CN114959919A

CN114959919A - Method for constructing saccharomyces cerevisiae artificial small promoter library and application

Info

Publication number: CN114959919A
Application number: CN202110200233.6A
Authority: CN
Inventors: 张学礼; 许丽萍; 刘萍萍; 樊飞宇
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2021-02-23
Filing date: 2021-02-23
Publication date: 2022-08-30

Abstract

The invention discloses a method for constructing a saccharomyces cerevisiae artificial small promoter library and application thereof. The invention provides a method for constructing a saccharomyces cerevisiae artificial promoter mutant library, which comprises the following steps: randomly mutating all or part of 1 st to 6 th positions from the 3' end of the nucleotide sequence of the saccharomyces cerevisiae artificial promoter UASF-E-C-core1 to obtain a saccharomyces cerevisiae artificial promoter mutant library. The invention constructs a kozak library by taking the strongest small synthetic promoter obtained by Alper as a scaffold and Green Fluorescent Protein (GFP) as a reporter gene. The method is applied to metabolic regulation of an endogenous pathway of saccharomyces cerevisiae, so that genes in the metabolic pathway are matched with a proper expression amount, and the problems of cell growth inhibition caused by large accumulation of toxic intermediate metabolites or low yield of target products caused by insufficient expression strength of key genes and the like are avoided.

Description

Method for constructing saccharomyces cerevisiae artificial small promoter library and application

Technical Field

The invention relates to the technical field of biology, in particular to a method for constructing a saccharomyces cerevisiae artificial small promoter library and application thereof.

Background

With the development of synthetic biology, the heterogeneous production of a large number of chemicals and products with high added values becomes possible by utilizing microorganisms with high growth speed and simple culture conditions. Saccharomyces cerevisiae, the most deeply studied single-cell lower eukaryote, is often used as a cell factory for producing various fuels, chemicals, food ingredients, and pharmaceuticals due to its simple genetic manipulation and its well-established fermentation and engineering techniques. The artemisinic acid "brewed" from the fermentation tank enabled people to achieve freedom of construction since 2013 when the Keasling team succeeded in heterologously synthesizing the precursor artemisinic acid of the antimalarial drug artemisinin in saccharomyces cerevisiae. Since then, the synthetic pathways for more complex, high-value-added compounds have been opened up in saccharomyces cerevisiae, such as ginsenosides, morphine, and scopolamine, which is more complex in structure. However, introduction of exogenous synthetic pathways often disrupts intracellular metabolic balance, thereby affecting synthesis of the target metabolites. Therefore, how to coordinate the expression of each gene in metabolic pathways has become an important part of synthetic biology research.

Researchers have developed a series of control elements to regulate the expression intensity of genes in metabolic pathways, such as promoter elements, terminator elements, and 3' UTRs. Coli also commonly use RBS (ribosomal binding site) libraries to regulate gene expression in pathways. The RBS is an untranslated region upstream of the prokaryotic initiation codon AUG, which contains an SD (Shine-Dalg-arno) sequence, is about 5 nucleotides in length, and is responsible for complementary pairing with the 3' end of ribosomal 16SrRNA, facilitating ribosome binding to mRNA and facilitating initiation of translation. The eukaryotic Kozak region has similar functions with prokaryotic SD sequence, and is a nucleic acid sequence located behind the eukaryotic mRNA 5 'end cap structure, which can combine with translation initiation factor to mediate the translation initiation of mRNA containing 5' cap structure, and the translation initiation rate is influenced by ribosome scanning and recognition of initiation codon. The length and nucleotide composition of the Kozak region vary among species, and one or more point mutations affect gene expression. Although the mechanism of the Kozak region to influence gene expression has been analyzed, no report has been made on the study of gene expression of Kozak region banking regulatory pathways.

Disclosure of Invention

The invention aims to provide a method for constructing a saccharomyces cerevisiae artificial small promoter library and application thereof.

In a first aspect, the invention claims a method for constructing a saccharomyces cerevisiae artificial promoter mutant library.

The method for constructing the saccharomyces cerevisiae artificial promoter mutant library claimed by the invention can comprise the following steps: randomly mutating all or part of 1 st to 6 th positions from the 3' end of the nucleotide sequence of the saccharomyces cerevisiae artificial promoter UASF-E-C-core1 to obtain a saccharomyces cerevisiae artificial promoter mutant library.

Wherein the nucleotide sequence of the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 is shown as 29-153 th site of SEQ ID No. 4.

In a specific embodiment of the invention, all the 1 st to 6 th positions from the 3 'end of the nucleotide sequence of the Saccharomyces cerevisiae artificial promoter UASF-E-C-core 1(the 29 th to 153 th positions of SEQ ID No. 4) are randomly mutated by means of PCR, the 1 st to 6 th positions from the 3' end of the nucleotide sequence of the primer corresponding to the Saccharomyces cerevisiae artificial promoter UASF-E-C-core 1(the 29 th to 153 th positions of SEQ ID No. 4) are NNNNNNNN, N is A or T or C or G.

In a second aspect, the present invention claims a library of recombinant vectors for screening of saccharomyces cerevisiae artificial promoter mutants of interest.

Each recombinant vector in the recombinant vector library for screening the saccharomyces cerevisiae artificial promoter mutant as claimed by the invention is double-stranded circular DNA formed by connecting a skeleton vector segment and a DNA segment with a specific structure; the DNA fragment with the specific structure sequentially consists of an artificial promoter UASF-E-C-core1 mutant of saccharomyces cerevisiae, a fragment to be transcribed and a terminator from upstream to downstream; and the 1 st to 6 th nucleotide sequences (including 6 bases which are different and also including parts of bases which are different) from the 3' end of the UASF-E-C-core1 mutant sequences of the saccharomyces cerevisiae artificial promoter on different recombinant vectors in the recombinant vector library are different; and, the sequences of the fragment to be transcribed and the terminator on different recombinant vectors in the recombinant vector library are the same.

Wherein, the segment to be transcribed can be a target gene.

Preferably, all sequences are identical on different recombinant vectors in the recombinant vector library except that the nucleotide sequences at positions 1 to 6 from the 3' end of the sequence of the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 mutant are different.

Furthermore, the nucleotide sequence of the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 is shown as 29-153 th site of SEQ ID No. 4.

In a specific embodiment of the present invention, the terminator is specifically an SPG5 terminator.

Further, the nucleotide sequence of the SPG5 terminator is shown in 23 rd to 213 th of SEQ ID No. 2.

In a specific embodiment of the invention, the backbone vector is saccharomyces cerevisiae universal expression vector pRS 313.

In a specific embodiment of the invention, the backbone vector is saccharomyces cerevisiae universal expression vector pRS313, and the fragment to be transcribed is specifically GFP gene. Correspondingly, the nucleotide sequence of the recombinant vector in the recombinant vector library is shown as SEQ ID No.9, wherein N is A or T or C or G.

In another embodiment of the invention, the fragment to be transcribed is an HMG1 gene truncated in situ (as achieved by CRISPR-Cas9 technology).

In a third aspect, the present invention claims a recombinant s.cerevisiae bank for screening artificial promoter mutants of s.cerevisiae of interest.

The invention claims a recombinant saccharomyces cerevisiae bank for screening a target saccharomyces cerevisiae artificial promoter mutant, which is obtained by introducing the recombinant vector bank in the second aspect into a recipient saccharomyces cerevisiae.

In a particular embodiment of the invention, the recipient saccharomyces cerevisiae is in particular BY 4742. Of course, other s.cerevisiae applications are theoretically possible.

In a fourth aspect, the present invention claims the use of the method as described in the previous first aspect or the library of recombinant vectors or the library of recombinant s.cerevisiae for screening of an artificial promoter mutant of s.cerevisiae of interest.

The target saccharomyces cerevisiae artificial promoter mutant can be a mutant with the promoter activity stronger than that of a standard promoter in saccharomyces cerevisiae. The standard promoter can be the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 (position 29-153 of SEQ ID No. 4) or Saccharomyces cerevisiae endogenous promoter pTDH3 or pTEF 1. Of course, the target saccharomyces cerevisiae artificial promoter mutant can also be a mutant meeting other requirements, and the specific requirements can be made according to actual requirements. The invention is characterized in that the promoter library with wide intensity range is obtained by the change of six bases.

In a fifth aspect, the invention claims a method for screening a saccharomyces cerevisiae artificial promoter mutant of interest.

