CN108342370B

CN108342370B - Novel fructosyl peptide oxidase and application thereof

Info

Publication number: CN108342370B
Application number: CN201710046116.2A
Authority: CN
Inventors: 杨广宇; 谢渊; 冯雁; 马富强
Original assignee: Shanghai Jiaotong University
Current assignee: WUHAN NEW BIOCALYSIS SOLUTION Co.,Ltd.
Priority date: 2017-01-22
Filing date: 2017-01-22
Publication date: 2021-05-28
Anticipated expiration: 2037-01-22
Also published as: CN108342370A

Abstract

The invention relates to a group of fructosyl peptide oxidase mutants and application thereof. The invention obtains the fructosyl peptide oxidase mutant with obviously improved stability by screening the fructosyl peptide oxidase mutant. The invention also relates to application of the fructosyl peptide oxidase in catalyzing the oxidative deglycosylation of the fructosyl peptide compound, and the fructosyl peptide oxidase can be further used in a kit or a sensor for detecting glycosylated hemoglobin.

Description

Novel fructosyl peptide oxidase and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to fructosyl peptide oxidase with improved thermal stability and application thereof in deglycosylation reaction of a maillard compound.

Background

Glycated hemoglobin (HbA1c) in the human body is a medlars compound (Amadori compound). The free glucose in the blood fructosylates the free amino group of the valine at the N-terminus of the beta chain of hemoglobin in erythrocytes, thereby producing HbA1 c. This glycosylation reaction proceeds continuously, slowly, irreversibly in vivo, and its rate is directly influenced by blood glucose levels. The concentration of HbA1c in a human can reflect the blood glucose level over a longer period of time. Therefore, the defect that the currently widely used fasting blood glucose measurement is influenced by factors such as short-term diet, work and rest, medicines and the like is well overcome, and therefore, in the new Asia-Pacific diabetes prevention and treatment guide proposed by the international diabetes alliance, the glycosylated hemoglobin measurement is definitely indicated as the internationally recognized 'gold standard' for diabetes monitoring.

HbA1c levels were determined to be dependent on fructosyl peptide oxidase. HbA1c is first digested by protease to form a short peptide, the terminal fructosyl valine (Fru-Val) or fructosyl valine-histidine (Fru-Val-His) is exposed, and the concentration of HbA1c can be rapidly quantified by detecting the peroxide product of the fructosyl valine-histidine-oxidase. Fructosyl peptide oxidase (FPOX-E) from Eupenicillium terrenum ATCC 18547 (Biochem Biophys Res Commun.2003Nov 7; 311(1):104-11) has ideal substrate selectivity and high catalytic activity, and is very suitable for measuring the level of HbA1 c; however, FPOX-E has poor thermal stability, obvious precipitation is generated after the temperature is kept at 40 ℃ for 2 hours, and the storage and transportation conditions of the detection reagent are high, so that the application of the detection method is greatly limited.

Therefore, it is highly desired to obtain a novel fructosyl peptide oxidase having high thermal stability and high activity.

Disclosure of Invention

The invention aims to provide a fructosyl peptide oxidase mutant and application thereof.

In a first aspect of the invention there is provided a mutant fructosyl peptide oxidase having at least 90% amino acid sequence identity to SEQ ID No. 2 and comprising a mutation at least one or more of the positions including at least one of positions 30, 60, 66, 95, 138, 161, 171, 184, 272 or 388 of SEQ ID No. 2 or a position corresponding thereto; the mutation is to substitute, insert or delete one or more amino acid residues on the mutation site.

Preferably, the fructosyl peptide oxidase has at least 93% amino acid sequence identity to SEQ ID NO 2; more preferably, the fructosyl peptide oxidase has at least 95% amino acid sequence identity to SEQ ID NO 2.

Preferably, the mutation is a substitution mutation, and at least comprises the substitution of one or more of the following amino acid residues:

serine at position 30 is replaced with arginine; or

Glycine 60 is replaced by asparagine or alanine or serine; or

Glycine at position 66 is replaced by aspartic acid; or

Isoleucine at position 95 is replaced with leucine; or

Alanine at position 138 is substituted with tyrosine, valine or isoleucine; or

Alanine at position 161 substituted with aspartic acid; or

Isoleucine at position 171 is replaced with arginine; or

Glycine 184 is replaced by aspartic acid; or

Asparagine at position 272 is replaced with aspartic acid; or

Histidine at position 388 was replaced by tyrosine.

More preferably, the mutation is a combination of the above mutations selected from the group consisting of:

(1) comprising a substitution of serine at position 30 with arginine and a substitution of glycine at position 66 with aspartic acid; or

(2) Comprising a substitution of glycine at position 66 with aspartic acid and a substitution of isoleucine at position 95 with leucine; or

(3) Comprising alanine at position 161 substituted with aspartic acid and alanine at position 138 substituted with isoleucine; or

(4) Comprising substitution of alanine at position 161 with aspartic acid and substitution of asparagine at position 272 with aspartic acid; or

(5) Comprises a substitution of serine at position 30 with arginine and a substitution of histidine at position 388 with tyrosine; or

(6) Comprises alanine at position 161 substituted by aspartic acid and histidine at position 388 substituted by tyrosine; or

(7) Comprises substitution of glycine at position 184 with aspartic acid and substitution of histidine at position 388 with tyrosine; or

(8) Comprises substitution of asparagine at position 272 with aspartic acid and substitution of histidine at position 388 with tyrosine; or

(9) Comprises substitution of glycine at position 66 with aspartic acid, substitution of alanine at position 161 with aspartic acid and substitution of histidine at position 388 with tyrosine; or

(10) Comprises alanine at position 161 substituted by aspartic acid, asparagine at position 272 substituted by aspartic acid and histidine at position 388 substituted by tyrosine; or

(11) Comprises substitution of glycine at position 66 with aspartic acid, substitution of alanine at position 161 with aspartic acid, substitution of asparagine at position 272 with aspartic acid and substitution of histidine at position 388 with tyrosine; or

(12) Comprises the substitution of glycine at position 66 with aspartic acid, the substitution of alanine at position 138 with isoleucine, the substitution of alanine at position 161 with aspartic acid, the substitution of asparagine at position 272 with aspartic acid and the substitution of histidine at position 388 with tyrosine.

In another preferred embodiment, the mutation is a recombination of the above mutations.

In another aspect of the invention, there is provided a polynucleotide encoding the fructosyl peptide oxidase mutant.

In a preferred embodiment, a molecular tag, such as a histidine tag, can be added to the end of the polynucleotide for further purification and analysis.

In another aspect of the invention, there is provided an expression vector comprising said polynucleotide.

In a preferred embodiment, the expression vector is pET-28 a.

In another aspect of the invention, there is provided a genetically engineered cell comprising said expression vector or a genome thereof having said polynucleotide integrated therein.

