CN114984000B

CN114984000B - Application of toddaline and/or glycyrrhizin in preparation of medicine for improving pain resistance

Info

Publication number: CN114984000B
Application number: CN202210670228.6A
Authority: CN
Inventors: 赖仞; 罗雷
Original assignee: Kunming Institute of Zoology of CAS
Current assignee: Kunming Institute of Zoology of CAS
Priority date: 2022-06-14
Filing date: 2022-06-14
Publication date: 2023-08-08
Anticipated expiration: 2042-06-14
Also published as: CN114984000A

Abstract

The invention provides application of toddaline and/or glycyrrhizin in preparing a medicament for improving pain resistance, and belongs to the technical field of biomedicine. The invention proves that the toddalin and/or the glycyrrhizin can obviously inhibit the voltage activation of the Cav3.2 calcium ion channel of mammals. Toddaline and/or glycyrrhizin act on cav3.2 receptors of other species including humans, and can inactivate pain in animals over time. In view of the fact that the toddaline and/or the glycyrrhizin can effectively enhance the resistance of an animal model to pain, the toddaline and/or the glycyrrhetin can be used as resources to develop a potential analgesic which is applied to human beings and other animals to relieve pain. In addition, the toddalin and/or the glycyrrhizin target acts on the receptor Cav3.2, and can be applied to the research of related ion channel diseases and the research of related ion channel diseases as potential therapeutic drugs.

Description

Application of toddaline and/or glycyrrhizin in preparation of medicine for improving pain resistance

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to application of toddalia asiatica and/or glycyrrhiza coumarin in preparation of a medicament for improving resistance to pain.

Background

Toddaculin is coumarin compound derived from plant of Toddaculin of RutaceaeToddalia asiatica). At present, the toddalin can be obtained by extraction and artificial synthesis methods. Glycyrrhizin (glycuromarin) is a main bioactive coumarin in liquorice, and belongs to analogues of toddalia asiatica.

It is known in the art that toddalin can induce leukemia cell differentiation and apoptosis. Meanwhile, the toddalin inhibits the activity of excessive osteoclast and enhances the differentiation and mineralization of osteoblast. Liquocoumarin inhibits hepatocyte lipid apoptosis by activating autophagy, inhibiting endoplasmic reticulum stress-mediated JNK and GSK-3-mediated mitochondrial pathways. The glycyrrhizin coumarin can directly target the T-LAK cell source protein kinase to play the role of resisting liver cancer. However, toddalin and glycyrrhizin have not been reported in terms of ion channel inhibition and pain perception.

Disclosure of Invention

In view of the above, the present invention aims to provide an application of toddalin and/or glycyrrhizin in preparing a drug for improving resistance to pain.

The invention provides a compound for affecting pain perception of human and animals, comprising toddalia element and glycyrrhizin.

Preferably, the mass ratio of the toddaline to the glycyrrhizin is 1-10:1-10.

The invention provides application of toddalin, glycyrrhizin or a compound thereof in preparing a medicament for improving pain resistance of a human and/or an animal.

The invention provides an analgesic, the active ingredients comprise toddalia asiatica, glycyrrhizin coumarin or the compound.

The invention provides an ion channel inhibitor, and active ingredients comprise toddalia asiatica, glycyrrhizin coumarin or the compound.

The invention provides application of toddaline, glycyrrhizin or a compound thereof in preparing medicines for preventing and/or treating Cav3.2 ion channel related diseases.

Preferably, the cav3.22 ion channel related diseases comprise one or more of the following: chronic pain, familial aldosteronism, early-onset hypertension and itching.

The invention provides an application of an agent for inhibiting activation of Cav3.2 ion channels in preparing a medicament for improving pain resistance of a human and/or an animal.

Preferably, the agent that inhibits activation of the cav3.2 ion channel comprises palmatine and/or glycyrrhizin.

