CN115011591B

CN115011591B - RNAi molecule preparation method for inhibiting growth and development of mikania micrantha

Info

Publication number: CN115011591B
Application number: CN202210757663.2A
Authority: CN
Inventors: 刘博�; 钱万强; 欧正慧; 乔曦; 申时才; 万方浩
Original assignee: Agricultural Genomics Institute at Shenzhen of CAAS
Current assignee: Agricultural Genomics Institute at Shenzhen of CAAS
Priority date: 2022-06-29
Filing date: 2022-06-29
Publication date: 2023-12-19
Anticipated expiration: 2042-06-29
Also published as: CN115011591A

Abstract

The invention discloses a preparation method of RNAi molecules for inhibiting the growth and development of mikania micrantha, which adopts an RNA interference technology, wherein RNA interference is an important defense mechanism formed in the long-term evolution process of plants, the RNAi technology is utilized to inhibit the root system development of the plants, so that the diffusion of mikania micrantha can be effectively controlled, and a theoretical basis is provided for the research on the targeted prevention and control technology for inhibiting the growth and development capability of mikania micrantha through the RNA interference technology in the biological prevention and control practice; the clear gene AtEXPA4 in the arabidopsis is screened out to have functions related to root system development, and the main function of the gene is to knock out the AtEXPA4 gene so as to enable the main root to grow slowly. By using Blastp comparison, the value of e-value is used<e ^‑5 As a standard, the gene Mm14G033446 was selected as a target and the corresponding RNAi molecule was designed.

Description

RNAi molecule preparation method for inhibiting growth and development of mikania micrantha

Technical Field

The invention relates to the field of biological prevention and control, in particular to a preparation method of RNAi molecules for inhibiting growth and development of mikania micrantha.

Background

The mikania micrantha, also called eupatorium adenophorum or eupatorium adenophorum, is a perennial grass or woody vine plant of the asteraceae, the eupatorium adenophorum, is used as an invasive weed, has high growth speed, has the capability of festival rooting on root systems, has extremely strong reproductive capacity, and causes great economic loss on local agriculture and forestry production due to the invasion of mikania micrantha;

chinese patent: CN202210230108.4 a biological method for inhibiting rapid growth of mikania micrantha, safety determination of mikania micrantha on non-target organisms; determining the infection process of the rust bacteria of the mikania micrantha; determining the growth phenotype of the mikania micrantha for inhibiting mikania micrantha; determination of inhibition of mikania micrantha synthesis by mikania micrantha; determination of inhibition of photosynthesis of mikania micrantha by mikania micrantha. According to the invention, through measurement of net photosynthetic rate and stomatal conductance of mikania micrantha leaves and analysis of content of related metabolites of the Calvin cycle pathway, it is found that after mikania micrantha is infected, the photosynthetic rate and the stomatal conductance of the mikania micrantha leaves can be remarkably reduced, and the content of related compounds of the Calvin cycle pathway can be inhibited, wherein the net photosynthetic rate is reduced by 10.57%, the stomatal conductance is reduced by 26.03%, and the content of related compounds of the Calvin cycle pathway is reduced by 1.9 to 3.4 times.

Analysis according to the prior art and the above patent gives rise to the following problems: the growth of the mikania micrantha root system is not directly inhibited, but is inhibited by adopting an infection process, and the inhibition effect is weak fundamentally even though a certain inhibition effect exists.

Disclosure of Invention

Therefore, in order to solve the above-mentioned shortcomings, the present invention provides a method for preparing RNAi molecules for inhibiting the growth and development of mikania micrantha.

In order to achieve the above purpose, the present invention adopts the following technical scheme: a method for preparing RNAi molecules for inhibiting the growth and development of mikania micrantha, which comprises the following steps:

s1, screening root system development genes of mikania micrantha;

screening out the definite gene AtEXPA4 in Arabidopsis thaliana of a model species by adopting a literature collection and arrangement method, wherein the gene has the function related to root development, the main function is that the AtEXPA4 gene is knocked out to enable the main root to grow slowly, and the comparison genomics method is utilized, and the comparison is carried out by Blastp, so that the E-value is obtained<e ^-5 Screening out key candidate genes as standards, and identifying specific sequences of the key candidate genes through homologous comparison;

functional verification gene: atEXPA4; the functions are as follows: the AtEXPA4 gene is knocked out to enable the main root to grow slowly; genes screened after Blastp alignment: mm14G033446; identity:84.49; e-value:1.39e ^-160 ；

S2 cloning a target gene;

preparation of S3 dsRNA.

