ACACCCGCATTC（SEQ ID NO.5）。

R：CAGATCAGACAGTTCGCTTTCC（SEQ ID NO.6）。

3) Taking the previous pUC-57-FAOD plasmid of the team as a template (the pUC-57 plasmid inserted with FAOD fragment, wherein the nucleic acid sequence of the FAOD fragment is shown as SEQ ID NO. 4), cloning by using the primers to obtain the FAOD gene fragment with the C-terminal variable region cut off, and setting a PCR reaction system as follows:

note: here 2 x Proofast^TMMaster Mix was purchased from Biotech, Inc. of Kyoto, Kyoto.

Reaction procedure: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 20s, circulation at 30, and extension at 72 ℃ for 5 min.

4) The PCR product obtained above was subjected to agarose electrophoresis, and the mutant fragment was obtained by cutting and recovering the gel with reference to the molecular experiment manual.

5) The pET-22b (+) plasmid was digested with XhoI and XbaI as follows:

6) the resulting enzyme-cleaved product was electrophoresed on agarose nucleic acid, and the correct band was excised and recovered with an ATGPure ™ PCR product purification kit of Biotech Ltd, Nanjing, to obtain a vector DNA fragment.

7) The DNA fragment obtained by cutting the FAOD at the C-terminus was recombined with the linear pET-22b (+) fragment as follows.

Note: 5 XUFO Buffer is the Buffer solution in CloneUFO cell Step Cloning Kit 1, Biotech ltd [ C101 ] of Kyoto, Kyoto.

10. mu.l of the recombinant ligation product obtained above was transformed into 100. mu.l of BL21(rosseta) competent cells, subjected to cold shock on ice for 30 min, then subjected to heat shock at 42 ℃ for 45 s, further subjected to cold shock on ice for 5min, added with 890. mu.l of LB medium, and incubated at 37 ℃ for 1h on a shaker at 200 rpm. The cells were collected by centrifugation at 4000rpm for 1min, 100. mu.l of the supernatant was resuspended and plated on Kan-resistant plates to select positive clones. Colony PCR verification is carried out by a T7 primer and a T7terminator primer, and positive clones are picked for transfer sequencing. The sequences of the T7 primer and the T7terminator primer are shown in the following table.

8) Transferring the mutant strain with the correct C-terminal excision verified by the sequencing to 3ml LB culture medium containing 50 mug/ml Kan resistance for overnight culture to obtain a primary seed, transferring the primary seed to 50ml LB culture medium according to the inoculation amount of 1% to obtain a secondary seed, transferring 5ml secondary seed to 500ml TB culture medium, continuing to culture for 2-4h at 37 ℃ until OD600=0.2-0.8, and adding 0.1-1mM IPTG inducer to induce the expression of FAOD mutant.

9) Centrifugally collecting the bacterial liquid after the induced fermentation, weighing the weight of bacterial sludge, and mixing the bacterial sludge according to the weight ratio of 1: resuspending the cells with Buffer A (20-50mM Tris-HCl, 100 + 800mM NaCl, 0.1-0.5mM DTT, 0.1mM-2mM EDTA, pH =7.8) at a dilution ratio of 5-1: 10, fully mixing the cells, and then disrupting the cells with a high pressure mean value homogenizer under conditions of 600 + 750bar and three cycles. Centrifugally collecting supernatant, and removing impurities by membrane filtration.

10) To the supernatant solution obtained from the above crude enzyme solution, 0.2 mol/L to 5 mol/L ammonium sulfate was added for salting out to precipitate proteins, and the protein precipitate was collected by centrifugation at 13000 rpm.

11) The precipitate obtained in the above step was washed with Buffer B (20-50mM Tris-HCl, 100-800mM NaCl, pH =7.8) and filtered through a 0.22 μm filter.

12) Adding 10mM imidazole into the obtained crude protein solution, purifying by Ni ion affinity chromatography to obtain the target protein, specifically, firstly flushing the column material by Buffer B, then adding the crude protein solution added with imidazole into a Ni column, and combining with Ni ions by utilizing the affinity of HIS-Tag labels. Eluting the hybrid protein and the target protein by 100mM-500mM imidazole.

