CN114085838B

CN114085838B - Potato stu-miRn220 and application thereof

Info

Publication number: CN114085838B
Application number: CN202111462628.XA
Authority: CN
Inventors: 刘升燕; 司怀军; 张宁; 杨江伟; 李世贵; 王晓凤
Original assignee: Gansu Agricultural University
Current assignee: Gansu Agricultural University
Priority date: 2021-12-02
Filing date: 2021-12-02
Publication date: 2023-08-15
Anticipated expiration: 2041-12-02
Also published as: CN114085838A

Abstract

The application provides a potato stu-miRn220 and application thereof. A new miRNA (stu-miRn 220) is discovered in the dormancy removing process of potato tubers, and the sequencing result of a degradation group shows that the novel miRNA is targeted to StTCP (Soltu.DM.08G 007440, soltu.DM.08G 007360) and plays an important role in regulating and controlling in the dormancy removing process of tubers. Based on this, the stu-miRn220 gene was overexpressed and silenced in potato to verify the function of stu-miRn220, potato stu-miRn220 regulating StTCP (soltu. Dm.08g 007360) and StTCP (soltu. Dm.08g 007460) gene expression for use in studying its function; use of potato stu-miRn220 for regulating tuber dormancy.

Description

Potato stu-miRn220 and application thereof

Technical Field

The application belongs to the field of potato miRNA, and particularly relates to potato stu-miRn220 and application thereof.

Background

Potato (Solanum tuberosum l.) is the only dual-purpose crop used as both food and vegetable with the largest planting area in our country, and is the fourth most important food source worldwide, and the potato has rich nutrition and is popular in the market (Zhang Ting, etc., 2019). Potatoes belong to annual herbs of the Solanaceae family, and are planted mainly by asexual propagation through tubers (Shen Shengfa, etc., 2016). Dormancy and germination of potato tubers are extremely important for potato cultivation, tuber growth, yield and post-processing of good quality (Li Yuanbao, et al, 2009), so that a certain theoretical basis is provided for rapid release of tuber dormancy in the future by researching a mechanism for releasing potato tuber dormancy.

MicroRNA (miRNA) is a class of small non-coding RNAs of about 22nt in length with regulatory functions that specifically regulate the expression of a target gene at the transcriptional or translational level by base complementary pairing with the target gene resulting in inhibition or complete degradation of target mRNA (Bartel, 2004). miRNAs have been found to play a central role in many aspects of plant development and in response to the environment (Wang Ming et al, 2017), and have regulatory roles in plant organ morphogenesis, plant flowering and floral organ development, phytohormone regulation (Shen et al, 2013), growth development (Pogue et al, 2014), external environmental stress response capability (Sunkar, 2010), and the like. Some of the miRNAs associated with seed development, dormancy and germination were also identified sequentially, but no miRNAs associated with de-dormancy of potato tubers have been identified.

The molecular regulation mechanism in the aspect of forming and releasing dormancy of potato tubers is not clear, the research in transcriptomics is the focus of molecular biology research in recent years, the expression information of a large number of genes in a specific period of individual materials can be rapidly obtained, the research in the growth and development stages of plants has great advantages, good research results (well Zhao and the like, 2011) are obtained in a plurality of species, and the application in the aspect of potato tuber dormancy research is less at present, in particular in the aspect of miRNA related to releasing dormancy of potato tubers. Therefore, through researching the molecular regulation mechanism in the aspects of formation and release of dormancy of potato tubers, related miRNAs of dormancy regulation are excavated, and crops with proper dormancy period are cultivated by using a genetic engineering means, so that a certain theoretical basis is provided for rapid release of dormancy of potato tubers in the future, and great significance is provided for potato breeding. In addition, in the retrievable prior art, studies on related miRNAs during the release of dormancy of potatoes have not been reported.

Disclosure of Invention

The technical problem to be solved by the application is to provide miRNA related to potato tuber dormancy removal, a precursor sequence of stu-miRn220, application of stu-miRn220 in inhibiting target gene expression to research the function of the target gene, and application of stu-miRn220 in inhibiting target gene expression to participate in the potato tuber dormancy removal process, so that reference is provided for research of potato dormancy removal in the future.

1. The precursor sequence of potato stu-miRn220 is shown in a sequence table SEQ ID NO: 1. The DNA sequence of the mature sequence of the potato stu-miRn220 is shown in a sequence table SEQ ID NO: 2. The mature sequence of potato stu-miRn220 is shown in a sequence table SEQ ID NO: 3.

2. CDS sequence of potato stu-miRn220 target gene StTCP (Soltu. DM.08G 0074340), its coding length is 1029bp, as shown in sequence table SEQ ID NO: 4. The CDS sequence of potato stu-miRn220 target gene StTCP (Soltu. DM.08G 0073360) has a code length of 1278bp and is shown in a sequence table SEQ ID NO: shown at 5.

3. The method for obtaining the potato miRn220 specifically comprises the following steps: (1) potato material treatment; (2) Illumina sequencing analysis; (3) identification of miRNA; (4) Stu-miRn220 homologous miRNA search.

4. The verification method for the application of the potato stu-miRn220 specifically comprises the following steps: (1) miRNA target gene prediction; (2) Analysis of stu-miRn220 expression level in dormancy-released period (3) construction of potato stu-miRn220 expression vector and genetic transformation; (4) Transgenic potato plants stu-miRn220 and target gene StTCP qRT-PCR analysis thereof.