Preferably, the cloning steps of the S2 target gene are as follows:

s2.1 total RNA extraction, cDNA first strand synthesis:

total RNA of mikania micrantha leaves is extracted by adopting a fuji kit method, the purity of the RNA of a sample is detected by an ultraviolet spectrophotometer, and cDNA synthesis is carried out by referring to the kit instruction book of YESEN company.

Cloning of S2.2 gene;

according to the sequence of the screened gene Mm14G033446, a Primer design software Primer Premier 5 is used for designing an amplification forward Primer (F) and a reverse Primer (R), and the target fragment is amplified, wherein an amplification system is as follows: 1. Mu.L of template cDNA, 0.5. Mu.L of primer F, 0.5. Mu.L of primer R, 2X Hieff Robust Master Mix 12.5.5. Mu.L and 10.5. Mu.L of ddH2O, carrying out amplification on a PCR instrument after centrifugal mixing, carrying out pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 10s, annealing at 55 ℃ for 20s and extension at 72 ℃ for 10s, and circulating 34 times; finally extending at 72 ℃ for 7min, and then storing at4 ℃ for standby;

preparing 50mL of 1.5% agarose gel, loading the PCR product into the gel, detecting (110 v,45 min) by using a Bio-Red electrophoresis apparatus, observing the result under an ultraviolet imager, then performing gel cutting recovery, and performing product recovery by using a DNA gel purification recovery kit to obtain a target fragment;

the pUCm-T Vector cloning kit is used to link the target fragment with the Vector, and the reaction system is: insert 3. Mu.L, pUCm-T Vector 1. Mu.L, 10 XLication Buffer 1. Mu.L, 50% PEG 40001. Mu.L, T4DNA Ligase 1. Mu.L, sterilized ddH2O 3. Mu.L, placing the reaction solution in a metal bath at 16 ℃ for 6h, cooling on ice, taking out 100. Mu.L DH 5. Alpha. Competent cells from a refrigerator at-80 ℃ for thawing, adding the 10. Mu.L connecting solution, gently mixing, placing on ice for 30min, subjecting the mixed solution to heat shock 90s in a water bath at 42 ℃, cooling on ice for 5min, resuscitating the resistance on the carrier, adding 900. Mu.L of LB liquid medium without antibiotics into the reaction solution, shaking and culturing for 1h at 37 ℃, taking out and centrifuging at 4000rpm for 3min, removing 750. Mu.L of supernatant, blowing and mixing the rest of the reaction solution, coating on LB solid medium containing p, picking positive single-stranded culture medium after inverting and culturing for 12h, carrying out universal primer for carrying out heat shock test on the bacterial solution at 42 ℃, and then placing the bacterial solution in a refrigerator for verifying that the bacterial colony is correctly sequenced by a PCR kit.

Preferably, the preparation steps of the S3dsRNA are as follows:

S3.1PCR amplification;

in the cloning step, a T7 promoter sequence is added at the 5' end of the amplification target fragment primer to be used as an amplification primer for synthesizing dsRNA, a specific primer is synthesized, and PCR amplification is carried out by taking the screened plasmid as a template, wherein a reaction system is as follows: 2. Mu.L of plasmid, 5. Mu.L of PrimerF, 5. Mu.L of Primer R, 2X HieffCanace Gold PCR Mix, 38. Mu.L of ddH2O, and after centrifugation and mixing, amplification is carried out on a PCR instrument, pre-denaturation at 98 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 20s, extension at 72 ℃ for 30s, and circulation for 34 times; final extension at 72℃for 5min;

purifying S3.2PCR product;

adding water into S3.2.1PCR product to make up to 500 μl, adding equal volume (500 μl) of phenol chloroform isoamyl alcohol (25:24:1), mixing under light shaking, standing for 15min, and centrifuging at 12000rpm for 15min;

