CN114984033B

CN114984033B - Application of Gen-miR-1 from gentianella acuta in inhibiting myocardial fibrosis

Info

Publication number: CN114984033B
Application number: CN202210634779.7A
Authority: CN
Inventors: 李爱英; 杨高山; 张婷婷; 张亚京
Original assignee: Hebei University of Chinese Medicine
Current assignee: Hebei University of Chinese Medicine
Priority date: 2022-06-02
Filing date: 2022-06-07
Publication date: 2023-07-07
Anticipated expiration: 2042-06-07
Also published as: CN114984033A

Abstract

The invention discloses an application of Gen-miR-1 from gentianella acuta in inhibiting myocardial fibrosis. Application of Gen-miR-1 shown in SEQ ID NO.1 in preparation of medicines for inhibiting myocardial fibrosis. The Gen-miR-1 has 2'-O-methyl structural modification on the 3' -terminal nucleotide. The Gen-miR-1 is derived from gentianella acuta or is directly chemically synthesized. Gen-miR-1 plays a role in inhibiting myocardial fibrosis in the inhibition of oxidative stress and inflammatory response.

Description

Application of Gen-miR-1 from gentianella acuta in inhibiting myocardial fibrosis

Technical Field

The invention belongs to the technical field of medicines, and relates to an application of Gen-miR-1 from gentiana acuta in inhibiting myocardial fibrosis.

Background

The gentiana acuta (Gentianella acuta, g.acuta) is an annual herb of gentiana acuta of gentiaceae, and is widely distributed in regions such as Hebei, northeast, inner Mongolia, shanxi and Shandong of China. The whole herb in the Mongolian medicine is slightly bitter in taste and cool in nature, and has the effects of clearing heat and detoxicating. Investigation of folk medicinal plants found jawWen Kezu Hupeh uses the tea-water-soaking tea for treating angina pectoris and other diseases, has very obvious curative effect, and is the only plant with the function of treating heart diseases ^[1,2] . Based on the theory of heat toxicity of heart system diseases in traditional Chinese medicine, myocardial fibrosis (Myocardial fibrosis, MF) after myocardial infarction is considered to be a pathological evolution result of heat toxicity and stasis due to accumulation of turbid stasis and accumulation of heat toxicity. Modern clinical and experimental researches show that G.acuta and its effective components have the function of preventing and treating MF ^[3] The water extract can reduce acute myocardial injury of rats by inhibiting TLR4/NF- κB inflammatory signal pathway; isoproterenol (ISO) -induced rat MF can also be improved by anti-inflammatory, antioxidant, inhibiting TGF-beta 1/Smads signaling pathway ^[4-6] . In recent years, research reports on G.acuta

The ketone active ingredients can inhibit ischemia/reperfusion injury of the isolated rat through antioxidation and anti-apoptosis effects; mitigating H ₂ O ₂ Myocardial cytotoxicity and injury caused; it contains four major ∈ ->

The ketone compounds can inhibit H by activating Nrf2/ARE channel ₂ O ₂ Oxidative damage of H9c2 cells ^[7,8] . Recent experimental study proves that the active ingredient of G.acuta, namely belleville gentian (BEL) can inhibit the MF of mice. BEL inhibits TGF-beta 1-induced activation of cardiac fibroblasts (Cardiac fibroblasts, CFs) by inhibiting TGF-beta 1/Smads and p38MAPK signaling pathways, blocking the phosphorylation activation of Smad2/3 and p38/MAPK, preventing NR4A1 phosphorylation and nuclear to cytoplasmic translocation thereof (this study has been published in Front Pharmacol.2021) ^[9] . Furthermore, we have studied to confirm the other +.in G.acuta>

Ketone component mangiferin can play an anti-MF role by regulating GSH synthesis and mitochondrial energy metabolism ^[10] . The above study shows that G.acuta and +.>

The ketone active ingredients have the effect of resisting MF. However, because the effective components in G.acuta are complex, the action mechanism is not completely clear and other factors, the application of the G.acuta and the active components thereof in cardiovascular diseases is greatly restricted. Therefore, the novel active ingredients in G.acuta which are more efficient, stable and safer are searched, the action mechanism of the novel active ingredients is clarified, and the problems to be solved in the development process of the medicaments for treating cardiovascular diseases are urgently solved.