5. Use of potato stu-miRn220 for regulating expression of StTCP (soltu. Dm.08g 0074340).

6. Use of potato stu-miRn220 for regulating expression of StTCP (soltu. Dm.08g 0073360).

7. Application of potato stu-miRn220 in researching StTCP (Soltu. DM.08G 0074340) gene function.

8. Application of potato stu-miRn220 in researching StTCP (Soltu. DM.08G 0073360) gene function.

9. Use of potato stu-miRn220 for regulating tuber dormancy.

The beneficial effects are that: the application discovers a new miRNA (stu-miRn 220) in the dormancy removing process of potato tubers, and the sequencing result of a degradation group shows that the novel miRNA has targeting effect on StTCP (Soltu. DM.08G 007440, soltu. DM.08G 007360) and plays an important regulation and control role in the dormancy removing process of tubers. Based on this, the stu-miRn220 gene was overexpressed and silenced in potato to verify the function of stu-miRn220, potato stu-miRn220 regulating StTCP (soltu. Dm.08g 007360) and StTCP (soltu. Dm.08g 007460) gene expression for use in studying its function; use of potato stu-miRn220 for regulating tuber dormancy.

Drawings

FIG. 1 is a two-stage block diagram of potato stu-miRn220 of the present application.

The stu-miRn220 precursor sequence is folded into a stable stem-loop structure, belongs to a typical secondary structure of the miRNA precursor, and accords with the structural characteristics of the miRNA precursor.

FIG. 2 is a diagram showing homology alignment of potato stu-mir n220 of the present application.

Wherein, the result of the sequence comparison of stu-miRn220 and stu-miR319-3p shows that the sequence is different only at the 16 th base, and other bases are the same, so that stu-miRn220 belongs to potato miR319 family members.

FIG. 3 is a sequencing drawing of the degradation group of the target gene of potato of the present application.

Wherein, the black solid dots are positioned at the cutting positions of stu-miRn220 degradation target genes. stu-miRn220 degrades StTCP (Soltu. DM.08G 007440) gene at 1182 base, and degrades StTCP (Soltu. DM.08G 007360) gene at 2423 base

FIG. 4 is a fluorescent quantitative PCR map of potato stu-miRn220 of the present application.

Among them, stu-miRn220 is expressed in the highest amount in the sprouting period, about 3.37 times that in the dormancy period, which indicates that it plays an important role in the dormancy-releasing process of potato tubers.

FIG. 5 is an electrophoretogram of amplification of a potato stu-miRn220 precursor fragment of the application.

Wherein, A represents the a, B and c fragments of stu-miRn220 and B represents the d fragment. Agarose gel electrophoresis detects that the sizes of a fragment, b fragment and c fragment are 272bp, 171bp and 298bp respectively, and the size of d fragment is 701bp.

FIG. 6 is a diagram of a STTM vector of potato stu-miRn220

Wherein KpnI and PstI are used as enzyme cutting sites, the middle of the enzyme cutting sites consists of 48 general bases, two stu-miRn220 and target gene binding site sequences are connected, cua bases are inserted between 10 th base and 11 th base, and a stu-miRn220 STTM sequence is formed.

FIG. 7 is a relative expression amount analysis of MiRn220 and StTCP in potato stu-MiRn220 overexpressing transgenic plants

Wherein, A represents the relative expression amount of stu-miRn220, and B represents the relative expression amount of StTCP gene. WT: wild plants; s4, S5, S6, S8, T34: stu-miRn220 overexpressing transgenic plants; different lowercase letters indicate difference significance (p.ltoreq.0.05).

Detailed description of the preferred embodiments

The methods and apparatus used in the following examples of the present application are conventional methods and apparatus unless otherwise specified; the equipment and the reagent are conventional equipment and reagents purchased by reagent companies. In order to make the objects, technical solutions and advantages of the present patent more apparent, the following detailed description of the present patent refers to the field of 'electric digital data processing'. Examples of these preferred embodiments are illustrated in the specific examples. It should be noted that, in order to avoid obscuring the technical solutions of the present application due to unnecessary details, only the technical solutions and/or processing steps closely related to the solutions according to the present application are shown in the embodiments, and other details having little relation are omitted.

Example 1

The embodiment provides potato stu-miRn220 and target genes thereof, which specifically comprise:

as shown in SEQ ID NO:1 (the nucleotide sequences listed in the application are all 5 '. Fwdarw.3'): aggaaauucaucaguccaaacaagguggcauauugggacugaucuuugcugcugaaucauugguucaucaccauaucucuaaccacaaggauauauauguuguugcaccaaugaugcaggagcugaguucaguuuugacuaccuuuucuuggacugaaggguuuccuuc.

The secondary structural formula of the potato stu-miRn220 precursor sequence is as follows: forms a ring from 9bp-11bp and 157bp-159bp, 19bp-22bp and 145bp-149bp of the 5 'end, forms a ring from 42bp-44bp and 127bp-129bp of the 5' end, forms a ring from 46bp-48bp and 123bp-125bp of the 5 'end, forms a ring from 50bp-52bp and 119bp-121bp of the 5' end, forms a ring from 54bp-56bp and 115bp-117bp of the 5 'end, forms a ring from 64bp-66bp and 105bp-107bp of the 5' end, forms a ring from 67bp-69bp and 102bp-104bp of the 5 'end, forms a ring from 70bp-72bp and 99bp-101bp of the 5' end, forms a ring from 76bp-78bp and 91bp-95bp of the 5 'end, and forms a ring from 80bp-89bp of the 5' end. Other base pairing forms a stem-loop structure.