s3.2.2 the supernatant was placed in another RNase-free centrifuge tube, and 2-3 volumes of pre-chilled absolute ethanol and 1/10 volumes of 3M NaAc (pH=5.2) were added;

s3.2.3 placing the above mixed solution in a refrigerator at-20deg.C for 1 hr or more;

s3.2.4 centrifuging at 12000rpm in a high-speed centrifuge at 4deg.C for 10min;

s3.2.5 the supernatant was discarded, 1mL of pre-chilled 75% ethanol was added, and the mixture was centrifuged at 12000rpm for 5min at4 ℃;

s3.2.6 repeat S3.2.5;

s3.2.7 the supernatant is sucked to volatilize the alcohol completely, and RNase-free Water is added for dilution according to the precipitation amount;

s3.2.8 1 μl of the PCR purified product was diluted with 9 μl ddH2O, mixed and centrifuged, and 1 μl was extracted and the concentration was measured with ultraviolet spectrophotometer Nanophoto meter P and recorded;

s3.3dsRNA transcription;

transcription is carried out in a PCR tube by taking the purified product as a template, and the reaction system is as follows: 10X Transcription Buffer. Mu.L, NTP Mix 8. Mu.L, T7 Enzyme Mix 2. Mu.L, template cDNA 2. Mu.g, ddH2O up to 20. Mu.L, instantaneous centrifugation followed by incubation at 37℃for 3H in a PCR apparatus, followed by double Enzyme digestion, RNase-free H2O 17. Mu.L, DNase I1. Mu.L, RNase T1 2. Mu.L were added to the reaction solution, instantaneous centrifugation followed by incubation at 37℃for 30min in a PCR apparatus, and the transcripts were detected by electrophoresis;

s3.4 dsRNA purification

S3.4.1 if the electrophoresis detection strip is correct and single in the previous step, transferring the incubated system into a 1.5mL RNase-free centrifuge tube, and adding 60 μl Nuclease-free Water to the total system of 100 μl;

s3.4.2 to the system 10 μl of 5M Ammonium Acetate (ammonium acetate) was added and vortexed;

s3.4.3 adding 3 times of 100% absolute ethanol (330 μl) into a centrifuge tube, and mixing by vortex;

s3.4.4 placing the mixed solution in a refrigerator at-20deg.C for 30min or more;

s3.4.5 centrifuging at 12000rpm in a high-speed centrifuge at 4deg.C for more than 15min to precipitate dsRNA;

s3.4.6 the supernatant was discarded, 1mL of 75% ethanol solution was added, and S3.4.5 was repeated;

s3.4.7 removing supernatant, adding 15-30 μl DEPC water according to precipitation amount after ethanol is volatilized, and dissolving precipitate;

s3.4.8 1. Mu.l of the dsRNA solution after vortex mixing was aspirated, 9. Mu.l of DEPC water was added for 10-fold dilution, and the concentration was measured using an ultraviolet spectrophotometer Nanophoto meter P330;

s3.4.9 the remaining purified dsRNA was stored at-20 ℃.

The invention has the beneficial effects that:

the invention adopts the RNA interference technology, RNA interference is an important defense mechanism formed in the long-term evolution process of plants, the RNAi technology is utilized to inhibit the root system development of the plants, so that the diffusion of mikania micrantha can be effectively controlled, and a theoretical basis is provided for the research on the targeted prevention and control technology for inhibiting the growth and development capacity of mikania micrantha by the RNA interference technology in the biological prevention and control practice; the clear gene AtEXPA4 in the arabidopsis is screened out to have functions related to root system development, and the main function of the gene is to knock out the AtEXPA4 gene so as to enable the main root to grow slowly. By using Blastp comparison, the value of e-value is used<e ^-5 As a standard, the gene Mm14G033446 was selected as a target and the corresponding RNAi molecule was designed.