The method for screening the target saccharomyces cerevisiae artificial promoter mutant claimed by the invention can comprise the following steps: culturing the recombinant saccharomyces cerevisiae bank in the third aspect, and screening to obtain a recombinant saccharomyces cerevisiae strain meeting the preset conditions, namely the target recombinant saccharomyces cerevisiae; the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 mutant carried in the target recombinant Saccharomyces cerevisiae is the target Saccharomyces cerevisiae artificial promoter mutant.

Wherein the predetermined condition may be: the amount of the expression product of the target gene in the target recombinant saccharomyces cerevisiae is higher than that in the control yeast. The control yeast is recombinant yeast obtained by introducing a control vector into the receptor saccharomyces cerevisiae; the control vector differs from the recombinant vectors in the library of recombinant vectors described in the second aspect above only in that the promoter is replaced with the standard promoter. Of course, the predetermined condition may also be other conditions, and may be specifically formulated according to actual requirements. Particularly, the regulation and control of genes in a multi-gene pathway are complex, the stronger the promoter strength is, the better the promoter strength is, the library is built to find a promoter with proper strength, and the small promoter library can conveniently and quickly achieve the purpose.

Accordingly, the saccharomyces cerevisiae artificial promoter mutant of interest may be a mutant having a promoter activity in saccharomyces cerevisiae that is stronger than that of the standard promoter. Wherein, the standard promoter can be the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1(SEQ ID No.4, 29-153 th position), or Saccharomyces cerevisiae endogenous promoter pTDH3(SEQ ID No.6, 21-820 th position) or pTEF1(SEQ ID No.7, 21-450 th position). Of course, the target saccharomyces cerevisiae artificial promoter mutant can also be a mutant meeting other requirements, and the specific requirements can be made according to actual requirements. The invention is characterized in that a promoter library with wide intensity range is obtained by the change of six bases.

In a sixth aspect, the present invention claims the use of the method according to the first aspect or the library of recombinant vectors according to the second aspect or the library of recombinant Saccharomyces cerevisiae according to the third aspect for the regulation of gene expression in a metabolic pathway of Saccharomyces cerevisiae.

In a seventh aspect, the invention claims a method for constructing a library of promoter mutants.

The method for constructing the promoter mutant library claimed by the invention can comprise the following steps: random mutation is carried out on all or part of the sequence in the Kozak region of the promoter, so as to obtain a promoter mutant library.

Wherein, the Kozak region of the promoter generally refers to the last six bases at the 3' end of the promoter.

The invention provides a method for quickly constructing a saccharomyces cerevisiae artificial small promoter library, which is used for constructing a kozak library by taking a strongest small synthetic promoter obtained by Alper as a support and Green Fluorescent Protein (GFP) as a reporter gene. The method is applied to metabolic regulation of an endogenous pathway of saccharomyces cerevisiae, so that genes in the metabolic pathway are matched with a proper expression amount, and the problems of cell growth inhibition caused by large accumulation of toxic intermediate metabolites or low yield of target products caused by insufficient expression strength of key genes and the like are avoided.

Drawings

FIG. 1 is a comparison of the strength of a high strength artificial mini-promoter with a yeast endogenous strong promoter.

FIG. 2 shows GC assay analysis of fermentation products of BY4742-tHMG1 and mut1-mut10 strains.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 construction of YPL001 plasmid as blank control

1. Amplification of GFP Gene and SPG5 terminator

GFP gene was synthesized by Kinsley, and PCR was performed using a synthetic plasmid (obtained by inserting the GFP gene shown at positions 25 to 741 of SEQ ID No.1 into pUC 57) as a template, using primers GFPzeo-up2/GFPzeo-down2 (see Table 1) as an amplification system for TAKARA

10. mu.l of HS DNA polymerase, 10. mu.l of Dntp mix, 1. mu.l each of primers (see Table 1), cDNA, 0.5. mu.l of template, 0.5. mu.l of PrimerSTAR HS polymerase (2.5U/. mu.L), and distilled water were added to a total volume of 50. mu.l. The amplification conditions were: pre-denaturation at 98 ℃ for 2min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 56 ℃ for 15 seconds, and extension at 72 ℃ for 1 minute (30 cycles); extension at 72 ℃ for 8 min (1 cycle). The resulting amplification product was designated GFP (SEQ ID No.1, this fragment contains the 24bp plasmid pRS313 homologous region, the 20bp SPG5 homologous region, and the GFP gene sequence). And purifying the obtained PCR amplification product by using a PCR product purification kit of Shanghai biological engineering Co., Ltd, and keeping the purified product for later use. The Saccharomyces cerevisiae BY4742 genome was used as a template, and amplification was terminated with primers SPG5-up2/SPG5-down2 (see Table 1)The seed SPG5 (method above), the amplification product was designated SPG5(SEQ ID No.2, fragment containing 22bp GFP homology region, 22bp plasmid pRS313 homology region, and SPG5 terminator sequence). And purifying the obtained PCR amplification product by using a PCR product purification kit of Shanghai biological engineering Co., Ltd, and obtaining a purified product for later use.

2. PCR amplification of expression vectors

The target expression vector was amplified with the primer 313-up2/313-down2 (see Table 1) using Saccharomyces cerevisiae universal expression vector pRS313 (from Addgene, His3 marker) as template. The amplification system and conditions were the same as in step 1 of example 1. The resulting amplified product was named pRS313-His-vector (SEQ ID No.3, this fragment is the pRS313 vector backbone with a 24bp GFP homology region and a 22bp SPG5 homology region). And (3) recovering and purifying the obtained PCR amplification product by using a PCR glue recovery kit of Shanghai biological engineering Co.

3. Construction of YPL001 plasmid by CPEC method

CPEC system: phusion High-Fidelity DNA polymerase 5 x Buffer 5. mu.l, Dntp mix 1, DMSO 0.75. mu.l, two purified fragments (GFP gene and SPG5 terminator amplified purified fragment obtained in step 1) and pRS313-His-vector obtained in step 2 were added equimolar, Phusion High-Fidelity DNA polymerase (2U/. mu.L) 0.5. mu.l, and distilled water was added to a total volume of 25. mu.l. The amplification conditions were: 30 seconds at 98 ℃ (1 cycle); 10 seconds at 98 ℃, 30 seconds at 55 ℃ and 15 seconds at 72 ℃ (15 cycles); extension at 72 ℃ for 10 min (1 cycle). Transfer 5. mu.l of PCR product into Trans1-T1 competent cells in ice bath for 30min, heat shock at 42 ℃ for 30 sec, and immediately ice for 2 min. After adding 800. mu.l of LB medium and incubating at 250rpm and 37 ℃ for 1 hour, the bacterial solution was spread on LB plate containing ampicillin and cultured overnight, PCR screening was carried out using YpL001-YZ-up/YpL001-YZ-down (see Table 1) with a positive clone band size of 1504 bp. And performing liquid culture on the positive clone, extracting positive clone plasmid, and performing sequencing verification, wherein a sequencing result shows that a target fragment is inserted into the vector pRS313-His to obtain the plasmid YPL 001. The plasmid YPL001 of interest was extracted for use by using a plasmid extraction kit of Aisijin.

TABLE 1 construction of YPL001 and YPL002 plasmid primers

Name of primer	Sequence (5 '-3')
		GFPzeo-up2	GTAAGGAGAAAATACCGCATCAGGatgagtaaaggagaagaacttttc
GFPzeo-down2	GCGATGAAACAACGTCTTTGctatttgtatagttcatccatg
		SPG5-up2	catggatgaactatacaaatagCAAAGACGTTGTTTCATCGC
SPG5-down2	CAAAATATTAACGTTTACAATTTGCTTATTTTCTGCCGAATTTTC
		313-up2	gaaaagttcttctcctttactcatCCTGATGCGGTATTTTCTCCTTAC
313-down2	GAAAATTCGGCAGAAAATAAGCAAATTGTAAACGTTAATATTTTG
		YpL001-YZ-up	CCAAAGGTGTTCTTATGTAGTG
YpL001-YZ-down	CTTTAGGGTTCCGATTTAGTGC
		Core11-up	GGAGAAAATACCGCATCAGGGGCGCGCCCCTCCTTGAAACTG
Core11-down	GAAAAGTTCTTCTCCTTTACTCATTTTTCTAGATTTTTTCGATGC
		YpL001-up	CATCGAAAAAATCTAGAAAAatgagtaaaggagaagaacttttc
YpL001-down	GTTTCAAGGAGGGGCGCGCCCCTGATGCGGTATTTTCTCCTTAC

