CN114958838A - High-strength saccharomyces cerevisiae artificial small promoter - Google Patents

Abstract

The invention discloses a high-strength saccharomyces cerevisiae artificial small promoter. The invention provides a saccharomyces cerevisiae artificial promoter mutant library which is obtained by randomly mutating all or part of 1 st to 6 th positions from the 3' end of a nucleotide sequence of a saccharomyces cerevisiae artificial promoter UASF-E-C-core 1. The saccharomyces cerevisiae artificial promoter mutant provided by the invention is specifically any one of the following: 14 promoter mutants with the nucleotide sequence shown in SEQ ID No. 10-23. The invention provides a group of high-strength saccharomyces cerevisiae artificial small promoters, wherein the strength of the small promoter with the strongest strength is about 3.3 times of that of a natural strong promoter TDH3 and 7 times of that of a starting promoter. The strength range of the artificial small promoter is remarkably widened, and the promoter engineering is better applied to gene expression regulation and control of a saccharomyces cerevisiae metabolic pathway.

Description

High-strength saccharomyces cerevisiae artificial small promoter

Technical Field

The invention relates to the technical field of biology, in particular to a group of high-strength saccharomyces cerevisiae artificial small promoters.

Background

Saccharomyces cerevisiae, as a eukaryotic model organism, has the advantages of rapid growth, easy culture, high safety, clear genetic background and the like, and is widely applied to synthetic biology. Saccharomyces cerevisiae cell factories have been developed for the production of recombinant proteins, biofuels and fine chemicals, among others. The promoter is an important transcription regulation element and plays an important role in the regulation of gene expression of a saccharomyces cerevisiae gene pathway and a metabolic pathway. The construction of metabolic pathways often involves the expression of multiple genes, the expression levels of which span several orders of magnitude. The fine regulation of these genes makes the selection of suitable promoters challenging.

At present, a series of constitutive promoters endogenous to yeast, such as pPGK1, pTEF1, pFBA11, pGPD/pTDH3, inducible strong promoter pGAL1 and the like, are commonly used for expressing exogenous genes in a saccharomyces cerevisiae cell factory. However, it is worth noting that these yeast endogenous promoters have some limitations, such as insufficient number of well-characterized promoters, poor dynamic range, and susceptibility to interference from endogenous substances, which hinder their application in metabolic engineering. In recent years, research on synthetic promoters of yeasts has been rapidly developed, especially in the model microorganism Saccharomyces cerevisiae. However, the problem is that the promoter frameworks for promoter modification at present are all from yeast endogenous promoters, and the obtained new promoters are generally large and have poor sequence diversity, so that the stability after multiple recombinations is poor. The promoter obtained by hybridization significantly improves the problem of poor sequence diversity, but has the defects that the obtained promoter is too large and depends on endogenous sequences such as UAS (upstream activation sequence) to play a role. To solve these problems, Alper et al obtained a series of small promoters of 125bp size independent of the yeast endogenous promoter by total synthesis. The length of the promoter is shortened by 80 percent compared with the integrated promoter. However, it reports that the strength of the strongest small promoter is about 70% of that of the yeast endogenous strong promoter TDH3, and this strength range is still difficult to satisfy the needs of researchers.

Disclosure of Invention

The invention aims to provide a group of high-strength saccharomyces cerevisiae artificial small promoters.

In a first aspect, the invention claims a saccharomyces cerevisiae artificial promoter mutant library.

The saccharomyces cerevisiae artificial promoter mutant library claimed by the invention is obtained by randomly mutating all or part of 1 st to 6 th positions from the 3' end of a nucleotide sequence of a saccharomyces cerevisiae artificial promoter UASF-E-C-core 1.

Wherein the nucleotide sequence of the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 is shown as 29-153 th site of SEQ ID No. 4.

In a specific embodiment of the invention, all the 1 st to 6 th positions from the 3 'end of the nucleotide sequence of the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 (the 29 th to 153 th positions of SEQ ID number 4) are randomly mutated by means of PCR, the 1 st to 6 th positions from the 3' end of the nucleotide sequence of the primer corresponding to the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 (the 29 th to 153 th positions of SEQ ID No. 4) are NNNNNNNN, and N is A or T or C or G.

In a second aspect, the invention claims an artificial promoter mutant of Saccharomyces cerevisiae.