As shown in SEQ ID NO:2, the DNA sequence encoding the mature sequence of the potato stu-miRn220 is: aggaaattcatcagtccaaacaaggtggcatattgggactgatctttgctgctgaatcattggttcatcaccatatctctaaccacaaggatatatatgttgttgcaccaatgatgcaggagctgagttcagttttgactaccttttcttggactgaagggtttccttc.

As shown in SEQ ID NO:3, the mature sequence of the potato stu-miRn220 is as follows: uuggacugaaggguuuccuuc. The mature sequence of stu-miRn220 is an RNA sequence of 149bp-169bp from the 5' end of the precursor sequence.

As shown in SEQ ID NO:4, the CDS sequence of the potato stu-miRn220 target gene StTCP (Soltu. DM.08G 0074340) has a coding length of 1029bp.

As shown in SEQ ID NO:5, the CDS sequence of the potato stu-miRn220 target gene StTCP (Soltu. DM.08G 0073360) has a code length of 1278bp.

Example 2

The embodiment provides a method for obtaining potato miRn220, which specifically includes:

1. potato material treatment

The potato cultivar Atlantic was selected, planted in Gansu province, jixi Lin/27950, and harvested in Octopus-in-county town for 8 months. Tubers which are uniform in size, uniform in shape and free of breakage are selected as dormancy research materials, stored under dark conditions, and respectively placed at 22 ℃ and 4 ℃ for culture. Sampling eye parts of freshly harvested potato blocks, dormant released potato blocks and germinated potato blocks by using a puncher with the diameter of 8mm, immediately using a liquid nitrogen freezing material, and storing at the temperature of-80 ℃ for later use.

2. Illumina sequencing analysis

The samples obtained in the previous step are sent to Beijing Nostoc source technology Co., ltd, total RNA sample detection is carried out, a library is constructed by using Small RNA Sample Pre Kit, library detection is carried out, and finally, the cDNA library is used as a template to carry out sequencing while synthesis in an Illumina sequencer.

Sequencing the raw reads, removing reads with a proportion of low mass reads, N (N indicates that base information cannot be determined) of more than 10%, reads with 5' linker contamination, reads without 3' linker sequence and insert, reads with 3' linker sequence and containing polyA/T/G/C (most of continuous polyA/T/G/C may be derived from sequencing errors, and low entropy of information may not be analyzed), to obtain high quality clean reads.

3. Identification of miRNAs

The clear reads of each sample were screened and sRNA of 18-30nt in length was selected for subsequent analysis. And targeting the length-screened sRNA to a reference sequence using bootie (langhead et al 2009), and analyzing the distribution of small RNA on the reference sequence, wherein mirnas were concentrated predominantly in the range of 20-24 nt. And selecting the rest non-annotated miRNA fragments except all annotated miRNA fragments for identification of known miRNAs and predictive analysis of new miRNAs. The novel miRNA can be predicted according to the marked hairpin structure of the miRNA precursor, and the novel miRNA can be analyzed by miREvo (Wen et al 2012) and miradeep 2 (Friedlander et al 2012) prediction software, the basic principle is that the novel miRNA in a sample is predicted by intercepting a reference sequence on a certain length sRNA alignment, searching the secondary structure of the novel miRNA and characteristics such as Dicer enzyme cleavage site information, energy and the like, and the sequence, the length, the occurrence frequency and the like of the sRNA matched in each sample are performed, and statistics of the first-site base distribution of miRNAs with different lengths and the base distribution situation of each site of all miRNAs are performed.

The stu-miRn220 product is obtained by RNA synthesis techniques such as MALDI-TOF (matrix-assisted laser desorption ionization-time-of-flight) synthesis and purity analysis of the product RNA by HPLC.

4. stu-miRn220 homologous miRNA search

In the miRBase database (http:// miRBase. Org), the stu-miRn220 mature body sequence is submitted to By sequence in the Search miRBase interface for homologous miRNA Search. As shown in FIG. 2, stu-miRn220 differs from stu-miR319-3p by only one base, and therefore stu-miRn220 belongs to a member of the stu-miR319 family.

Example 3

The embodiment provides applications of the potato stu-miRn220, which specifically comprises the following steps:

1. miRNA target gene prediction

The remaining samples from example two were sent to Hangzhou Liangchuan biosystems, inc., and a potato mixed degradation group library was constructed and sequenced with an Illumina Hiseq2000/2500, sequencing read at a single end of 1X 50bp.

Degradation group analysis used the clear bond program (Version 4.0) and the specific procedure was as follows: raw data obtained by sequencing is processed through a series of data to obtain comparable sequencing sequences which can be used for subsequent analysis. The alignable sequences were aligned with the cDNA database sequences of potato to generate a degraded group density file (degradome density file). Target gene mRNA sequences paired with potato microrna sequences were predicted by cleavage site prediction software (GSTAr). And carrying out combination operation on the target genes corresponding to the predicted miRNAs and mRNA in the density file of the generated degradation group, and finding out common mRNA, wherein the mRNA is the target gene of the miRNAs. And simultaneously giving peak classification and score of the degradation group, and performing t-plots graph on the generated prediction result. The sequencing result of the degradation group shows that the stu-miRn220 target gene is StTCP (Soltu. DM.08G 007440, soltu. DM.08G 007360), and the degradation site is shown in figure 3 (the position of the black solid dot is the cleavage position of the stu-miRn220 degradation target gene).

