CN114984033A

CN114984033A - Application of Gen-miR-1 derived from gentiana acuta in inhibition of myocardial fibrosis

Info

Publication number: CN114984033A
Application number: CN202210634779.7A
Authority: CN
Inventors: 李爱英; 杨高山; 张婷婷; 张亚京
Original assignee: Hebei University of Chinese Medicine
Current assignee: Hebei University of Chinese Medicine
Priority date: 2022-06-02
Filing date: 2022-06-07
Publication date: 2022-09-02
Anticipated expiration: 2042-06-07
Also published as: CN114984033B

Abstract

The invention discloses an application of Gen-miR-1 derived from gentiana acuta in inhibiting myocardial fibrosis. Application of Gen-miR-1 shown in SEQ ID No.1 in preparation of drugs for inhibiting myocardial fibrosis. The Gen-miR-1 has a modified 2 '-O-methylated structure on the 3' terminal nucleotide. The Gen-miR-1 is derived from gentiana acuta or is directly chemically synthesized. Gen-miR-1 plays a role in inhibiting myocardial fibrosis in the process of inhibiting oxidative stress and inflammatory reaction.

Description

Application of Gen-miR-1 derived from gentiana acuta in inhibition of myocardial fibrosis

Technical Field

The invention belongs to the technical field of medicines, and relates to application of Gen-miR-1 derived from gentiana acuta in inhibiting myocardial fibrosis.

Background

Gentianella acuta (g. acuta) is an annual herb of Gentianella acuta of gentianaceae, and is widely distributed in the north and the east of china in the river, the north, the inner mongolian, the west and the east of China. The whole herb is used as a medicine in the mongolian medicine, has slightly bitter taste and cool property, and has the effects of clearing heat and removing toxicity. The investigation of folk medicinal plants shows that the Erwink family civil use tea-soaked water instead of tea for treating the diseases such as angina pectoris has extremely obvious curative effect, and is the only plant with the effect of treating heart diseases ^[1,2] . Based on the theory of toxic heat of heart diseases in traditional Chinese medicine, Myocardial Fibrosis (MF) after Myocardial infarction is considered to be a pathological evolution result of accumulation of turbid stasis and accumulation of toxic heat, which leads to coexistence of toxic heat and blood stasis. The modern clinical and experimental researches show that the G.acuta and the active ingredients thereof have the function of preventing and treating MF (MF) ^[3] The aqueous extract can relieve acute myocardial injury of rats by inhibiting a TLR 4/NF-kB inflammatory signal channel; isoprenol (ISO) -induced rat MF can also be improved by anti-inflammatory, antioxidant, and TGF-beta 1/Smads signaling pathway inhibition ^[4-6] . Recent studies have reported that of G.acuta

The ketone active ingredient can inhibit in vitro rat ischemia/reperfusion injury through antioxidation and anti-apoptosis; h mitigation ₂ O ₂ Resulting myocardial cytotoxicity and injury; it contains four main components

The ketone compounds can inhibit H by activating Nrf2/ARE pathway ₂ O ₂ Resulting oxidative damage of H9c2 cells ^[7,8] . Recent experimental studies have confirmed that g.acuta active ingredient, Bellidifolin (BEL) inhibits mouse MF. BEL blocks phosphorylation activation of Smad2/3 and p38/MAPK by inhibiting TGF-beta 1/Smads and p38MAPK signaling pathways, and prevents NR4A1 from phosphorylation andits nuclear to cytoplasmic translocation, in turn, inhibits TGF-. beta.1-induced activation of Cardiac Fibroblasts (CFs) (this study has been published in Front Pharmacol.2021) ^[9] . In addition, our study demonstrated that another of g

Mangiferin as ketone component can play an anti-MF role by regulating and controlling GSH synthesis and mitochondrial energy metabolism ^[10] . The above studies indicate that G, acuta and

the ketone effective component has MF resisting effect. However, due to the factors that the effective components in the G.acuta are complex, the action mechanism is not completely clear and the like, the application of the G.acuta and the active components thereof in the cardiovascular diseases is greatly restricted. Therefore, finding a novel active ingredient with higher efficiency, more stability and more safety in G.acuta and defining the action mechanism thereof becomes a problem to be solved urgently in the process of developing medicaments for treating cardiovascular diseases.