Example 2 construction of YPL002 plasmid as Positive control

The strongest artificial small promoter reported by Alper group, UASF-E-C-core1 (positions 29-153 of SEQ ID No. 4), was synthesized by Kinsley. The PCR product obtained by amplification with the primers Core11-up/Core11-down (see Table 1) was named UASF-E-C-Core1(SEQ ID No.4, which contains a 20bp plasmid pRS313 homologous region, a 24bp GFP homologous region, and UASF-E-C-Core1) in the same manner as in step 1 of example 1. The YPL001 plasmid constructed in example 1 was used as a template, and PCR amplification was carried out using primers YpL001-up/YpL001-down (see Table 1), and the resulting amplification product was designated pRS313-His-GFP-SPG5(SEQ ID No.5, which contains pRS313 vector backbone, GFP gene and SPG5 terminator). And (3) recovering and purifying the obtained PCR amplification product by using a PCR glue recovery kit of Shanghai biological engineering Co. The two fragments were ligated by the CPEC method (same procedure as in example 1, step 3). Transfer 5. mu.l of PCR product into Trans1-T1 competent cells in ice bath for 30min, heat shock at 42 ℃ for 30 sec, and immediately ice for 2 min. After adding 800. mu.l of LB medium, incubating at 250rpm and 37 ℃ for 1 hour, plating the broth on LB plates containing ampicillin overnight, and performing PCR screening using the primer Core11-up/GFPzeo-down2 (see Table 1), the size of the positive clone band was 890 bp. And (3) performing liquid culture on the positive clone to extract a positive clone plasmid for sequencing verification, wherein a sequencing result shows that a target fragment is inserted into the vector pRS313 to obtain the plasmid YPL 002. The plasmid extraction kit of Aisijin was used to extract the desired plasmid YPL002 for use.

Example 3 construction of strains Ypl001, Ypl002, Ypl007, Ypl008

Construction of YPL007 and YPL008 plasmids

1. Amplification of pGPD/pTDH3, pTEF1 promoters

PCR amplification was carried out using Saccharomyces cerevisiae BY4742 genome as template and primers GPD-Dai-up/GPD-Dai-down, TEF1-Dai-up/TEF1-Dai-down (see Table 2), respectively. The amplification system is TAKARA

HS DNA polymerase 5 × Buffer 10 μ L, Dntp mix 4 μ L, primers 1 μ L each, cDNA, template 0.5 μ L, PrimerSTAR HS polymerase (2.5U/. mu.L) 0.5 μ L, and distilled water was added to a total volume of 50 μ L. The amplification conditions were: pre-denaturation at 98 ℃ for 2min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 56 ℃ for 15 seconds, and extension at 72 ℃ for 1 minute (30 cycles); extension at 72 ℃ for 8 min (1 cycle). The amplified products were designated pTDH3(SEQ ID No.6, which contains the 20bp plasmid pRS313 homologous region, the 24bp GFP homologous region and the TDH3 promoter sequence), pTEF1(SEQ ID No.7, which contains the 20bp plasmid pRS313 homologous region, the 24bp GFP homologous region and the TEF1 promoter), respectively. And purifying the obtained PCR amplification product by using a PCR product purification kit of Shanghai biological engineering Co., Ltd, and obtaining a purified product for later use.

TABLE 2 construction of YPL007 and YPL008 plasmid primers

2. Amplification expression vector

Using YPL001 constructed in example 1 as a template, PCR amplification was carried out using primers YpL001-YZ-up/YpL001-YZ-down (see Table 1), and the resulting amplification product was designated pRS313-His-GFP-SPG5(SEQ ID No.5, which contains pRS313 vector backbone, GFP gene and SPG5 terminator). And (3) recovering and purifying the obtained PCR amplification product by using a PCR glue recovery kit of Shanghai biological engineering Co.

3. Construction of YPL007 and YPL008 plasmids by CPEC method

CPEC system: phusion High-Fidelity DNA polymerase 5 x Buffer 5. mu.l, Dntp mix 1, DMSO 0.75. mu.l, purified fragment (pTDH 3 or pTEF1 obtained in step 1) and pRS313-His-GFP-SPG5 were added equimolar, Phusion High-Fidelity DNA polymerase (2U/. mu.L) 0.5. mu.l, and distilled water was added to a total volume of 25. mu.l. The amplification conditions were: 30 seconds at 98 ℃ (1 cycle); 10 seconds at 98 ℃, 30 seconds at 55 ℃, 15 seconds at 72 ℃ (15 cycles); extension at 72 ℃ for 10 min (1 cycle). Transfer 5. mu.l of PCR product into Trans1-T1 competent cells in ice bath for 30min, heat shock at 42 ℃ for 30 sec, and immediately ice for 2 min. Adding 800 ul LB culture medium, incubating at 250rpm and 37 ℃ for 1 hour, coating the bacterial liquid on LB plate containing ampicillin, culturing overnight, and PCR screening with primer GPD-Dai-up or TEF1-Dai-up/GFPzeo-down2 (see Table 1 and Table 2), the positive clone band size is 1557bp or 1187 bp. And (3) performing liquid culture on the positive clone, extracting a positive clone plasmid, and performing sequencing verification, wherein the sequencing result shows that the target fragment is inserted into the vector pRS313-His-GFP-SPG5 to obtain plasmids YPL007 (corresponding to pTDH3) and YPL008 (corresponding to pTEF 1). The plasmid extraction kit of Aisijin company is used to extract the target plasmid for later use.

Secondly, Ypl001, Ypl002, Ypl007 and Ypl008 strain are constructed

Starting with Saccharomyces cerevisiae BY4742(Saccharomyces cerevisiae BY4742, described in Carrier baker brochmann et al, 1998, Yeast,14: 115-. 1mL (OD. about.0.6-1.0) was dispensed into 1.5mL EP tubes, centrifuged at 4 ℃ at 10000g for 1min, the supernatant was discarded, the precipitate was washed with sterile water (4 ℃), centrifuged under the same conditions, and the supernatant was discarded. The cells were incubated at 25 ℃ for 20min with 1mL of a treatment solution (10mM LiAc; 10mM DTT; 0.6M sorbitol; 10mM Tris-HCl (pH7.5), DTT being added when the treatment solution was used). After centrifugation, the supernatant was discarded, 1mL of 1M sorbitol (0.22 μ M aqueous membrane filtration sterilization) was added to the cells for resuspension, and the cells were centrifuged to discard the supernatant (resuspended twice with 1M sorbitol) to a final volume of about 80 μ L. YPL001, YPL002, YPL007 and YPL008 plasmid 1 μ L were added, mixed well and transferred to an electric cuvette, shocked at 2.7kv for 5.6ms, added with 1mL of 1M sorbitol, revived at 30 ℃ for 1h, spread on a screening medium plate (formulation: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.01% Leu., 0.01% Ura., 0.01% Trp. (each percentage number indicates g/100mL), screened and cultured under conditions of 30 ℃ for 36h or more, and each strain was named Ypl, 36002, Ypl007 and Ypl according to the difference of the transferred plasmids.

Example 4 construction of Artificial Small promoter Kozak library and screening to obtain high-Strength Artificial Small promoter

Construction of Saccharomyces cerevisiae artificial promoter Kozak library

1. Amplification of YPL-Kozak-mut fragment

The strongest artificial small promoter reported by Alper group, UASF-E-C-Core1 (positions 29-153 of SEQ ID No. 4), was synthesized by Kinsley and PCR amplified using the primers CoreKM-up/Core11 KM-down (see Table 3). The amplification system and conditions were the same as in step 1 of example 1. The resulting amplification product was designated YPL-Kozak-mut (SEQ ID No.8, which fragment includes the 50bp plasmid pRS313 homology arm, UASF-E-C-core1 and Kozakmut). And (3) recovering and purifying the obtained PCR amplification product by using a PCR glue recovery kit of Shanghai biological engineering Co.

2. Homologous recombination in saccharomyces cerevisiae body, construction of saccharomyces cerevisiae artificial promoter Kozak library

Saccharomyces cerevisiae BY4742 was prepared and was competent (same procedure as in step two of example 3). YPL-Kozak-mut fragment and pRS313-His-GFP-SPG5 vector fragment were added in an amount of 2. mu.L each, mixed well, transferred to an electric cuvette, shocked at 2.7kv for 5.6ms, added with 1mL of 1M sorbitol, thawed at 30 ℃ for 1 hour, and spread on a screening medium plate (formulation: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.01% Leu., 0.01% Ura, 0.01% Trp. (each percentage indicates g/100mL), screening culture was carried out at 30 ℃ for 36 hours or more.

The recombinant saccharomyces cerevisiae obtained by screening contains a recombinant vector formed by homologous recombination of a YPL-Kozak-mut fragment and a pRS313-His-GFP-SPG5 vector fragment, wherein the nucleotide sequence of the recombinant vector is shown as SEQ ID No.9, and N is A, C, T or G.