Drawings

FIG. 1 is a schematic diagram of the cloning and sequencing gel electrophoresis of a gene of interest of the present invention;

FIGS. 2-3 are schematic diagrams of a bacterial sample A1 of the present invention;

FIG. 4 is a schematic representation of a bacterial sample A2 of the present invention;

FIG. 5 is a schematic representation of a bacterial sample A3 of the present invention;

FIG. 6 is a schematic representation of a bacterial sample A4 of the present invention;

FIG. 7 is a schematic of gel electrophoresis for the preparation of dsRNA of the present invention;

FIGS. 8-12 are schematic diagrams of experimental hydroponics and root growth phenotype measurements of inhibiting root development of mikania micrantha according to the invention;

FIGS. 13-14 are graphs showing qRT-PCR results of the present invention inhibiting the root system gene EXPA4 of mikania micrantha at various times.

Detailed Description

In order to further explain the technical scheme of the invention, the following is explained in detail through specific examples.

The invention provides a preparation method of RNAi molecules for inhibiting the growth and development of mikania micrantha,

screening root system development genes of mikania micrantha:

by adopting a literature collection and arrangement method, the clear gene AtEXPA4 in the arabidopsis thaliana of a model species is screened out, and has the function related to root development, and the main function of knocking out the AtEXPA4 gene to enable the main root to grow slowly. By using a comparative genomics method, key candidate genes are screened out by Blastp comparison and taking an e-value < e-5 as a standard. The following table:

cloning of the Gene of interest (clone sequencing):

total RNA extraction, cDNA first strand synthesis:

the total RNA of the mikania micrantha leaves is extracted by adopting a fuji kit method, and the purity of the sample RNA is detected by an ultraviolet spectrophotometer. cDNA synthesis was performed by reference to the kit instructions of YESEN.

Cloning of the target Gene:

amplification primers F and R were designed using Primer design software Primer 5 based on the sequences of the selected gene Mm14G033446 (appendix Table 1). Amplifying the target fragment, wherein an amplification system is as follows: 1. Mu.L of template cDNA, 0.5. Mu.L of primer F, 0.5. Mu.L of primer R, 2X Hieff Robust Master Mix 12.5.5. Mu.L, and 10.5. Mu.L of ddH 2O. Amplifying on a PCR instrument after centrifugal mixing, pre-denaturing for 5min at 94 ℃, denaturing for 10s at 94 ℃, annealing for 20s at 55 ℃ and extending for 10s at 72 ℃, and circulating for 34 times; and finally extending at 72 ℃ for 7min, and then storing at4 ℃ for standby.

50mL of 1.5% agarose gel is prepared, PCR products are loaded in the gel, the PCR products are detected by a Bio-Red electrophoresis apparatus (110 v,45 min), the result is observed under an ultraviolet imager, then the cut gel is recovered, and the DNA gel purification recovery kit is used for recovering the products, so that the target fragment is obtained.

The fragment of interest was ligated with the Vector using pUCm-T Vector cloning kit. The reaction system is as follows:

insert 3. Mu.L, pUCm-T Vector 1. Mu.L, 10 Xligation Buffer 1. Mu.L, 50% PEG 40001. Mu.L, T4DNA Ligation 1. Mu.L, sterilized ddH2O 3. Mu.L. The reaction solution is placed in a metal bath at 16 ℃ for 6 hours, then placed on ice for cooling, 100 mu L of DH5 alpha competent cells are taken out from a refrigerator at-80 ℃ and placed on ice for thawing, 10 mu L of the connecting solution is added, and the mixture is gently mixed and placed on ice for 30 minutes. The mixture was heat shocked in a water bath at 42℃for 90s and cooled on ice for 5min. To resuscitate the resistance on the support, 900. Mu.L of LB liquid medium without antibiotics was added to the reaction solution, and shake culture was performed at 37℃and 200rpm/min for 1 hour. Taking out, centrifuging at 4000rpm for 3min, sucking 750 mu L of supernatant, blowing and mixing the rest reaction liquid uniformly, coating on LB solid medium containing Amp, inverted dark culturing for 12h, picking up positive single colony, carrying out bacterial liquid PCR verification by using M13 universal primer, and then carrying out sequencing verification on bacterial liquid. Extracting plasmid from bacterial liquid with proper sequence by using the kit, and storing in a refrigerator at-20 ℃.