Plant-derived miRNAs can enter a body to play a target regulation role by relying on SDIT1 protein to mediate gastric absorption ^[11] Not only can regulate the fat metabolism of the human body ^[12] Even influence tumor development ^[13] . Research also finds that miR2911 in traditional Chinese medicine honeysuckle can inhibit replication of influenza A virus in animal bodies ^[14] Therefore, the research focus of cross-species regulation and disease treatment of miRNAs from traditional Chinese medicine sources is opened. Interestingly, we found that Sal-miR-1 and Sal-miR-3 specifically existing in Salvia miltiorrhiza Bunge can cross-species regulate OTUD7B/KLF4/NMHC IIA pathway to influence VSMC phenotype conversion, thereby inhibiting migration and adhesion of cells and effectively improving intimal hyperplasia of blood vessels (research results are published in: Theranostics.2020) ^[15] (ii) a In addition, Sal-miR-58 derived from Salvia miltiorrhiza Bunge can induce autophagy and reduce VSMC inflammatory response by regulating KLF3/NEDD4L/PFKP axis (research results are published in: Mol Ther Nucleic acids.2020) ^[16] . However, miRNA is not present in all chinese herbs, nor is miRNA present in chinese herbs necessarily have the same pharmacological action as the chinese herb or its active ingredient. Due to the fact thatThus, the presence of miRNA in g.acuta, whether they can stably exist and act in vivo, and what kind of drug effect they possess are not predictable.

Reference documents:

[1] wunier, chunling, hasba root, ebeck national folk medicinal plant and its comparison with mongolian medicine [ J ]. chinese national folk medicine, 2009; 18(17):156-158.

[2] The research on the chemical components and pharmacological actions of Pongyuhang, guanwei, Huyangyang, catalpa, Liji, Gentiana cuspidata.2018; 49(22):5468-5476.

[3] Zhujunhong, jin Zheng, Zhu Qing Min, all cured Yi, Wuwei, the method of clearing away heat and toxic material to assist PCI to the clinical efficacy of patients with coronary heart disease and MACE influence Meta analysis [ J ] the Chinese and Western medicine combined cardiovascular and cerebrovascular disease journal.2021; 19(07):1070-1078.

[4]Sun JH,Yang HX,Yao TT,Li Y,Ruan L,Xu GR,Zhang C,Guo GX,Li AY. Gentianella acuta prevents acute myocardial infarction induced by isoproterenol in rats via inhibition of galectin-3/TLR4/MyD88/NF-κB inflammatory signalling[J].Inflammopharmacology.2021；29: 205-219.

[5]Li AY,Wang JJ,Yang SC,Zhao YS,Li JR,Liu Y,Sun JH,An LP,Guan P,Ji ES.Protective role of Gentianella acuta on isoprenaline induced myocardial fibrosis in rats via inhibition of NF-κB pathway[J]. Biomed Pharmacother.2019；110:733-741.

[6]Yang HX,Xu GR,Zhang C,Sun JH,Zhang Y,Song JN,Li YF,Liu Y,Li AY.The aqueousextract of Gentianella acuta improves isoproterenol-induced myocardial fibrosis via inhibition of the TGF-β1/Smads signaling pathway[J].Int J Mol Med.2020；45(1): 223-233.

[7]Wang Z,Wu G,Yu Y,Liu H,Yang B,Kuang H,Wang Q.Xanthones isolated from Gentianella acuta and their protective effects against H ₂ O ₂ -induced myocardial cell injury[J].Nat Prod Res.2018；32(18): 2171-2177.

[8]Ren K,Su H,Lv LJ,Yi LT,Gong X,Dang LS,Zhang RF,Li MH.Effects of four compounds from Gentianella acuta(Michx.)Hulten on hydrogen peroxide-induced injury in H9c2 Cells[J].Biomed Res Int.2019； 2692970.