The invention provides application of toddalin, glycyrrhizin or a compound thereof in preparing a medicament for improving pain resistance of a human and/or an animal. The toddaline and/or the glycyrrhizin can obviously inhibit the activation of Cav3.2 voltage-gated ion channels in different species. Electrophysiological experiments indicate that toddaculin and glycouromarin act on the cav3.2 receptor. Cav3.2 acts as a receptor closely related to the perception of pain in the human or animal's periphery, while toddaculin and glycouromarin are effective in inhibiting Cav3.2 and in inactivating the human or animal's perception of pain over a period of time. Experiments in model animal mice show that toddaculin and glycouromarin treatment can enhance the tolerance of mice to formalin, acetic acid, heat, hydrogen sulfide and paclitaxel induced acute pain, and the number of pain behaviors of mice is significantly reduced. In conclusion, toddaculin and glycouromarin enhance the resistance of species such as mice to pain, can be developed as a potential analgesic as a resource, and can be applied to human beings and other animals for relieving pain. Meanwhile, toddaculin and glycouromarin target on the receptor Cav3.2, and can be applied to the research of related ion channel diseases and the research of related ion channel diseases as potential therapeutic drugs.

Drawings

FIG. 1 shows the result of the inhibition of Cav3.2 ion channels by toddaculin;

FIG. 2 is a graph showing the results of site selection for the interaction of toddaculin and Cav3.2 and binding between toddaculin and Cav3.2 based on double mutation cycling;

FIG. 3 is a graph showing the current and concentration effects of toddaculin and glycouromarin on inhibition of Cav 3.2;

FIG. 4 is a graph showing the pain relieving effect of toddaculin on mice; wherein A and B are sodium hydrogen sulfide induction model results; c is a paclitaxel-induced allodynia model; d is a formalin-induced pain model; e is an acetic acid-induced pain model;

fig. 5 is a comparison of the effects of toddaculin and glycouromarin on pain relief in mice.

Description of the embodiments

In the invention, the structural formula of the toddalin is shown as a formula I; the route of acquisition was from Kunming Luo Biotechnology Co.

Formula I.

In the invention, the structural formula of the glycyrrhizin coumarin is shown as a formula II; the route of acquisition was from Yunnan Sipower Biotechnology Co.

Formula II.

In the invention, the mass ratio of the toddaline to the glycyrrhizin is preferably 1-10:1-10, more preferably 1-5:1-5, and most preferably 1:1.

In the invention, the toddalin or the liquorice coumarin can target the receptor Cav3.2 and can obviously inhibit the activation of the Cav3.2, wherein the Cav3.2 is a voltage-controlled calcium ion channel related to pain, and is abundantly expressed in peripheral nerve cells, particularly in dorsal root ganglion, and the Cav3.2 is found to be closely related to various physiological and pathological functions of the pain due to the special distribution of the Cav3.2, so that people and animals can carry out pain relief under the condition of the pain through the compound. In the embodiment of the invention, electrophysiological experiment results show that the toddalin or the glycyrrhizin coumarin is a key chemical substance for relieving the pain induced by Cav3.2, and meanwhile, the pain relieving effect of toddalin on mice is verified through a mouse pain model experiment. The Cav3.2 plasmids of the species of mice, humans and the like are synthesized, and the patch clamp technology is used for verifying that the toddaculoin inhibits the activation of the Cav3.2 of the mammal, so that the universality of the toddaculoin applied to different species is verified. Thus, toddalin can affect the perception of pain in humans and animals and can be used to increase the resistance of animals to pain. The glycyrrhizin is superior to the palmatine in improving the pain resistance of human and/or animals. In the mouse pain model, the effective dose of the pterocarpan is preferably not less than 10 mg/kg body weight mouse. The effective dose of the glycyrrhizin is preferably not less than 1mg/kg body weight of mice.