The genetically engineered cell may be a gram positive bacterium, such as bacillus subtilis; it may also be a gram-negative bacterium, such as E.coli; also actinomycetes, such as streptomyces; fungi, such as yeast, Aspergillus, and other host microorganisms;

in a preferred embodiment, the genetically engineered cell is E.coli.

In another aspect of the present invention, there is provided a method for improving the thermal stability of a fructosyl peptide oxidase, which comprises using the fructosyl peptide oxidase in a bio-enzymatic catalytic system.

In a preferred embodiment, the biological enzyme method catalytic system is an in vitro enzyme method;

in a preferred embodiment, the biological enzyme catalysis system is whole-cell catalysis;

the biological enzyme catalysis system also comprises immobilized enzyme catalysis, purified enzyme catalysis, a cell factory containing an artificial metabolic pathway and the like.

In another aspect of the invention, there is provided a use of a fructosyl peptide oxidase for catalyzing oxidative deglycosylation of a maillard compound, specifically, a starting material of the maillard compound is subjected to catalytic action of the fructosyl peptide oxidase to remove glycosyl from the maillard compound and generate peroxide.

In a preferred embodiment, the medlars compound is glycated hemoglobin.

In a preferred embodiment, the medlar's compound is the proteolytic product fructosyl-valine-histidine dipeptide of glycated hemoglobin.

According to the present invention, a fructosyl peptide oxidase having excellent thermostability and a gene encoding the fructosyl peptide oxidase are provided and used as an enzyme for diagnosis of diabetes.

In another aspect of the present invention, there is provided a kit for assaying glycated hemoglobin, which comprises the fructosyl peptide oxidase.

The detection method comprises the following steps: after whole blood is hemolyzed, glycated hemoglobin is digested into fructosyl peptide by specific endoprotease, and hydrogen peroxide (H) is generated under the action of fructosyl peptide oxidase₂O₂)，H₂O₂Is proportional to the content of glycated hemoglobin in blood, H₂O₂Coupling with corresponding chromogen under the action of peroxidase so as to obtain H according to color change degree₂O₂And further knowing the content of the glycosylated hemoglobin in the sample.

In another aspect of the present invention, there is provided a sensor for measuring glycated hemoglobin, which comprises the fructosyl peptide oxidase.

The detection method comprises the following steps: the fructosyl peptide oxidase is fixed on a carrier, the carrier comprises but is not limited to inorganic materials, natural materials, high molecular materials and the like, an acting electrode is formed and is inserted into a buffer solution suitable for the fructosyl peptide oxidase together with an antipode and a reference electrode, the whole system keeps constant and stable, a fixed voltage is applied to the acting electrode, a sample to be detected is added, and the increase of the current intensity caused by hydrogen peroxide generated by reaction is measured, so that the content of the glycosylated hemoglobin in the sample is known.

The counter electrode is preferably a platinum electrode;

the reference electrode is preferably a silver electrode or a silver chloride electrode.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1 shows a schematic diagram of the crystal structure of FPOX-E and the distribution of mutation sites on the structure. The distribution of the mutation sites in the FPOX-E protein structure is shown. As can be seen in the figure, the 25 mutation sites are uniformly distributed in the protein structure, wherein 18 of the mutation sites are located in the loop region of the protein, and the remaining 7 mutation sites are located in the secondary structure of the protein.

FIG. 2 comparison of the detection of hemoglobin by FPOX-E enzyme method and HPLC method

Detailed Description

The inventor provides a group of novel fructosyl peptide oxidase through research and screening, and the fructosyl peptide oxidase has remarkably improved thermal stability. The fructosyl peptide oxidase of the invention is particularly suitable for catalyzing the oxidative deglycosylation reaction of the fructosyl peptide compound. The invention also provides application of the fructosyl peptide oxidase in a kit or a sensor for detecting glycosylated hemoglobin.

The present invention provides a mutant of fructosyl peptide oxidase, FPOX-E, having a sequence with at least any amino acid sequence identity in the range of 90% to 100% with SEQ ID NO. 2 and comprising a mutation at one or more positions including positions 30, 60, 66, 95, 138, 161, 171, 184, 272, 388 or their corresponding positions of SEQ ID NO. 2, having improved thermostability.

The invention also includes derivatives and analogs of the mutant enzymes. As used herein, the terms "derivative" and "analog" refer to a protein that retains substantially the same biological function or activity as the mutant enzyme of the present invention. A fragment, derivative or analogue of a protein of the invention may be (i) a protein in which one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a protein having a substituent group in one or more amino acid residues, or (iii) a protein in which the mature polypeptide is fused to another compound, such as a compound that extends the half-life of the polypeptide, e.g.polyethylene glycol, or (iv) a protein in which an additional amino acid sequence is fused to the sequence of the polypeptide (e.g.a leader or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the definitions herein.

In the present invention, the fructosyl peptide oxidase mutant enzyme also includes a variant form of the above mutant sequence having the same function as the mutant enzyme. These variants include (but are not limited to): deletion, insertion and/or substitution of several (e.g., 1-3, 1-2) amino acids, and addition of one or several (e.g., less than 300, preferably less than 200, more preferably less than 100, more preferably less than 50, e.g., 40, 30, 20, 10, 5, 3, 2, 1) amino acids at the C-terminus and/or N-terminus. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Also, for example, the addition of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein. The term also includes active fragments and active derivatives of the mutant enzymes.

In the present invention, modified forms of polypeptides (usually without changing the primary structure) comprising one or more amino acids modified to increase the stability, half-life, or promoting efficacy of the mutant enzyme are also included, including: chemically derivatized forms of the polypeptide, such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are mutant enzymes modified to improve resistance to hydrolysis or to optimize solubility.

The invention also provides polynucleotide sequences encoding the fructosyl carnosine oxidases of the invention. The polynucleotide of the present invention may be in the form of DNA or RNA. The DNA may be the coding strand or the non-coding strand. That is, a "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences.

The present invention further provides a recombinant vector comprising a gene encoding the above-described fructosyl peptide oxidase or a mutant thereof, and a transformant (e.g., the microorganism of the present invention) comprising the recombinant vector.

The recombinant vector of the present invention is understood to be any recombinant vector of a gene in the prior art, for example, various plasmids, i.e., a DNA vector plasmid in which a mutant gene of a fructosyl peptide oxidase mutant is introduced into a DNA vector which enables the fructosyl peptide oxidase mutant to be stably expressed.

The transformant of the recombinant vector refers to a host cell of the recombinant vector, for example, a host cell of the microorganism E.coli BL21(DE3) -CodonPlus-RIL described in example 1 of the present invention; of course, the microorganisms commonly used as host cells in the prior art include gram-positive bacteria such as Bacillus subtilis, gram-negative bacteria such as Escherichia coli, actinomycetes such as Streptomyces, yeasts such as Saccharomyces cerevisiae, fungi such as Aspergillus, and their cells are the host cells of commonly used recombinant vectors.