[9]Yang HX,Sun JH,Yao TT,Li Y,Xu GR,Zhang C,Liu XC,Zhou WW,Song QH,Zhang Y,Li AY.Bellidifolin ameliorates isoprenaline-induced myocardial fibrosis by regulating TGF-beta1/Smads and p38 signaling and preventing NR4A1 cytoplasmic localization[J].Front Pharmacol. 2021；12:644886.

[10]Song J,Meng Y,Wang M,Li L,Liu Z,Zheng K,Wu L,Liu B,Hou F, Li A.Mangiferin activates Nrf2 to attenuate cardiac fibrosis via redistributing glutaminolysis-derived glutamate[J].Pharmacol Res. 2020；157:104845.

[11]Zhou Z,Li X,Liu J,Dong L,Chen Q,Liu J,Kong H,Zhang Q,Qi X, Hou D,Zhang L,Zhang G,Liu Y,Zhang Y,Li J,Wang J,Chen X,Wang H,Zhang J,Chen H,Zen K,Zhang CY.Honeysuckle-encoded atypical microRNA2911 directly targets influenza A viruses[J].Cell Res.2015； 25(1):39-49.

[12]Chin AR,Fong MY,Somlo G,Wu J,Swiderski P,Wu X,Wang SE. Cross-kingdom inhibition of breast cancer growth by plant miR159[J]. Cell Res.2016；026(002):217-228.

[13]Chen Q,Zhang F,Dong L,Wu H,Xu J,Li H,Wang J,Zhou Z,Liu C, Wang Y,Liu Y,Lu L,Wang C,Liu M,Chen X,Wang C,Zhang C,Li D, Zen K,Wang F,Zhang Q,Zhang CY.SIDT1-dependent absorption in the stomach mediates host uptake of dietary and orally administered microRNAs[J].Cell Res.2020；0:1-12.

[14]Yang GS,Zheng B,Qin Y,Zhou J,Yang Z,Zhang XH,Zhao HY,Yang HJ, Wen JK.Salvia miltiorrhiza-derived miRNAs suppress vascular remodeling through regulating OTUD7B/KLF4/NMHCⅡA axis[J]. Theranostics.2020；10(17):7787-7811.

[15]Qin Y,Zheng B,Yang GS,Yang HJ,Zhou J,Yang Z,Zhang XH,Zhao HY, Shi JH,Wen JK.Salvia miltiorrhiza-derived Sal-miR-58induces autophagy and attenuates inflammation in vascular smooth muscle cells [J].Mol Ther Nucleic Acids.2020；21:492-511.

[16]Murphy MP.How mitochondria produce reactive oxygen species[J]. Biochem J.2009；417(1):1-13.

Disclosure of Invention

The invention aims to provide application of Gen-miR-1 in preparation of a medicament for treating and inhibiting myocardial fibrosis.

Another object of the present invention is to provide compositions comprising Gen-miR-1.

The purpose of the invention can be realized by the following technical scheme:

application of Gen-miR-1 shown in SEQ ID NO.1 in preparation of drugs for inhibiting myocardial fibrosis.

The precursor sequence of Gen-miR-1 is shown as SEQ ID NO.2, the mature body sequence is shown as SEQ ID NO.1, and the secondary construction is shown as FIG. 2.

As a preferred embodiment of the present invention, Gen-miR-1 has a 2 '-O-methylated structure modification at its 3' -terminal nucleotide.

As a preferable selection of the invention, the Gen-miR-1 is derived from gentiana acuta (Gentianella acuta) or directly chemically synthesized.

As a preferable selection of the invention, the Gen-miR-1 is applied to the preparation of medicines for inhibiting oxidative stress and inflammatory reaction in the process of myocardial fibrosis.

The composition contains Gen-miR-1 shown in SEQ ID NO.1, and the Gen-miR-1 has a 2 '-O-methylated structure modification on the 3' terminal nucleotide.

Preferably, the composition further comprises a pharmaceutical adjuvant.

As a preferred mode of the present invention, the composition is prepared into tablets, capsules or injections.