In the present invention, the analgesic preferably further comprises pharmaceutically acceptable excipients. The kind of the auxiliary materials is not particularly limited, and auxiliary materials known in the art, such as glucose, sucrose, starch and the like, can be used. The dosage form of the analgesic agent of the present invention is not particularly limited, and may be any conventional dosage form in the art. The analgesic is preferably applied to humans and animals by oral administration or injection, etc. to relieve pain, overcome acute and chronic pain in a short period of time, etc. The method for preparing the analgesic agent of the present invention is not particularly limited, and may be any analgesic agent known in the art. The dosage of the analgesic is preferably 1-10 mg/kg of mice.

In the invention, both the palmatine and the glycyrrhizin can target to act on the receptor Cav3.2, and the activation of the Cav3.2 is obviously inhibited, so that the palmatine and/or the glycyrrhizin can serve as active ingredients to play a role in inhibiting the activation of ion channels. In the embodiment of the invention, the mouse Cav3.2 receptor (mCav 3.2) is overexpressed on the HEK293T cell line, and the experimental result of the patch clamp technology shows that the acting target of the Feilongzhangxuin is the Cav3.2 receptor, and the activation of the Cav3.2 receptor can be inhibited. The molecular structure of mcav3.2 (mouse cav3.2 channel) was simulated using Rosetta molecular modeling software. Through chimerism and point mutation of the mCav3.2 sequence, the mutation site L1508A is found to influence binding of the Feilongxuridine, so that the Feilongxuridine can inhibit activation of the Cav3.2 channel, and further influence the Cav3.2 channel to exert corresponding biological functions.

In the present invention, the ion channel inhibitor preferably further comprises pharmaceutically acceptable excipients such as glucose, sucrose, starch, etc. The method for preparing the ion channel inhibitor is not particularly limited, and ion channel inhibitors known in the art may be used.

In the present invention, the activation of the cav3.2 ion channel may cause various diseases such as chronic pain, familial aldosteronism, early-onset hypertension or pruritus, etc. In view of the fact that the toddalia asiatica and/or the glycyrrhizin can effectively inhibit the activation of the Cav3.2 ion channel, a novel technical means is provided for preventing and treating diseases related to the Cav3.2 ion channel.

In the present invention, the agent that inhibits the activation of cav3.2 ion channels is preferably palmitoxin and/or glycyrrhizin. The dosage form of the drug is not particularly limited in the present invention, and it is sufficient to employ a pharmaceutical dosage form well known in the art, such as an oral preparation or an injection.

The application of the toddaline and/or glycyrrhizin provided by the invention in preparing a medicament for improving the resistance to pain is described in detail below with reference to examples, but they should not be construed as limiting the scope of the invention.

Examples

Electrophysiological experiments on the targeting of Toddalin and mCav3.2 pain-associated receptors

Plasmids expressing mCav3.2 (construction methods reference: luo L, li B, wang S, wu F, wang X, liang P, ombati R, chen J, lu X, cui J, lu Q, zhang L, zhou M, tian C, yang S, lai R. Centipedes subdue giant prey by blocking KCNQ channels Proc Natl Acad Sci U S A.2018Feb 13;115 (7): 1646-1651.) were transiently transfected and overexpressed on HEK293T cell lines. HEK293T cells were cultured in DMEM medium (10% fetal bovine serum+0.1% penicillin-streptomycin) by adherence and cultured in a carbon dioxide incubator for more than 4 hours. Transfecting the recombinant plasmid by using Lipofectamine 2000 cell transfection reagent, putting 6 mu l of Lipo 2000 into 200 mu l of Opti-MEM culture medium, adding 4 mu g of recombinant plasmid and 1 mu g of green fluorescent protein, uniformly mixing, standing for 20 min, adding the mixture into cells replaced by the Opti-MEM culture medium, standing for 4 h, and replacing the Opti-MEM culture medium by the DMEM culture medium for later use. All HEK293TThe cell lines were all supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin, 37℃and 5% CO using DMEM (Dulbecco's modified Eagle's medium) ₂ And (5) incubating and culturing. The transfected cells express green fluorescent protein, and the cells with green colors are irradiated by the LED lamp, so that the transfection is successful.