13) Taking 20 mul of the stock solution obtained above for SDS-PAGE experimental analysis, specifically, taking 20 mul of the sample to be tested, adding 5 mul of 5 XLoading Buffer, placing in boiling water, heating for 5min, making 8% polyacrylamide gel, and performing electrophoresis, wherein the result is shown in figure 2, the FAOD obtained by the invention has higher purity, and the purity exceeds 95%.

14) The obtained eluate was desalted by 10Kda membrane-coated membrane, and the desalting Buffer was: 20-50mM HEPES, 1-5g/ml fructose, 5mM Tris-HCl; and concentrated to more than 5 mg/ml.

15) Desalting and concentrating the obtained pure enzyme solution according to the steps, subpackaging in 30ml PP wide-mouth plastic bottles, subpackaging 15ml in each bottle, and freezing at-80 ℃ for more than 12 h.

16) Transferring the frozen pure enzyme to a freeze dryer for freezing, wherein the freeze drying conditions are as follows: 20bar, 40 ℃ and a lyophilization time of 72 h.

Test example 1: FAOD enzyme activity test

Diluting the obtained pure enzyme solution to 1-5mg/ml, obtaining wild type FAOD enzyme with the same concentration as the pure enzyme solution, and preparing a reaction system according to the following formula:

remarking: POD is peroxidase, and 4-AA is 4-aminoantipyrine.

And (3) preparing the reaction solution according to the system, adding 980 mu l of reaction mixture into a 1ml cuvette, incubating for 5min at 37 ℃, adding 20 mu l of enzyme solution to be detected into the reaction mixture, reacting at 37 ℃, and detecting the change of the light absorption value of the sample within 1min by using a spectrophotometer at 555 nm. The results are shown in the following table.

In the table, 6.7s and 26.7s refer to absorbance values at 6.7 seconds and 26.7 seconds in the kinetic test; detaA is the difference between the OD555 of 26.7 and 6.7.

Test example 2 thermal stability test

The crude enzyme solution obtained above was diluted to 1mg/ml and placed in a water bath at 50 ℃ in a water bath, and 20. mu.l of the solution was sampled every 5min to test the activity. The results are shown in FIG. 1.

As can be seen from FIG. 1, when the heating time is within the range of 10-35 minutes, the residual specific enzyme activity of the mutant FAOD provided by the invention is obviously better than that of the wild-type FAOD, which indicates that the mutant FAOD has better thermal stability.

Test example 3 storage stability test

1g of freeze-dried powder is placed in an incubator at 25 ℃ to test the storage stability of FAOD, and the specific enzyme activities of different samples are tested every 8 hours. The results are shown in figure 3 and the table below.

The statistical result shows that the storage time of the wild type FAOD at 25 ℃ can reach 48h, and the storage time of the mutant FAOD can reach 72h, which indicates that the mutant FAOD has better storage stability than the wild type FAOD.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> Nanjing Judge Biotech Co., Ltd

<120> fructosyl amino acid oxidase mutant and application thereof, product, gene, plasmid and genetic engineering bacteria