The saccharomyces cerevisiae artificial promoter mutant claimed by the invention can be any one of the following mutants:

(A1) the nucleotide sequence is shown as SEQ ID No.19 (corresponding to 528 in FIG. 1);

(A2) the nucleotide sequence is shown as SEQ ID No.13 (corresponding to 510 in FIG. 1);

(A3) the nucleotide sequence is shown as SEQ ID No.11 (corresponding to 503 in FIG. 1);

(A4) the nucleotide sequence is shown as SEQ ID No.10 (corresponding to 501 in FIG. 1);

(A5) the nucleotide sequence is shown as SEQ ID No.12 (corresponding to 507 in FIG. 1);

(A6) the nucleotide sequence is shown as SEQ ID No.14 (corresponding to 512 in FIG. 1);

(A7) the nucleotide sequence is shown as SEQ ID No.20 (corresponding to 532 in FIG. 1);

(A8) the nucleotide sequence is shown as SEQ ID No.21 (corresponding to 536 in FIG. 1);

(A9) the nucleotide sequence is shown as SEQ ID No.16 (corresponding to 517 in FIG. 1);

(A10) the nucleotide sequence is shown as SEQ ID No.18 (corresponding to 525 in FIG. 1);

(A11) the nucleotide sequence is shown as SEQ ID No.15 (corresponding to 514 in FIG. 1);

(A12) the nucleotide sequence is shown as SEQ ID No.17 (corresponding to 523 in FIG. 1);

(A13) the nucleotide sequence is shown as SEQ ID No.22 (corresponding to 540 in FIG. 1);

(A14) the nucleotide sequence is shown as SEQ ID No.23 (corresponding to 545 in FIG. 1).

In a third aspect, the invention claims the application of the saccharomyces cerevisiae artificial promoter mutant in promoting the expression of a target gene in saccharomyces cerevisiae.

In a fourth aspect, the invention claims the application of the saccharomyces cerevisiae artificial promoter mutant in improving the expression level of the target gene in the saccharomyces cerevisiae.

In a fifth aspect, the present invention claims an expression cassette comprising an artificial promoter mutant of Saccharomyces cerevisiae as described in the previous second aspect.

The expression cassette consists of the saccharomyces cerevisiae artificial promoter mutant, a target gene and a terminator which are connected in sequence.

In a specific embodiment of the present invention, the terminator is specifically an SPG5 terminator.

Further, the nucleotide sequence of the SPG5 terminator is shown in 23 rd to 213 th of SEQ ID No. 2.

In a sixth aspect, the invention claims a recombinant vector comprising an expression cassette as described in the fifth aspect above.

In a specific embodiment of the invention, the backbone vector of the recombinant vector is saccharomyces cerevisiae universal expression vector pRS 313.

In a seventh aspect, the present invention claims a recombinant s.cerevisiae strain comprising the recombinant vector described above in the sixth aspect.

In a particular embodiment of the invention, the recipient saccharomyces cerevisiae is in particular BY 4742. Of course, other s.cerevisiae strains are theoretically possible.

In an eighth aspect, the present invention claims the application of the Saccharomyces cerevisiae artificial promoter mutant library of the first aspect or the Saccharomyces cerevisiae artificial promoter mutant of the second aspect or the expression cassette of the fifth aspect or the recombinant vector of the sixth aspect or the recombinant Saccharomyces cerevisiae of the seventh aspect in gene expression regulation of Saccharomyces cerevisiae metabolic pathway.

The invention provides a group of high-strength saccharomyces cerevisiae artificial small promoters, wherein the strength of the small promoter with the strongest strength is about 3.3 times of that of a natural strong promoter TDH3 and 7 times of that of a starting promoter. The strength range of the artificial small promoter is remarkably widened, and the promoter engineering is better applied to gene expression regulation and control of a saccharomyces cerevisiae metabolic pathway.