Selecting cells with smoother cell membranes and uniform cytoplasm under an inverted microscope, and performing patch clamp experiments at the room temperature of 20-25 ℃. The method comprises the steps of selecting a WPI 0.86 mm thin-wall borosilicate glass capillary as a glass electrode material, drawing the glass electrode on a drawing instrument (P-97, cutter) in 5 steps, thermally polishing the glass electrode, filling an intracellular fluid into the glass electrode after the drawing is finished, wherein the aperture of the tip of the electrode is 1.5-3.0 mu m. The initial resistance of the glass electrode is 1.5-2.5 MΩ. After the high-impedance genius (G omega) seal is formed between the electrode and the cell membrane, the electrode fast capacitor is supplemented. Then a short and powerful negative pressure is applied to break the cell membrane clamped in the electrode rapidly and compensate the slow capacitance of the cell. After the whole cell recording mode was established, the cells were clamped to 0mV and the cells were allowed to stabilize for 10 minutes and the current was started to record using the appropriate pulse voltage (80/-80 mV). Drug was infused using Biolab RS200, with a switching rate between drugs of 50 ms. The series resistance (Rs) is kept unchanged within the range of 5-8 MΩ throughout the experiment, and the system series resistance compensation is generally between 30-60%. Experimental data were analyzed using Patch Master software and further analysis of the data used Igor software. All results are expressed in terms of Average (Average) ± Standard Error (SEM), n representing the number of data tested.

The cells are slowly lifted to the lower edge of the drug adding port of the rapid drug adding switching system (RSC-200) by the electric micro-operation system. The dosing switch system was directly connected to the amplifier through which all experimental data was recorded in the computer software Patch Master. Cell stimulation and dosing treatment are given through the Patch Master and the switching dosing system, channel current change is recorded, and the inhibitory activity of different concentrations toddaculin (1 mu M, 12.5 mu M, 25 mu M, 50 mu M and 100 mu M) to the channel is detected. In order to ensure the accuracy of experimental data, the whole recording process needs to keep a stable sealing resistance and a series resistance.

Cav3.2 channel exo-fluid: 2.5 mM CsCl,140 mM TEA-Cl,0.6 mM MgCl ₂ ，5 mM CaCl ₂ 10 mM glucose and 10 mM HEPES, pH was adjusted to 7.4 with NaOH. The medicine used in the experimental process is prepared by dissolving the electrode external liquid.

Cav3.2 in-channel fluid: 140 mM CsCl, 0.1. 0.1 mM ₂ ，2 mM MgCl ₂ 10 mM EGTA,10 mM HEPES and 5 mM Mg-ATP, adjusted to pH 7.3 with CsOH.

The results are shown in FIG. 1, where toddaculin inhibits activation of the Cav3.2 channel and exhibits concentration dependence.

Examples

Structural simulation and point mutation experiment of m Cav3.2

I.m Cav3.2 structural simulation

modeling of mCav3.2 was constructed using Rosetta molecular modeling software version 2020.37. Adopts human Ca _V 3.1 (PDB: 6 KZO) A cryoelectron microscope structure was used as the starting structure for homologous modeling. The lowest energy fraction of the toddaculin docking was selected using Rosetta to stretch its structure. For each docking trial 10000 models were generated and scored further using the binding energy between toddaculin and the channel of mouse cav 3.2. The complex structural model in which the binding energy is lowest is selected as the structural model for the interaction of the final toddaculin with cav 3.2.

mCav3.2 Point mutation

Point mutation experiments were used to explore the effect of mCav3.2 on the targeted binding site of toddaculin. All mutant mCav3.2 channels used in the invention are constructed by a homologous recombination method and are obtained by using a Fasta rapid site-directed mutagenesis kit of Saighur company. The specific experimental operation steps are as follows:

1. only one pair of primers (example: 194Q/K-F1: GCGGGTACCAAGGGCAACATCTTCGCCACGTCCGCG, SEQ ID NO: 1) was designed to introduce single base site-directed mutagenesis into the plasmid; 194Q/K-F2: GATGTTGCCCTTGGTACCCGCGGCGATGACGGCCAC, SEQ ID NO: 2) The plasmid is subjected to inverse PCR amplification, and the design principle of the primer is as follows: the forward and reverse amplification primers comprise 20 bp reverse complementary regions (preferably 40% -60% GC content) at the 5 'end and each primer non-complementary region is at least 15 bp long (preferably the Tm value from the site to be mutated to the 3' end region of the primer is higher than 60 ℃). Mu.l of template DNA sequence, 8.5. Mu.l of deionized water, 2. Mu.l of 2 XMax buffer, 0.5. Mu.l of dNTP mix, 1. Mu.l of 5'PCR primer, 1. Mu.l of 3' PCR primer and 0.5. Mu.l of DNA polymerase centrifuge tube were reacted.

Amplification in a PCR instrument was performed as follows: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 15s, annealing at 60℃for 15s, elongation at 72℃for 9min,30 cycles; extending at 72℃for 5min.

2. Recombination reaction: 40-50 μl of the PCR product from the previous step is added with DpnI 2 μl and incubated for 2h at 37deg.C. Then 2. Mu.l is taken DpnDigestion product I, 2. Mu.l of CE II buffer, 1. Mu.lExnaseII and 5 μl of deionized water, and after 10 μl total of the recombination system was reacted at 37 ℃ for 30min, the ice water bath was cooled for 5min. Conversion of the connection product to 100 [ mu ] LDh5αIn competent cells, monoclonal colonies were picked after overnight incubation with plating, amplified by shaking and sequenced after incubation.

The electrophysiological single cell patch clamp system was used to detect the current changes of toddaculin treatment on all point mutant mcav3.2 channels, i.e. the inhibition rate of toddaculin on wild type and point mutant channels.

The results in FIG. 2 show that amino acid mutations at the L1508 position significantly attenuate the inhibition of the mCav3.2 channel by toddaculin.

Examples

Cav3.2 channel inhibitory Activity of Toddaculin analog Glycourmarin

Based on the direct interaction of cav3.2 and toddaculin, a computer docking analysis was performed for the L1508 site of cav 3.2.

The results indicate that the analogs of toddaculinin, glycoumarin and Cav3.2 channels, are less energy-to-junction, suggesting that Glycoumarin has better affinity for the Cav3.2 channel (see upper left panel of FIG. 3).

For verifying the docking result, whole-cell electrophysiological recording was performed, see in particular the method of example 1, with the difference that the glycouromarin treatment concentration was 0.01 μm, 0.1 μm, 1 μm, 10 μm and 20 μm, respectively. The results show that 12.5. Mu.M Glycoumarin almost completely inhibited Cav3.2 channel current, while 12.5. Mu.M toddaculin inhibited 44.50% of channel current. Glycoumarin concentration dependently inhibited the Cav3.2 channel with half inhibition concentration of 1.82. Mu.M (lower left panel of FIG. 3).

The activity of Toddaculin and Glycoumarin on Cav3.2 channel inhibition was also compared, and the results are shown in the lower two graphs of FIG. 3. From the graph results, under the same concentration condition, glycuromarin has stronger inhibition effect on the Cav3.2 channel than Toddaculin, and can realize the Cav3.2 channel inhibition activity at a lower concentration.