2. Analysis of Stu-miRn220 expression level during sleep release period

Samples stored at 22℃at different times were each passed through a TRNzol Universal Total RNA extraction kit (catalog number: DP 424) from TIANGEN company to extract total RNA, as follows:

(1) Sample homogenization treatment. 50-100mg of sample is quickly ground in a mortar by liquid nitrogen, 1mL TRNzol Universal reagent is added, vortex and shake vigorously immediately, and the sample is left at room temperature for 5min, so that the nucleic acid-protein complex is completely separated.

(2) The mixture was centrifuged at 12,000rpm (13,400 Xg) at 4℃for 10 minutes, and the supernatant was collected.

(3) 0.2mL of chloroform was added, the tube was capped, vigorously shaken for 15sec, and left at room temperature for 3min.

(4) Centrifuge at 12,000rpm (13,400Xg) for 15min at 4 ℃. The sample would be divided into three layers: the pink organic phase, middle and upper colorless aqueous phase, with RNA predominantly in the aqueous phase, was transferred to a fresh centrifuge tube (about 500. Mu.L).

(5) Adding equal volume of isopropanol into the obtained aqueous phase solution, uniformly mixing, and standing at room temperature for 10min.

(6) Centrifuge at 12,000rpm (13,400Xg) for 10min at 4℃and remove the supernatant. RNA precipitation is often not visible before centrifugation, and a gelatinous precipitate forms on the tube side and bottom after centrifugation.

(7) 1mL of 75% ethanol (with RNase-free ddH ₂ O formulation) the precipitate was washed. The precipitate was washed with at least 1mL of 75% ethanol per 1mL TRNzol Universal reagent.

(8) Centrifuge at 10,000rpm (. About. 9,391 Xg) for 5min at 4 ℃. The liquid was decanted, taking care not to decant the pellet, the remaining small amount of liquid was centrifuged briefly and then aspirated with a gun head, taking care not to aspirate the pellet.

(9) Air-drying at room temperature (without air-drying, RNA is difficult to dissolve after completely drying, and air-drying for about 2-3 min), adding 30-100 μl RNase-Free ddH according to experimental requirement ₂ And O, repeatedly blowing and uniformly mixing to fully dissolve RNA.

The extracted RNA was reverse transcribed into cDNA using the first strand synthesis kit of miRNA cDNA from Ai Kerui Bio Inc. (catalog number: AG 11717) as follows:

a mixture of reverse transcription systems (10. Mu.L) was prepared on ice: miRNA RT Enzyme Mix,1.25 μl;2X miRNA RT Reaction Solution,5. Mu.L; total RNA, 2. Mu.L; RNase free water, 1.75. Mu.L. The prepared reaction solution is gently mixed, the reaction solution on the pipe wall is settled by short centrifugation, the reaction is carried out at 42 ℃ for 60min and at 85 ℃ for 5min, and the synthesized cDNA reaction solution is placed at-20 ℃ for preservation, and can also be directly subjected to downstream fluorescence quantitative detection.

By Ai Kerui Bio IncGreen Premix Pro Taq HS qPCR Kit II (catalog number: AG 11702) (with reverse primer) Stu-miRn220 expression was examined at various times (FIG. 4), and the 20. Mu.L reaction system was as follows, using St18S rRNA gene as an internal control: 2X->Green Pro Taq HS Premix II 10. Mu.L, miRNA-specific primer (10. Mu.M) 0.8. Mu.L, miRNA qPCR 3' primer (10. Mu.M) 0.8. Mu.L, ROX Reference Dye (4. Mu.M) 0.4. Mu.L, RNase free water 8. Mu.L. The qRT-PCR amplification procedure was: 95 ℃ for 30sec;95 ℃,5s,60 ℃,30s,40cycles. Wherein the primer sequence is as follows, stu-miRn 220F: TTGGACTGAAGGGTTTCCTTC; st18S rRNA F: TTAGAGGAAGGAGAAGTCGTAACAA; (St 18S rRNA is an internal reference gene).

3. Construction and genetic transformation of potato stu-miRn220 expression vector

3.1 construction of Potato stu-MiRn220 overexpression vector

Design of primers

The primers I, II, III, IV and the universal primers A and B for over-sequencing PCR were designed using the website WMD (http:// WMD2.Weigelworld. Org /) to Stu-miRn220 (uuggacugaaggguuuccuuc). The sequence is designed as follows, I is gaTTGGACTGAAGGGTTTCCTTCtctctcttttgtattcc; II, gaGAAGGAAACCCTTCAGTCCAAtcaaagagaatcaatga; III gaGACGGAAACCCTTGAGTCCATtcacaggtcgtgatatg; IV is gaATGGACTCAAGGGTTTCCGTCtctacatatatattcct; CTGCAAGGCGATTAAGTTGGGTAAC; GCGGATAACAATTTCACACAGGAAACAG;

precursor fragment amplification

Using plasmid pRS300 as a template (Ossowski et al, 2008), the 20 nucleotides of endogenous miR319a in plasmid pRS300 were replaced by an amiRNA sequence of 21 nucleotides of stu-MIRn220 (uuggacugaaggguuuccuuc) by overlap PCR. Firstly, respectively amplifying a 5 'arm (fragment a), a center loop (fragment b) and a 3' arm (fragment c) by PCR, and performing electrophoresis on 1.5% agarose gel; recovering a, B and c fragments by using a gel recovery kit (catalog number: B518131) of a biological engineering (Shanghai) stock, purifying, and performing PCR amplification on a precursor fragment d by using a mixture of the a, B and c fragments as a template and A, B as primers, wherein the amplification procedure is as follows: pre-denaturation at 95℃for 2min; denaturation at 95℃for 30s, annealing at 55℃for 30s, extension at 72℃for 1.5min,34cycles; extending at 72℃for 5min.1.5% agarose gel was subjected to electrophoresis and d fragment was recovered with a gel recovery kit and stored in a-20℃refrigerator for use (FIG. 5).