Drawings

FIG. 1 is a comparison of the strength of a high strength artificial mini-promoter with a yeast endogenous strong promoter.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 construction of YPL001 plasmid as blank control

1. Amplification of GFP Gene and SPG5 terminator

GFP gene was synthesized by Kinsley, and PCR was performed using a synthetic plasmid (obtained by inserting the GFP gene shown at positions 25 to 741 of SEQ ID No.1 into pUC 57) as a template, using primers GFPzeo-up2/GFPzeo-down2 (see Table 1) as an amplification system for TAKARA

DNA polymerase 5 Xbuffer 10. mu.l, DnMu.l of tp mix, 1. mu.l each of primers (see Table 1), cDNA, template 0.5. mu.l, 0.5. mu.l of PrimerSTAR HS polymerase (2.5U/. mu.L), and distilled water to a total volume of 50. mu.l. The amplification conditions were: pre-denaturation at 98 ℃ for 2 min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 56 ℃ for 15 seconds, and extension at 72 ℃ for 1 minute (30 cycles); extension at 72 ℃ for 8 min (1 cycle). The resulting amplification product was designated GFP (SEQ ID No.1, the fragment containing the 24bp plasmid pRS313 homologous region, the 20bp SPG5 homologous region, and the GFP gene sequence). And purifying the obtained PCR amplification product by using a PCR product purification kit of Shanghai biological engineering Co., Ltd, and obtaining a purified product for later use. The terminator SPG5 (as described above) was amplified using the Saccharomyces cerevisiae BY4742 genome as a template and the primers SPG5-up2/SPG5-down2 (see Table 1), and the amplification product was named SPG5(SEQ ID No.2, this fragment contains a 22bp GFP homologous region, a 22bp plasmid pRS313 homologous region, and a SPG5 terminator sequence). And purifying the obtained PCR amplification product by using a PCR product purification kit of Shanghai biological engineering Co., Ltd, and keeping the purified product for later use.

2. PCR amplification of expression vectors

The target expression vector was amplified with the primer 313-up2/313-down2 (see Table 1) using Saccharomyces cerevisiae universal expression vector pRS313 (from Addgene, His3 marker) as template. The amplification system and conditions were the same as in step 1 of example 1. The resulting amplified product was named pRS313-His-vector (SEQ ID No.3, this fragment is the pRS313 vector backbone with a 24bp GFP homology region and a 22bp SPG5 homology region). And (3) recovering and purifying the obtained PCR amplification product by using a PCR glue recovery kit of Shanghai biological engineering Co.

3. Construction of YPL001 plasmid by CPEC method

CPEC system: phusion High-Fidelity DNA polymerase 5 x Buffer 5. mu.l, Dntp mix 1, DMSO 0.75. mu.l, two purified fragments (the GFP gene and SPG5 terminator amplified purified fragments obtained in step 1) and pRS313-His-vector obtained in step 2 were added equimolar, Phusion High-Fidelity DNA polymerase (2U/. mu.L) 0.5. mu.l, and distilled water was added to a total volume of 25. mu.l. The amplification conditions were: 30 seconds at 98 ℃ (1 cycle); 10 seconds at 98 ℃, 30 seconds at 55 ℃ and 15 seconds at 72 ℃ (15 cycles); extension for 10 min at 72 ℃ (1 cycle). Transfer 5. mu.l of PCR product into Trans1-T1 competent cells in ice bath for 30 min, heat shock at 42 ℃ for 30 sec, and immediately ice for 2 min. After adding 800. mu.l of LB medium and incubating at 250rpm and 37 ℃ for 1 hour, the bacterial solution was spread on LB plate containing ampicillin and cultured overnight, PCR screening was carried out using YpL001-YZ-up/YpL001-YZ-down (see Table 1) with a positive clone band size of 1504 bp. And performing liquid culture on the positive clone, extracting a positive clone plasmid, and performing sequencing verification, wherein a sequencing result shows that a target fragment is inserted into the vector pRS313-His to obtain the plasmid YPL 001. A plasmid extraction kit of Aisijin is used to extract the target plasmid YPL001 for later use.