Plant-derived miRNAs can enter the body to exert targeted regulation and control effect by mediating gastric absorption through SDIT 1-dependent proteins ^[11] Not only can regulate fat metabolism of human body ^[12] Can even influence the occurrence of tumors ^[13] . Research also shows that miR2911 in traditional Chinese medicine honeysuckle can inhibit replication of influenza A virus in animal body ^[14] Thus, research hot spots for treating diseases by cross-species regulation of the miRNAs derived from traditional Chinese medicines are opened. Interestingly, we found that Sal-miR-1 and Sal-miR-3, which are specifically present in Sal, can affect VSMC phenotype switching across species-regulated OTUD7B/KLF4/NMHC IIA pathways, thereby inhibiting migration and adhesion of cells and effectively improving intimal hyperplasia (research results are published in: theranostics.2020) ^[15] The method comprises the steps of carrying out a first treatment on the surface of the In addition, sal-miR-58 derived from Sal can induce autophagy and reduce VSMC inflammatory response by regulating KLF3/NEDD4L/PFKP axis (research results are published in Mol Ther Nucleic acids.2020) ^[16] . However, miRNA does not exist in all Chinese medicines, and miRNA does not exist in a Chinese medicine necessarily has the same pharmacological action as the Chinese medicine or the active ingredients thereof. Thus, whether miRNA exists in g.acuta, whether they exist stably and act in vivo, and what kind of drug effect is not expected.

Reference is made to:

[1] chenille, chunling, ha Siba, a comparison of a folk medicinal plant of the Ewenke family with a Mongolian medicine [ J ]. A folk medicine of the Chinese nationality, 2009;18 (17):156-158.

[2] Pang Yuhang, guan Wei, hu Xiaoyang, gao Yanyu, li Ji. Chemical composition of gentianella acuta and pharmacological effect research progress [ J ]. Chinese herbal medicine 2018;49 (22):5468-5476.

[3] Zhu Junhong and Jin Zheng and Qingmin are all effective in treating coronary heart disease, wu Wei. Meta analysis [ J ] of the effect of PCI operation on coronary heart disease is assisted by heat and toxic materials clearing method, and J.2021 is combined with Chinese and Western medicine; 19 (07):1070-1078.

[4]Sun JH,Yang HX,Yao TT,Li Y,Ruan L,Xu GR,Zhang C,Guo GX,Li AY. Gentianella acuta prevents acute myocardial infarction induced by isoproterenol in rats via inhibition of galectin-3/TLR4/MyD88/NF-κB inflammatory signalling[J].Inflammopharmacology.2021；29: 205-219.

[5]Li AY,Wang JJ,Yang SC,Zhao YS,Li JR,Liu Y,Sun JH,An LP,Guan P,Ji ES.Protective role of Gentianella acuta on isoprenaline induced myocardial fibrosis in rats via inhibition of NF-κB pathway[J]. Biomed Pharmacother.2019；110:733-741.

[6]Yang HX,Xu GR,Zhang C,Sun JH,Zhang Y,Song JN,Li YF,Liu Y,Li AY.The aqueousextract of Gentianella acuta improves isoproterenol-induced myocardial fibrosis via inhibition of the TGF-β1/Smads signaling pathway[J].Int J Mol Med.2020；45(1): 223-233.

[7]Wang Z,Wu G,Yu Y,Liu H,Yang B,Kuang H,Wang Q.Xanthones isolated from Gentianella acuta and their protective effects against H ₂ O ₂ -induced myocardial cell injury[J].Nat Prod Res.2018；32(18): 2171-2177.

[8]Ren K,Su H,Lv LJ,Yi LT,Gong X,Dang LS,Zhang RF,Li MH.Effects of four compounds from Gentianella acuta(Michx.)Hulten on hydrogen peroxide-induced injury in H9c2 Cells[J].Biomed Res Int.2019； 2692970.