TABLE 3 construction of Kozak library primers

Note: n represents A or T or C or G.

Second, screening of Saccharomyces cerevisiae artificial promoter Kozak library

1. Flow cytometry initial screening of saccharomyces cerevisiae artificial promoter Kozak library

Collecting the strains obtained in the steps into a 1.5ml centrifuge tube, washing twice by using a sterilized PBS buffer solution, sorting by using a flow cytometer, collecting 2% strains with higher fluorescence intensity, culturing in a 96 deep-well plate (added with a corresponding liquid culture medium), and carrying out screening culture under the conditions as follows: culturing at 30 deg.C, humidity 80% and rotation speed of 800rpm for more than 24 h.

2. 96-hole plate double screen

Transfer the 96-deep-well plate bacterial liquid to the 96-well plate with white bottom and black edge by using 200 mu L of a row gun. Subsequently, fluorescence measurement was carried out under the conditions of 395nm for excitation light, 507nm for absorption light and OD measurement under the conditions of 600nm wavelength. The fluorescence/OD 600 ratio was calculated and 38 clones with significant enhancement were rescreened in vitro.

3. Test tube rescreening

The seed solutions (30 ℃ C., 250rpm, 12 hours) were prepared by cloning 38 clones selected as described above in the corresponding liquid selection medium (formulation: liquid yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose; each percentage number indicates g/100mL), followed by selection according to the initial OD _600nm The culture was continued by transfer (30 ℃, 250rpm, 12 hours) at 0.1, followed by fluorescence measurement under the conditions of 395nm for excitation light, 507nm for absorption light and 600nm for OD measurement. The fluorescence/OD 600 ratio was calculated, and finally fourteen small promoters were retained, and the corresponding strains were named 501, 503, 507, 510, 512, 514, 517, 523, 525, 528, 532, 536, 540, 545(SEQ ID No.10-SEQ ID No.23)

Thirdly, comparing the strength of the high-strength artificial small promoter with that of the yeast endogenous strong promoter

Fluorescence measurement experiment: the 4 strains Ypl001, Ypl002, Ypl007 and Ypl008 and a total of 14 strains of the saccharomyces cerevisiae strains obtained by screening in step two were activated in the corresponding solid selection medium (formulation: solid yeast screening medium SD-Ura-His-Leu-Trp, 2% glucose, 1.5% agar; each percentage number indicates g/100mL), a seed solution (30 ℃, 250rpm, 12h) was prepared in the corresponding liquid selection medium (formulation: liquid yeast screening medium SD-Ura-His-Leu-Trp, 2% glucose; each percentage number indicates g/100mL), followed by transfer culture (30 ℃, 250rpm, 12h) according to initial OD600nm 0.1 followed by fluorescence measurement under excitation light 395nm, absorption light 507nm and OD measurement under wavelength 600nm, the results of which are shown in fig. 1.

The above measurement results show that 14 high-strength artificial small promoters are finally obtained by constructing a library of the artificial small promoter Kozak region and performing multiple rounds of screening, and except 545 activity which is slightly lower than that of the saccharomyces cerevisiae endogenous strong promoters pTDH3 and pTEF1, the activity of the other 13 artificial small promoters is higher than that of pTDH3 and pTEF 1. The strength of the artificial small promoter 528 with the strongest strength is 3.3 times that of pTDH3 and pTEF1 and 7 times that of the strongest small promoter reported by Alper, and the dynamic range of the saccharomyces cerevisiae artificial small promoter is remarkably widened.

Example 5 use of the Kozak library of an Artificial promoter to regulate the Key Rate-limiting enzyme tHMG1 of the MVA pathway

First, truncating HMG1 in situ to remove feedback inhibition to obtain control strain BY4742-tHMG1

1. Construction of Saccharomyces cerevisiae endogenous HMG1 gene gRNA plasmid

First, PCR amplification was carried out using the plasmid p426-SNR52p-gRNA. CAN1.Y-SUP4t (#43803, from Addgene) as template and the primers 43803-up and 43803-HMG1gRNA-down1 (see Table 4), in the procedure described in example 1, step 1. And (3) carrying out Dpn1 digestion treatment on the PCR product obtained by amplification, wherein the Dpn1 treatment system is as follows: 10. mu.L of 10 XDpn 1 Buffer (Thermo Co.), 5. mu.L Dpn1 (Thermo Co., 400,000 chemical end units/ml), 80. mu.L of PCR amplification product, and distilled water were supplemented to 100. mu.L, and digestion was carried out for 4 hours, followed by gel recovery of the treated product for use. The digest obtained after gel recovery was transferred to Trans1-T1 competent cells in an ice bath for 30min, heat-shocked at 42 ℃ for 30 sec, and immediately placed on ice for 2 min. Adding 800 mul LB culture medium, incubating at 250rpm and 37 ℃ for 1 hour, coating the bacterial liquid on LB plate containing ampicillin, directly selecting two monoclonal plasmids after overnight culture for sequencing verification, and the plasmid with correct sequencing result (N20: GTCATTGAAGAGGCCGAATAG) is named as pHMG 1-gRNA. The plasmid contains an N20 sequence corresponding to HMG1 gene.

TABLE 4 construction of HMG1 site gRNA plasmid primers

2. Transformation of Cas9 plasmid

BY4742 strain competence, SD-Ura-His-Leu-Trp (beijing pan kino (functional genome) science and technology ltd.), 2% glucose, 0.005% His, 0.01% Leu, 0.01% Ura, 0.01% Trp (each percentage indicates g/100mL) was prepared. 1mL (OD. about.0.6-1.0) was dispensed into 1.5mL EP tubes, centrifuged at 4 ℃ at 10000g for 1min, the supernatant was discarded, the precipitate was washed with sterile water (4 ℃), centrifuged under the same conditions, and the supernatant was discarded. The cells were incubated at 25 ℃ for 20min with 1mL of a treatment solution (10mM LiAc; 10mM DTT; 0.6M sorbitol; 10mM Tris-HCl (pH7.5) added thereto, and the treatment solution was used. After centrifugation, the supernatant was discarded, 1mL of 1M sorbitol (0.22 μ M aqueous membrane filtration sterilization) was added to the cells for resuspension, and the cells were centrifuged to discard the supernatant (resuspended twice with 1M sorbitol) to a final volume of about 80 μ L. Cas9 plasmid p414-TEF1p-Cas9-CYC1t (#43802, from Addgene) 1. mu.L is added, the mixture is transferred to an electric cuvette after being mixed evenly, 2.7kv electric shock is carried out for 5.6ms, 1mL of 1M sorbitol is added, the mixture is revived at 30 ℃ for 1h, and the mixture is coated on a screening medium plate (formula: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.005% His, 0.01% Leu, 0.01% Ura, 1.5% agar, and each percentage number represents g/100 mL). The conditions of the screening culture are as follows: culturing at 30 deg.C for 36 hr or more. One of the monoclonals was arbitrarily selected and named strain BY4742(Cas 9).

3. In-situ truncation of HMG1 by using CRISPR-Cas9 technology

The BY4742(Cas9) strain was made competent, as detailed in example 3, step two. pHMG1-gRNA plasmid and tHMG1-oligo (Table 4) were added in an amount of 2. mu.L each, and the mixture was transferred to an electric cuvette after mixing, and subjected to electric shock at 2.7kv for 5.6ms, followed by addition of 1mL of 1M sorbitol, recovery at 30 ℃ for 1 hour, and applied to a screening medium plate (formulation: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.005% His., 0.01% Leu., 1.5% agar; each percentage indicates g/100 mL). The conditions of the screening culture are as follows: culturing at 30 deg.C for 36 hr or more. 8 single clones were arbitrarily selected, verified BY PCR with the primer pHMG1-up-F/tHMG1-middle-R (see Table 4), and a positive clone band size of 518bp identified the correct positive clone, designated strain BY4742-tHMG 1.

In-situ truncation and regulation of HMG1 expression by using artificial small promoter Kozak library

1. Obtaining a Small promoter Kozak library

PCR was performed using YPL002 plasmid as a template and primers pHMG1-528-F/pHMG1-528mut-R (see Table 5), and the procedure is as described in step 1 of example 1. A small Kozak promoter library with upstream and downstream homology arms of the HMG1 gene promoter region was obtained and designated Kozakmut (SEQ ID No.24, which fragment contains the 50bp upstream homology arm, the 54bp downstream homology arm, the UASF-E-C-core1 and Kozakmut of HMG1 gene promoter region).

TABLE 5 construction of HMG1 site gRNA plasmid primers

Note: n is A or C or T or G.

