CN115011676A - A kind of detection method and application of gene polymorphism locus related to sheep meat tenderness - Google Patents

Abstract

The invention discloses a detection method and application of a gene polymorphism site related to sheep meat tenderness. The genetic polymorphism of sheep CCN5 gene in the population was analyzed by sequencing technology, and the correlation analysis was carried out by combining with individual meat quality data. Sheep herds for early selection.

Description

A kind of detection method and application of gene polymorphism locus related to sheep meat tenderness

technical field

The invention belongs to the field of gene detection and livestock and poultry breed improvement and breeding, and particularly relates to the identification of a single nucleotide polymorphism (SNP) marker related to the tenderness of sheep meat.

Background technique

With the economic progress, the continuous improvement of residents' living standards, and the vigorous development of the catering industry, mutton has become more and more popular among the public. As the demand for mutton increases, people's requirements for its meat quality also increase. In recent years, breeders have gradually shifted their research direction to the improvement of sheep meat quality traits. The overall quality of mutton is affected by a variety of factors, such as intramuscular fat content, which can significantly affect the tenderness of meat; unsaturated fatty acids in mutton not only affect the flavor of mutton, but also are essential nutrients for the human body. By exploring the relationship between candidate genes that affect sheep meat quality traits and their mutated sites and the differences in meat quality traits in sheep populations, it provides an important basis for molecular breeding of sheep to improve meat quality. Earlier studies revealed the regularity of gene expression related to the differentiation process of preadipocytes in Small Tail Han sheep (DOI: 10.16431/j.cnki.1671-7236.2019.07.018.), but the main genes affecting meat quality traits have not been identified.

Cellular communication network factor 5 (CCN5) is involved in many physiological processes in the body, such as cell adhesion, proliferation, differentiation, migration, and maturation. Studies have shown that CCN5 gene can affect the proliferation and differentiation of mesenchymal stem cells (MSCs), and participate in the body's fat metabolism. However, there are few studies on the CCN5 gene in livestock meat quality, and the regulatory role that affects the body's meat quality traits is still unclear. At present, the exploration of CCN5 gene SNP markers is stagnant.

SUMMARY OF THE INVENTION

The object of the present invention is to provide a detection method and application of a gene polymorphism site related to sheep meat tenderness, and to provide a fast and effective method for selecting sheep individuals with relatively high intramuscular fat content in a fixed population, To provide a basis for breeding to improve sheep meat quality.

To achieve the above object, the present invention has adopted the following technical solutions:

A method for detecting single nucleotide polymorphism of sheep CCN5 gene, comprising the following steps:

A partial fragment of CCN5 gene was amplified by PCR using sheep genomic DNA or DNA contained in isolated sheep biological material, and the genotype of the single nucleotide polymorphism site in exon 5 of CCN5 gene was identified by this fragment.

Preferably, the single nucleotide polymorphism site is located at chr.13:7625253, and this site has a C-G mutation in a sheep (eg, Small Tail Han sheep) population.

Preferably, the primers of the PCR are:

Upstream primer: 5'-AACGGAGGGAAGGACATCAAAT-3' (ie SEQ.ID.NO.1)

Downstream primer: 5'-AGCGGCTGACATAGAGTTTCCA-3' (ie SEQ.ID.NO.2).

Preferably, the in vitro biological material of sheep is blood collected from sheep individuals.

Preferably, the PCR reaction system includes: 50-150 ng/μL sheep genomic DNA 1-2 μL or sheep blood sample 1-2 μL, and 10-20 μmol/L upstream and downstream primers each 0.4-0.5 μL.

Preferably, the PCR reaction conditions include: 94°C for 5 min; 94-95°C for 30s, 55-65°C for 30s, 72°C for 16s, a total of 35 cycles; and 72°C for 8min.

Preferably, the identification of the genotype specifically includes the following steps: sequencing the fragment, and then aligning the sequencing result with the reference sequence.

A detection kit for sheep CCN5 gene single nucleotide polymorphism, the kit includes a locus for identifying the genotype of the CCN5 gene exon 5 single nucleotide polymorphism site by a PCR-sequencing method Spot amplification primers (eg, the upstream and downstream primers described above).

The application of the above-mentioned sheep CCN5 gene single nucleotide polymorphism detection method in sheep molecular marker-assisted selection breeding.