[9]Yang HX,Sun JH,Yao TT,Li Y,Xu GR,Zhang C,Liu XC,Zhou WW,Song QH,Zhang Y,Li AY.Bellidifolin ameliorates isoprenaline-induced myocardial fibrosis by regulating TGF-beta1/Smads and p38 signaling and preventing NR4A1 cytoplasmic localization[J].Front Pharmacol. 2021；12:644886.

[10]Song J,Meng Y,Wang M,Li L,Liu Z,Zheng K,Wu L,Liu B,Hou F, Li A.Mangiferin activates Nrf2 to attenuate cardiac fibrosis via redistributing glutaminolysis-derived glutamate[J].Pharmacol Res. 2020；157:104845.

[11]Zhou Z,Li X,Liu J,Dong L,Chen Q,Liu J,Kong H,Zhang Q,Qi X, Hou D,Zhang L,Zhang G,Liu Y,Zhang Y,Li J,Wang J,Chen X,Wang H,Zhang J,Chen H,Zen K,Zhang CY.Honeysuckle-encoded atypical microRNA2911 directly targets influenza A viruses[J].Cell Res.2015； 25(1):39-49.

[12]Chin AR,Fong MY,Somlo G,Wu J,Swiderski P,Wu X,Wang SE. Cross-kingdom inhibition of breast cancer growth by plant miR159[J]. Cell Res.2016；026(002):217-228.

[13]Chen Q,Zhang F,Dong L,Wu H,Xu J,Li H,Wang J,Zhou Z,Liu C, Wang Y,Liu Y,Lu L,Wang C,Liu M,Chen X,Wang C,Zhang C,Li D, Zen K,Wang F,Zhang Q,Zhang CY.SIDT1-dependent absorption in the stomach mediates host uptake of dietary and orally administered microRNAs[J].Cell Res.2020；0:1-12.

[14]Yang GS,Zheng B,Qin Y,Zhou J,Yang Z,Zhang XH,Zhao HY,Yang HJ, Wen JK.Salvia miltiorrhiza-derived miRNAs suppress vascular remodeling through regulating OTUD7B/KLF4/NMHCⅡA axis[J]. Theranostics.2020；10(17):7787-7811.

[15]Qin Y,Zheng B,Yang GS,Yang HJ,Zhou J,Yang Z,Zhang XH,Zhao HY, Shi JH,Wen JK.Salvia miltiorrhiza-derived Sal-miR-58induces autophagy and attenuates inflammation in vascular smooth muscle cells [J].Mol Ther Nucleic Acids.2020；21:492-511.

[16]Murphy MP.How mitochondria produce reactive oxygen species[J]. Biochem J.2009；417(1):1-13.

Disclosure of Invention

The invention aims to provide an application of Gen-miR-1 in preparation of a medicament for inhibiting myocardial fibrosis.

It is another object of the invention to provide compositions containing Gen-miR-1.

The aim of the invention can be achieved by the following technical scheme:

application of Gen-miR-1 shown in SEQ ID NO.1 in preparing medicines for inhibiting myocardial fibrosis is provided.

The precursor sequence of Gen-miR-1 is shown as SEQ ID NO.2, the mature body sequence is shown as SEQ ID NO.1, and the secondary structure is shown as FIG. 2.

As a preferred aspect of the present invention, the Gen-miR-1 has a 2'-O-methyl structure modification at its 3' -terminal nucleotide.

As a preferred aspect of the invention, the Gen-miR-1 is derived from gentiana acuta (Gentianella acuta) or is synthesized chemically directly.

As a preferred aspect of the invention, the Gen-miR-1 is used for preparing a medicament for inhibiting oxidative stress and inflammatory response in myocardial fibrosis.

A composition containing Gen-miR-1 shown in SEQ ID NO.1, wherein the Gen-miR-1 has 2'-O-methyl structure modification on 3' -terminal nucleotide.

Preferably, the composition further comprises a pharmaceutical excipient.

Preferably, the composition is prepared into a tablet, a capsule or an injection.