TABLE 1 construction of YPL001 and YPL002 plasmid primers

Example 2 construction of YPL002 plasmid as Positive control

The strongest artificial small promoter reported by Alper group, UASF-E-C-core1 (positions 29-153 of SEQ ID No. 4), was synthesized by Kinsley. The PCR product obtained by amplification with the primers Core11-up/Core11-down (see Table 1) was named UASF-E-C-Core1(SEQ ID No.4, which contains a 20bp plasmid pRS313 homologous region, a 24bp GFP homologous region, and UASF-E-C-Core1) in the same manner as in step 1 of example 1. The YPL001 plasmid constructed in example 1 was used as a template, and PCR amplification was carried out using primers YpL001-up/YpL001-down (see Table 1), and the resulting amplification product was designated pRS313-His-GFP-SPG5(SEQ ID No.5, which contains pRS313 vector backbone, GFP gene and SPG5 terminator). And (3) recovering and purifying the obtained PCR amplification product by using a PCR glue recovery kit of Shanghai biological engineering Co. The two fragments were ligated by the CPEC method (same procedure as in example 1, step 3). Transfer 5. mu.l of PCR product into Trans1-T1 competent cells in ice bath for 30 min, heat shock at 42 ℃ for 30 sec, and immediately ice for 2 min. After adding 800. mu.l of LB medium, incubating at 250rpm and 37 ℃ for 1 hour, plating the broth on LB plates containing ampicillin overnight, and performing PCR screening using primer Core11-up/GFPzeo-down2 (see Table 1), the band size of the positive clone was 890 bp. And performing liquid culture on the positive clone, extracting a positive clone plasmid, and performing sequencing verification, wherein a sequencing result shows that a target fragment is inserted into the vector pRS313 to obtain the plasmid YPL 002. A plasmid extraction kit of Aisijin is used to extract a target plasmid YPL002 for later use.

Example 3 construction of strains Ypl001, Ypl002, Ypl007, Ypl008

Construction of YPL007 and YPL008 plasmids

1. Amplification of pGPD/pTDH3, pTEF1 promoters

PCR amplification was carried out using Saccharomyces cerevisiae BY4742 genome as template and primers GPD-Dai-up/GPD-Dai-down, TEF1-Dai-up/TEF1-Dai-down (see Table 2), respectively. The amplification system is TAKARA

DNA polymerase 5 Xbuffer 10. mu.l, Dntp mix 4. mu.l, primers 1. mu.l each, cDNA, template 0.5. mu.l, PrimerSTAR HS polymerase (2.5U/. mu.L) 0.5. mu.l, and distilled water was added to a total volume of 50. mu.l. The amplification conditions were: pre-denaturation at 98 ℃ for 2 min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 56 ℃ for 15 seconds, and extension at 72 ℃ for 1 minute (30 cycles); extension at 72 ℃ for 8 min (1 cycle). The amplified products were designated pTDH3(SEQ ID No.6, which contains the 20bp plasmid pRS313 homologous region, the 24bp GFP homologous region and the TDH3 promoter sequence), pTEF1(SEQ ID No.7, which contains the 20bp plasmid pRS313 homologous region, the 24bp GFP homologous region and the TEF1 promoter), respectively. And purifying the obtained PCR amplification product by using a PCR product purification kit of Shanghai biological engineering Co., Ltd, and obtaining a purified product for later use.

TABLE 2 construction of YPL007 and YPL008 plasmid primers

Primer name	Sequence (5 '-3')
		GPD-Dai-up	GGAGAAAATACCGCATCAGGATACTAGCGTTGAATGTTAGCG
GPD-Dai-down	GAAAAGTTCTTCTCCTTTACTCATTTTGTTTGTTTATGTGTGTTTATTC
		TEF1-Dai-up	GGAGAAAATACCGCATCAGGAGTGATCCCCCACACACCATAG
TEF1-Dai-down	GAAAAGTTCTTCTCCTTTACTCATTTTGTAATTAAAACTTAGATTAG
		YpL001-YZ-up	CCAAAGGTGTTCTTATGTAGTG
YpL001-YZ-down	CTTTAGGGTTCCGATTTAGTGC

2. Amplification expression vector

Using YPL001 constructed in example 1 as a template, PCR amplification was carried out using primers YpL001-YZ-up/YpL001-YZ-down (see Table 1), and the resulting amplification product was designated pRS313-His-GFP-SPG5(SEQ ID No.5, which contains pRS313 vector backbone, GFP gene and SPG5 terminator). And (3) recovering and purifying the obtained PCR amplification product by using a PCR glue recovery kit of Shanghai biological engineering Co., Ltd, and obtaining a purified product for later use.