And (3) PCR amplification:

in the cloning step, a T7 promoter sequence was added to the 5' -end of the primer for amplifying the target fragment as an amplification primer for synthesizing dsRNA (appendix Table 2), and a specific primer was synthesized. PCR amplification is carried out by taking the screened plasmid as a template, and the reaction system is as follows: plasmid 2. Mu.L, primer F5. Mu.L, primer R5. Mu.L, 2X Hieff Canace Gold PCR Mix. Mu.L, ddH2O 38. Mu.L. Amplifying on a PCR instrument after centrifugal mixing, pre-denaturing for 3min at 98 ℃, denaturing for 10s at 98 ℃, annealing for 20s at 60 ℃ and extending for 30s at 72 ℃, and circulating for 34 times; final extension at 72℃for 5min;

and (3) purifying a PCR product:

(1) Adding water into the PCR product to make up to 500 mu l, adding equal volume (500 mu l) of phenol chloroform isoamyl alcohol (25:24:1), mixing by light shaking, standing for 15min, and centrifuging at 12000rpm for 15min;

(2) Taking the supernatant into another RNase-free centrifuge tube, adding 2-3 times of pre-cooled absolute ethanol and 1/10 of 3M NaAc (PH=5.2);

(3) Placing the mixed solution in a refrigerator at-20deg.C for 1 hr or more;

(4) Centrifuging at 12000rpm in a low-temperature high-speed centrifuge at 4deg.C for 10min;

(5) Discarding the supernatant, adding 1mL of pre-cooled 75% ethanol, and centrifuging at 12000rpm for 5min at4 ℃;

(6) Repeating step (5);

(7) The supernatant was aspirated to evaporate the alcohol completely, and RNase-free Water was added to dilute the solution according to the amount of precipitate.

(8) Diluting 1 μl of the PCR purified product with 9 μl ddH2O, mixing, centrifuging, sucking 1 μl, measuring the concentration with ultraviolet spectrophotometer Nanopoto MeterP330, and recording;

dsRNA transcription:

transcription is carried out in a PCR tube by taking the purified product as a template, and the reaction system is as follows: 10X Transcription Buffer. Mu.L, NTP Mix 8. Mu.L, T7 Enzyme Mix 2. Mu.L, template cDNA 2. Mu.g, ddH2O up to 20. Mu.L. After transient centrifugation, the mixture was placed in a PCR apparatus and incubated at 37℃for 3 hours. Then, the reaction mixture was subjected to double enzyme digestion, and RNase-free H2O 17. Mu.L, DNase I1. Mu.L and RNase T1 2. Mu.L were added thereto, and the mixture was subjected to instantaneous centrifugation and then incubated at 37℃for 30 minutes in a PCR apparatus. Detecting the transcription product by electrophoresis;

and (3) dsRNA purification:

(1) If the electrophoresis detection strip is correct and single in the previous step, transferring the incubated system into a 1.5mL RNase-free centrifuge tube, and adding 60 μl Nuclease-free Water to the total system of 100 μl;

(2) 10 μl of 5M Ammonium Acetate (ammonium acetate) was added to the system and vortexed to mix well;

(3) Adding 3 times of 100% absolute ethyl alcohol (330 μl) into a centrifuge tube, and mixing by vortex;

(4) Placing the mixed solution in a refrigerator at-20deg.C for 30min or more;

(5) Centrifuging at 12000rpm for more than 15min in a low-temperature high-speed centrifuge at4 ℃ to precipitate dsRNA;

(6) Discarding the supernatant, adding 1mL of 75% ethanol solution, and repeating step (5);

(7) Discarding the supernatant, adding 15-30 mu l DEPC water according to the precipitation amount after the ethanol is volatilized, and dissolving the precipitate;

(8) Mu.l of the dsRNA solution after vortex mixing was aspirated, 9. Mu.l of DEPC water was added for 10-fold dilution, and the concentration was measured using an ultraviolet spectrophotometer Nanopoto MeterP 330;

(9) The remaining purified dsRNA was stored at-20 ℃.