Has the advantages that:

the Gen-miR-1 derived from the pseudogentiana acuta is found to play a role in inhibiting oxidative stress and inflammatory reaction in the process of inhibiting myocardial fibrosis by combining experimental research on the myocardial fibrosis for decades, performing second-generation high-throughput sequencing on the pseudogentiana acuta, unifying and synthesizing active ingredients of the pseudogentiana acuta, performing in-vitro experiment on antioxidant stress, inhibiting inflammation, researching a cell migration mechanism, establishing an animal model and the like. The discovery breaks through the teaching and the suggestion of the prior art, is not obtained by the technicians in the field without creative work, and has outstanding substantive features and remarkable progress. In order to further research the action mechanism of Gen-miR-1 from the gentianella acuta for inhibiting myocardial fibrosis in the process of inhibiting oxidative stress and inflammatory reaction. The invention adopts methods of biochemistry, molecular biology, histopathology and the like to develop Gen-miR-1 with the functions of inhibiting oxidative stress and inflammatory reaction, lays a foundation for providing a novel high-efficiency and low-toxicity medicament for clinical treatment of cardiovascular remodeling, provides in-vivo pharmacodynamics, action mechanism and theoretical experimental basis for research and development of traditional Chinese medicine for treating cardiovascular remodeling, and creates conditions for scientific and technological achievement transformation.

Drawings

FIG. 1 shows the sequencing process of Gentiana acuta RNA library construction

FIG. 2 shows Gen-miR-1 secondary structure derived from Gentiana acuta

FIG. 3. Gentiana acuta miRNA bioinformation analysis process

FIG. 4 Gentiana acuta miRNA KEGG pathway enrichment assay (A) and KOG enrichment assay (B)

FIG. 5 classification of Gentiana acuta miRNAs

FIG. 6. expression abundance of miRNAs specific to Gentiana acuta

FIG. 7 expression levels of Gen-miR-1 in mouse tissues

FIG. 8 shows the results of the experiment of Gen-miR-1 in mouse myocardial fibrosis cell model

Western Blot detection of the influence of Gen-miR-1 on the expression of Collagen I, Collagen III, alpha-SMA, IL-1 beta, TNF-alpha and IL-6 proteins in TGF-beta 1-induced myocardial fibrosis cell model

B. Scratch experiment for detecting influence of Gen-miR-1 on TGF-beta 1-induced fibroblast model migration

FIG. 9 in vivo results of Gen-miR-1 mice

Effect of Gen-miR-1 on the changes in the electrocardiogram of ISO-induced myocardial fibrosis mice

Representative images of Masson and HE staining of different groups of left ventricular tissues of ISO-induced myocardial fibrosis mice by Gen-miR-1

Western Blot detection of the influence of Gen-miR-1 on protein expression of Tbeta R I, Tbeta RII, Collagen III, IL-1 beta and IL-6 in different groups of heart tissues of ISO-induced myocardial fibrosis mice

D. Immunohistochemical detection of the influence of Gen-miR-1 on the expression of Collagen I, Collagen III, IL-1 beta, IL-6 and TNF-alpha in different groups of heart tissues of mice with myocardial fibrosis induced by ISO

E. Fluorescence observation of ROS generation condition of Gen-miR-1 in different groups of heart tissues of ISO-induced myocardial fibrosis mice

FIG. 10 Stable expression of Gen-miR-1 derived from Gentiana acuta in CF

Detailed Description

Example 1

In order to identify miRNAs in the gentianella acuta, the miRNAs possibly existing in the gentianella acuta are subjected to sequence analysis by using a high-throughput second-generation sequencing method, RNA of the traditional Chinese medicine gentianella acuta is extracted firstly before the library is established, and the library is established and sequenced after the quality is qualified (figure 1). The sequencing results showed that a total of 111 miRNAs were selected (see FIG. 5), which were both homologous to other plants and 6 miRNAs specific to Gentiana acuta.

6 miRNAs have the following sequences:

name sequence

Gen-miR-1 uggaaucgaaaaucucucuug

Gen-miR-2 gcuuugucagagauccugagc

Gen-miR-3 uuaugcagccaaucauguaaag

Gen-miR-4 uuggacugaagggagcucccuuc

Gen-miR-5 guagaucguaugguagaaaga

Gen-miR-8 cggcaagucgucuuuggcu

all of the miRNAs provided above have a modification of the 2 '-O-methylated structure at the 3' terminal nucleotide.