The medlars (Amadori compounds) are key compounds generated by non-enzymatic browning reaction of reducing sugar and amino compounds, and have a basic structure of 1-amino-1 deoxy-2 ketose, for example, glucosamine is subjected to ring opening under the action of acid to generate enamine at one position and become hydroxyl at five positions. Through glucosamine rearrangement, two positions are changed into ketone, hydroxyl on five positions attacks ketone carbonyl, and after ring closure, fructosamine is obtained.

The biological enzyme method catalytic system is a process for preparing or producing corresponding macromolecular or micromolecular compounds by using biological enzyme as a catalyst to realize functions of oxidation, synthesis, hydrolysis and the like.

The in vitro enzymatic catalysis refers to the industrial production of the enzyme in vitro as a catalyst.

Whole-cell catalysis refers to the use of intact biological organisms (i.e., whole cells, tissues, and even individuals) as catalysts for biotransformation, which in essence is catalyzed by intracellular enzymes.

An immobilized enzyme is an enzyme which has a catalytic action in a certain spatial range and can be repeatedly and continuously used. Generally, enzymatic reactions are carried out in an aqueous solution, and an immobilized enzyme is obtained by physically or chemically treating a water-soluble enzyme to render it insoluble in water but still enzymatically active. Immobilized enzyme catalysis refers to a catalytic reaction in vitro using an immobilized enzyme as a catalyst.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

General description of the sources of the biological materials described in the present invention:

1. primer synthesis: the primers used in the present invention were all prepared synthetically by Jinwei Zhi, Suzhou. Degenerate bases are used for part of the primers, and the relevant degenerate bases include:

n is a, c, g or t; k is g or t; m is a or c.

2. T4DNA ligase and the like used in the experiment were purchased from NewEngland Biolabs; PrimeSTAR HS high fidelity enzyme from Takara; restriction enzymes were purchased from Fermentas; the DNA gel recovery kit and the plasmid miniprep kit used were purchased from Axygen, Inc.

3, the fructosyl peptide oxidase modified by the invention is fructosyl peptide oxidase (FPOX-E) from Eupenicillus terrenum ATCC 18547

EXAMPLE 1 cloning of wild-type fructosyl oxidase FPOX-E Gene

The wild-type fructosyl peptide oxidase FPOX-E gene was codon optimized using E.coli as a host (SEQ ID NO: 1, encoded protein sequence SEQ ID NO: 2) and synthesized by Jinwei, Suzhou, with the following primers to amplify the gene of interest.

Upstream primer 5' -ATCGCACATATGGCCCATTCACGCGCAAGCA-3’

(underlined bases are recognition sites for restriction enzyme NdeI, SEQ ID NO: 3)

And downstream primer 5' -ATCGGACTCGAGTTACAGGTGGGCGTCATGCTT-3’

(underlined bases are restriction enzyme XhoI recognition sites, SEQ ID NO: 4)

The PCR reaction used Takara's PrimeSTAR HS polymerase under the following conditions: 2min at 98 ℃, then 10sec at 98 ℃, 15sec at 55 ℃, 90sec at 72 ℃ for 25 cycles; finally, 10min at 72 ℃. After the reaction, the PCR amplification product was subjected to 1% agarose gel electrophoresis to obtain a 1.4kb band, which was consistent with the expected result. The target fragment was digested with DpnI, recovered, purified, double-digested with restriction enzymes NdeI and XhoI, ligated with plasmid pET28a (Novagen) double-digested with the same enzymes, the ligation product was transformed into Escherichia coli BL21(DE3) -CodonPlus-RIL competent cells, the transformed cells were plated on LB plate containing 50. mu.g/mL kanamycin to screen positive clones, plasmids were extracted and sequenced, the sequencing result showed that the cloned fructosyl peptide oxidase FPOX-E gene sequence was correct and correctly ligated into pET28a, and the recombinant plasmid was named pET28 a-FPOX-E.

Example 2 expression, purification and Activity assay of FPOX-E

The engineering bacteria in the glycerin pipe are inoculated into a 4mL LB culture medium test tube containing 100ug/mL kanamycin according to the volume ratio of 1 percent, and cultured for 12h at 37 ℃ and 220 rpm. The 4mL of the cell suspension was transferred to a 1L LB medium shake flask containing 50. mu.g/mL kanamycin, cultured at 37 ℃ for about 2.5 hours at 220rpm to achieve an OD600 of about 0.9, added with 0.1mM IPTG inducer, and induced at 25 ℃ for 12-16 hours at 200 rpm. And ultrasonically crushing the escherichia coli thallus suspension obtained after fermentation, and performing Ni-NTA affinity chromatography treatment in one step to obtain the target protein with the purity of more than 95%.

Fructosyl peptide oxidase activity assay see document Biosci Biotechnol biochem.2002jun; 66(6):1256-61. The method for measuring the half-life of the fructosyl peptide oxidase comprises the following steps: the enzyme solution was incubated at a certain temperature, samples were taken at different treatment times and the percent of the fructosyl peptide oxidase residual activity was determined. The plot of ln in percent residual activity against time t (min) is obtained by plotting the slope of the line as the inactivation constant k_inact, from t_1/2＝ln2/k_inactThe half-life of the fructosyl peptide oxidase at this temperature is obtained.

Example 3 selection of FPOX-E mutational hotspots

1. We obtained crystals of FPOX-E and resolved their structure by X-ray diffraction. And screening out mutants most likely to improve the thermal stability of FPOX-E under the following screening conditions:

(1) the standard for judging a certain locus as a candidate locus is as follows: the amino acid abundance of most proteins in the family at the position is high overall; ② the amino acid at the site is conserved; and the amino acid with higher occurrence frequency at the site has larger physical and chemical property difference with the amino acid at the site of FPOX-E, such as charge difference, polarity intensity, steric hindrance and the like.

(2) Removal of the active site in the vicinity, i.e.away from the catalytic residue (glutamic acid 283)

Amino acid residues within the range, excluding amino acid residues in the embedded or semi-embedded state.

After two-step screening, there were 106 different sites remaining, most of which were located on the surface of the protein molecule.

(3) According to the crystal structure of FPOX-E, the 106 mutant forms are analyzed in detail one by one, and mutants which can improve the thermal stability of FPOX-E are screened out.

The main judgment criteria are: firstly, the mutation eliminates the original acting force form which is not beneficial to thermal stability, such as electrostatic repulsion, charge aggregation and the like; secondly, the mutation does not damage the existing acting force form which is beneficial to thermal stability and the stable protein structure; and thirdly, new acting force forms which are beneficial to thermal stability, such as hydrogen bonds, salt bridges, hydrophobic interaction and the like, are introduced into the mutation.