3. Construction of YPL007 and YPL008 plasmids by CPEC method

CPEC system: phusion High-Fidelity DNA polymerase 5 x Buffer 5. mu.l, Dntp mix 1, DMSO 0.75. mu.l, purified fragment (pTDH 3 or pTEF1 obtained in step 1) and pRS313-His-GFP-SPG5 were added equimolar, Phusion High-Fidelity DNA polymerase (2U/. mu.L) 0.5. mu.l, and distilled water was added to a total volume of 25. mu.l. The amplification conditions were: 30 seconds at 98 ℃ (1 cycle); 10 seconds at 98 ℃, 30 seconds at 55 ℃ and 15 seconds at 72 ℃ (15 cycles); extension for 10 min at 72 ℃ (1 cycle). Transfer 5. mu.l of PCR product into Trans1-T1 competent cells in ice bath for 30 min, heat shock at 42 ℃ for 30 sec, and immediately ice for 2 min. Adding 800 ul LB culture medium, incubating at 250rpm and 37 ℃ for 1 hour, coating the bacterial liquid on LB plate containing ampicillin, culturing overnight, and PCR screening with primer GPD-Dai-up or TEF1-Dai-up/GFPzeo-down2 (see Table 1 and Table 2), the positive clone band size is 1557bp or 1187 bp. And (3) performing liquid culture on the positive clone, extracting a positive clone plasmid, and performing sequencing verification, wherein the sequencing result shows that the target fragment is inserted into the vector pRS313-His-GFP-SPG5 to obtain plasmids YPL007 (corresponding to pTDH3) and YPL008 (corresponding to pTEF 1). The plasmid extraction kit of Aisijin company is used to extract the target plasmid for later use.

Secondly, Ypl001, Ypl002, Ypl007 and Ypl008 strain are constructed

Starting with Saccharomyces cerevisiae BY4742(Saccharomyces cerevisiae BY4742, described in Carrier baker brochmann et al, 1998, Yeast,14: 115-. 1mL (OD. about.0.6-1.0) was dispensed into 1.5mL EP tubes, centrifuged at 4 ℃ at 10000g for 1min, the supernatant was discarded, the precipitate was washed with sterile water (4 ℃), centrifuged under the same conditions, and the supernatant was discarded. The cells were incubated at 25 ℃ for 20min with 1mL of a treatment solution (10mM LiAc; 10mM DTT; 0.6M sorbitol; 10mM Tris-HCl (pH7.5), DTT being added when the treatment solution was used). After centrifugation, the supernatant was discarded, 1mL of 1M sorbitol (0.22 μ M aqueous membrane filtration sterilization) was added to the cells for resuspension, and the cells were centrifuged to discard the supernatant (resuspended twice with 1M sorbitol) to a final volume of about 80 μ L. YPL001, YPL002, YPL007 and YPL008 plasmid 1 μ L were added, mixed well and transferred to an electric cuvette, shocked at 2.7kv for 5.6ms, added with 1mL of 1M sorbitol, revived at 30 ℃ for 1h, spread on a screening medium plate (formulation: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.01% Leu., 0.01% Ura., 0.01% Trp. (each percentage number indicates g/100mL), screened and cultured under conditions of 30 ℃ for 36h or more, and each strain was named Ypl, 36002, Ypl007 and Ypl according to the difference of the transferred plasmids.

Example 4 construction of Artificial Small promoter Kozak library and screening to obtain high-Strength Artificial Small promoter

Construction of Saccharomyces cerevisiae artificial promoter Kozak library

1. Amplification of YPL-Kozak-mut fragment

The strongest artificial small promoter reported by Alper group, UASF-E-C-Core1 (positions 29-153 of SEQ ID No. 4), was synthesized by Kinsley and PCR amplified using the primers CoreKM-up/Core11 KM-down (see Table 3). The amplification system and conditions were the same as in step 1 of example 1. The resulting amplification product was designated YPL-Kozak-mut (SEQ ID No.8, which fragment includes the 50bp plasmid pRS313 homology arm, UASF-E-C-core1 and Kozakmut). And (3) recovering and purifying the obtained PCR amplification product by using a PCR glue recovery kit of Shanghai biological engineering Co.

2. Homologous recombination in saccharomyces cerevisiae body, construction of saccharomyces cerevisiae artificial promoter Kozak library

Saccharomyces cerevisiae BY4742 was made competent (same procedure as step two of example 3). YPL-Kozak-mut fragment and pRS313-His-GFP-SPG5 vector fragment were added in an amount of 2. mu.L each, mixed well, transferred to an electric cuvette, shocked at 2.7kv for 5.6ms, added with 1mL of 1M sorbitol, thawed at 30 ℃ for 1 hour, and spread on a screening medium plate (formulation: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.01% Leu., 0.01% Ura, 0.01% Trp. (each percentage indicates g/100mL), screening culture was carried out at 30 ℃ for 36 hours or more.