Preferably, the individual whose genotype of the single nucleotide polymorphism site (specifically chr. 13:7625253) is CG or CC is better in meat quality.

Preferably, the meat quality trait is selected from intramuscular fat content.

Preferably, the sheep are selected from Small Tail Han sheep.

The beneficial effects of the present invention are embodied in:

According to the discovered SNP site located in the 5th exon of the CCN5 gene, the present invention can not only realize the rapid and accurate typing of the CCN5 gene of the sheep (eg, small-tailed Han sheep) population. And based on the significant correlation between this locus and individual meat quality traits, molecular markers (ie SNP markers) can be used to screen sheep individuals with good meat quality (such as tenderness) at an early stage, thereby improving the breeding of dominant meat sheep (such as Small Tail Han sheep). speed.

Further, compared with the traditional typing method, the present invention has the advantages of short time-consuming, high success rate, more intuitive results, and the ability to identify and select in large batches by identifying genotypes by sequencing.

Description of drawings

Figure 1 is the electrophoresis image of the amplification product of the partial region of the CCN5 gene exon 5 of the small-tailed Han sheep; the five lanes on the right side of the Marker in the figure are samples from different individuals.

Figure 2 shows the sequencing map of the partial region of exon 5 of the CCN5 gene of the small-tailed Han sheep; WE5-25-W5R_E02/F02/G02/H02/A03/B03/C03.ab1RC in the figure represents different individual samples.

Figure 3 is a sequence peak diagram of different genotypes of the CCN5 gene (exon 5) of the small-tailed Han sheep; wherein: A is the CC genotype, B is the GG genotype, and C is the CG genotype.

Detailed ways

The present invention will be described in further detail below with reference to the accompanying drawings and embodiments. The embodiments are only used to explain the present invention, but not to limit the protection scope of the present invention.

(1) Screening of candidate regions of sheep genome

In the present invention, the representative mutton sheep breed, Small Tail Han sheep, is selected as the experimental object. In the early stage of the laboratory, the differentially expressed genes during the differentiation of experimental sheep adipocytes were detected by transcriptome sequencing technology. The results showed that the CCN5 gene was related to the fat metabolism of the experimental sheep and could affect the meat quality of the experimental sheep. The latter finding has not been reported before. Subsequent experimental detection found that there is only one potential SNP site in exon 5 of CCN5 gene. Therefore, this locus was correlated with the experimental mutton meat quality data, in an attempt to prove that the CCN5 gene has SNP markers related to mutton meat quality traits (for details, please refer to the following experimental content).

(2) Sheep sample collection and CCN5 gene exon 5 mutation detection

1. Sample Collection

In October 2021, blood samples were collected from Small Tail Han sheep raised by the Jilin Academy of Agricultural Sciences in Changchun City, Jilin Province. Blood samples were obtained through jugular vein blood collection, and the collected blood was stored in anticoagulation tubes and stored in a 4°C refrigerator. A total of 96 6-month-old Small Tail Han sheep were collected.

2. Mutation detection strategy

According to the sheep CCN5 gene sequence, specific primers were designed, and then the DNA fragment in the exon 5 region of the CCN5 gene was cloned by PCR, and the DNA fragment was detected by direct sequencing technology to obtain sequence information, and then determined according to the sheep genome reference sequence. Mutations in exon 5 of the CCN5 gene in the sample.

3. Primer Design

Take sheep CCN5 gene DNA sequence as reference (gene ID number: XM_027977228.2) to design a pair of primers, the primer sequences are as follows, and the length of the target fragment is 745bp:

CCN5 gene exon5 upstream primer: 5'-AACGGAGGGAAGGACATCAAAT-3'

CCN5 gene exon5 downstream primer: 5'-AGCGGCTGACATAGAGTTTCCA-3'

Primers were synthesized by Suzhou Jinweizhi Biological Co., Ltd.

4. PCR Amplification

Genomic DNA was extracted from the collected blood samples of Small Tail Han sheep and used as a template to determine the optimal test temperature by gradient PCR test.

Add the PCR reaction system to a 200 μL PCR centrifuge tube: 10 μL of 2×Master Mix, 0.5 μL of upstream primers (10 μmol/L), 0.5 μL of downstream primers (10 μmol/L), 1 μL of genomic DNA (about 50 ng/μL), using ddH Make up to 20 μL of ₂ O.