A total of 25 single-point mutants were designed:

L25Y，S30R，V42K，G66D，Q70R，Q80R，N81E，F89Y，G103E，V126H，L135R，A136R，A138Y，A161D，I171R，F172E，G184D，G184K，G186T，T199R，D229K，A238R，N272D，N356H，H388Y

design of Fold-X method

Fold-X(http://foldxsuite.crg.eu/) Is a piece of bioinformatic algorithm software which mainly provides a fast quantitative estimation of the interaction effect on the stability of the protein (complex). Inputting a crystal structure file of the fructosyl peptide oxidase, compiling a script, calculating energy changes before and after saturation mutation of each site of the fructosyl peptide oxidase by using Fold-X, and obtaining a plurality of sites with larger energy changes after mutation by sequencing, wherein the energy changes are as follows: 7 sites of G60, W79, I95, I303, C347, A402 and P429.

3, B-factor screening strategy

B-factor is a method based on structural biology and bioinformatics. We used the crystal structure of fructosyl peptide oxidase and the B-FITTER software supplied by the Reetz team to calculate the B factor value of the protein. The B-FITTER software is able to calculate the B-factor value for each amino acid as the average B-factor value for all its atoms except hydrogen, resulting in an output file ordered according to B-factor. The first 20 sites with the highest B-factor value are selected, and by combining the results of Fold-X, the following 8 mutation sites are selected for constructing a saturated mutation library, wherein the mutation sites are as follows: s30, G60, W79, I95, E102, S130, a138 and N272.

Example 4 construction, expression, purification and characterization of the Properties of FPOX-E mutants

1, construction of site-directed mutants

Using the recombinant plasmid pET28a-FPOX-E as a template and a pair of complementary oligonucleotides with mutation sites as primers, whole plasmid PCR amplification was performed using PrimeSTAR HS high fidelity enzyme (Takara Inc.) to obtain a recombinant plasmid with a specific mutation site. The primer sequences are as follows:

L25Y

5'TAGTTCCACGGCTTACCACCTGATTCGTTC 3'(SEQ ID NO：5)

5'GAATCAGGTGGTAAGCCGTGGAACTACCGA 3'(SEQ ID NO：6)

S30R

5'CTGATTCGTCGTGGCTATACCCCGTCGAAC 3'(SEQ ID NO：7)

5'GGGTATAGCCACGACGAATCAGGTGCAGAG 3'(SEQ ID NO：8)

V42K

5'CTGGATAAGTACAAAACCCCGTCGCTG 3'(SEQ ID NO：9)

5'GGGGTTTTGTACTTATCCAGCACCGTAATG 3'(SEQ ID NO：10)

G66D

5'TCTGCGCAATGATCCGGATCTGCAGCTGTC 3'(SEQ ID NO：11)

5'TGCAGATCCGGATCATTGCGCAGACGGATG 3'(SEQ ID NO：12)

Q70R

5'GTCCGGATCTGCGGCTGTCTCTGGAAAGTC 3'(SEQ ID NO：13)

5'TCCAGAGACAGCCGCAGATCCGGACCATTG 3'(SEQ ID NO：14)

Q80R

5'TGGATATGTGGCGGAACGACGAACTGTTTA 3'(SEQ ID NO：15)

5'TTCGTCGTTCCGCCACATATCCAGACTTTC 3'(SEQ ID NO：16)

N81E

5'ATATGTGGCAAGAAGACGAACTGTTTAAAC 3'(SEQ ID NO：17)

5'ACAGTTCGTCTTCTTGCCACATATCCAGAC 3'(SEQ ID NO：18)

F89Y

5'TTTAAACCGTTTTACCACCAAGTGGGCATG 3'(SEQ ID NO：19)

5'CACTTGGTGGTAAAACGGTTTAAACAGTTC 3'(SEQ ID NO：20)

G103E

5'AGAAGAGATCGAAAATCTGCGTCGCAAGTA 3'(SEQ ID NO：21)

5'AGATTTTCGATCTCTTCTTTACTAGAGCTG 3'(SEQ ID NO：22)

V126H

5'AAAAAACGAACCACTGGCTGGAATCCGAAG 3'(SEQ ID NO：23)

5'ATTCCAGCCAGTGGTTCGTTTTTTCCAGAC 3'(SEQ ID NO：24)

L135R

5'AAGACGAAATCCGGGCCAAAGCACCGAATT 3'(SEQ ID NO：25)

5'TGCTTTGGCCCGGATTTCGTCTTCGGATTC 3'(SEQ ID NO：26)

A136R

5'CGAAATCCTGCGGAAAGCACCGAATTTTAC 3'(SEQ ID NO：27)

5'ATTCGGTGCTTTCCGCAGGATTTCGTCTTC 3'(SEQ ID NO：28)

A138Y

5'TCCTGGCCAAATACCCGAATTTTACCCGTG 3'(SEQ ID NO：29)

5'AAAATTCGGGTATTTGGCCAGGATTTCGTC 3'(SEQ ID NO：30)

A161D

5'CTGGATGCGGCAAAAGCCATTAATGCAATT 3'(SEQ ID NO：31)

5'TGCCGCATCCAGCCAACCGCCATCCGTACA 3'(SEQ ID NO：32)

I171R

5'ATGCAATTGGCAGGTTTCTGCAAGACAAAG 3'(SEQ ID NO：33)

5'TCTTGCAGAAACCTGCCAATTGCATTAATG 3'(SEQ ID NO：34)

F172E

5'ATTGGCATCGAGCTGCAAGACAAAGGCGTG 3'(SEQ ID NO：35)

5'TTGTCTTGCAGCTCGATGCCAATTGCATTA 3'(SEQ ID NO：36)

G184D

5'TTTTGGCGATGCGGGTACCTTTCAGCAAC 3'(SEQ ID NO：37)

5'GTACCCGCATCGCCAAAACCGAACTTCAC 3'(SEQ ID NO：38)

G184K

5'TTTTGGCAAAGCGGGTACCTTTCAGCAA 3'(SEQ ID NO：39)

5'GTACCCGCTTTGCCAAAACCGAACTTCA 3'(SEQ ID NO：40)

G186T

5'GGCGGTGCGACTACCTTTCAGCAACCGCTG 3'(SEQ ID NO：41)

5'TGAAAGGTAGTCGCACCGCCAAAACCGAAC 3'(SEQ ID NO：42)

T2199R

5'GGATGGCAAACGCTGCATCGGTCTGGAAAC 3'(SEQ ID NO：43)

5'CCGATGCAGCGTTTGCCATCCGCAGCGAAC 3'(SEQ ID NO：44)

D229K

5'CCTGGTGAAGCTGGAAGACCAGTGTGTTAG 3'(SEQ ID NO：45)

5'CTTCCAGCTTCACCAGGGTCGGAGACCATG 3'(SEQ ID NO：46)

A238R

5'AAACGATGGGTCTTCGCGCATATTCAACTG 3'(SEQ ID NO：47)