2. Regulation and control of tHMG1 expression in combination with CRISPR-Cas9 technology

The BY4742 strain is made competent, the concrete method is shown in example 3, step two. pHMG1-gRNA plasmid and a small promoter Kozak library with HMG1 gene homology arms were added in an amount of 2. mu.L each, and the mixture was transferred to an electric cuvette after mixing, shocked at 2.7kv for 5.6ms, added with 1mL of 1M sorbitol, revived at 30 ℃ for 1 hour, and applied to a screening medium plate (formulation: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.005% His., 0.01% Leu., 1.5% agar; each percentage indicates g/100 mL). The conditions of the screening culture are as follows: culturing at 30 deg.C for 36 hr or more. 16 single clones were randomly selected, PCR-verified with the primer pHMG1-up-F/tHMG1-middle-R (see Table 4), the band size of the positive clone was 522bp, and correct positive clones were identified, and 10 correct strains were randomly selected and named as strains mut1-mut 10.

3. Detection of squalene production

As reported in the literature, HMG1 is the main rate-limiting step of the whole MVA pathway, and there are many reports on increasing the expression level of HMG1 by removing feedback inhibition with tHMG1 in the overexpression stage [ Zhang Lexus, Shiliu Luo Huang wearable ], construction of Saccharomyces Cerevisiae cell factory for the production of lycopene [ J ]. China Mediterranean J. 2014.10 Srisawat P, Yasumoto S, Fukushima E O, et al.Production of the Bioactive Plant-Derived Triterpolar organic Acid in Engineered Saccharomyces Cerevisiae [ J ]. Biotechnol Bioeng,2020,117(7):2198 and 208 ]. Here, we increased squalene production by controlling the expression of tHMG1 so that it could obtain a promoter of appropriate strength.

And (3) flask fermentation catalysis: saccharomyces cerevisiae BY4742-tHMG1, mut1-mut10 strain was activated in the corresponding solid selection medium (formulation: solid Yeast selection Medium SD-Ura-His-Leu-Trp, 2% glucose, 1.5% agar; each percentage number indicates g/100mL), seed solutions (30 ℃, 250rpm, 16h) were prepared in the corresponding liquid selection medium (formulation: liquid Yeast selection Medium SD-Ura-His-Leu-Trp, 2% glucose; each percentage number indicates g/100mL), the cells were inoculated in 100mL Erlenmeyer flasks each containing 15mL of the corresponding liquid medium in 3 flasks at the initial OD 0.1, performing shaking culture at 30 ℃ and 250rpm for 5 days, taking 2mL of fermentation liquor in a crushing tube, centrifuging at 13000r/min for 2min, removing the culture medium, washing with sterile water, adding a proper amount of glass beads (the diameter is 0.5mm) and 1mL of methanol: and (3) oscillating and crushing the mixture for 5min and 2 times by using acetone at a volume ratio of 1:1, carrying out ultrasonic treatment for 30min, centrifuging the mixture for 2min at a speed of 13000r/min, taking supernatant, filtering the supernatant by using a 0.22-micron organic nylon filter membrane, and waiting for detection for later use. The product was detected using an agilent technologies 5975C gas chromatograph. The squalene yield is shown in FIG. 2.

The data show that the control strain BY4742-tHMG1 can produce 1.57mg/L squalene, the small promoter Kozak library is used for carrying out in-situ regulation on tHMG1 gene, and the strain mut2 with the lowest detection yield only produces 0.9mg/L squalene which is half of that of the control strain BY4742-tHMG 1; the strain mut10 with the highest squalene accumulation can produce 15mg/L, which is 9.56 times of that of the control strain BY4742-tHMG1 and 19.12 times of that of the control strain, and the Kozak library has a larger regulation range. The small promoter Kozak library can quickly regulate the expression of tHMG1, and the artificial small promoter Kozak library which can be quickly constructed provides a good method for regulating the expression of genes in a pathway.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> method for constructing saccharomyces cerevisiae artificial small promoter library and application thereof