Construction of cloning vector pUCI-T-miRn220

The gel recovery purified d fragment was ligated with pUCI-T Zero vector, 10. Mu.L ligation system as follows: 10 XEnhance 1. Mu.L, pUCI-T Zero cloning vector (30 ng/uL) 1. Mu.L, d fragment plasmid 2. Mu.L, sterilized ddH ₂ O6 uL; centrifuging for 30s, and connecting at room temperature (20-30 ℃) for 5min. The ligation product was then introduced into the prepared E.coli competent DH 5. Alpha. By heat shock. The specific transformation process is as follows:

(1) 100uL of competent cells thawed on an ice bath were added to 10 uL of the above ligation product, gently mixed, and left in the ice bath for 30 minutes.

(2) Heat shock in a 2 ℃ water bath for 45 seconds, then transfer the tube quickly into the ice bath for 2 minutes without shaking the centrifuge tube.

(3) 500uL of liquid LB medium (without antibiotics) was added to the centrifuge tube, and after mixing, the mixture was placed at 37℃and cultured at 200rpm for 1 hour to resuscitate the bacteria.

(4) Different volumes, such as 70uL, 100uL, 130uL of transformed competent cells were pipetted onto LB agar medium containing Amp (1 mg/mL), spread evenly with a spreading bar, seal the dishes with sealing film and mark, invert the plates, and incubate overnight at 37℃for about 12-16h in the dark.

Single colonies with smooth edges were picked with sterilized tips and placed in 5mL of LB liquid medium (containing Amp) and incubated in a constant temperature shaker at 37℃at 260r/min for about 5h. PCR verification is carried out by taking the bacterial liquid as a template and a universal primer M13F, M R as a primer, the plasmid with the strip size meeting the expected requirement is sent to a biological engineering (Shanghai) Co., ltd for sequencing, and the plasmid with the correct sequencing is named pUCI-T-miRn220.

Construction of the overexpression vector pCAMBIA1300-miRn220

pUCI-T-miRn220 was cloned with restriction endonucleases KpnI and XbaI, respectively, from Bao Ri doctor Material technology (Beijing) Co., ltdThe vector and the pCAMBIA1300 expression vector are subjected to double enzyme digestion, and the enzyme digestion system is as follows: 10X QuickCut GreenBuffer uL, quickCut KpnI 1uL, quickCut XbaI 1uL, plasmid.ltoreq.1.0. Mu.g, ddH ₂ O is complemented to 20uL; the reaction conditions are as follows: enzyme digestion at 37℃for 10min and enzyme inactivation at 70℃for 15min. The desired fragment and vector fragment were recovered by gel and mixed in a DNA molar ratio of 3:1 and ligated for 1.5h at 16℃by T4 DNA ligase, the resulting ligation was transferred into E.coli (Escherichia coli) strain DH 5. Alpha. Competent cells, positive clones were selected and plasmids were extracted for double restriction verification, the primers were F GACGTAAGGGATGACGCACA, R: AAGTCGATGCCCTTCAGCTC. Suitable expression vectors were validated for introduction into Agrobacterium GV3101 competent cells by freeze thawing and for use in genetic transformation experiments.

3.2 construction of Potato MiRn220 STTM silencing expression vector

Design of potato miRn220 STTM fragment

The mature sequence of miRn220 is 5 'UUGGACUGAAGGUUUUCCUUCCUUCCUUC3'. The sequence of the binding site of miRn220 should be complementary thereto, 5'-GAAGGAAACCCUUCAGUCCAA-3'. In order for this site to bind to and not be cleaved by mature miRn220, a trinucleotide bulge must be designed at the 10-11 th base of mature miRn220. We extracted trinucleotide sequences (CUA) at positions 10 and 11 corresponding to miR399 from Arabidopsis IPS1 (Franco-Zorrilla et al, 2007). After insertion cua, the binding sequence was 5'-GAAGGAAACCcuaCUUCAGUCCAA-3', which was converted to DNA and then 5'-GAAGGAAACCctaCTTCAGTCCAA-3'. Finally, the two binding sites were ligated with a 48 nucleotide sequence to form STTM fragment 5'-GAAGGAAACCctaCTTCAGTCCAAgttgttgttgttatggtctaatttaaatatggtctaaagaagaagaatGAAGGAAACCctaCTTCAGTCCAA-3', and cleavage sites KpnI and PstI were added at both ends, and the designed Stu-MiRn220 STTM fragment (FIG. 6) was synthesized by Shanghai Co., ltd.

Construction of expression vector miRn220 STTM

The designed potato miRn220 STTM fragment is connected with a plant expression vector pCAMBIA1300 by using a ClonExpress II One Step Cloning Kit kit (catalog number: C112-01) of Nanjinouzan biotechnology limited company by utilizing a homologous recombination method and is introduced into escherichia coli competent DH5 alpha, positive clones are screened and plasmids are extracted for double enzyme digestion verification, and a bacterial solution verification primer is F: ATCCTTCGCAAGACCCTTCC, R: CTTCGGTCATTAGAGGCCACG. Suitable expression vectors were validated for introduction into Agrobacterium GV3101 competent cells by freeze thawing and for use in genetic transformation experiments.