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 428

<212> PRT

<213> Artificial sequence

<400> 1

Met Asp Arg Asn Thr Arg Ile Leu Ile Val Gly Ala Gly Cys Phe Gly

1 5 10 15

Thr Ser Thr Ala Tyr His Leu Ala Gln Arg Gly Phe Thr Ser Ile Arg

20 25 30

Val Leu Asp Arg Tyr Pro Ala Pro Ser Cys Glu Ala Ala Ser Thr Asp

35 40 45

Ile Ser Lys Ile Ile Arg Ser Asp Tyr Asn Glu Pro Leu Tyr Ala Arg

50 55 60

Leu Gly Ile Glu Ala Ile Ala Ala Trp Lys Ser Ser Asp Leu Phe Arg

65 70 75 80

Gly Leu Tyr His Val Pro Gly Trp Val Leu Ser Ala Tyr Lys Leu Ser

85 90 95

Cys Ala Phe Val Glu Gly Ser Ile Glu Thr Cys Thr Lys Leu Gly Val

100 105 110

Glu Gly Leu Glu Arg Leu Ser Thr Gln Gln Ile His Glu Arg Phe Pro

115 120 125

Leu Val Thr Gly Glu Leu Asp Gly Trp Asn Ile Asn Val Trp Asn Pro

130 135 140

Thr Ala Gly Trp Ala Ala Ala Gly Glu Ala Leu Arg Arg Met Ala Val

145 150 155 160

Ala Ala Gln Glu Gln Gly Val Glu Tyr Ile Ser Gly Glu Glu Gly Trp

165 170 175

Val Lys Arg Leu Leu Phe Asp Glu Glu Lys His Cys Thr Gly Val Ile

180 185 190

Thr Ala Asp Gly Ser Thr His Val Ala Asp Leu Val Val Val Ala Ala

195 200 205

Gly Ala Trp Thr Pro Thr Leu Leu Asp Val Ala Gly Gln Leu Thr Ala

210 215 220

Lys Gly His Ser Val Ala His Ile Gln Leu Ser Pro Ala Glu Thr Ala

225 230 235 240

His Tyr Ser Ala Leu Pro Ile Met Asp Asn Leu Glu Leu Gly Tyr Phe

245 250 255

Phe Pro Pro Gln Ala Asp Gly Val Phe Lys Met Ala His Ser Gln Phe

260 265 270

Ile Thr Asn Met Gln Thr Asp Thr Arg Ser Gly Asn Lys Ser Ser Val

275 280 285

Pro His Thr Phe Val Asp Asn Pro Gln Asp Asp Leu Pro Leu Glu Ile

290 295 300

Glu Ala Gln Met Arg Arg Asn Leu Arg Arg Val Leu Pro Glu Leu Ala

305 310 315 320

Asp Arg Pro Phe Cys Tyr Thr Arg Leu Cys Trp Asp Ala Asp Thr Ala

325 330 335

Asp Arg His Phe Leu Ile Ser Pro His Pro Asn His Gln Gly Leu Tyr

340 345 350

Val Ala Ala Gly Gly Ser Ala His Gly Phe Lys Phe Leu Pro Val Leu

355 360 365

Gly Lys Tyr Ile Ala Asp Leu Leu Glu Gly Asn Leu Glu Ser Asp Ile

370 375 380

Ala Arg Gln Trp Gln Trp Arg Ala Gly Gln Thr Val Thr Ala Lys Asn

385 390 395 400

Leu Ala His Gln Asp Pro Glu Ser Glu Leu Ser Asp Leu Thr Gly Trp

405 410 415

Lys Gly Arg Lys Thr Arg Glu Arg Gly Pro Arg Leu

420 425

<210> 2

<211> 422

<212> PRT

<213> Artificial sequence

<400> 2

Met Asp Arg Asn Thr Arg Ile Leu Ile Val Gly Ala Gly Cys Phe Gly

1 5 10 15

Thr Ser Thr Ala Tyr His Leu Ala Gln Arg Gly Phe Thr Ser Ile Arg

20 25 30

Val Leu Asp Arg Tyr Pro Ala Pro Ser Cys Glu Ala Ala Ser Thr Asp

35 40 45

Ile Ser Lys Ile Ile Arg Ser Asp Tyr Asn Glu Pro Leu Tyr Ala Arg

50 55 60

Leu Gly Ile Glu Ala Ile Ala Ala Trp Lys Ser Ser Asp Leu Phe Arg

65 70 75 80

Gly Leu Tyr His Val Pro Gly Trp Val Leu Ser Ala Tyr Lys Leu Ser

85 90 95

Cys Ala Phe Val Glu Gly Ser Ile Glu Thr Cys Thr Lys Leu Gly Val

100 105 110

Glu Gly Leu Glu Arg Leu Ser Thr Gln Gln Ile His Glu Arg Phe Pro

115 120 125

Leu Val Thr Gly Glu Leu Asp Gly Trp Asn Ile Asn Val Trp Asn Pro

130 135 140

Thr Ala Gly Trp Ala Ala Ala Gly Glu Ala Leu Arg Arg Met Ala Val

145 150 155 160