<130> GNCLN210180

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 761

<212> DNA

<213> Artificial sequence

<400> 1

gtaaggagaa aataccgcat caggatgagt aaaggagaag aacttttcac tggagttgtc 60

ccaattcttg ttgaattaga tggtgatgtt aatgggcaca aattttctgt cagtggagag 120

ggtgaaggtg atgcaacata cggaaaactt acccttaaat ttatttgcac tactggaaaa 180

ctacctgttc catggccaac acttgtcact actttctctt atggtgttca atgcttttca 240

agatacccag atcatatgaa acggcatgac tttttcaaga gtgccatgcc cgaaggttat 300

gtacaggaaa gaactatatt tttcaaagat gacgggaact acaagacacg tgctgaagtc 360

aagtttgaag gtgataccct tgttaataga atcgagttaa aaggtattga ttttaaagaa 420

gatggaaaca ttcttggaca caaattggaa tacaactata actcacacaa tgtatacatc 480

atggcagaca aacaaaagaa tggaatcaaa gttaacttca aaattagaca caacattgaa 540

gatggaagcg ttcaactagc agaccattat caacaaaata ctccaattgg cgatggccct 600

gtccttttac cagacaacca ttacctgtcc acacaatctg ccctttcgaa agatcccaac 660

gaaaagagag accacatggt ccttcttgag tttgtaacag ctgctgggat tacacatggc 720

atggatgaac tatacaaata gcaaagacgt tgtttcatcg c 761

<210> 2

<211> 258

<212> DNA

<213> Artificial sequence

<400> 2

catggatgaa ctatacaaat agcaaagacg ttgtttcatc gcgctattac caagaaggtt 60

actttacttg ttcttgcaca tggacgcacg ttgtgtgttc atatatatat atatatatat 120

atatatatat ttgtgcttgt tttcattgtc tctatagtta atacattcta tttttatcgt 180

tatatttgca ttctcttcgc ataaaaactt catgaaaatt cggcagaaaa taagcaaatt 240

gtaaacgtta atattttg 258

<210> 3

<211> 5013

<212> DNA

<213> Artificial sequence

<400> 3

gaaaattcgg cagaaaataa gcaaattgta aacgttaata ttttgttaaa attcgcgtta 60

aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa aatcccttat 120

aaatcaaaag aatagaccga gatagggttg agtgttgttc cagtttggaa caagagtcca 180

ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc 240

ccactacgtg aaccatcacc ctaatcaagt tttttggggt cgaggtgccg taaagcacta 300

aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc ggcgaacgtg 360

gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg 420

gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcg 480

cgccattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg 540

ctattacgcc agctggcgaa ggggggatgt gctgcaaggc gattaagttg ggtaacgcca 600

gggttttccc agtcacgacg ttgtaaaacg acggccagtg aattgtaata cgactcacta 660

tagggcgaat tggagctcca ccgcggtggc ggccgctcta gaactagtgg atcccccggg 720

ctgcaggaat tcgatatcaa gcttatcgat accgtcgacc tcgagggggg gcccggtacc 780

cagcttttgt tccctttagt gagggttaat tccgagcttg gcgtaatcat ggtcatagct 840

gtttcctgtg tgaaattgtt atccgctcac aattccacac aacataggag ccggaagcat 900

aaagtgtaaa gcctggggtg cctaatgagt gaggtaactc acattaattg cgttgcgctc 960

actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg 1020

cgcggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct 1080

gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt 1140

atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc 1200

caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctcggcc cccctgacga 1260

gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata 1320

ccaggcgttc ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac 1380

cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcaat gctcacgctg 1440

taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc 1500

cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag 1560

acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt 1620

aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt 1680

atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg 1740

atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac 1800

gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca 1860

gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac 1920

ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac 1980

ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt 2040

tcgttcatcc atagttgcct gactgcccgt cgtgtagata actacgatac gggagggctt 2100

accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt 2160

atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc 2220

cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa 2280

tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg 2340

tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt 2400

gtgaaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc 2460

agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt 2520

aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg 2580

gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac 2640

tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc 2700

gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt 2760

tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg 2820

aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat attattgaag 2880

catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa 2940

acaaataggg gttccgcgca catttccccg aaaagtgcca cctgggtcct tttcatcacg 3000

tgctataaaa ataattataa tttaaatttt ttaatataaa tatataaatt aaaaatagaa 3060

agtaaaaaaa gaaattaaag aaaaaatagt ttttgttttc cgaagatgta aaagactcta 3120

gggggatcgc caacaaatac taccttttat cttgctcttc ctgctctcag gtattaatgc 3180

cgaattgttt catcttgtct gtgtagaaga ccacacacga aaatcctgtg attttacatt 3240

ttacttatcg ttaatcgaat gtatatctat ttaatctgct tttcttgtct aataaatata 3300

tatgtaaagt acgctttttg ttgaaatttt ttaaaccttt gtttattttt ttttcttcat 3360

tccgtaactc ttctaccttc tttatttact ttctaaaatc caaatacaaa acataaaaat 3420

aaataaacac agagtaaatt cccaaattat tccatcatta aaagatacga ggcgcgtgta 3480

agttacaggc aagcgatccg tcctaagaaa ccattattat catgacatta acctataaaa 3540

ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt gaaaacctct 3600

gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac 3660

aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg 3720

catcagagca gattgtactg agagtgcacc ataattccgt tttaagagct tggtgagcgc 3780

taggagtcac tgccaggtat cgtttgaaca cggcattagt cagggaagtc ataacacagt 3840

cctttcccgc aattttcttt ttctattact cttggcctcc tctagtacac tctatatttt 3900

tttatgcctc ggtaatgatt ttcatttttt tttttccacc tagcggatga ctcttttttt 3960

ttcttagcga ttggcattat cacataatga attatacatt atataaagta atgtgatttc 4020

ttcgaagaat atactaaaaa atgagcaggc aagataaacg aaggcaaaga tgacagagca 4080

gaaagcccta gtaaagcgta ttacaaatga aaccaagatt cagattgcga tctctttaaa 4140

gggtggtccc ctagcgatag agcactcgat cttcccagaa aaagaggcag aagcagtagc 4200

agaacaggcc acacaatcgc aagtgattaa cgtccacaca ggtatagggt ttctggacca 4260

tatgatacat gctctggcca agcattccgg ctggtcgcta atcgttgagt gcattggtga 4320

cttacacata gacgaccatc acaccactga agactgcggg attgctctcg gtcaagcttt 4380

taaagaggcc ctactggcgc gtggagtaaa aaggtttgga tcaggatttg cgcctttgga 4440

tgaggcactt tccagagcgg tggtagatct ttcgaacagg ccgtacgcag ttgtcgaact 4500

tggtttgcaa agggagaaag taggagatct ctcttgcgag atgatcccgc attttcttga 4560

aagctttgca gaggctagca gaattaccct ccacgttgat tgtctgcgag gcaagaatga 4620

tcatcaccgt agtgagagtg cgttcaaggc tcttgcggtt gccataagag aagccacctc 4680

gcccaatggt accaacgatg ttccctccac caaaggtgtt cttatgtagt gacaccgatt 4740

atttaaagct gcagcatacg atatatatac atgtgtatat atgtatacct atgaatgtca 4800

gtaagtatgt atacgaacag tatgatactg aagatgacaa ggtaatgcat cattctatac 4860

gtgtcattct gaacgaggcg cgctttcctt ttttcttttt gctttttctt tttttttctc 4920

ttgaactcga cggatcatat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac 4980

cgcatcagga tgagtaaagg agaagaactt ttc 5013

<210> 4

<211> 177

<212> DNA

<213> Artificial sequence

<400> 4

ggagaaaata ccgcatcagg ggcgcgcccc tccttgaaac tgaaatttta gcatgtgatt 60

aattaacttg taatattcta atcaagctta taaaagagca ctgttgggcg tgagtggagg 120

cgccggaaaa aagcatcgaa aaaatctaga aaaatgagta aaggagaaga acttttc 177

<210> 5

<211> 5937

<212> DNA

<213> Artificial sequence

<400> 5

catcgaaaaa atctagaaaa atgagtaaag gagaagaact tttcactgga gttgtcccaa 60

ttcttgttga attagatggt gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg 120

aaggtgatgc aacatacgga aaacttaccc ttaaatttat ttgcactact ggaaaactac 180

ctgttccatg gccaacactt gtcactactt tctcttatgg tgttcaatgc ttttcaagat 240

acccagatca tatgaaacgg catgactttt tcaagagtgc catgcccgaa ggttatgtac 300

aggaaagaac tatatttttc aaagatgacg ggaactacaa gacacgtgct gaagtcaagt 360

ttgaaggtga tacccttgtt aatagaatcg agttaaaagg tattgatttt aaagaagatg 420

gaaacattct tggacacaaa ttggaataca actataactc acacaatgta tacatcatgg 480

cagacaaaca aaagaatgga atcaaagtta acttcaaaat tagacacaac attgaagatg 540

gaagcgttca actagcagac cattatcaac aaaatactcc aattggcgat ggccctgtcc 600

ttttaccaga caaccattac ctgtccacac aatctgccct ttcgaaagat cccaacgaaa 660

agagagacca catggtcctt cttgagtttg taacagctgc tgggattaca catggcatgg 720

atgaactata caaatagcaa agacgttgtt tcatcgcgct attaccaaga aggttacttt 780

acttgttctt gcacatggac gcacgttgtg tgttcatata tatatatata tatatatata 840

tatatttgtg cttgttttca ttgtctctat agttaataca ttctattttt atcgttatat 900

ttgcattctc ttcgcataaa aacttcatga aaattcggca gaaaataagc aaattgtaaa 960

cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca 1020

ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga tagggttgag 1080

tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg 1140

gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct aatcaagttt 1200

tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag 1260

agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc 1320

gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc 1380

gcttaatgcg ccgctacagg gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg 1440

ggaagggcga tcggtgcggg cctcttcgct attacgccag ctggcgaagg ggggatgtgc 1500

tgcaaggcga ttaagttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac 1560

ggccagtgaa ttgtaatacg actcactata gggcgaattg gagctccacc gcggtggcgg 1620

ccgctctaga actagtggat cccccgggct gcaggaattc gatatcaagc ttatcgatac 1680

cgtcgacctc gagggggggc ccggtaccca gcttttgttc cctttagtga gggttaattc 1740

cgagcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa 1800

ttccacacaa cataggagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga 1860

ggtaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt 1920

gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct 1980

cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 2040

cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 2100

acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 2160

ttttccatag gctcggcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 2220

ggcgaaaccc gacaggacta taaagatacc aggcgttccc ccctggaagc tccctcgtgc 2280

gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 2340

gcgtggcgct ttctcaatgc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 2400

ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 2460

actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 2520

gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 2580

ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 2640

ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 2700

gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 2760

tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 2820

tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta 2880

aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg 2940

aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctgcccgtcg 3000

tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc 3060

gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg 3120

agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg 3180

aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag 3240

gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat 3300

caaggcgagt tacatgatcc cccatgttgt gaaaaaaagc ggttagctcc ttcggtcctc 3360

cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc 3420

ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa 3480

ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac 3540

gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt 3600

cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc 3660

gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa 3720

caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca 3780

tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 3840

acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 3900

aagtgccacc tgggtccttt tcatcacgtg ctataaaaat aattataatt taaatttttt 3960

aatataaata tataaattaa aaatagaaag taaaaaaaga aattaaagaa aaaatagttt 4020

ttgttttccg aagatgtaaa agactctagg gggatcgcca acaaatacta ccttttatct 4080

tgctcttcct gctctcaggt attaatgccg aattgtttca tcttgtctgt gtagaagacc 4140

acacacgaaa atcctgtgat tttacatttt acttatcgtt aatcgaatgt atatctattt 4200

aatctgcttt tcttgtctaa taaatatata tgtaaagtac gctttttgtt gaaatttttt 4260

aaacctttgt ttattttttt ttcttcattc cgtaactctt ctaccttctt tatttacttt 4320

ctaaaatcca aatacaaaac ataaaaataa ataaacacag agtaaattcc caaattattc 4380

catcattaaa agatacgagg cgcgtgtaag ttacaggcaa gcgatccgtc ctaagaaacc 4440

attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt tcgtctcgcg 4500

cgtttcggtg atgacggtga aaacctctga cacatgcagc tcccggagac ggtcacagct 4560

tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg gcgcgtcagc gggtgttggc 4620