The beneficial effects are that:

according to the invention, through combining experimental researches on myocardial fibrosis for decades, performing second-generation high-throughput sequencing on the gentiana acuta, unifying and synthesizing active ingredients of the gentiana acuta, performing in vitro experiments on antioxidation stress, inhibiting inflammation, researching a cell migration mechanism, establishing an animal model and the like, the Gen-miR-1 derived from the gentiana acuta plays a role in inhibiting the oxidation stress and inflammatory reaction in the process of inhibiting myocardial fibrosis. This finding breaks through the teachings and teachings of the prior art and is not readily available to those skilled in the art without the benefit of the inventive faculty, having outstanding substantial features and significant advances. To further investigate the mechanism of action of gentianella acuta-derived Gen-miR-1 in inhibiting oxidative stress and inflammatory response in inhibiting myocardial fibrosis. The invention adopts biochemical, molecular biology, histopathology and other methods to develop Gen-miR-1 with the functions of inhibiting oxidative stress and inflammatory reaction, lays a foundation for providing a high-efficiency and low-toxicity novel medicament for clinically treating cardiovascular remodeling, provides in-vivo pharmacodynamics and action mechanism and theoretical experiment basis for developing traditional Chinese medicine for treating cardiovascular remodeling, and creates conditions for technological achievement transformation.

Drawings

FIG. 1A sequence of RNA pooling sequencing of gentianella acuta

FIG. 2 Gen-miR-1 secondary structure derived from gentianella acuta

FIG. 3 flow chart of analysis of biological information of gentianella acuta miRNA

FIG. 4 gentianella acuta miRNA KEGG pathway enrichment analysis (A) and KOG enrichment analysis (B)

FIG. 5 classification of gentianella acuta miRNAs

FIG. 6 expression abundance of specific miRNAs from gentianella acuta

FIG. 7 expression level of Gen-miR-1 in mouse tissue

FIG. 8 experimental results of Gen-miR-1 in mouse myocardial fibrosis cell model

Western Blot detection of the Effect of Gen-miR-1 on the expression of Collagen I, collagen III, alpha-SMA, IL-1 beta, TNF-alpha, IL-6 proteins in TGF-beta 1-induced myocardial fibrosis cell models

B. Scratch experiment for detecting influence of Gen-miR-1 on TGF-beta 1 induced fibroblast model migration

FIG. 9 results of in vivo Gen-miR-1 mice

Effect of gen-miR-1 on ISO-induced myocardial fibrosis mouse electrocardiogram changes

Representative images of gen-miR-1 staining of different groups of left ventricular tissue Masson and HE in ISO-induced myocardial fibrosis mice

Western Blot detection of the Effect of Gen-miR-1 on protein expression of Tss R I, tss RII, collagen III, IL-1 beta, IL-6 in different groups of cardiac tissue of ISO-induced myocardial fibrosis mice

D. Immunohistochemical detection of the Effect of Gen-miR-1 on the expression of Collagen I, collagen III, IL-1 beta, IL-6, TNF-alpha in different groups of heart tissue of ISO-induced myocardial fibrosis mice

E. Fluorescent observation of Gen-miR-1 on the production of ROS in different groups of cardiac tissue of ISO-induced myocardial fibrosis mice

FIG. 10 Gen-miR-1 from gentianella acuta is stably expressed in CF

Detailed Description

Example 1

In order to identify miRNAs in gentiana aculeata, we used a high-throughput second-generation sequencing approach to sequence analysis of possible miRNAs in gentiana aculeata, we first extracted the RNA of the traditional Chinese medicine gentiana aculeata and started to establish and sequence after quality is qualified before establishing the library (FIG. 1). Sequencing results showed that 111 miRNAs were screened altogether (see fig. 5), of which there were both miRNAs homologous to other plants and 6 miRNAs specifically present in gentiana aculeata.