5'CGCGAAGACCCATCGTTTACTAACACACTG 3'(SEQ ID NO：48)

N272D

5'TTGAACCGGATGAATACGGCGTCATTAAAG 3'(SEQ ID NO：49)

5'ACGCCGTATTCATCCGGTTCAAAGAAAAAG 3'(SEQ ID NO：50)

N356H

5'CTGACGCGCACCTGCTGATTTGTGAACATC 3'(SEQ ID NO：51)

5'ACAAATCAGCAGGTGCGCGTCAGCCGTATC 3'(SEQ ID NO：52)

H388Y

5'TCGGCAAGTACGTTGTCGAACTGCTGGAAG 3'(SEQ ID NO：53)

5'TTCGACAACGTACTTGCCGATATTCGGCAG 3'(SEQ ID NO：54)

the amplification system is as follows: PrimeSTAR Buffer (5X) 10 u L, dNTP (2.5mM)4 u L, recombinant plasmid template 20ng, primers (10 u M) each 2 u L, PrimeSTAR HS high fidelity enzyme 0.5 u L, supplemented double distilled water to 50 u L. The amplification condition is pre-denaturation at 98 ℃ for 1 min; denaturation at 98 ℃ for 10sec, annealing at 68 ℃ and extension for 7min (30 cycles). The PCR product was recovered from the gel, and the gel-recovered product was digested with DpnI enzyme (Fermentas Corp.) at 37 ℃ for 2h to degrade the original template. The digestion products were transformed into E.coli BL21(DE3) -Codonplus-RIL, spread on LB agar plates containing 50. mu.g/mL kanamycin, cultured overnight at 37 ℃, screened for positive clones, and verified by sequencing. Obtaining the recombinant strain of the fructosyl peptide oxidase mutant.

2, construction and screening of saturated mutation library

In this experiment, a simple whole plasmid PCR mutation method was used (

site-directed mutagenesis method) to introduce site-directed saturation mutagenesis. The primer sequences are as follows:

S30 5'CTGATTCGTNNKGGCTATACCCCGTCGAAC 3'(SEQ ID NO：55)

5'GGGTATAGCCMNNACGAATCAGGTGCAGAG 3'(SEQ ID NO：56)

G60 5'AAATTATGNNKATCCGTCTGCGCAATGGT 3'(SEQ ID NO：57)

5'CAGACGGATMNNCATAATTTTGTTCAGGTC 3'(SEQ ID NO：58)

W79 5'CTGGATATGNNKCAAAACGACGAACTGTT 3'(SEQ ID NO：59)

5'CGTCGTTTTGMNNCATATCCAGACTTTCCA 3'(SEQ ID NO：60)

I95 5'GTGGGCATGNNKGATTGCAGCTCTAGTAAAG 3'(SEQ ID NO：61)

5'GCTGCAATCMNNCATGCCCACTTGGTGGAA 3'(SEQ ID NO：62)

S130 5'GCTGGAANNKGAAGACGAAATCCTGGCCAA 3'(SEQ ID NO：63)

5'CAGGATTTCGTCTTCMNNTTCCAGCCAGAC 3'(SEQ ID NO：64)

A138 5'TCCTGGCCAAANNKCCGAATTTTACCCGTG 3'(SEQ ID NO：65)

5'AAAATTCGGMNNTTTGGCCAGGATTTCGTC 3'(SEQ ID NO：66)

N272 5'TTGAACCGNNKGAATACGGCGTCATTAAAG 3'(SEQ ID NO：67)

5'ACGCCGTATTCMNNCGGTTCAAAGAAAAAG 3'(SEQ ID NO：68)

the PCR reaction used Takara's PrimeSTAR HS polymerase under the following conditions: 2min at 98 ℃, then 10sec at 98 ℃, 15sec at 55 ℃ and 7min at 72 ℃ for 25 cycles; finally, 10min at 72 ℃. After the reaction, the PCR amplification product was subjected to 1% agarose gel electrophoresis to obtain a 7kb band, which was consistent with the expected result. After the template was digested with DpnI, the purified PCR product was recovered using Axygen PCR clean up kit and transformed into BL21(DE3) codon plus-RIL competent cells to obtain a saturated mutation library with a library capacity of greater than 300 clones.

A single colony is picked up in a 96-well plate by using a microbial colony screening system Qpix2, 200 mu L of LB culture medium containing 100mg/L Kan is added into each well, the mixture is placed into a shaking table at 37 ℃ for overnight culture at 400rpm, glycerol is added into each well on the next day to enable the final concentration to be 15 percent, and the mixture is frozen at 80 ℃ below zero to be used as a saturated mutation library master plate. 20 mul mother bacteria liquid in the mother plate is absorbed and added into LB culture medium containing 130 mul 100mg/L Kan, and then is put into a shaker at 37 ℃, and cultured at 400rpm until the bacteria liquid is 0D₆₀₀0.6-0.8 (about 4 hours), and then LB medium mixed with IPTG was added to 200. mu.l to a final concentration of 1. mu.M. After inducing at 28 ℃ and 400rpm for 6-8h, centrifuging the 96-well plate filled with the bacterial liquid for 1h by using a high-speed refrigerated centrifuge 4500rpm, taking out and discarding the supernatant, and freezing and storing the thalli in a refrigerator at-80 ℃ overnight. The next day, the 96-well plate is taken out from a refrigerator with the temperature of minus 80 ℃ and naturally melted for 1h at room temperature, then put into the refrigerator for 2h again, and the freezing and thawing are repeated for 3 times in this way to fully crush the cells, 200 mul of 50mM Tris-HCl (pH 8.0) is added, the mixture is placed on a vibrating plate instrument and fully shaken up, and after the mixture is centrifuged for 15 min by a high-speed refrigerated centrifuge 4500rpm, the obtained supernatant is the crude enzyme solution. Adding the supernatant into two 96-well plates respectively, placing one of the plates at room temperature and the other plate in a 45 ℃ water bath to heat for 20min, sucking 25 mu L of enzyme solution from each well of the two plates respectively by a discharging gun, adding the enzyme solution into 100 mu L of substrate, detecting the change of light absorption value in unit time, and screening mutants with improved thermal stability. Sequencing results show that the mutants with improved thermal stability are respectively as follows: a138V, a138I, G60S, G60N, G60A, I95L, and N272D.

Characterization of the Properties of the mutants

Pure enzyme solutions of the fructosyl peptide oxidase site-directed mutagenesis mutants were obtained according to the method of example 2, and the 31 single-point mutants were characterized. The results show that the thermal stability of 10 mutants in the 31 single-point mutants is obviously improved, the catalytic activity of 4 mutants (I171R, G60A, G60N and G60S) is improved, and the thermal stability of the rest 16 mutants is not improved. Table 1 summarizes the enzymatic properties of the mutants with improved thermostability.