3.3 identification of Potato transformation and transgenic plants

Genetic transformation of potatoes

Potato stem and chip genetic transformation reference Zhang Ning et al (2004). The test tube plantlet was cut to a length of about 1cm without axillary bud stem with sterilized scissors, placed in MS solid culture dish, and pre-cultured in the dark at 28℃for three days. Cutting potato chips with the thickness of about 2mm and infecting agrobacterium tumefaciens bacteria liquid containing target genes by the pre-cultured stem segments for about 10min, sucking the surface bacteria liquid of the potato chips and the stem segments by using sterile filter paper, placing the potato chips and the stem segments in an MS solid culture dish, and culturing in the dark at the temperature of 28 ℃ for two days. Potato chips were transferred to differentiation medium (MS+2 mg/L ZT+1mg/L IAA+0.2mg/L GA) ₃ In +0.5mg/L6-BA+5mg/L Hyg+50mg/L Cef), the stem was transferred to differentiation medium (MS+2mg/L ZT+2mg/L6-BA+5mg/L GA) ₃ In +5mg/L Hyg+50mg/L Cef), the culture medium was changed once at 25℃and 2500Lx for about 10 days, and the culture was transferred to rooting medium (MS+5mg/L Hyg+50mg/L Cef) after about 1.5cm of buds had been differentiated, and rooting screening was performed. If the shoots cut after about 10 days root, the shoots can be preliminarily judged as transgenic plants and propagated.

Identification of transgenic plants of potato

The method for extracting the genomic DNA of the leaf blade by using the CTAB method and carrying out hygromycin detection comprises the following steps:

(1) about 0.5g of the sample was placed in a 2mL centrifuge tube and crushed for 2min at 70Hz with a crusher.

(2) 600uL of 3 XCTAB buffer was added, and the mixture was gently stirred and mixed at 65℃for 30 minutes to be thoroughly cleaved.

(3) Adding equal volume of chloroform-isoamyl alcohol (24:1) mixture, covering with a cover, gently shaking to obtain emulsion, standing at room temperature for 5min, and centrifuging at 4deg.C at 8000rpm for 10min.

(4) The centrifuge tube (containing 3 layers) was removed and the supernatant was aspirated into a clean centrifuge tube.

(5) Adding 700uL of pre-cooled absolute ethyl alcohol, gently shaking, centrifuging at 8000rpm for 5min at room temperature for 5min at 4 ℃, discarding the supernatant, and drying the precipitate

(6) The crude DNA was dissolved in 100uL of ddH ₂ In O, the concentration was measured.

According to the specific hygromycin Hyg gene on the pCAMBIA1300 vector, a specific primer Hyg-F is designed: ACGAGTGCTGGGGCGTCGGTTTCC and Hyg-R: GTGATTTCATATGCGCGATTGCTG. The Hyg gene was amplified using the extracted genomic DNA as a PCR template (Edwards et al, 1991), the genomic DNA of non-transgenic plants as a negative control, and the expression vector plasmid into which the fragment of interest was inserted as a positive control, with the fragment length of the gene being about 566bp, under the following PCR amplification conditions: pre-denaturation at 94℃for 1.5min; denaturation at 94℃for 20s, annealing at 60℃for 20s, extension at 72℃for 1min,34cycles; extending at 72℃for 5min. The PCR product was detected by agarose gel electrophoresis at 1.5%, and a strain in which the Hyg gene of 566bp in size could be detected was determined as a transgenic plant.

3.4 transgenic Potato plants stu-miRn220 and StTCP qRT-PCR analysis of their target genes

The total RNA of the non-transgenic and transgenic plants, test tube potato, was extracted separately using the TRNzol Universal total RNA extraction kit from TIANGEN. Expression analysis of stu-miRn 220: the related kit and the specific method are used for analyzing the expression quantity of stu-miRn220 under the dormancy release period in the third example; cDNA for StTCP expression analysis of target Gene was synthesized by reverse transcription using a FastKing one-step method from TIANGEN company, except that the first strand of genomic cDNA was synthesized with a premix reagent (catalog number: KR 118), by using Ai Kerui Bio IncGreen Premix Pro Taq HS qPCR Kit II (catalog number: AG 11702) was subjected to real-time fluorescent quantitative PCR. Quantitative analysis reference->Method, ΔΔct= (Δct) _{Transgenic plants} －ΔCt _ef1a )－(ΔCt _{Non-rotatingGene} －ΔCt _ef1a ) (Livak and Schmittgen, 2001). The sequence of the fluorescent quantitative expression analysis primer is as follows:

StTCP (Soltu. DM.08G 007440) Forward: CGTGCATCTGGAGGGAAAGA, forward: GCGGCTGCTTTTAACAACCA; stTCP (Soltu. DM.08G 0073360) Forward: AACATGCACCCTAGCTCGTC, forward: ACGAGTAGCTGATGGGCCTA; reference gene efla Forward: CAAGGATGACCCAGCCAAG, forward: TTCCTTACCTGAACGCCTGT (efla is a reference gene).