Examples

Analgesic Activity of Toddaculin and Glycoumarin

1. Formalin-induced pain: to produce painful paw licking behavior in mice, pain was induced by plantar injection of formalin (ref: yang S, xao Y, kang D, liu J, li Y, undheim EA, klin JK, rong M, lai R, king GF. Discovery of a selective Na) _V 1.7 inhibitor from centipede venom with analgesic efficacy exceeding morphine in rodent pain models Proc Natl Acad Sci U S A.2013 Oct 22;110 (43): 17534-9. Doi: 10.1073/pnas.1306285110.). The comparison of induced pain and attenuation was performed by intraperitoneally injecting 100. Mu.l of physiological saline as a negative control group, toddaculin (administered in amounts of 1mg/kg, 10 mg/kg and 20 mg/kg in physiological saline as a solvent) or glycouromarin (administered in amounts of 20 mg/kg in physiological saline as a solvent) as a sample test group, and morphine (5 mg/kg in 100. Mu.l of physiological saline) as a positive control group to the mice of the different groups. Half an hour after pretreatment, each group of mice was injected with 20 μl of 0.92% (vol/vol) formalin on the right posterior sole. After formalin injection, each mouse was placed in clear and open polyethylene cages (20 cm ×40 cm ×15 cm), respectively. The time spent licking the right hind paw was recorded with the camera at 0-5 min after injection (stage I) and 15-30 min after injection (stage II) for the different groups of mice, respectively.

2. Acetic acid induced pain: for acetic acid induced smallThe murine acid wriggle model (reference: yang S, xao Y, kang D, liu J, li Y, undheim EA, klin JK, rong M, lai R, king GF. Discovery of a selective Na) _V 1.7 inhibitor from centipede venom with analgesic efficacy exceeding morphine in rodent pain models Proc Natl Acad Sci U S A2013 Oct 22;110 (43): 17534-9. Doi: 10.1073/pnas.1306285110.) mice were intraperitoneally injected with 100. Mu.l of physiological saline (negative control group), toddaculin in 100. Mu.l of physiological saline (1, 10 and 20 mg/kg, experimental group), glycouromarin in 100. Mu.l of physiological saline (20 mg/kg, experimental group) and morphine in 5 mg/kg in 100. Mu.l of physiological saline (positive control group). 30min after injection, 200 μl of 0.8% (vol/vol) acetic acid was injected into the peritoneum of the mice and placed directly alone in an open and transparent cage of size 20 cm ×40 cm ×15 cm. Counting mice for 30min accumulated abdominal twist, constriction, hind limb extension times, see in particular the prior art (Yang S, xiao Y, kang D, liu J, li Y, undheim EA, klin JK, rong M, lai R, king GF. Discovery of a selective Na) _V 1.7 inhibitor from centipede venom with analgesic efficacy exceeding morphine in rodent pain models. Proc Natl Acad Sci U S A. 2013 Oct 22;110(43):17534-9. doi: 10.1073/pnas.1306285110.）。

3.H ₂ S-induced colon pain: mice were given intraperitoneal injections of 100. Mu.l of saline, 1mg/kg, 10 mg/kg, 20 mg/kg toddaculin, or 5 mg/kg morphine, respectively. 30. After minutes, mice in each group were given NaHS (5 nM) treatment: a volume of 50 μl NaHS was injected 3 cm from the anus. The visceral pain-associated nociception (e.g., licking the abdomen) was then observed for 30min, followed by nociception scoring (10 times per mouse, 2-5 seconds intervals) of lower abdominal irritation with von Frey fibers (ref: matsui K, tubota M, fukushi S, koike N, masuda H, kasanami Y, miyazaki T, sekikuchi F, ohkubo T, yoshida S, mukai Y, oita A, takada M, kawabata A. Genetic deletion of Cav 3.2T-type calcium channels abolishes H S-dependent somatic and visceral pain signaling in C BL/6 mic J Pharmacol Sci.2019 Jul;140 (3): 310-312. Doi: 10.1016/j.jphi.2019.07.010. Epub 2019 Jul 30.).

4. Paclitaxel-induced neuropathic pain: paclitaxel was dissolved in a mixture of 17% Cremophor EL, 17% ethanol and 66% physiological saline. Mechanical allodynia was assessed prior to the first dose and on days 2, 4, 6 and 8 using Von Frey test. Each mouse was placed in a clear plastic box (20X 17X 13 cm) with wire mesh floor prior to dosing and on days 2, 4 and 6, and the paw withdrawal threshold was determined by a modified up-down method (ref: son DB, choi W, kim M, go EJ, jeong D, park CK, kim YH, lee H, suh JW. Decursin Alleviates Mechanical Allodynia in a Paclitaxel-Induced Neuropathic Pain Mouse model. Cells. 2021 Mar 4;10 (3): 547.). The administration method is to administer 100. Mu.l physiological saline, 1mg/kg, 10 mg/kg, 20 mg/kg toddaculin, or 5 mg/kg morphine to the mice intraperitoneally, respectively.