We performed additive combinations of mutants with improved stability: using a similar construction method to the single-point mutant, 8 combination mutants were successfully constructed: S30R/G66D, G66D/I95L, A161D/A138I, A161D/N272D, S30R/H388Y, A161D/H388Y, G184D/H388Y, N272D/H388Y, G66D/A161D/H388Y, A161D/N272D/H388Y, G66D/A161D/N272D/H388Y, G66D/A138I/A161D/N272D/H388Y, and express, purify and characterize one by one. The expression amount and soluble protein amount of the combined mutant are obviously improved compared with the wild FPOX-E. All combination mutants showed additive effects of thermostabilization compared to single point mutants. Table two details the enzymatic properties of FPOX-E wild-type enzyme, thermostable mutants, the most stable mutants had a half-life at 42 ℃ approximately 570 times that of the wild-type (Table 1).

TABLE 1 characterization of the enzymatic Properties of FPOX-E wild type and Single Point mutants

In addition, a mutant enzyme with improved thermostability can be obtained by performing deletion mutation at positions 30, 60, 66, 95, 138, 161, 171, 184, 272, 388, or by inserting 1 or more amino acid residues at positions 30, 60, 66, 95, 138, 161, 171, 184, 272, 388.

Example 5 enzymatic assay of glycated hemoglobin content by FPOX-E mutant

1. Reagent preparation

Reagent I: horseradish peroxidase was dissolved in 200mM potassium phosphate buffer (pH7.5) to a final concentration of 1.8U/mL.

And (2) reagent II: 50mM sodium 2-hydroxy-3-m-toluidine propanesulfonate (TOOS) solution.

Reagent III: 45mM 4-aminopyridine (4-AP) solution.

And (4) a reagent IV: the fructosyl peptide oxidase enzyme solution (taking a proper amount of enzyme solution or enzyme freeze-dried powder to be dissolved in a proper amount of 100mM potassium phosphate buffer solution (pH7.5), preparing the enzyme solution with the concentration of 1U/mL, and placing on ice for standby).

Sample preparation: whole blood was collected from the patient and the red blood cells were recovered by natural sedimentation for 10 minutes. mu.L of the settled erythrocytes were mixed with 400. mu.L of a hemolysis buffer (Nippon hydro-therapeutic Co., Ltd.) and dispensed for use.

2. Procedure for the preparation of the

The glycated valine-histidine dipeptide derived from the N-terminus of the beta chain of hemoglobin A1c was cleaved by protease, and the concentration of hemoglobin (Hb) was determined by measuring the difference in absorbance at 600nm and 800 nm.

The reagent solutions of Table 2 were added in sequence and mixed in a cuvette (optical path 1cm) and preheated at 37 ℃ for 5 min.

TABLE 2 reagents related to the detection of glycated hemoglobin

0.02mL of reagent IV is added into the preheated reaction mixture at 37 ℃ and mixed evenly. Measuring absorbance A at 37 deg.C at 555nm for 3 min by ultraviolet spectrophotometer_{Measurement of}. 0.02mL of potassium phosphate buffer was added to the reaction mixture, and the absorbance A was measured under the same conditions_{Blank space}. According to Δ a ═ a_{Measurement of}-A_{Blank space}) The glycated hemoglobin (HbAlc) concentration can be determined.

HbA1c (%) was calculated from the HbA1c concentration and the Hb concentration obtained.

The method can specifically measure glycated dipeptide derived from HbA1c, does not require complicated reagent preparation, has no contamination to reaction cup, is suitable for various automatic analyzers, and has no influence on measurement values due to unstable HbA1c and modified Hb (carbonylation, acetylation, etc.). Compared with HPLC method, the method has good linear relation (figure 2), and the regression equation is that y is 1.025x-0.5857, R²0.9904: the detection sensitivity is 3-16%.

Comparison of FPXO-E mutants with wild type

The FPOX-E mutant of example 4 was changed to FPOX-E wild type and measured using a standard with HbAlc concentration of 8%, the other conditions being identical. The result shows that the HbAlc concentration can be accurately measured by the wild type and the mutant in a short time, but the detection result is obviously distorted after the wild type is placed at 25 ℃ for four days; on the other hand, the mutant (G67D/A162D/H389Y) in example 4 can still accurately measure HbAlc concentration after being placed at 25 ℃ for three months.

TABLE 3 comparison of the thermostability Effect of FPOX-E wild type and mutant enzymes

The other mutant enzymes shown in Table 1 also have similar experimental effects to those shown in Table 3, i.e., they all have more stable performance than wild-type FPOX-E, and can detect HbAlc concentration after being placed at room temperature (25 ℃) for a plurality of days.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Shanghai university of transportation