The results show in fig. 7: in the stu-miRn220 over-expression transgenic lines S4, S5, S6, S8 and T34, the relative expression level of the stu-miRn220 is obviously higher than that of a Wild Type (WT) (p is less than or equal to 0.05), and the stu-miRn220 is respectively up-regulated by 7.40 times, 9.57 times, 6.38 times, 6.15 times and 4.90 times; whereas the expression of the target genes StTCP (Soltu. DM.08G 007440, soltu. DM.08G 0073360) was inhibited in S4, S5, S6, S8 and T34 test-tube potatoes, the relative expression amounts of StTCP (Soltu. DM.08G 007440) were 0.47, 0.32, 0.53, 0.57 and 0.71 times that of WT, respectively, and the relative expression amounts of StTCP (Soltu. DM.08G 0073360) were 0.54, 0.43, 0.64, 0.62 and 0.67 times that of WT, respectively, indicating that stu-miRn220 negatively regulates the expression of the target genes StTCP (Soltu. DM.08G 0073360 ).

The beneficial effects are that: the application discovers a new miRNA (stu-miRn 220) in the dormancy removing process of potato tubers, and the sequencing result of a degradation group shows that the novel miRNA has targeting effect on StTCP (Soltu. DM.08G 007440, soltu. DM.08G 007360) and plays an important regulation and control role in the dormancy removing process of tubers. Based on the method, the stu-miRn220 gene is over-expressed and silenced in the potato to verify the function of the stu-miRn220, a certain theoretical basis is provided for rapid release of tuber dormancy in the future, and the transgenic potato with moderate dormancy period is cultivated, so that the method has important significance for wide application of the potato.

The foregoing is merely illustrative of the embodiments of this application and it will be appreciated by those skilled in the art that variations and modifications may be made without departing from the principles of the application, and it is intended to cover all modifications and variations as fall within the scope of the application.

Reference is made to:

well Zhao, wei Lin, jing, etc. transcriptome sequencing and its application in the development of pasture gene resources. Science of grass, 2011,28 (7), 1364-1369.

Li Yuanbao, wen Gang, li Shifeng, et al the mechanism of dormancy and sprouting of potato tubers and regulatory research progress [ C ] potato industry and food safety 2009.

Shen Shengfa, wu Liehong, li Bing. Tuber growth law for early harvest cultivation of spring potatoes [ J ]. Zhejiang agricultural journal 2016,28 (3): 389-394.

Wang Ming, xie Jie, xiong Xingyao, etc. the role of miRNAs in the abiotic stress response of horticultural plants [ J ]. Modern horticulture, 2017 (18): 13-14.

Zhang Ning, huai Jun, li Xuecai, et al. Research on Agrobacterium tumefaciens-mediated efficient genetic transformation of potato [ J ]. Chinese potato, 2004 (03): 132-135.

Zhang Ting, yang Huixian, yang Xiuli, etc. measurement and comparison of the content of 3 potato starch, protein, anthocyanin [ J ]. Shanxi agricultural science, 2019 (04): 560-562+576.

Bartel DP.MicroRNAs:genomics,biogenesis,mechanism,and function.Cell.2004,116(2):281-97.

Edwards K,Johnstone C,Thompson C.A simple and rapid method for the preparation of plant genomic DNA for PCR analysis[J].Nucl Acids Res,1991,19:1349.

Franco-Zorrilla JM,Valli A,Todesco M,et al.Target mimicry provides a new mechanism for regulation of microRNA activity[J].Nat Genet,2007,39(8):1033-7.

Friedlander M R,Mackowiak S D,Li N,et al.miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades[J].Nucleic Acids Research,2012,40(1):37-52.

Langmead B,Trapnell C,Pop M,et al.Ultrafast and memory-efficient alignment of short DNA sequences to the human genome[J].Genome Biology,2009,10(3):1-10.

Livak K J，Schmittgen T D.Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method[J].Methods,2001,25(4):402–408.

Ossowski S,Schwab R,Weigel D.Gene silencing in plants using artificial microRNAs and other small RNAs[J].Plant Journal for Cell&Molecular Biology,2008,53(4):674.

Pogue AI,Clement C,Hill J M,et al.Evolution of microRNA(miRNA)Structure and Function in Plants and Animals:Relevance to Aging and Disease[J].Journal of Aging Science,2014,2(2):122-138.

Shen Y,Jiang Z,Lu S,et al.Combined small RNA and degradome sequencing reveals microRNA regulation during immature maize embryo dedifferentiation[J].Biochem Biophys Res Commun.2013,441(2):425-30.

Sunkar R.MicroRNAs with macro-effects on plant stress responses[J].Seminars in Cell&Developmental Biology,2010,21(8):805-811.

Wen M,Shen Y,Shi S,et al.miREvo:an integrative microRNA evolutionary analysis platform for next-generation sequencing experiments[J].BMC Bioinformatics,2012,13(1):140-140.