Ala Ala Gln Glu Gln Gly Val Glu Tyr Ile Ser Gly Glu Glu Gly Trp

165 170 175

Val Lys Arg Leu Leu Phe Asp Glu Glu Lys His Cys Thr Gly Val Ile

180 185 190

Thr Ala Asp Gly Ser Thr His Val Ala Asp Leu Val Val Val Ala Ala

195 200 205

Gly Ala Trp Thr Pro Thr Leu Leu Asp Val Ala Gly Gln Leu Thr Ala

210 215 220

Lys Gly His Ser Val Ala His Ile Gln Leu Ser Pro Ala Glu Thr Ala

225 230 235 240

His Tyr Ser Ala Leu Pro Ile Met Asp Asn Leu Glu Leu Gly Tyr Phe

245 250 255

Phe Pro Pro Gln Ala Asp Gly Val Phe Lys Met Ala His Ser Gln Phe

260 265 270

Ile Thr Asn Met Gln Thr Asp Thr Arg Ser Gly Asn Lys Ser Ser Val

275 280 285

Pro His Thr Phe Val Asp Asn Pro Gln Asp Asp Leu Pro Leu Glu Ile

290 295 300

Glu Ala Gln Met Arg Arg Asn Leu Arg Arg Val Leu Pro Glu Leu Ala

305 310 315 320

Asp Arg Pro Phe Cys Tyr Thr Arg Leu Cys Trp Asp Ala Asp Thr Ala

325 330 335

Asp Arg His Phe Leu Ile Ser Pro His Pro Asn His Gln Gly Leu Tyr

340 345 350

Val Ala Ala Gly Gly Ser Ala His Gly Phe Lys Phe Leu Pro Val Leu

355 360 365

Gly Lys Tyr Ile Ala Asp Leu Leu Glu Gly Asn Leu Glu Ser Asp Ile

370 375 380

Ala Arg Gln Trp Gln Trp Arg Ala Gly Gln Thr Val Thr Ala Lys Asn

385 390 395 400

Leu Ala His Gln Asp Pro Glu Ser Glu Leu Ser Asp Leu Thr Gly Trp

405 410 415

Lys Gly Arg Lys Thr Arg

420

<210> 3

<211> 1251

<212> DNA

<213> Artificial sequence

<400> 3

atggatcgta atacccgtat cctgatcgtg ggcgcaggct gttttggcac ctctaccgct 60

taccatctgg cccagcgtgg tttcacctcc attcgtgttc tggatcgcta cccggcacca 120

tcttgcgaag cggcatctac cgatatctct aaaatcatcc gctctgatta caatgaaccg 180

ctgtatgcac gcctgggtat tgaggcaatc gcggcctgga aatctagcga cctgtttcgt 240

ggcctgtacc acgtaccggg ctgggttctg tctgcgtaca agctgtcttg cgcgttcgtt 300

gaaggctcca tcgaaacttg caccaagctg ggtgttgaag gtctggaacg cctgtccacc 360

cagcagatcc acgaacgctt cccgctggtt accggtgaac tggatggctg gaacattaac 420

gtttggaacc caacggctgg ttgggctgca gcgggtgaag ctctgcgtcg tatggcagtc 480

gcggctcagg aacagggtgt tgaatacatc agcggcgagg aaggctgggt taaacgtctg 540

ctgtttgatg aagaaaaaca ttgtaccggt gtaatcaccg ctgatggtag cacccatgtt 600

gctgacctgg ttgtggttgc tgctggtgct tggactccaa ccctgctgga cgtagctggt 660

cagctgaccg cgaagggtca ctccgttgcg cacatccagc tgtctccggc tgaaactgct 720

cactatagcg ctctgccgat catggataat ctggaactgg gctacttctt cccgccgcaa 780

gcggatggtg ttttcaaaat ggcgcactcc cagtttatca ccaacatgca gaccgacacc 840

cgtagcggta ataaatcttc tgttccgcac accttcgtag ataatccgca ggacgacctg 900

cctctggaaa tcgaggcaca gatgcgtcgt aacctgcgtc gcgttctgcc ggaactggca 960

gatcgtccgt tctgttacac tcgcctgtgt tgggatgcag acacggcgga ccgtcatttt 1020

ctgatctctc cacacccaaa ccatcaaggc ctgtatgtcg cagctggcgg ttctgcgcac 1080

ggttttaaat tcctgccggt actgggtaaa tacatcgcgg atctgctgga aggtaacctg 1140

gaatctgaca tcgctcgtca gtggcagtgg cgtgctggtc agacggtaac tgcaaaaaac 1200

ctggcacacc aggacccgga aagcgaactg agcgatctga ccggttggaa a 1251

<210> 4

<211> 1266

<212> DNA

<213> Artificial sequence

<400> 4

atggaccgta acacccgcat tctgatcgtt ggtgcaggct gtttcggcac ctctaccgct 60

tatcatctgg ctcagcgtgg cttcacctcc attcgcgttc tggaccgtta cccagctccg 120