<120> a group of novel fructosyl peptide oxidases and uses thereof

<130> < introduction after filing >

<160> 68

<170> PatentIn version 3.5

<210> 1

<211> 1314

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 1

atggcccatt cacgcgcaag caccaaagtt gtcgtcgtcg gcggcggcgg caccatcggt 60

agttccacgg ctctgcacct gattcgttcg ggctataccc cgtcgaacat tacggtgctg 120

gatgtttaca aaaccccgtc gctgcagagc gcaggtcatg acctgaacaa aattatgggc 180

atccgtctgc gcaatggtcc ggatctgcag ctgtctctgg aaagtctgga tatgtggcaa 240

aacgacgaac tgtttaaacc gtttttccac caagtgggca tgattgattg cagctctagt 300

aaagaaggta tcgaaaatct gcgtcgcaag tatcaaaccc tgctggatgc gggcattggt 360

ctggaaaaaa cgaacgtctg gctggaatcc gaagacgaaa tcctggccaa agcaccgaat 420

tttacccgtg aacaggttaa aggctggaag ggtctgttct gtacggatgg cggttggctg 480

gcggcggcaa aagccattaa tgcaattggc atctttctgc aagacaaagg cgtgaagttc 540

ggttttggcg gtgcgggtac ctttcagcaa ccgctgttcg ctgcggatgg caaaacctgc 600

atcggtctgg aaaccacgga tggcacgaaa tactttgccg acaaggtggt tctggccgca 660

ggtgcatggt ctccgaccct ggtggatctg gaagaccagt gtgttagtaa agcgtgggtc 720

ttcgcgcata ttcaactgac gccgaaagaa gctgatgcgt ataagaacgt tccggtcgtg 780

tatgacggcg aatacggctt tttctttgaa ccgaatgaat acggcgtcat taaagtgtgc 840

gatgaatttc cgggtttttc ccgtttcaag ctgcaccagc cgtatggcgc tgcgtcaccg 900

aaaatgatct cggtgccgcg cagccatgca aagcacccga ccgatacgta cccggacgcg 960

agcgaagtta ccattcgtaa agccatcgca cgctttctgc cggaatttaa ggataaggaa 1020

ctgttcaacc gtacgatgtg ctggtgtacc gatacggctg acgcgaacct gctgatttgt 1080

gaacatccga aatggaagaa ttttatcctg gccaccggcg attccggtca ttcattcaaa 1140

ctgctgccga atatcggcaa gcacgttgtc gaactgctgg aaggctccct gtcacaggaa 1200

atggcaggtg catggcgttg gcgtccgggc ggtgatgcac tgcgcagccg tcgcggcgct 1260

ccggcaaaag atctggctga aatgccgggt tggaagcatg acgcccacct gtaa 1314

<210> 2

<211> 437

<212> PRT

<213> Eupenicillium terrenum

<400> 2

Met Ala His Ser Arg Ala Ser Thr Lys Val Val Val Val Gly Gly Gly

1 5 10 15

Gly Thr Ile Gly Ser Ser Thr Ala Leu His Leu Ile Arg Ser Gly Tyr

20 25 30

Thr Pro Ser Asn Ile Thr Val Leu Asp Val Tyr Lys Thr Pro Ser Leu

35 40 45

Gln Ser Ala Gly His Asp Leu Asn Lys Ile Met Gly Ile Arg Leu Arg

50 55 60

Asn Gly Pro Asp Leu Gln Leu Ser Leu Glu Ser Leu Asp Met Trp Gln

65 70 75 80

Asn Asp Glu Leu Phe Lys Pro Phe Phe His Gln Val Gly Met Ile Asp

85 90 95

Cys Ser Ser Ser Lys Glu Gly Ile Glu Asn Leu Arg Arg Lys Tyr Gln

100 105 110

Thr Leu Leu Asp Ala Gly Ile Gly Leu Glu Lys Thr Asn Val Trp Leu

115 120 125

Glu Ser Glu Asp Glu Ile Leu Ala Lys Ala Pro Asn Phe Thr Arg Glu

130 135 140

Gln Val Lys Gly Trp Lys Gly Leu Phe Cys Thr Asp Gly Gly Trp Leu

145 150 155 160

Ala Ala Ala Lys Ala Ile Asn Ala Ile Gly Ile Phe Leu Gln Asp Lys

165 170 175

Gly Val Lys Phe Gly Phe Gly Gly Ala Gly Thr Phe Gln Gln Pro Leu

180 185 190

Phe Ala Ala Asp Gly Lys Thr Cys Ile Gly Leu Glu Thr Thr Asp Gly

195 200 205

Thr Lys Tyr Phe Ala Asp Lys Val Val Leu Ala Ala Gly Ala Trp Ser

210 215 220

Pro Thr Leu Val Asp Leu Glu Asp Gln Cys Val Ser Lys Ala Trp Val

225 230 235 240

Phe Ala His Ile Gln Leu Thr Pro Lys Glu Ala Asp Ala Tyr Lys Asn

245 250 255

Val Pro Val Val Tyr Asp Gly Glu Tyr Gly Phe Phe Phe Glu Pro Asn

260 265 270

Glu Tyr Gly Val Ile Lys Val Cys Asp Glu Phe Pro Gly Phe Ser Arg

275 280 285

Phe Lys Leu His Gln Pro Tyr Gly Ala Ala Ser Pro Lys Met Ile Ser

290 295 300

Val Pro Arg Ser His Ala Lys His Pro Thr Asp Thr Tyr Pro Asp Ala

305 310 315 320

Ser Glu Val Thr Ile Arg Lys Ala Ile Ala Arg Phe Leu Pro Glu Phe

325 330 335

Lys Asp Lys Glu Leu Phe Asn Arg Thr Met Cys Trp Cys Thr Asp Thr

340 345 350

Ala Asp Ala Asn Leu Leu Ile Cys Glu His Pro Lys Trp Lys Asn Phe

355 360 365

Ile Leu Ala Thr Gly Asp Ser Gly His Ser Phe Lys Leu Leu Pro Asn

370 375 380

Ile Gly Lys His Val Val Glu Leu Leu Glu Gly Ser Leu Ser Gln Glu

385 390 395 400

Met Ala Gly Ala Trp Arg Trp Arg Pro Gly Gly Asp Ala Leu Arg Ser

405 410 415

Arg Arg Gly Ala Pro Ala Lys Asp Leu Ala Glu Met Pro Gly Trp Lys

420 425 430

His Asp Ala His Leu

435

<210> 3

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 3

atcgcacata tggcccattc acgcgcaagc a 31

<210> 4

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 4

atcggactcg agttacaggt gggcgtcatg ctt 33

<210> 5

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 5

tagttccacg gcttaccacc tgattcgttc 30

<210> 6

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 6

gaatcaggtg gtaagccgtg gaactaccga 30

<210> 7

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 7

ctgattcgtc gtggctatac cccgtcgaac 30

<210> 8

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 8

gggtatagcc acgacgaatc aggtgcagag 30

<210> 9

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 9

ctggataagt acaaaacccc gtcgctg 27

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 10

ggggttttgt acttatccag caccgtaatg 30

<210> 11

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 11

tctgcgcaat gatccggatc tgcagctgtc 30

<210> 12

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 12

tgcagatccg gatcattgcg cagacggatg 30

<210> 13

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 13

gtccggatct gcggctgtct ctggaaagtc 30

<210> 14

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 14

tccagagaca gccgcagatc cggaccattg 30

<210> 15

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 15

tggatatgtg gcggaacgac gaactgttta 30

<210> 16

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 16

ttcgtcgttc cgccacatat ccagactttc 30

<210> 17

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 17

atatgtggca agaagacgaa ctgtttaaac 30

<210> 18

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 18

acagttcgtc ttcttgccac atatccagac 30

<210> 19

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 19

tttaaaccgt tttaccacca agtgggcatg 30

<210> 20

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 20

cacttggtgg taaaacggtt taaacagttc 30

<210> 21

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 21

agaagagatc gaaaatctgc gtcgcaagta 30

<210> 22

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 22

agattttcga tctcttcttt actagagctg 30

<210> 23

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 23

aaaaaacgaa ccactggctg gaatccgaag 30

<210> 24

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 24

attccagcca gtggttcgtt ttttccagac 30

<210> 25

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 25

aagacgaaat ccgggccaaa gcaccgaatt 30

<210> 26

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 26

tgctttggcc cggatttcgt cttcggattc 30

<210> 27

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 27

cgaaatcctg cggaaagcac cgaattttac 30

<210> 28

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 28

attcggtgct ttccgcagga tttcgtcttc 30

<210> 29

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 29

tcctggccaa atacccgaat tttacccgtg 30

<210> 30

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 30

aaaattcggg tatttggcca ggatttcgtc 30

<210> 31

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 31

ctggatgcgg caaaagccat taatgcaatt 30

<210> 32

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 32

tgccgcatcc agccaaccgc catccgtaca 30

<210> 33

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 33

atgcaattgg caggtttctg caagacaaag 30

<210> 34

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 34

tcttgcagaa acctgccaat tgcattaatg 30

<210> 35

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 35