<110> Gansu agricultural university

<120> Potato stu-miRn220 and application thereof

<160> 5

<210> 1

<211> 169

<212> RNA

<213> Potato (Solanum tuberosum)

<400> 1

aggaaauuca ucaguccaaa caagguggca uauugggacu gaucuuugcu gcugaaucau 60

ugguucauca ccauaucucu aaccacaagg auauauaugu uguugcacca augaugcagg 120

agcugaguuc aguuuugacu accuuuucuu ggacugaagg guuuccuuc 169

<210> 2

<211> 21

<212> DNA

<213> Potato (Solanum tuberosum)

<400> 2

ttggactgaa gggtttcctt c 21

<210> 3

<211>21

<212> RNA

<213> Potato (Solanum tuberosum)

<400> 3

uuggacugaa ggguuuccuu c 21

<210> 4

<211> 1029

<212> DNA

<213> Potato (Solanum tuberosum)

<400> 4

atgagtaaca aggaggatga gcagtaccac caatacgatg ttggagaagt caaaaagagt 60

agtgacctag gtggtgggat tgggaaatta tatgggtggc ctacatcaag aattgttaga 120

gtttctcgtg catctggagg gaaagatagg catagcaaag tattgacttc aaagggatta 180

agagacagac gtgttcgcct ctctgtcaat actgctatac agttctatga tttgcaagac 240

cgcctcggtt gtgatcagcc cagcaaggtt gtagagtggt tgttaaaagc agccgctcct 300

ttaatcgctg agcttccacc tcttgaggca tttcaagata cactgcagct cagcgatgag 360

aaaaggtcaa gcgagccgcg ttttgattca gctgatgttg aaatggatga tgatcttaat 420

tataatcagc agcaacaaca acaacaacaa caaccttgtt gtagtaattc tgagacaagc 480

aaaggttctg gattgtcact ttccagatct gatagtcggg tcaaggcacg ggagcgagca 540

agggaaaggg ctacagagaa agtaaacact gttgctaatc atcaccaaaa tatgcaccct 600

agctcttctt ttacggaact attgactggt ggtatgaacg ataacaacaa caagagtagt 660

gttaatgatg atcaaaacac accgagacaa tggtctacaa atcccttgga gtattttacg 720

gacaaccaaa tttatttggg aaatccatta agaccggtgt cttcaccaat gtttagtatt 780

acaggtgatc atcgacccga gatgcagcat ttcccattcg gcggcgacct agtcccagtt 840

gtgacaagta ctaataacga gtacaatttg aacttcagca tttcttcatc atctgatttc 900

aataggggga cccttcagtc caattcttcc tctactttgc cacaatacca gaggtacgga 960

tcatatcttg gttccacaac tgaatatgac aaccggcatt cagatcagaa aggaaaagga 1020

aagaagtaa 1029

<210> 5

<211> 1278

<212> DNA

<213> Potato (Solanum tuberosum)

<400> 5

atgattaatg caaaggacat ctacagtcct ccaagcccaa gaaggtatga aagttgtagt 60

atggagatgg aggagattca aactgatgag tgcaagtttc caagaatgag caacaaggag 120

gatgagcagt accaaaaata tgatgtagat gatgtaggag aagtcaaaag gagtagtgga 180

cttggtggga ttgtaaaatt ttatggtcgg ccttcatcaa gaattgttag agtttctcgt 240

gcatctggag ggaaagatag gcatagcaaa gtattgactt caaaggggtt aagagataga 300

cgtgttcgtc tttctgtcaa tactgctata cagttctatg atttgcaaga ccgtctaggc 360

tgtgatcagc ccagcaaggc tgtcgaatgg ctgctaaaag cggccgctcc ttctattgct 420

gagcttccac ctcttgaggc atttccagat acactgcagc tcagtgatga gaaaaggtca 480

agtgagccgg gttttgattc agctgatgtg gaaatggatg atgatcttaa ttacaatcag 540

cagcaacaac cttgttgtag caattctgag acaagtaaag gttcgggctt gtcactttcc 600

agatctgata gtcggctcaa ggcacgggag cgagcaaagg aaagggccac agagaaagaa 660

aaggaaaaag aaaacaagtc ttgtattgtt gctcaacacc accaaaacat gcaccctagc 720

tcgtctttca ctgagctatt gaccggtggt atgagcgata acaacaacag caacacaagt 780

cctaatggca acattcacca aaatacacca aggcaatggt ctacaaatcc gttggagtat 840

tttacctcag gattattagg cccatcagct actcgtggaa tagacaactc tagtggccaa 900

atttacttgg gaaatcctct acagccatta agaccagtgt cttcaccaat gtttagtatt 960

acgggtgagc atcgaccgga gctgcagcat ttcccatttg gcggtgacaa cctagtcccg 1020

ggcgttacct ccagtaatac taatactaat aacgagtaca atttgaactt cagcatttct 1080

tcaacatctg gtttcaatag ggggaccctt cagtccaatt cttcctctac tttgcctcat 1140

taccagaggt tttctcccac agacggatca tatcttggtc ccacaactga atatgatgct 1200

cgtttacatc tcttctatgg aaatgggtat gaccacggcc acggacattc agatcagaaa 1260

ggaaaaggaa agaactaa 1278

Claims

1. The potato stu-miRn220 is characterized in that a precursor sequence of the potato stu-miRn220 is shown in a sequence table SEQ ID NO:1 is shown in the specification; the DNA sequence of the mature sequence of the potato stu-miRn220 is shown in a sequence table SEQ ID NO:2 is shown in the figure; the mature sequence of the potato stu-miRn220 is shown in a sequence table SEQ ID NO: 3.

2. A vector comprising the DNA sequence of the mature sequence of potato stu-miRn220 of claim 1.

3. Use of potato stu-miRn220 according to claim 1 for regulating expression of StTCP soltu dm.08g 007440, wherein said use is overexpression of the stu-miRn220 gene maturation sequence, whereby StTCP soltu.dm.08g 007440 expression is down-regulated.

4. Use of potato stu-miRn220 according to claim 1 for regulating expression of StTCP soltu dm.08g 0073360, wherein said use is overexpression of the stu-miRn220 gene maturation sequence for down-regulating sttcpsoltu dm.08g 0073360 expression.