The recombinant saccharomyces cerevisiae obtained by screening contains a recombinant vector formed by homologous recombination of a YPL-Kozak-mut fragment and a pRS313-His-GFP-SPG5 vector fragment, wherein the nucleotide sequence of the recombinant vector is shown as SEQ ID No.9, and N is A, C, T or G.

TABLE 3 construction of Kozak library primers

Note: n represents A or T or C or G.

Second, screening of Saccharomyces cerevisiae artificial promoter Kozak library

1. Flow cytometry initial screening of saccharomyces cerevisiae artificial promoter Kozak library

Collecting the strains obtained in the steps into a 1.5ml centrifuge tube, washing twice by using a sterilized PBS buffer solution, sorting by using a flow cytometer, collecting 2% strains with higher fluorescence intensity, culturing in a 96 deep-well plate (added with a corresponding liquid culture medium), and carrying out screening culture under the conditions as follows: culturing at 30 deg.C, humidity 80% and rotation speed of 800rpm for more than 24 h.

2. 96-hole plate double screen

Transfer the 96-deep-well plate bacterial liquid to the 96-well plate with white bottom and black edge by using 200 mu L of a row gun. Subsequently, fluorescence measurement was carried out under the conditions of 395nm for excitation light, 507nm for absorption light and 600nm for OD measurement. The fluorescence/OD 600 ratio was calculated and 38 clones with significant enhancement were rescreened in vitro.

3. Test tube rescreening

The seed solutions (30 ℃ C., 250rpm, 12 hours) were prepared by cloning 38 clones selected as described above in the corresponding liquid selection medium (formulation: liquid yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose; each percentage number indicates g/100mL), followed by selection according to the initial OD _600nm The culture was continued by transfer (30 ℃, 250rpm, 12 hours) at 0.1, followed by fluorescence measurement under the conditions of 395nm for excitation light, 507nm for absorption light and 600nm for OD measurement. fluorescence/OD 600 ratios were calculated, and finally fourteen small promoters were retained, and the corresponding strains were named 501, 503, 507, 510, 512, 514, 517, 523, 525, 528, 532, 536, 540, 545(SEQ ID NO: S)ID No.10-SEQ ID No.23)

Thirdly, comparing the strength of the high-strength artificial small promoter with that of the yeast endogenous strong promoter

Fluorescence measurement experiment: the 4 strains Ypl001, Ypl002, Ypl007 and Ypl008 and a total of 14 strains of the saccharomyces cerevisiae strains obtained by screening in step two were activated in the corresponding solid selection medium (formulation: solid yeast screening medium SD-Ura-His-Leu-Trp, 2% glucose, 1.5% agar; each percentage number indicates g/100mL), a seed solution (30 ℃, 250rpm, 12h) was prepared in the corresponding liquid selection medium (formulation: liquid yeast screening medium SD-Ura-His-Leu-Trp, 2% glucose; each percentage number indicates g/100mL), followed by transfer culture (30 ℃, 250rpm, 12h) according to initial OD600nm 0.1 followed by fluorescence measurement under excitation light 395nm, absorption light 507nm and OD measurement under wavelength 600nm, the results of which are shown in fig. 1.

The above measurement results show that 14 high-strength artificial small promoters are finally obtained by constructing a library of the artificial small promoter Kozak region and performing multiple rounds of screening, and except 545 activity which is slightly lower than that of the saccharomyces cerevisiae endogenous strong promoters pTDH3 and pTEF1, the activity of the other 13 artificial small promoters is higher than that of pTDH3 and pTEF 1. The strength of the artificial small promoter 528 with the strongest strength is 3.3 times that of pTDH3 and pTEF1 and 7 times that of the strongest small promoter reported by Alper, so that the dynamic range of the saccharomyces cerevisiae artificial small promoter is remarkably widened.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific examples, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> a group of high-strength saccharomyces cerevisiae artificial small promoters