gggtgtcggg gctggcttaa ctatgcggca tcagagcaga ttgtactgag agtgcaccat 4680

aattccgttt taagagcttg gtgagcgcta ggagtcactg ccaggtatcg tttgaacacg 4740

gcattagtca gggaagtcat aacacagtcc tttcccgcaa ttttcttttt ctattactct 4800

tggcctcctc tagtacactc tatatttttt tatgcctcgg taatgatttt catttttttt 4860

tttccaccta gcggatgact cttttttttt cttagcgatt ggcattatca cataatgaat 4920

tatacattat ataaagtaat gtgatttctt cgaagaatat actaaaaaat gagcaggcaa 4980

gataaacgaa ggcaaagatg acagagcaga aagccctagt aaagcgtatt acaaatgaaa 5040

ccaagattca gattgcgatc tctttaaagg gtggtcccct agcgatagag cactcgatct 5100

tcccagaaaa agaggcagaa gcagtagcag aacaggccac acaatcgcaa gtgattaacg 5160

tccacacagg tatagggttt ctggaccata tgatacatgc tctggccaag cattccggct 5220

ggtcgctaat cgttgagtgc attggtgact tacacataga cgaccatcac accactgaag 5280

actgcgggat tgctctcggt caagctttta aagaggccct actggcgcgt ggagtaaaaa 5340

ggtttggatc aggatttgcg cctttggatg aggcactttc cagagcggtg gtagatcttt 5400

cgaacaggcc gtacgcagtt gtcgaacttg gtttgcaaag ggagaaagta ggagatctct 5460

cttgcgagat gatcccgcat tttcttgaaa gctttgcaga ggctagcaga attaccctcc 5520

acgttgattg tctgcgaggc aagaatgatc atcaccgtag tgagagtgcg ttcaaggctc 5580

ttgcggttgc cataagagaa gccacctcgc ccaatggtac caacgatgtt ccctccacca 5640

aaggtgttct tatgtagtga caccgattat ttaaagctgc agcatacgat atatatacat 5700

gtgtatatat gtatacctat gaatgtcagt aagtatgtat acgaacagta tgatactgaa 5760

gatgacaagg taatgcatca ttctatacgt gtcattctga acgaggcgcg ctttcctttt 5820

ttctttttgc tttttctttt tttttctctt gaactcgacg gatcatatgc ggtgtgaaat 5880

accgcacaga tgcgtaagga gaaaataccg catcaggggc gcgcccctcc ttgaaac 5937

<210> 6

<211> 844

<212> DNA

<213> Artificial sequence

<400> 6

ggagaaaata ccgcatcagg atactagcgt tgaatgttag cgtcaacaac aagaagttta 60

atgacgcgga ggccaaggca aaaagattcc ttgattacgt aagggagtta gaatcatttt 120

gaataaaaaa cacgcttttt cagttcgagt ttatcattat caatactgcc atttcaaaga 180

atacgtaaat aattaatagt agtgattttc ctaactttat ttagtcaaaa aattagcctt 240

ttaattctgc tgtaacccgt acatgcccaa aatagggggc gggttacaca gaatatataa 300

catcgtaggt gtctgggtga acagtttatt cctggcatcc actaaatata atggagcccg 360

ctttttaagc tggcatccag aaaaaaaaag aatcccagca ccaaaatatt gttttcttca 420

ccaaccatca gttcataggt ccattctctt agcgcaacta cagagaacag gggcacaaac 480

aggcaaaaaa cgggcacaac ctcaatggag tgatgcaacc tgcctggagt aaatgatgac 540

acaaggcaat tgacccacgc atgtatctat ctcattttct tacaccttct attaccttct 600

gctctctctg atttggaaaa agctgaaaaa aaaggttgaa accagttccc tgaaattatt 660

cccctacttg actaataagt atataaagac ggtaggtatt gattgtaatt ctgtaaatct 720

atttcttaaa cttcttaaat tctactttta tagttagtct tttttttagt tttaaaacac 780

caagaactta gtttcgaata aacacacata aacaaacaaa atgagtaaag gagaagaact 840

tttc 844

<210> 7

<211> 474

<212> DNA

<213> Artificial sequence

<400> 7

ggagaaaata ccgcatcagg agtgatcccc cacacaccat agcttcaaaa tgtttctact 60

ccttttttac tcttccagat tttctcggac tccgcgcatc gccgtaccac ttcaaaacac 120

ccaagcacag catactaaat ttcccctctt tcttcctcta gggtgtcgtt aattacccgt 180

actaaaggtt tggaaaagaa aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg 240

caataaaaat ttttatcacg tttctttttc ttgaaaattt ttttttttga tttttttctc 300

tttcgatgac ctcccattga tatttaagtt aataaacggt cttcaatttc tcaagtttca 360

gtttcatttt tcttgttcta ttacaacttt ttttacttct tgctcattag aaagaaagca 420

tagcaatcta atctaagttt taattacaaa atgagtaaag gagaagaact tttc 474

<210> 8

<211> 232

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (178)..(183)

<223> n is a, c, g, or t

<400> 8

tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg ggcgcgcccc 60

tccttgaaac tgaaatttta gcatgtgatt aattaacttg taatattcta atcaagctta 120

taaaagagca ctgttgggcg tgagtggagg cgccggaaaa aagcatcgaa aaaatctnnn 180

nnnatgagta aaggagaaga acttttcact ggagttgtcc caattcttgt tg 232

<210> 9

<211> 6030

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (178)..(183)

<223> n is a, c, g, or t

<400> 9

tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg ggcgcgcccc 60

tccttgaaac tgaaatttta gcatgtgatt aattaacttg taatattcta atcaagctta 120

taaaagagca ctgttgggcg tgagtggagg cgccggaaaa aagcatcgaa aaaatctnnn 180

nnnatgagta aaggagaaga acttttcact ggagttgtcc caattcttgt tgaattagat 240

ggtgatgtta atgggcacaa attttctgtc agtggagagg gtgaaggtga tgcaacatac 300

ggaaaactta cccttaaatt tatttgcact actggaaaac tacctgttcc atggccaaca 360

cttgtcacta ctttctctta tggtgttcaa tgcttttcaa gatacccaga tcatatgaaa 420

cggcatgact ttttcaagag tgccatgccc gaaggttatg tacaggaaag aactatattt 480

ttcaaagatg acgggaacta caagacacgt gctgaagtca agtttgaagg tgataccctt 540

gttaatagaa tcgagttaaa aggtattgat tttaaagaag atggaaacat tcttggacac 600

aaattggaat acaactataa ctcacacaat gtatacatca tggcagacaa acaaaagaat 660

ggaatcaaag ttaacttcaa aattagacac aacattgaag atggaagcgt tcaactagca 720

gaccattatc aacaaaatac tccaattggc gatggccctg tccttttacc agacaaccat 780

tacctgtcca cacaatctgc cctttcgaaa gatcccaacg aaaagagaga ccacatggtc 840

cttcttgagt ttgtaacagc tgctgggatt acacatggca tggatgaact atacaaatag 900

caaagacgtt gtttcatcgc gctattacca agaaggttac tttacttgtt cttgcacatg 960

gacgcacgtt gtgtgttcat atatatatat atatatatat atatatattt gtgcttgttt 1020

tcattgtctc tatagttaat acattctatt tttatcgtta tatttgcatt ctcttcgcat 1080

aaaaacttca tgaaaattcg gcagaaaata agcaaattgt aaacgttaat attttgttaa 1140

aattcgcgtt aaatttttgt taaatcagct cattttttaa ccaataggcc gaaatcggca 1200

aaatccctta taaatcaaaa gaatagaccg agatagggtt gagtgttgtt ccagtttgga 1260

acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc 1320

agggcgatgg cccactacgt gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc 1380

gtaaagcact aaatcggaac cctaaaggga gcccccgatt tagagcttga cggggaaagc 1440

cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct agggcgctgg 1500

caagtgtagc ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac 1560

agggcgcgtc gcgccattcg ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc 1620