5. Heat-induced sage pain: the tail immersion test of the mice was performed after immersing the tail in a water bath at a temperature of 53.+ -. 0.5 ℃. Individual with thermal response (tail flick) time less than 15 seconds in the pre-experiment were discarded, and individual without response for 30 seconds were discarded. Each group of animals was intraperitoneally injected with 100. Mu.l of physiological saline (negative control group), toddaculin in 100. Mu.l of physiological saline (test group), glycooumarin in 100. Mu.l of physiological saline (20 mg/kg, test group), and 5 mg/kg morphine (positive control group), respectively. The tail flick experiment was performed 30 minutes after the administration (reference: yang S, xao Y, kang D, liu J, li Y, undheim EA, klin JK, rong M, lai R, king GF. Discovery of a selective Na) _V 1.7 inhibitor from centipede venom with analgesic efficacy exceeding morphine in rodent pain models Proc Natl Acad Sci U S A.2013 Oct 22;110 (43): 17534-9. Doi: 10.1073/pnas.1306285110.). The time from immersion of the mouse's tail in water until the tail swings out of the water bath was recorded as pain latency.

Figure 4 is a graph showing pain relief results after administration of each pain model. After toddaculin is administered, pain is effectively relieved, and the degree of relief is dose dependent.

The upper two graphs in fig. 5 show the statistics of the time to supplementation of 20 mg/kg toddaculin or glycooumarin dosing group phase I and phase II, respectively, in formalin-induced pain experiments. The lower two panels in fig. 5 are the statistical results of acetic acid torque in 20 mg/kg toddaculin or glycouromarin administration group pain latency and acetic acid induced pain model, respectively, in the heat induced rat tail pain model. As can be seen from the results of FIG. 5, the administration of either toddaculin or glycouromarin significantly reduced pain induced by various factors compared to normal saline, and the efficacy of glycouromarin in reducing pain was superior to toddaculin.

The above-described mouse-related behavioral experiments indicate that pain relief can be assisted in mice by intraperitoneal injections of toddaculin and glycouromarin into the mice. toddaculin and glycouromarin enhance the resistance of mice to pain and can be developed as a potential analgesic as a resource for pain relief in humans and other animals. Second, toddaculin and glycouromarin target on receptor cav3.2, and can be applied to the research of related ion channel diseases and as potential therapeutic drugs.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> Kunming animal institute of China academy of sciences

<120> application of toddalin and/or glycyrrhizin in preparation of medicine for improving pain resistance

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gcgggtacca agggcaacat cttcgccacg tccgcg 36

<210> 2

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gatgttgccc ttggtacccg cggcgatgac ggccac 36

Claims

1. The use of toddalin as sole active ingredient for the manufacture of a medicament for improving the resistance of a human or animal to pain.

2. The application of the combination of the toddaline and the glycyrrhizin in preparing the medicine for improving the pain resistance of the human or the animal.

3. Use of glycyrrhizin for the preparation of an analgesic agent for formalin-induced pain, paclitaxel-induced neuropathic pain or thermally induced rat tail pain.

4. Use of an agent that inhibits the activation of the cav3.2 ion channel, which agent inhibits the activation of the cav3.2 ion channel is toddalin, which is the sole active ingredient, in the manufacture of a medicament for improving the resistance of a human or animal to pain.

5. Use of an agent that inhibits the activation of cav3.2 ion channels in the manufacture of a medicament for increasing the resistance of a human or animal to pain, said agent that inhibits the activation of cav3.2 ion channels being a combination of toddaline and glycyrrhizin.