Experiment for inhibiting root development of mikania micrantha

Hydroponic experiments (injection/infusion of rhizome base):

selecting plants with consistent root growth vigor of mikania micrantha, injecting/soaking 175ng/ul dsRNA at the stem base position of mikania micrantha nearest to the root, taking untreated plants as negative control, culturing the plants by a water culture method, and culturing the plants in a greenhouse with photoperiod L:D=16 h:8 h at the temperature of 25 ℃ and relative humidity of about 80 percent. Morphological phenotypes were observed and recorded over time after treatment. Extracting total RNA of roots, and detecting the expression level of a target gene by adopting qRT-PCR. GAPDH (AGI: AT1G 13440) and UBQ10 (AGI: AT4G 05320) were chosen as internal controls for qRT-PCR. Experiments were performed 3 biological replicates, each with 2 technical replicates, and primer sequences for qRT-PCR are shown in appendix 3;

the whole process of whether the dsRNA can enter into plant cells or not under the condition of injecting/soaking the dsRNA into root systems is observed by using a laser confocal microscope. The method for marking dsRNA by Fluorescein RNA Labeling Mix comprises the following steps: fluorescein RNA Labeling Mix was added to the dsRNA synthesis system and Fluorescein RNA Labeling Mix was added as a substrate to the newly synthesized dsRNA during polymerization using T7RNA polymerase to synthesize Fluorescein-12-UTP labeled dsRNA, and the dsRNA integrity was checked by electrophoresis, as described in the instructions for the T7 RNAi Transcription Kit kit.

Treating the prepared fluorescent drug by adopting an injection/soaking mode, placing the root system of mikania micrantha in water for culture, and observing root tissues by laser confocal after 5 days and photographing.

Soil culture experiment (spray leaf):

young plants with consistent growth vigor of mikania micrantha leaves are selected, dsRNA of 175ng/ul is sprayed on the mikania micrantha leaves, dsEGFP and water are used as 3 treatments, the plants are cultivated by a soil cultivation method, and the plants are cultivated in a greenhouse with a photoperiod of L:D=16 h:8 h and a temperature of 25 ℃ and a relative humidity of about 80%. After treatment, the total RNA of leaves, stems and roots is extracted and qRT-PCR is used to detect the expression level of target gene. GAPDH (AGI: AT1G 13440) and UBQ10 (AGI: AT4G 05320) were chosen as internal controls for qRT-PCR. Experiments were performed 3 biological replicates, 2 technical replicates per biological replicate, and primer sequences for qRT-PCR are shown in appendix 3.

Statistical analysis:

statistical analysis and mapping were performed using GraphPad 8.0 software, qPCR data were expressed as mean ± standard error, mRNA relative expression was analyzed using one-way variance analysis, and Tukey's test was performed.

Results

The extended protein family EXPA gene is screened as a target gene of mikania micrantha:

expansins are involved in the growth and stress-adaptive response of a variety of plants, with EXPA being one of the most studied families. The clear gene AtEXPA4 in the arabidopsis is screened out to have functions related to root system development, and the main function of the gene is to knock out the AtEXPA4 gene so as to enable the main root to grow slowly. By using Blastp comparison, the value of e-value is used<e ^-5 Screening a gene Mm14G033446 as a target by taking the gene as a standard, and designing a corresponding RNAi molecule;

cloning and sequencing of the target Gene:

as shown in the gel electrophoresis chart of fig. 1;

a) The target fragment is amplified by PCR, the Maker is DL2000, the amplified fragment is 511bp, and the band size is correct;

b) Bacterial liquid PCR amplification, maker is DL2000, 4 samples are shared, and the stripe size is correct.

Sequencing sequence alignment: (4 samples in total)

As shown in fig. 2 to 6, A1: alignment after nucleic acid sequence splicing: a base mutation was found, and then translated into amino acids for alignment); amino acid alignment: (the comparison shows that there is a different letter);

by comparison, the sequence of the sequencing result of the bacteria samples A1, A2, A3 and A4 has a mutation with the original sequence (genome sequencing sequence), and the sequence is suspected to be incorrect in genome sequencing. Wherein, A2 has 2 mutations, so the mutation is eliminated, and A1, A3 and A4 are uniform after comparison, and the sequencing results of the bacterial liquid A1, A3 and A4 are presumed to be correct, and A2 is incorrect.