Further, by performing the KEGG Pathway and KOG enrichment analysis on the function of miRNAs in gentianella acuta, the KEGG and KGO signal Pathway enrichment analysis showed that g.acuta-derived miRNAs play a role in endoplasmic reticulum stress, autophagy regulation, and glycolipid metabolism (see fig. 4). Several miRNAs related to cardiovascular function are selected from the extract for subsequent verification, the RNA of the gentianella acuta is extracted for qRT-PCR detection, and the result shows that the expression of the miRNAs derived from the gentianella acuta can be detected in the gentianella acuta, and the Gen-miR-1 expression specific to the gentianella acuta is relatively high (figure 6). We decided to target such miRNAs as a study.

Since plant-derived miRNAs have a modification of the 2 '-O-methylated structure at their 3' terminal nucleotides, they are resistant to periodate. In contrast, mammalian miRNAs with free 2 'and 3' hydroxyl groups are sensitive to periodate. And (3) further extracting miRNA in the gentianella acuta, treating the miRNA by using sodium periodate (an oxidizing agent), and performing qRT-PCR detection, wherein the result shows that the specific Gen-miR-1 of the gentianella acuta still expresses. We further verified that if miRNAs derived from gentianella acuta can be stably expressed in CF, we prepared Gen-miR-1, and added the modification of 2 '-O-methyl structure on the respective 3' terminal nucleotide, respectively transfected CF, extracted RNA and treated with sodium periodate, and then carried out qRT-PCR detection. The results show that Gen-miR-1 derived from pseudogentiana acuta is not oxidatively degraded by sodium periodate and can stably exist in mouse CF (FIG. 10).

The experimental procedure involved is as follows:

1. extraction of plant Total RNA

1) Grinding the whole plant of the dried gentianella acuta by liquid nitrogen to ensure that no blocky tissue exists, putting 100mg of powder into a 2mL sterile centrifuge tube, adding 500 mu L of Buffer RCL/beta-mercaptoethanol (adding the beta-mercaptoethanol before thawing the sample), and quickly and uniformly mixing;

2) carrying out water bath at 55 deg.C for 1-3min, centrifuging at room temperature for 5min at 14,000 g;

3) the supernatant (approximately 450. mu.L was obtained) was aspirated, added to a gDNA Filter Colum containing 2mL collection tubes, and centrifuged at 14,000g for 2min at room temperature;

4) adding Buffer RCB with equal volume into a collecting pipe, and turning upside down and uniformly mixing for 5-10 times;

5) placing the whole mixture from (4), including the pellet, in a HiBind RNA mini Colum, adding a new 2mL collection tube, centrifuging at room temperature for 1min at 10,000, removing the mobile phase, and placing the column back in the collection tube;

6) add 400. mu.L of RWC Wash Buffer and put on a column, centrifuge at room temperature for 1min at 10,000g to remove mobile phase, put the column back in the collection tube; in this case, DNAse I treatment is selected;

7) placing the column in a new 2mL collection tube, adding 500. mu.L of RNA Wash Buffer II, centrifuging at 10,000g for 1min at room temperature, removing the mobile phase, and placing the column back in the collection tube;

8) repeating (7), placing the column back into the collecting tube, centrifuging at 10,000g for 2min, and centrifugally drying;

9) placing the centrifugal column in a new 1.5mL centrifuge tube, adding 30-50 μ L DEPC water into the centrifugal column, standing at room temperature for 2min, centrifuging at full speed (not less than 13,000g) for 1min, collecting the effluent, and storing at-80 deg.C;

2. gentiana acuta RNA library-building sequencing process

From the RNA sample to the final data acquisition, each link of sample detection, library establishment and sequencing influences the quality and quantity of data, and the quality of the data directly influences the result of subsequent information analysis; in order to ensure the accuracy and reliability of sequencing data from the source, each step of sample detection, library building and sequencing is strictly controlled, and the output of high-quality data is ensured; the flow chart is shown in figure 1.