A miRNA having the sequence:

name sequence

Gen-miR-1 uggaaucgaaaaucucucuug

Gen-miR-2 gcuuugucagagauccugagc

Gen-miR-3 uuaugcagccaaucauguaaag

Gen-miR-4 uuggacugaagggagcucccuuc

Gen-miR-5 guagaucguaugguagaaaga

Gen-miR-8 cggcaagucgucuuuggcu

the miRNAs provided above all have modifications of the 2'-O-methyl structure on their 3' -terminal nucleotides.

Further by performing KEGG Pathway and KOG enrichment assays on the function of miRNAs in gentiana aculeata, KEGG and KGO signaling Pathway enrichment assays showed that g.acuta-derived miRNAs play a role in endoplasmic reticulum stress, autophagy regulation, and glycolipid metabolism (see fig. 4). From these several miRNAs related to cardiovascular function were selected for subsequent validation, we extracted gentiana aculeata RNA for qRT-PCR detection, and the results showed that expression of miRNAs from gentiana aculeata could be detected in gentiana aculeata, and that Gen-miR-1 expression specific to gentiana aculeata was relatively high (fig. 6). We decided to consider such miRNAs as subjects.

Since plant-derived miRNAs have modifications of the 2'-O-methyl structure on their 3' -terminal nucleotides, this renders them periodate-resistant. In contrast, mammalian miRNAs with free 2 'and 3' hydroxyl groups are sensitive to periodate. We further extracted miRNA from gentiana acuta and treated with sodium periodate (oxidant) for qRT-PCR detection, which showed that gentiana acuta specific Gen-miR-1 was still expressed. We further verified whether the gentiana aculeata-derived miRNAs can be stably expressed in CF, and we prepared Gen-miR-1 and added 2'-O-methyl structure modifications on the respective 3' -terminal nucleotides, transfected CF respectively, extracted RNA and subjected to sodium periodate treatment for qRT-PCR detection. The results showed that Gen-miR-1, derived from gentianella acuta, was not oxidatively degraded by sodium periodate and could be stably present in mouse CF (FIG. 10).

The experimental procedure involved was as follows:

1. extraction of total RNA from plants

1) Grinding the dried whole plant of the gentiana acuta with liquid nitrogen to ensure that no massive tissue exists, placing 100mg of powder into a 2mL sterile centrifuge tube, adding 500 mu L of Buffer RCL/beta-mercaptoethanol (adding beta-mercaptoethanol before thawing a sample), and rapidly and uniformly mixing;

2) Water bath at 55 ℃ for 1-3min, room temperature, and centrifugation at 14,000g for 5min;

3) The supernatant (approximately 450. Mu.L available) was aspirated, added to gDNA Filter Colum containing a 2mL collection tube and centrifuged at 14,000g for 2min at room temperature;

4) Adding Buffer RCB with equal volume into a collecting pipe, and mixing for 5-10 times upside down;

5) Placing the whole mixture obtained in (4) including the precipitate in HiBind RNA mini Colum, adding a new 2mL collecting tube, centrifuging at room temperature for 1min at 10,000, removing mobile phase, and placing the column back into the collecting tube;

6) Adding 400 mu L RWC Wash Buffer, placing in a column, centrifuging at room temperature for 1min at 10,000g to remove mobile phase, and placing the column back in a collecting tube; at this time, DNAase I treatment may be selected;

7) The column was placed in a fresh 2mL collection tube, 500. Mu. L RNA Wash Buffer II was added, centrifuged at 10,000g for 1min at room temperature, the mobile phase was removed, and the column was returned to the collection tube;

8) Repeating the step (7), putting the column back into a collecting pipe, centrifuging for 2min at 10,000g, and centrifuging and drying;

9) Placing the centrifugal column in a new 1.5mL centrifuge tube, adding 30-50 mu L DEPC water into the centrifugal column, standing at room temperature for 2min, centrifuging at full speed (more than or equal to 13,000 g) for 1min, collecting effluent, and preserving at-80deg.C;

2. RNA library-building sequencing process of gentiana acuta

From RNA sample to final data acquisition, each link of sample detection, library establishment and sequencing can influence the quality and quantity of data, and the quality of data can directly influence the result of subsequent information analysis; in order to ensure the accuracy and reliability of sequencing data from the source, each step of sample detection, library establishment and sequencing is strictly controlled, so that the output of high-quality data is ensured; the flow chart is shown in fig. 1.