gggcctcttc gctattacgc cagctggcga aggggggatg tgctgcaagg cgattaagtt 1680

gggtaacgcc agggttttcc cagtcacgac gttgtaaaac gacggccagt gaattgtaat 1740

acgactcact atagggcgaa ttggagctcc accgcggtgg cggccgctct agaactagtg 1800

gatcccccgg gctgcaggaa ttcgatatca agcttatcga taccgtcgac ctcgaggggg 1860

ggcccggtac ccagcttttg ttccctttag tgagggttaa ttccgagctt ggcgtaatca 1920

tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatagga 1980

gccggaagca taaagtgtaa agcctggggt gcctaatgag tgaggtaact cacattaatt 2040

gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga 2100

atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc 2160

actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 2220

gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 2280

cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctcggc 2340

ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 2400

ctataaagat accaggcgtt cccccctgga agctccctcg tgcgctctcc tgttccgacc 2460

ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa 2520

tgctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 2580

cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 2640

aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 2700

gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 2760

agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 2820

ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 2880

cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 2940

tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 3000

aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 3060

tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 3120

atctgtctat ttcgttcatc catagttgcc tgactgcccg tcgtgtagat aactacgata 3180

cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 3240

gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 3300

gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 3360

tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 3420

tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 3480

tcccccatgt tgtgaaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 3540

aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 3600

atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 3660

tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 3720

catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 3780

aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 3840

tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 3900

gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 3960

tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 4020

tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgggtcc 4080

ttttcatcac gtgctataaa aataattata atttaaattt tttaatataa atatataaat 4140

taaaaataga aagtaaaaaa agaaattaaa gaaaaaatag tttttgtttt ccgaagatgt 4200

aaaagactct agggggatcg ccaacaaata ctacctttta tcttgctctt cctgctctca 4260

ggtattaatg ccgaattgtt tcatcttgtc tgtgtagaag accacacacg aaaatcctgt 4320

gattttacat tttacttatc gttaatcgaa tgtatatcta tttaatctgc ttttcttgtc 4380

taataaatat atatgtaaag tacgcttttt gttgaaattt tttaaacctt tgtttatttt 4440

tttttcttca ttccgtaact cttctacctt ctttatttac tttctaaaat ccaaatacaa 4500

aacataaaaa taaataaaca cagagtaaat tcccaaatta ttccatcatt aaaagatacg 4560

aggcgcgtgt aagttacagg caagcgatcc gtcctaagaa accattatta tcatgacatt 4620

aacctataaa aataggcgta tcacgaggcc ctttcgtctc gcgcgtttcg gtgatgacgg 4680

tgaaaacctc tgacacatgc agctcccgga gacggtcaca gcttgtctgt aagcggatgc 4740

cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt ggcgggtgtc ggggctggct 4800

taactatgcg gcatcagagc agattgtact gagagtgcac cataattccg ttttaagagc 4860

ttggtgagcg ctaggagtca ctgccaggta tcgtttgaac acggcattag tcagggaagt 4920

cataacacag tcctttcccg caattttctt tttctattac tcttggcctc ctctagtaca 4980

ctctatattt ttttatgcct cggtaatgat tttcattttt ttttttccac ctagcggatg 5040

actctttttt tttcttagcg attggcatta tcacataatg aattatacat tatataaagt 5100

aatgtgattt cttcgaagaa tatactaaaa aatgagcagg caagataaac gaaggcaaag 5160

atgacagagc agaaagccct agtaaagcgt attacaaatg aaaccaagat tcagattgcg 5220

atctctttaa agggtggtcc cctagcgata gagcactcga tcttcccaga aaaagaggca 5280

gaagcagtag cagaacaggc cacacaatcg caagtgatta acgtccacac aggtataggg 5340

tttctggacc atatgataca tgctctggcc aagcattccg gctggtcgct aatcgttgag 5400

tgcattggtg acttacacat agacgaccat cacaccactg aagactgcgg gattgctctc 5460

ggtcaagctt ttaaagaggc cctactggcg cgtggagtaa aaaggtttgg atcaggattt 5520

gcgcctttgg atgaggcact ttccagagcg gtggtagatc tttcgaacag gccgtacgca 5580

gttgtcgaac ttggtttgca aagggagaaa gtaggagatc tctcttgcga gatgatcccg 5640

cattttcttg aaagctttgc agaggctagc agaattaccc tccacgttga ttgtctgcga 5700

ggcaagaatg atcatcaccg tagtgagagt gcgttcaagg ctcttgcggt tgccataaga 5760

gaagccacct cgcccaatgg taccaacgat gttccctcca ccaaaggtgt tcttatgtag 5820

tgacaccgat tatttaaagc tgcagcatac gatatatata catgtgtata tatgtatacc 5880

tatgaatgtc agtaagtatg tatacgaaca gtatgatact gaagatgaca aggtaatgca 5940

tcattctata cgtgtcattc tgaacgaggc gcgctttcct tttttctttt tgctttttct 6000

ttttttttct cttgaactcg acggatcata 6030

<210> 10

<211> 125

<212> DNA

<213> Artificial sequence

<400> 10

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctt 120

caaca 125

<210> 11

<211> 125

<212> DNA

<213> Artificial sequence

<400> 11

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctc 120

caacc 125

<210> 12

<211> 125

<212> DNA

<213> Artificial sequence

<400> 12

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctg 120

caaag 125

<210> 13

<211> 125

<212> DNA

<213> Artificial sequence

<400> 13

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

taacc 125

<210> 14

<211> 125

<212> DNA

<213> Artificial sequence

<400> 14

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

cgaag 125

<210> 15

<211> 125

<212> DNA

<213> Artificial sequence

<400> 15

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

tctag 125

<210> 16

<211> 125

<212> DNA

<213> Artificial sequence

<400> 16

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctg 120

tcaac 125

<210> 17

<211> 125

<212> DNA

<213> Artificial sequence

<400> 17

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

ctaca 125

<210> 18

<211> 125

<212> DNA

<213> Artificial sequence

<400> 18

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctc 120

caagc 125

<210> 19

<211> 125

<212> DNA

<213> Artificial sequence

<400> 19

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctg 120

caata 125

<210> 20

<211> 125

<212> DNA

<213> Artificial sequence

<400> 20

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctt 120

cagca 125

<210> 21

<211> 125

<212> DNA

<213> Artificial sequence

<400> 21

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctc 120

accaa 125

<210> 22

<211> 125

<212> DNA

<213> Artificial sequence

<400> 22

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

tcgtc 125

<210> 23

<211> 125

<212> DNA

<213> Artificial sequence

<400> 23

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

ttatt 125

<210> 24

<211> 225

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (170)..(175)

<223> n is a, c, g, or t

<400> 24

gacaacttga aagagctata ttcgtcttcg gttttttgat ttttattaac cctccttgaa 60

actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct tataaaagag 120

cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctn nnnnnctgca 180

gaccaattgg tgaaaactga agtcaccaag aagtctttta ctgct 225

Claims

1. A method for constructing a saccharomyces cerevisiae artificial promoter mutant library comprises the following steps: and randomly mutating all or part of 1-6 th positions from the 3' tail end of the nucleotide sequence of the saccharomyces cerevisiae artificial promoter UASF-E-C-core1 to obtain a saccharomyces cerevisiae artificial promoter mutant library.

2. The method of claim 1, wherein: the nucleotide sequence of the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 is shown as 29-153 th site of SEQ ID No. 4.

3. The recombinant vector library for screening the saccharomyces cerevisiae artificial promoter mutant is characterized in that: each recombinant vector in the recombinant vector library is double-stranded circular DNA formed by connecting a skeleton vector segment and a DNA segment with a specific structure; the DNA fragment with the specific structure sequentially consists of an artificial promoter UASF-E-C-core1 mutant of saccharomyces cerevisiae, a fragment to be transcribed and a terminator from upstream to downstream; and is

The 1 st to 6 th nucleotide sequences from the 3' end of the UASF-E-C-core1 mutant sequences of the saccharomyces cerevisiae artificial promoter on different recombinant vectors in the recombinant vector library are different; and is

The sequences of the fragment to be transcribed and the terminator on different recombinant vectors in the recombinant vector library are the same;

4. The library of recombinant vectors of claim 3, wherein: the terminator is an SPG5 terminator; and/or

The fragment to be transcribed is a target gene.

5. The library of recombinant vectors of claim 3 or 4, wherein: the skeleton vector is a saccharomyces cerevisiae universal expression vector pRS 313.

6. The recombinant saccharomyces cerevisiae library for screening the target saccharomyces cerevisiae artificial promoter mutant is obtained by introducing the recombinant vector library of any one of claims 3-5 into a receptor saccharomyces cerevisiae.

7. Use of the method of claim 1 or 2 or the recombinant vector library of any one of claims 3 to 5 or the recombinant s.cerevisiae library of claim 6 for screening of s.cerevisiae artificial promoter mutants of interest.

8. A method for screening a target saccharomyces cerevisiae artificial promoter mutant comprises the following steps: culturing the recombinant Saccharomyces cerevisiae bank of claim 6, and screening to obtain a recombinant Saccharomyces cerevisiae strain meeting the predetermined conditions; the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 mutant carried in the target recombinant Saccharomyces cerevisiae is a target Saccharomyces cerevisiae artificial promoter mutant.

9. Use of the method of claim 1 or 2 or 8 or the library of recombinant vectors of any one of claims 3 to 5 or the library of recombinant Saccharomyces cerevisiae of claim 6 for the regulation of gene expression in a metabolic pathway of Saccharomyces cerevisiae.

10. A method for constructing a library of promoter mutants, comprising the steps of: randomly mutating all or part of sequences in a Kozak region of the promoter to obtain a promoter mutant library;

the Kozak region of the promoter refers to the last six bases at the 3' end of the promoter.