Place the PCR centrifuge tube in the PCR machine, and set the reaction conditions as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30s; gradient annealing at 55°C-65°C for 30s; extension at 72°C for 16s, starting from the second step for 35 cycles ; After the cycle is completed, extend at 72 °C for 8 min; store at 4 °C.

Take 5 μL of PCR products and use 2% agarose gel for electrophoresis in 1×TBE for 20 min. The final annealing temperature is determined based on the brightness and clarity of the strips.

After determining the final annealing temperature, use the full gold blood PCR kit, take the collected sheep blood sample as the template, and carry out the amplification of the target fragment according to the following PCR reaction system:

10 μL of 2×Master Mix, 0.4 μL of 10 μmol/L upstream and downstream primers, 1 μL of blood, and make up to 20 μL with ddH ₂ O.

The preparation of the PCR reaction system was operated on ice, and it was put into the PCR machine after being thoroughly mixed. The final PCR reaction conditions were: 94°C for 5 min; 95°C for 30s, annealing at 60°C for 30s, 72°C for 16s, a total of 35 cycles; 72°C for 8 min.

After the reaction, 5 μL of PCR products were taken and detected by electrophoresis in 1×TBE with 2% agarose gel. The detection results are shown in FIG. 1 .

5. Fragment Sequencing and Sequence Analysis

The product of the 745bp target fragment amplified by PCR was subjected to band recovery, and then directly subjected to Sanger sequencing.

Referring to Figure 2, the sample sequencing results were compared with the reference genome sequence (gene ID number: XM_027977228.2) to determine a mutation site (position chr.13:7625253) existing in the fifth exon of the CCN5 gene, C-G mutation occurs, that is, the coding sequence is mutated from the original GTA to CTA, and a missense mutation (the coding amino acid is valine is mutated to leucine) is formed. The mutant sequence/wild-type sequence is as follows:

GACCCCAGTTTTCTGGCTTTGTCGCTCCCCCAGCCCCTGGCGTCTCCTGCCCGGAATGGAGCACCGCCTGGGGTCCCTGCTCGACCACCTGCGGCCTGGGCGTGGCCACCCGAGTGTCCAATCAGAACCGTTTCTGCCGCCTGGAGACCCAGCGCCGCCTGTGC(C/G)TACTGGGGCCCTGCCCACCCGCCAGGGGCCACGGCCCAAGGAGCAGAGCCTTTTAG

(3) Analysis of sheep CCN5 gene polymorphism

After Sanger sequencing, there will be two results after the comparison. If different genotypes appear in the overall sequence alignment results (Figure 2), use the results shown in Figure 3 to check the specific sequence (genotype) of the individual. ). The results showed that the 5th exon of CCN5 gene produced three genotypes of CC, CG and GG in the collected Small Tail Han sheep population. Among them, 36 were GG genotype, 12 were CC genotype, 48 were CG genotype, and G was the dominant allele.

Further analysis results showed (Table 1) that the mutation site in the fifth exon of CCN5 gene was a SNP site.

Table 1. Gene frequency, genotype frequency and genetic index of CCN5 gene in Small-tailed Han sheep

(4) Association analysis between genetic variation of CCN5 gene and meat quality traits in sheep

Meat quality data: The pH value, shear force, meat color, water retention rate, tenderness, and intramuscular fat content of the longissimus dorsi muscle of the above 96 6-month-old Small Tail Han sheep were detected.

Genotype data: The genotype (CC, CG or GG) of the CCN5 gene of the above 96 6-month-old Small Tail Han sheep.

Table 2. Results of significant differences in meat quality traits of each genotype of CCN5 gene in Small-tailed Han sheep

Note: Different shoulder letters represent significant differences, with statistical significance (P<0.05).

Referring to Table 2, through the joint analysis of each genotype and actual meat quality traits in the small-tailed Han sheep population, it was found that the individuals with the CG genotype and the CC genotype had significantly greater intramuscular fat content than those with the GG genotype. The meat tenderness of individuals with C allele was significantly higher than that of homozygous wild-type (GG) individuals. And the experimental and analysis results showed that this SNP locus of CCN5 gene had no significant correlation with other meat quality traits except for meat tenderness.