2.1 Total RNA sample detection

Detection of RNA samples mainly includes 4 methods:

(1) Agarose gel electrophoresis analysis of RNA degradation degree and whether pollution exists;

(2) Nanodrop detects the purity of RNA (OD 260/280 ratio);

(3) Qubit accurately quantifies RNA concentration;

(4) Agilent 2100 accurately detects the integrity of RNA;

2.2 library construction

After the sample is detected to be qualified, a library is constructed by using Small RNA Sample Pre Kit, 3 'and 5' special structures (the 5 'end is provided with a complete phosphate group and the 3' end is provided with a hydroxyl group) of the Small RNA are utilized, total RNA is taken as a starting sample, the two ends of the Small RNA are directly added with connectors, and then reverse transcription is carried out to synthesize cDNA; then carrying out PCR amplification, separating target DNA fragments by electrophoresis of PAGE gel, and cutting gel and recovering to obtain a cDNA library; the construction schematic is shown in figure 1.

2.3 library inspection

After the library construction is completed, the Qubit2.0 is used for preliminary quantification, the library is diluted to 1 ng/. Mu.L, the Agilent 2100 is used for detecting the insert size of the library, and after the insert size meets the expectations, the Q-PCR method is used for accurately quantifying the effective concentration of the library (the effective concentration of the library is more than 2 nM) so as to ensure the quality of the library;

2.4 on-machine sequencing

After qualified library inspection, carrying out HiSeq/MiSeq sequencing on different libraries according to the effective concentration and the requirement of target off-machine data volume to obtain plant-derived miRNA existing in the false gentiana acuta;

3. extraction of plant miRNA

1) Grinding dry false gentian plant tissue with liquid nitrogen to ensure that no massive tissue exists, placing 50-100 mg powder into a 2mL sterile centrifuge tube, adding 700 mu L of Lysis mixture, swirling for 30s at the highest speed, and fully mixing the samples;

2) Water bath at 55 ℃ for 3min, room temperature, centrifugation at 12,000g for 5min;

3) The supernatant was aspirated, added to gDNA Removel Colum containing a 2mL collection tube and centrifuged at 12,000g for 2min at room temperature;

4) Transferring the liquid in the collecting pipe to a new 2mL centrifuge tube, adding absolute ethyl alcohol vortex with the volume of 1.1 times of that of the liquid into the liquid in the collecting pipe, and fully and uniformly mixing the liquid in the collecting pipe for 20 s; centrifuging at 12,000g for 1min, and discarding the mobile phase;

5) Placing 700. Mu.L of the mixture obtained in (4) in microElute RNA mini Colum, adding a new 2mL collecting tube, centrifuging at room temperature for 1min at 12,000, removing the mobile phase, and placing the column back into the collecting tube;

6) Repeating (5) until all liquid is transferred;

7) Adding 500 μl of absolute ethanol to microElute RNA mini Colum, centrifuging at room temperature for 1min at 12,000g, and removing mobile phase;

8) Adding 500 mu L XD Binding Buffer to microElute RNA mini Colum, centrifuging at room temperature for 1min at 12,000g, and removing mobile phase;

9) Adding 750 mu L RNA Wash Buffer II, centrifuging at room temperature for 1min at 10,000g, removing mobile phase, and placing the column back into a collection tube; repeating the process once;

10 Centrifugal drying with maximum rotation speed (not less than 12,000 g) for 2min

11 Placing the centrifugal column in a new 1.5mL centrifuge tube, adding 30-50 mu L DEPC water into the centrifugal column, standing at room temperature for 5min, centrifuging at full speed (not less than 12,000 g) for 1min, collecting effluent, and preserving at-80deg.C;

4. digestion of RNA with sodium periodate

(1) mu.L of extracted RNA was added to 95. Mu.L of 10mM NaIO ₃ Incubating at 0deg.C in dark for 40min;

(2) Adding 1mL of absolute ethanol and 1 mu L of glycogen, and standing on ice for 20min;