tcttgcgaag ctgcctccac tgatatctct aaaattatcc gctccgatta taacgagcct 180

ctgtacgcgc gcctgggcat tgaagcaatc gcggcttgga aatcctctga cctgtttcgt 240

ggtctgtacc acgtaccggg ctgggtgctg tctgcttata aactgtcttg tgcctttgtc 300

gaaggtagca tcgaaacctg cactaaactg ggtgttgagg gtctggaacg tctgtctact 360

caacagatcc acgaacgttt cccgctggta accggtgaac tggatggctg gaacatcaac 420

gtctggaacc cgaccgcagg ttgggcagca gcaggtgaag cactgcgtcg catggcagtg 480

gcagcacagg aacagggcgt tgaatacatc agcggtgaag aaggctgggt aaaacgtctg 540

ctgttcgatg aagaaaaaca ctgtaccggt gtaattaccg ctgatggtag cacccacgtt 600

gcagacctgg ttgtcgttgc agcaggtgca tggactccaa ccctgctgga tgtagcaggc 660

cagctgaccg ctaaaggcca ttctgttgct catatccagc tgtcccctgc ggaaactgcc 720

cactactccg ctctgccgat catggacaac ctggaactgg gctatttttt ccctccacaa 780

gcggatggtg tgttcaaaat ggctcacagc cagttcatca ccaacatgca gaccgatacc 840

cgcagcggca acaaatcctc tgttccgcat acctttgtgg acaacccgca ggatgacctg 900

ccgctggaaa tcgaagcgca aatgcgtcgt aacctgcgcc gtgttctgcc ggaactggca 960

gaccgtccgt tctgctacac tcgtctgtgc tgggacgcag ataccgcaga tcgtcacttt 1020

ctgatctccc cgcacccgaa ccatcagggt ctgtacgtgg ctgcaggcgg ttctgcacat 1080

ggttttaaat ttctgccagt tctgggcaag tacatcgccg acctgctgga gggtaacctg 1140

gagtctgata tcgctcgtca gtggcagtgg cgcgcaggtc aaaccgttac tgcgaaaaac 1200

ctggctcatc aggacccgga atccgagctg agcgacctga ccggttggaa gggccgtaaa 1260

acccgt 1266

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence

<400> 5

atggaccgta acacccgcat tc 22

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<400> 6

cagatcagac agttcgcttt cc 22

<210> 7

<211> 19

<212> DNA

<213> Artificial sequence

<400> 7

taatacgact cactatagg 19

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

tgctagttat tgctcagcgg 20

Claims

1. A fructosyl amino acid oxidase mutant, characterized in that 6 amino acids at the C-terminus of the fructosyl amino acid oxidase are cleaved;

2. The fructosyl amino acid oxidase mutant according to claim 1, wherein the amino acid sequence of the fructosyl amino acid oxidase mutant is represented by SEQ ID No. 2.

3. The fructosyl amino acid oxidase mutant according to claim 1, wherein the nucleotide sequence for expressing the fructosyl amino acid oxidase mutant is shown in SEQ ID No. 3.

4. Use of the fructosyl amino acid oxidase mutant according to any one of claims 1 to 3 for the preparation of a glycated protein assay product;

the glycated proteins include glycated hemoglobin.

5. A glycated protein assay product comprising the fructosyl amino acid oxidase mutant according to any one of claims 1 to 3.

6. A gene encoding the fructosyl amino acid oxidase mutant according to any one of claims 1 to 3.

7. A recombinant plasmid comprising a vector and the gene of claim 6.

8. The recombinant plasmid of claim 7, wherein the vector comprises pET-22 b.

9. A genetically engineered bacterium comprising the recombinant plasmid according to claim 7 or 8.

10. The genetically engineered bacterium of claim 9, wherein the genetically engineered bacterium comprises escherichia coli;

the Escherichia coli comprises BL 21.