attggcatcg agctgcaaga caaaggcgtg 30

<210> 36

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 36

ttgtcttgca gctcgatgcc aattgcatta 30

<210> 37

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 37

ttttggcgat gcgggtacct ttcagcaac 29

<210> 38

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 38

gtacccgcat cgccaaaacc gaacttcac 29

<210> 39

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 39

ttttggcaaa gcgggtacct ttcagcaa 28

<210> 40

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 40

gtacccgctt tgccaaaacc gaacttca 28

<210> 41

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 41

ggcggtgcga ctacctttca gcaaccgctg 30

<210> 42

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 42

tgaaaggtag tcgcaccgcc aaaaccgaac 30

<210> 43

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 43

ggatggcaaa cgctgcatcg gtctggaaac 30

<210> 44

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 44

ccgatgcagc gtttgccatc cgcagcgaac 30

<210> 45

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 45

cctggtgaag ctggaagacc agtgtgttag 30

<210> 46

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 46

cttccagctt caccagggtc ggagaccatg 30

<210> 47

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 47

aaacgatggg tcttcgcgca tattcaactg 30

<210> 48

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 48

cgcgaagacc catcgtttac taacacactg 30

<210> 49

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 49

ttgaaccgga tgaatacggc gtcattaaag 30

<210> 50

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 50

acgccgtatt catccggttc aaagaaaaag 30

<210> 51

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 51

ctgacgcgca cctgctgatt tgtgaacatc 30

<210> 52

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 52

acaaatcagc aggtgcgcgt cagccgtatc 30

<210> 53

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 53

tcggcaagta cgttgtcgaa ctgctggaag 30

<210> 54

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<400> 54

ttcgacaacg tacttgccga tattcggcag 30

<210> 55

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (10)..(11)

<223> n is a, c, g, or t

<400> 55

ctgattcgtn nkggctatac cccgtcgaac 30

<210> 56

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (12)..(13)

<223> n is a, c, g, or t

<400> 56

gggtatagcc mnnacgaatc aggtgcagag 30

<210> 57

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (9)..(10)

<223> n is a, c, g, or t

<400> 57

aaattatgnn katccgtctg cgcaatggt 29

<210> 58

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (11)..(12)

<223> n is a, c, g, or t

<400> 58

cagacggatm nncataattt tgttcaggtc 30

<210> 59

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (10)..(11)

<223> n is a, c, g, or t

<400> 59

ctggatatgn nkcaaaacga cgaactgtt 29

<210> 60

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (12)..(13)

<223> n is a, c, g, or t

<400> 60

cgtcgttttg mnncatatcc agactttcca 30

<210> 61

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (10)..(11)

<223> n is a, c, g, or t

<400> 61

gtgggcatgn nkgattgcag ctctagtaaa g 31

<210> 62

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (11)..(12)

<223> n is a, c, g, or t

<400> 62

gctgcaatcm nncatgccca cttggtggaa 30

<210> 63

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (8)..(9)

<223> n is a, c, g, or t

<400> 63

gctggaannk gaagacgaaa tcctggccaa 30

<210> 64

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (17)..(18)

<223> n is a, c, g, or t

<400> 64

caggatttcg tcttcmnntt ccagccagac 30

<210> 65

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (12)..(13)

<223> n is a, c, g, or t

<400> 65

tcctggccaa annkccgaat tttacccgtg 30

<210> 66

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (11)..(12)

<223> n is a, c, g, or t

<400> 66

aaaattcggm nntttggcca ggatttcgtc 30

<210> 67

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (9)..(10)

<223> n is a, c, g, or t

<400> 67

ttgaaccgnn kgaatacggc gtcattaaag 30

<210> 68

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial primer

<220>

<221> misc_feature

<222> (13)..(14)

<223> n is a, c, g, or t

<400> 68

acgccgtatt cmnncggttc aaagaaaaag 30

Claims

1. A fructosyl peptide oxidase having improved thermostability, wherein the fructosyl peptide oxidase has a mutation compared to SEQ ID NO:2, the mutation being selected from any one of:

serine at position 30 is replaced with arginine; or

Glycine at position 60 is substituted with serine; or

Glycine at position 66 is replaced by aspartic acid; or

Isoleucine at position 95 is replaced with leucine; or

Alanine at position 138 is substituted with valine or isoleucine; or

Alanine at position 161 substituted with aspartic acid; or

Glycine 184 is replaced by aspartic acid; or

Asparagine at position 272 is replaced with aspartic acid; or

Histidine at position 388 substituted with tyrosine; or

Serine at position 30 is replaced with arginine and glycine at position 66 is replaced with aspartic acid; or

Glycine at position 66 is replaced by aspartic acid and isoleucine at position 95 is replaced by leucine; or

Alanine at position 161 substituted with aspartic acid and alanine at position 138 substituted with isoleucine; or

Alanine at position 161 substituted with aspartic acid and asparagine at position 272 substituted with aspartic acid; or

Serine at position 30 is replaced with arginine and histidine at position 388 is replaced with tyrosine; or

Alanine at position 161 substituted with aspartic acid and histidine at position 388 substituted with tyrosine; or

Glycine 184 is replaced by aspartic acid and histidine 388 is replaced by tyrosine; or

Asparagine at position 272 substituted with aspartic acid and histidine at position 388 substituted with tyrosine; or

Glycine at position 66 is replaced by aspartic acid, alanine at position 161 is replaced by aspartic acid and histidine at position 388 is replaced by tyrosine; or

Alanine at position 161 substituted with aspartic acid, asparagine at position 272 substituted with aspartic acid, and histidine at position 388 substituted with tyrosine; or

Glycine at position 66 is substituted with aspartic acid, alanine at position 161 is substituted with aspartic acid, asparagine at position 272 is substituted with aspartic acid and histidine at position 388 is substituted with tyrosine; or

Glycine at position 66 was replaced by aspartic acid, alanine at position 138 was replaced by isoleucine, alanine at position 161 was replaced by aspartic acid, asparagine at position 272 was replaced by aspartic acid and histidine at position 388 was replaced by tyrosine.

2. A polynucleotide encoding the fructosyl peptide oxidase of claim 1.

3. An expression vector comprising the polynucleotide of claim 2.

4. A genetically engineered cell comprising the expression vector of claim 3 or a polynucleotide of claim 2 integrated into its genome.

5. A method for improving the thermostability of a fructosyl peptide oxidase, which comprises using the fructosyl peptide oxidase according to claim 1.

6. Use of the fructosyl peptide oxidase of claim 1 in an oxidative desugarization reaction of a maillard compound.

7. The use of claim 6, wherein the medlars compound is glycated hemoglobin and its proteolytic derivatives.

8. A kit or a sensor for measuring glycated hemoglobin, comprising the fructosyl peptide oxidase of claim 1.