2.1 Total RNA sample detection

The detection of RNA samples mainly comprises 4 methods:

(1) analyzing the degradation degree of RNA and whether pollution exists by agarose gel electrophoresis;

(2) the purity of the Nanodrop detection RNA (OD260/280 ratio);

(3) the Qubit accurately quantifies the RNA concentration;

(4) agilent 2100 accurately examined RNA integrity;

2.2 library construction

After the Sample is detected to be qualified, constructing a library by using a Small RNA Sample Pre Kit, directly adding joints on two ends of the Small RNA by using a special structure of the 3 'end and the 5' end of the Small RNA (the 5 'end has a complete phosphate group, and the 3' end has a hydroxyl group) and taking total RNA as an initial Sample, and then carrying out reverse transcription to synthesize cDNA; then, carrying out PCR amplification, carrying out PAGE gel electrophoresis to separate target DNA fragments, cutting the gel and recovering the gel to obtain a cDNA library; a schematic diagram is constructed as shown in the attached figure 1.

2.3 library examination

After the library is constructed, firstly, carrying out primary quantification by using the qubit2.0, diluting the library to 1 ng/mu L, then, detecting the insert size of the library by using Agilent 2100, and accurately quantifying the effective concentration of the library by using a Q-PCR method (the effective concentration of the library is more than 2nM) after the insert size meets the expectation so as to ensure the quality of the library;

2.4 sequencing on machine

After the library is qualified, carrying out HiSeq/MiSeq sequencing on different libraries according to the effective concentration and the requirement of the target off-machine data volume to obtain plant-derived miRNA in the gentianella acuta;

3. extraction of plant miRNAs

1) Grinding dry Gentiana acuta plant tissue with liquid nitrogen to ensure no blocky tissue, placing 50-100 mg of powder into a 2mL sterile centrifuge tube, adding 700 μ L lysine mixture, vortexing at the highest speed for 30s, and mixing the sample;

2) water bath at 55 deg.C for 3min, centrifuging at room temperature for 5min at 12,000 g;

3) sucking supernatant, adding the supernatant into gDNA Remolel Colum containing 2mL collecting tubes, and centrifuging at room temperature for 2min at 12,000 g;

4) transferring the liquid in the collecting tube to a new 2mL centrifuge tube, adding 1.1-time volume of absolute ethyl alcohol, and vortexing for 20s, and fully and uniformly mixing; centrifuging at 12,000g for 1min, and discarding the mobile phase;

5) placing 700. mu.L of the mixture from (4) in a micro Elute RNA mini Colum, adding a new 2mL collection tube, centrifuging at 12,000 for 1min at room temperature, removing the mobile phase, and placing the column back in the collection tube;

6) repeating (5) until all liquid is transferred;

7) adding 500. mu.L of absolute ethanol to the micro Elute RNA mini Colum, centrifuging at room temperature of 12,000g for 1min, and removing the mobile phase;

8) adding 500 μ L XD Binding Buffer to the micro RNA mini Colum, centrifuging at 12,000g for 1min at room temperature, and removing mobile phase;

9) adding 750 μ L RNA Wash Buffer II, centrifuging at room temperature 10,000g for 1min, removing mobile phase, and placing the column back into the collection tube; repeating the steps once;

10) centrifuging at maximum rotation speed (not less than 12,000g) for 2min, and centrifuging and drying

11) Placing the centrifugal column in a new 1.5mL centrifugal tube, adding 30-50 μ L DEPC water into the centrifugal column, standing at room temperature for 5min, centrifuging at full speed (not less than 12,000g) for 1min, collecting the effluent, and storing at-80 deg.C;

4. sodium periodate digestion of RNA

(1) 5. mu.L of the extracted RNA was added to 95. mu.L of 10mM NaIO ₃ Incubating at 0 deg.C in dark for 40 min;

(2) adding 1mL of absolute ethyl alcohol and 1 μ L of glycogen, and standing on ice for 20 min;

(3) centrifuging at 12,000g for 15min at 4 deg.C, and discarding the supernatant;