(3) Centrifuging the supernatant at 4℃for 12,000g,15 min;

(4) Adding 1mL of absolute ethanol at 12,000g for 15min, centrifuging at 4 ℃ and discarding the supernatant;

(5) 1mL of 75% ethanol was added at 12,000g for 15min and the supernatant was centrifuged at 4 ℃;

(6) Standing at room temperature for 5min, dissolving with ddH2O, and quantifying;

5. reverse transcription of miRNAs

5.1 ligation reaction System:

the reaction system was subjected to reverse transcription reaction in a PCR apparatus under the following conditions:

5.2 reverse transcription reaction System:

4. Mu.L of ligation product was added to the reverse transcription system (equilibrated at room temperature for 2min before addition)

6. Semi-quantitative detection of miRNA

PCR reaction system:

mu.L of cDNA was added to 200. Mu.LRNase-free H ₂ O

name primers

Gen-miR-1 cgtggaatcgaaaatctctcttg

7. Sequencing of miRNAs

Sequencing the amplified PCR products to determine the sequence of Gen-miR-1.

Gen-miR-1 sequence information:

precursor (Precursor):

uggaaucgaaaaucucucuugcauugucuuuguauauuaccuuccugagcccuggugaaaauaucugaa cuaaucgaugcccucuacaaggaugggaggauagaagaugcaaacuauuuaguuuagaccaugacccag gaagguguuaguuaagauauuuucacuuuuaguuguuuugauggguguguauguguugcguggucaaaa gacaaagcaagagagauuucugauuccaug(SEQ ID NO.2)

material (Mature):

uggaaucgaaaaucucucuug(SEQ ID NO.1)

secondary structure:

as in fig. 2.

Example 2

We cultured mouse myocardial fibroblasts (CF) in vitro, prepared Gen-miR-1 agoniR transfected CF with 2 '-O-methylation at 3' end, and clear that Gen-miR-1 can inhibit the molecular mechanism of induced myocardial fibrosis and transforming growth factor-beta 1 (transforming growth factor-beta 1, TGF-beta 1) induced response to CF oxidative stress and inflammation.

Causes aseptic inflammatory and oxidative stress reaction of myocardial tissues after myocardial infarction, activates CFs and then induces MF. Numerous studies have demonstrated that oxidative stress and inflammatory response are the core events of MF. To clarify the role of Gen-miR-1 in the CF activation process, we transfected CFs with G.acuta-derived Gen-miR-1 synthesized in vitro, and experimental results show that Gen-miR-1 can inhibit the expression levels of CFs activation markers Collagen I, collagen III and alpha-SMA induced by TGF-beta 1 (FIG. 8A) and the expression levels of inflammatory factors such as IL-1 beta, TNF-alpha and IL-6 and migration of CFs (FIG. 8B). Research results show that Gen-miR-1 inhibits TGF-beta 1 induced CFs activation and inflammatory response through targets.

Example 3 in vivo test

To determine whether g.acuta-derived Gen-miR-1 can exert a regulatory effect across species entry into the body, C57 mice were given Gen-miR-1 agonir by gavage 1 time per day, 1 OD/time, seven consecutive days. And taking blood from eyeballs, taking heart and blood vessel specimens after sacrifice, extracting miRNA in blood and tissues by using a kit, and detecting the level of Gen-miR-1 in the blood and the tissues by using RT-PCR. The results showed that Gen-miR-1 was perfused into mice, and Gen-miR-1 was detectable in all of the blood, blood vessels and heart tissues of the mice (FIG. 7), indicating that Gen-miR-1 could cross species into mice.