Combined with the above correlation analysis results, it can be inferred that: due to the mutation of the 5th exon of the sheep CCN5 gene to produce different amino acids, the protein secondary structure and the conformation of the protein tertiary structure change, resulting in different genotypes. Differences in meat quality traits, that is, differences in meat tenderness.

In a word, the present invention analyzes the genetic polymorphism of sheep CCN5 gene by Sanger sequencing technology and performs correlation analysis in combination with meat quality data, and reveals from the molecular level a candidate gene affecting the tenderness of sheep meat, namely CCN5 gene, and can be based on The polymorphic loci on the CCN5 gene can be used for early selection of sheep populations with superior meat tenderness, thereby providing theoretical basis and scientific basis for the breeding of high-quality sheep.

<110> Jilin Academy of Agricultural Sciences

<120> A kind of detection method and application of gene polymorphism locus related to sheep meat tenderness

<160> 3

<210> 1

<211> 22

<212> DNA

<213> Synthetic

<400> 1

aacggaggga aggacatcaa at 22

<210> 2

<211> 22

<212> DNA

<213> Synthetic

<400> 2

agcggctgac atagagtttc ca 22

<210> 3

<211> 221

<212> DNA

<213> Reference sequence of the region near the SNP site of the 5th exon of the sheep CCN5 gene

<400> 3

gaccccagtt ttctggcttt gtcgctcccc cagcccctgg cgtctcctgc ccggaatgga 60

gcaccgcctg gggtccctgc tcgaccacct gcggcctggg cgtggccacc cgagtgtcca 120

atcagaaccg tttctgccgc ctggagaccc agcgccgcct gtgcgtactg gggccctgcc 180

cacccgccag gggccacggc ccaaggagca gagcctttta g 221

Claims (10)

1. a detection method of sheep CCN5 gene single nucleotide polymorphism, is characterized in that: comprise the following steps: A partial fragment of CCN5 gene was amplified by PCR using sheep genomic DNA or DNA contained in isolated sheep biological material, and the genotype of the single nucleotide polymorphism site in exon 5 of CCN5 gene was identified by this fragment. 2. the detection method of a kind of sheep CCN5 gene single nucleotide polymorphism according to claim 1, is characterized in that: described single nucleotide polymorphism site is located at chr.13:7625253, and this site is located at chr.13:7625253 C-G mutations are present in sheep populations. 3. the detection method of a kind of sheep CCN5 gene single nucleotide polymorphism according to claim 1, is characterized in that: the primer of described PCR is: Upstream primer: 5'-AACGGAGGGAAGGACATCAAAT-3' Downstream primer: 5'-AGCGGCTGACATAGAGTTTCCA-3'. 4 . The method for detecting a single nucleotide polymorphism of a sheep CCN5 gene according to claim 1 , wherein the in vitro biological material of the sheep is blood collected from an individual sheep. 5 . 5 . The method for detecting single nucleotide polymorphism of sheep CCN5 gene according to claim 1 , wherein the PCR reaction system comprises: 50-150 ng/μL sheep genomic DNA 1-2 μL or sheep blood sample. 6 . 1-2 μL, and 0.4-0.5 μL of 10-20 μmol/L upstream and downstream primers; the PCR reaction conditions include: 94°C for 5 min; 94-95°C for 30s, 55-65°C for 30s, 72°C for 16s, a total of 35 cycle; 72 ℃ 8min. 6. the detection method of a kind of sheep CCN5 gene single nucleotide polymorphism according to claim 1, is characterized in that: the identification of described genotype specifically comprises the following steps: described fragment is sequenced, then sequenced result Alignment with reference sequence. 7. A detection kit for sheep CCN5 gene single nucleotide polymorphism, characterized in that: the test kit comprises a single nucleotide polymorphism site for identifying CCN5 gene exon 5 by PCR-sequencing method Amplification primers for the locus of the genotype of the spot. 8. The application of the method for detecting single nucleotide polymorphism of CCN5 gene in sheep as claimed in claim 1 in molecular marker-assisted selection breeding of sheep. 9. The application according to claim 8, wherein the single nucleotide polymorphism site is located at chr.13:7625253, and the genotype of this site is CG or CC. excellent. 10. The use according to claim 9, wherein the meat quality traits are selected from intramuscular fat content.

Images