(4) adding 12,000g of 1mL of absolute ethyl alcohol, centrifuging for 15min at 4 ℃, and removing supernatant;

(5) adding 1mL of 75% ethanol 12,000g, centrifuging at 4 ℃ for 15min, and removing the supernatant;

(6) standing at room temperature for 5min, dissolving with ddH2O, and quantifying;

5. reverse transcription of miRNA

5.1 connecting reaction system:

carrying out reverse transcription reaction on the reaction system in a PCR instrument according to the following conditions:

5.2 reverse transcription reaction system:

mu.L of ligation product was added to the reverse transcription system (equilibration at room temperature for 2min before addition)

6. Semi-quantitative detection of miRNA

And (3) PCR reaction system:

mu.L of cDNA was added to 200. mu.L of LRNase-free H ₂ O

name primers

Gen-miR-1 cgtggaatcgaaaatctctcttg

7. Sequencing of miRNA

And sequencing the amplified PCR product to determine that the sequence of Gen-miR-1 is consistent.

Gen-miR-1 sequence information:

precursor (Precursor):

uggaaucgaaaaucucucuugcauugucuuuguauauuaccuuccugagcccuggugaaaauaucugaa cuaaucgaugcccucuacaaggaugggaggauagaagaugcaaacuauuuaguuuagaccaugacccag gaagguguuaguuaagauauuuucacuuuuaguuguuuugauggguguguauguguugcguggucaaaa gacaaagcaagagagauuucugauuccaug(SEQ ID NO.2)

mature (Mature):

uggaaucgaaaaucucucuug(SEQ ID NO.1)

secondary structure:

as shown in fig. 2.

Example 2

We cultured mouse Cardiac Fibroblasts (CF) in vitro, prepared Gen-miR-1agomiR transfected CF with 2 '-O-methylation added at the 3' end, and clarified that Gen-miR-1 can inhibit induced myocardial fibrosis and molecular mechanisms of transforming growth factor-beta 1 (TGF-beta 1) induced response to CF oxidative stress and inflammation.

Aseptic inflammation and oxidative stress reaction of myocardial tissues are caused after myocardial infarction, CFs are activated, and then MF is induced. Numerous studies have demonstrated that oxidative stress and inflammatory responses are central events of MF. To clarify the role of Gen-miR-1 in the process of CF activation, we transfected CFs with g.acuta-derived Gen-miR-1 synthesized in vitro, and the experimental results showed that Gen-miR-1 was able to inhibit the expression levels of TGF- β 1-induced CFs activation markers, Collagen I, Collagen iii, α -SMA (fig. 8A), and the expression levels of inflammatory factors such as IL-1 β, TNF- α, IL-6 and the migration of CFs (fig. 8B). Research results show that Gen-miR-1 inhibits CFs activation and inflammatory reaction induced by TGF-beta 1 through a target.

Example 3 in vivo assay

To determine whether g.acuta-derived Gen-miR-1 can enter the body cross species to exert a regulatory effect, C57 mice were gavaged with Gen-miR-1agomiR 1 times daily for 1 OD/time seven consecutive days. Taking eyeballs, taking blood, taking heart and blood vessel samples after sacrifice, extracting miRNA in blood and tissues by using a kit, and detecting the level of Gen-miR-1 in blood and tissues by RT-PCR. The results show that by intragastrically administering Gen-miR-1 to the mice, Gen-miR-1 can be detected in blood, blood vessels and heart tissues of the mice (figure 7), which indicates that Gen-miR-1 can enter the bodies of the mice in a cross-species manner.