40C 57BL/6 mice (about 20g male mice) are selected, and after one week of adaptive feeding, the mice are randomly divided into 4 groups: (1) miR-Ctl+normal saline group, (2) miR-Ctl+ISO group, (3) normal saline+Gen-miR-1 group, (4) ISO+Gen-miR-1 group, and 10 miR-1 groups. Groups (2) and (4) were subcutaneously injected with ISO (5 mg/kg) every 24h, while mice miR-Ctl agoniR or Gen-miR-1 agoniR (1 OD/day) were administered by gavage for 7d. Groups (1) and (3) were subcutaneously injected with physiological saline (5 mg/kg) every 24h, while mice miR-Ctl agoniR or Gen-miR-1 agoniR (1 OD/day) was administered by gavage for 7d. Electrocardiographic examination observes changes in cardiac biology. Heart samples were taken after animal sacrifice, HE and Masson staining was performed to observe changes in heart tissue morphology and Collagen deposition, western Blot was performed to detect expression levels of TGF-beta receptor I (Tβ R I), TGF-beta receptor II (TβRII), collagen III, interleukin 1 beta (IL-1 beta) and interleukin 6 (IL-6) in heart tissue, and immunohistochemical was performed to detect expression levels of Collagen I, collagen III, IL-1 beta, IL-6, TNF-alpha in heart tissue.

Electrocardiogram results show that Gen-miR-1 can obviously improve ISO-induced ST segment reduction and myocardial ischemia of mice (figure 9A); HE and Masson staining results show that Gen-miR-1 can significantly reduce the range of myocardial infarction and reduce collagen fiber deposition in the infarcted area (FIG. 9B); western Blot detection shows that Gen-miR-1 can inhibit protein expression levels of Tss R I, tss RII, collagen III, IL-1 beta, IL-6 (FIG. 9C). Immunohistochemical detection showed that Gen-miR-1 could inhibit the expression levels of Collagen I, collagen III, IL-1β, IL-6, TNF- α (FIG. 9D), which indicated that G.acuta-derived Gen-miR-1 could inhibit ISO-induced myocardial fibrosis and inflammatory responses of mice across species.

TGF-. Beta.1 is closely related to oxidative stress: TGF-. Beta.1 may increase ROS production, leading to redox imbalances; in turn, ROS can activate and mediate many of the pro-fibrotic effects of TGF- β1, which mediate each other to form a vicious circle, involved in the pathological processes of fibrotic diseases. ROS produced in tissues was detected using Dihydroethidium (DHE), and the results showed that Gen-miR-1 could inhibit ROS production (fig. 9E). According to the suggestion, gen-miR-1 regulates TGF-beta 1 signals and simultaneously influences ROS production.

Sequence listing

<110> Hebei national institute of Chinese medicine

<120> use of Gen-miR-1 from gentianella acuta for inhibiting myocardial fibrosis

<150> 2022106211250

<151> 2022-06-02

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Russian gentian (Gentianella acuta)

<400> 1

uggaaucgaa aaucucucuu g 21

<210> 2

<211> 237

<212> RNA

<213> Russian gentian (Gentianella acuta)

<400> 2

uggaaucgaa aaucucucuu gcauugucuu uguauauuac cuuccugagc ccuggugaaa 60

auaucugaac uaaucgaugc ccucuacaag gaugggagga uagaagaugc aaacuauuua 120

guuuagacca ugacccagga agguguuagu uaagauauuu ucacuuuuag uuguuuugau 180

ggguguguau guguugcgug gucaaaagac aaagcaagag agauuucuga uuccaug 237

Claims

Application of Gen-miR-1 shown in SEQ ID No.1 in preparation of medicines for treating myocardial fibrosis.
2. The use according to claim 1, characterized in that the Gen-miR-1 has a modification of the 2'-O-methyl structure at its 3' terminal nucleotide.
3. The use according to claim 1 or 2, characterized in that the Gen-miR-1 is derived from pseudogentian acuta (Gentianella acuta) or direct chemical synthesis.
4. Use according to claim 3, characterized by the use in the preparation of a medicament for inhibiting oxidative stress and inflammatory reactions during myocardial fibrosis.
5. A composition containing Gen-miR-1 shown in SEQ ID NO.1, wherein the Gen-miR-1 has 2'-O-methyl structure modification on 3' -terminal nucleotide.
6. The composition of claim 5, wherein the composition further comprises a pharmaceutical excipient.
7. The composition according to claim 5, wherein the composition is formulated as a tablet, capsule or injection.