Preparation of dsRNA: as shown in fig. 7 gel electrophoresis, a) PCR amplification (T7) gel profile, B) dsRNA synthesis gel profile.

Appendix table 1: PCR amplification primer sequences

Primer name	Sequence(s)
		MmEXPA4-F	ACTGCTCACGCCACCTTCTAC
MmEXPA4-R	GACTCATCCATTCGGTCCTTG

Appendix table 2: dsRNA primer sequences

Appendix table 3: qRT-PCR primer sequences

Appendix table 4: screened target genes

The foregoing is merely a preferred example of the present invention, and the present invention is not limited thereto, but it is to be understood that modifications and equivalents of some of the technical features described in the foregoing embodiments may be made by those skilled in the art, although the present invention has been described in detail with reference to the foregoing embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of Mm14G 033446-targeted dsRNA in inhibiting growth and development of mikania micrantha is characterized in that the sequence of Mm14G033446 is ATGGAGGTCAGGGGTGTCGGTTATGCAGCAATTCTGTGTGTTATTTTCACAGTGGTCAACGCTCGTATACCGGGAGTTTACACCGGCGGACAATGGGAGACTGCTCACGCCACCTTCTACGGCGGCAATGATGCCTCCGGCACCATGGGAGGTGCATGTGGGTACGGTAACCTATATAGCCAAGGCTATGGTGTGAATACAGCGGCCTTGAGTACTGCTCTGTTCAACAATGGGCTGAGCTGCGGTGCATGTTTCGAGATTAAGTGTGTGGATGACCCACAGTGGTGCCATCCAGGCAGCCCCTCGATTTTCATAACAGCAACCAACTTCTGTCCACCTAATTTTGCTCAGCCAAGTGATAATGGTGGGTGGTGCAACCCTCCTCGAACCCATTTCGATCTGGCCATGCCTATGTTTCTCAAGATTGCCGAGTATCGAGCCGGAATAGTTCCTGTTTCTTACCGCCGGATCCCATGTCGAAAGCAAGGCGGGGTAAGATTCACCATCAACGGATTCCGTTACTTCAATTTGGTTCTCATCACCAACGTTGCTGGAGCCGGGGACATAACGCAAGCATGGGTGAAAGGATCAAGGACCGAATGGATGAGTCTTAGCCGTAACTGGGGTCAAAACTGGCAATCAAATGTTGTGCTTGTTGGCCAATCACTTTCATTTAGGGTTAGAGGCAGTGATCATCGCACTTCCACATCTTGGAACATTGCCCCAGCTGACTGGAAATTTGGTCAAACCTTTGTCGGGAAAAATTTCCGAGTCTAG

The preparation method of the dsRNA comprises the following steps:

s1, screening root system development genes of mikania micrantha; genes screened after Blastp alignment: mm14G033446; identity:84.49; e-value:1.39e ^-160 ；

S2 cloning a target gene;

s2.1, extracting total RNA of mikania micrantha leaves by adopting a fuji kit method, detecting the purity of sample RNA by an ultraviolet spectrophotometer, and synthesizing cDNA by referring to a kit instruction book of YESEN company;

cloning of S2.2 gene;

according to the sequence of the screened gene Mm14G033446, a Primer design software Primer Premier 5 is used for designing and amplifying a forward Primer F ACTGCTCACGCCACCTTCTAC and a reverse Primer R GACTCATCCATTCGGTCCTTG, a target fragment is amplified, and the target fragment is connected with a Vector by using a pUCm-T Vector cloning kit and is transformed into DH5 alpha competent cells;

s3dsRNA preparation;

S3.1PCR amplification:

amplifying the 5' end of the target fragment primer in the cloning step, adding a T7 promoter sequence as an amplification primer for synthesizing dsRNA, synthesizing a specific primer, and performing PCR amplification by taking the screened plasmid as a template;

purifying S3.2PCR product;

s3.3dsRNA transcription;

transcription is carried out in a PCR tube by taking the purified product as a template;

s3.4 dsRNA purification.