40C 57BL/6 mice (male mice of about 20 g) were selected and randomly divided into 4 groups one week after adaptive feeding: the kit comprises a miR-Ctl + physiological saline group, a miR-Ctl + ISO group, a physiological saline + Gen-miR-1 group and a ISO + Gen-miR-1 group, wherein each group comprises 10 animals. And the group II and the group IV are injected with ISO (5mg/kg) subcutaneously every 24h, and simultaneously, the miR-Ctl agomiR or Gen-miR-1agomiR (1 OD/mouse/day) is fed in a gastric lavage mode for 7 days. The group I and the group III are injected with physiological saline (5mg/kg) subcutaneously every 24h, and simultaneously, the mice are fed with miR-Ctl agomiR or Gen-miR-1agomiR (1 OD/mouse/day) in a gastric perfusion mode for 7 days. Electrocardiographic testing observes changes in the biology of the heart. The animals are sacrificed and heart samples are taken, HE and Masson are stained to observe the change of the morphology and the Collagen deposition of the heart tissues, Western Blot detects the expression level of TGF-beta receptor I (T beta R I), TGF-beta receptor II (T beta RII), Collagen III, interleukin 1 beta (IL-1 beta) and interleukin 6(IL-6) in the heart tissues, and immunohistochemistry detects the expression level of Collagen I, Collagen III, IL-1 beta, IL-6 and TNF-alpha in the heart tissues.

Electrocardiogram results show that Gen-miR-1 can obviously improve the reduction of the ST segment induced by ISO and improve myocardial ischemia of mice (figure 9A); HE and Masson staining results show that Gen-miR-1 can remarkably reduce the range of myocardial infarction and reduce collagen fiber deposition in the infarct area (figure 9B); western Blot detection shows that Gen-miR-1 can inhibit protein expression levels of Tbeta R I, Tbeta RII, Collagen III, IL-1 beta and IL-6 (figure 9C). Immunohistochemical detection shows that Gen-miR-1 can inhibit the expression levels of Collagen I, Collagen III, IL-1 beta, IL-6 and TNF-alpha (figure 9D), and the results show that G.acuta-derived Gen-miR-1 can inhibit ISO-induced myocardial fibrosis and inflammatory reaction of mice across species.

TGF-. beta.1 is closely related to oxidative stress: TGF-. beta.1 may increase the production of ROS, leading to a redox imbalance; in turn, ROS can activate and mediate many of the pro-fibrotic effects of TGF- β 1, which are mutually regulated to form the malignant cycle, involved in the pathological process of fibrotic diseases. Detection of ROS produced in tissues using Diethyldithiocarbamate (DHE) revealed that Gen-miR-1 inhibits ROS production (fig. 9E). According to the suggestion, the Gen-miR-1 regulates and controls TGF-beta 1 signals and influences the generation of ROS.

Sequence listing

<110> Hebei college of traditional Chinese medicine

Application of Gen-miR-1 derived from Gentiana acuta in inhibiting myocardial fibrosis

<150> 2022106211250

<151> 2022-06-02

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Gentianella acuta (Gentianella acuta)

<400> 1

uggaaucgaa aaucucucuu g 21

<210> 2

<211> 237

<212> RNA

<213> Gentianella acuta (Gentianella acuta)

<400> 2

uggaaucgaa aaucucucuu gcauugucuu uguauauuac cuuccugagc ccuggugaaa 60

auaucugaac uaaucgaugc ccucuacaag gaugggagga uagaagaugc aaacuauuua 120

guuuagacca ugacccagga agguguuagu uaagauauuu ucacuuuuag uuguuuugau 180

ggguguguau guguugcgug gucaaaagac aaagcaagag agauuucuga uuccaug 237

Claims

Application of Gen-miR-1 shown in SEQ ID No.1 in preparation of medicines for treating myocardial fibrosis.
2. The use of claim 1, wherein Gen-miR-1 has a modification of the 2 '-O-methylated structure at its 3' terminal nucleotide.
3. The use according to claim 1 or 2, characterized in that said Gen-miR-1 is derived from pseudogentiana acuta (Gentianella acuta) or is directly chemically synthesized.
4. Use according to claim 3, characterized by the fact of being used in the preparation of a medicament for the inhibition of oxidative stress and inflammatory reactions in myocardial fibrosis.
5. The composition contains Gen-miR-1 shown in SEQ ID NO.1, and the Gen-miR-1 has a 2 '-O-methylated structure modification on the 3' terminal nucleotide.
6. The composition of claim 5, wherein said composition further comprises a pharmaceutically acceptable excipient.
7. The composition according to claim 5, wherein the composition is formulated as a tablet, capsule or injection.