<130> GNCLN210181

<160> 23

<170> PatentIn version 3.5

<210> 1

<211> 761

<212> DNA

<213> Artificial sequence

<400> 1

gtaaggagaa aataccgcat caggatgagt aaaggagaag aacttttcac tggagttgtc 60

ccaattcttg ttgaattaga tggtgatgtt aatgggcaca aattttctgt cagtggagag 120

ggtgaaggtg atgcaacata cggaaaactt acccttaaat ttatttgcac tactggaaaa 180

ctacctgttc catggccaac acttgtcact actttctctt atggtgttca atgcttttca 240

agatacccag atcatatgaa acggcatgac tttttcaaga gtgccatgcc cgaaggttat 300

gtacaggaaa gaactatatt tttcaaagat gacgggaact acaagacacg tgctgaagtc 360

aagtttgaag gtgataccct tgttaataga atcgagttaa aaggtattga ttttaaagaa 420

gatggaaaca ttcttggaca caaattggaa tacaactata actcacacaa tgtatacatc 480

atggcagaca aacaaaagaa tggaatcaaa gttaacttca aaattagaca caacattgaa 540

gatggaagcg ttcaactagc agaccattat caacaaaata ctccaattgg cgatggccct 600

gtccttttac cagacaacca ttacctgtcc acacaatctg ccctttcgaa agatcccaac 660

gaaaagagag accacatggt ccttcttgag tttgtaacag ctgctgggat tacacatggc 720

atggatgaac tatacaaata gcaaagacgt tgtttcatcg c 761

<210> 2

<211> 258

<212> DNA

<213> Artificial sequence

<400> 2

catggatgaa ctatacaaat agcaaagacg ttgtttcatc gcgctattac caagaaggtt 60

actttacttg ttcttgcaca tggacgcacg ttgtgtgttc atatatatat atatatatat 120

atatatatat ttgtgcttgt tttcattgtc tctatagtta atacattcta tttttatcgt 180

tatatttgca ttctcttcgc ataaaaactt catgaaaatt cggcagaaaa taagcaaatt 240

gtaaacgtta atattttg 258

<210> 3

<211> 5013

<212> DNA

<213> Artificial sequence

<400> 3

gaaaattcgg cagaaaataa gcaaattgta aacgttaata ttttgttaaa attcgcgtta 60

aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa aatcccttat 120

aaatcaaaag aatagaccga gatagggttg agtgttgttc cagtttggaa caagagtcca 180

ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc 240

ccactacgtg aaccatcacc ctaatcaagt tttttggggt cgaggtgccg taaagcacta 300

aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc ggcgaacgtg 360

gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg 420

gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcg 480

cgccattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg 540

ctattacgcc agctggcgaa ggggggatgt gctgcaaggc gattaagttg ggtaacgcca 600

gggttttccc agtcacgacg ttgtaaaacg acggccagtg aattgtaata cgactcacta 660

tagggcgaat tggagctcca ccgcggtggc ggccgctcta gaactagtgg atcccccggg 720

ctgcaggaat tcgatatcaa gcttatcgat accgtcgacc tcgagggggg gcccggtacc 780

cagcttttgt tccctttagt gagggttaat tccgagcttg gcgtaatcat ggtcatagct 840

gtttcctgtg tgaaattgtt atccgctcac aattccacac aacataggag ccggaagcat 900

aaagtgtaaa gcctggggtg cctaatgagt gaggtaactc acattaattg cgttgcgctc 960

actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg 1020

cgcggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct 1080

gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt 1140

atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc 1200

caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctcggcc cccctgacga 1260

gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata 1320

ccaggcgttc ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac 1380

cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcaat gctcacgctg 1440

taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc 1500

cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag 1560

acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt 1620

aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt 1680

atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg 1740

atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac 1800

gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca 1860

gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac 1920

ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac 1980

ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt 2040

tcgttcatcc atagttgcct gactgcccgt cgtgtagata actacgatac gggagggctt 2100

accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt 2160

atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc 2220

cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa 2280

tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg 2340

tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt 2400

gtgaaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc 2460

agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt 2520

aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg 2580

gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac 2640

tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc 2700

gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt 2760

tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg 2820

aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat attattgaag 2880

catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa 2940

acaaataggg gttccgcgca catttccccg aaaagtgcca cctgggtcct tttcatcacg 3000

tgctataaaa ataattataa tttaaatttt ttaatataaa tatataaatt aaaaatagaa 3060

agtaaaaaaa gaaattaaag aaaaaatagt ttttgttttc cgaagatgta aaagactcta 3120

gggggatcgc caacaaatac taccttttat cttgctcttc ctgctctcag gtattaatgc 3180

cgaattgttt catcttgtct gtgtagaaga ccacacacga aaatcctgtg attttacatt 3240

ttacttatcg ttaatcgaat gtatatctat ttaatctgct tttcttgtct aataaatata 3300

tatgtaaagt acgctttttg ttgaaatttt ttaaaccttt gtttattttt ttttcttcat 3360

tccgtaactc ttctaccttc tttatttact ttctaaaatc caaatacaaa acataaaaat 3420

aaataaacac agagtaaatt cccaaattat tccatcatta aaagatacga ggcgcgtgta 3480

agttacaggc aagcgatccg tcctaagaaa ccattattat catgacatta acctataaaa 3540

ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt gaaaacctct 3600

gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac 3660

aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg 3720

catcagagca gattgtactg agagtgcacc ataattccgt tttaagagct tggtgagcgc 3780

taggagtcac tgccaggtat cgtttgaaca cggcattagt cagggaagtc ataacacagt 3840

cctttcccgc aattttcttt ttctattact cttggcctcc tctagtacac tctatatttt 3900

tttatgcctc ggtaatgatt ttcatttttt tttttccacc tagcggatga ctcttttttt 3960

ttcttagcga ttggcattat cacataatga attatacatt atataaagta atgtgatttc 4020

ttcgaagaat atactaaaaa atgagcaggc aagataaacg aaggcaaaga tgacagagca 4080

gaaagcccta gtaaagcgta ttacaaatga aaccaagatt cagattgcga tctctttaaa 4140

gggtggtccc ctagcgatag agcactcgat cttcccagaa aaagaggcag aagcagtagc 4200

agaacaggcc acacaatcgc aagtgattaa cgtccacaca ggtatagggt ttctggacca 4260

tatgatacat gctctggcca agcattccgg ctggtcgcta atcgttgagt gcattggtga 4320

cttacacata gacgaccatc acaccactga agactgcggg attgctctcg gtcaagcttt 4380

taaagaggcc ctactggcgc gtggagtaaa aaggtttgga tcaggatttg cgcctttgga 4440

tgaggcactt tccagagcgg tggtagatct ttcgaacagg ccgtacgcag ttgtcgaact 4500

tggtttgcaa agggagaaag taggagatct ctcttgcgag atgatcccgc attttcttga 4560

aagctttgca gaggctagca gaattaccct ccacgttgat tgtctgcgag gcaagaatga 4620

tcatcaccgt agtgagagtg cgttcaaggc tcttgcggtt gccataagag aagccacctc 4680

gcccaatggt accaacgatg ttccctccac caaaggtgtt cttatgtagt gacaccgatt 4740

atttaaagct gcagcatacg atatatatac atgtgtatat atgtatacct atgaatgtca 4800

gtaagtatgt atacgaacag tatgatactg aagatgacaa ggtaatgcat cattctatac 4860

gtgtcattct gaacgaggcg cgctttcctt ttttcttttt gctttttctt tttttttctc 4920

ttgaactcga cggatcatat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac 4980

cgcatcagga tgagtaaagg agaagaactt ttc 5013

<210> 4

<211> 177

<212> DNA

<213> Artificial sequence

<400> 4

ggagaaaata ccgcatcagg ggcgcgcccc tccttgaaac tgaaatttta gcatgtgatt 60

aattaacttg taatattcta atcaagctta taaaagagca ctgttgggcg tgagtggagg 120

cgccggaaaa aagcatcgaa aaaatctaga aaaatgagta aaggagaaga acttttc 177

<210> 5

<211> 5937

<212> DNA

<213> Artificial sequence

<400> 5

catcgaaaaa atctagaaaa atgagtaaag gagaagaact tttcactgga gttgtcccaa 60

ttcttgttga attagatggt gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg 120

aaggtgatgc aacatacgga aaacttaccc ttaaatttat ttgcactact ggaaaactac 180

ctgttccatg gccaacactt gtcactactt tctcttatgg tgttcaatgc ttttcaagat 240

acccagatca tatgaaacgg catgactttt tcaagagtgc catgcccgaa ggttatgtac 300

aggaaagaac tatatttttc aaagatgacg ggaactacaa gacacgtgct gaagtcaagt 360

ttgaaggtga tacccttgtt aatagaatcg agttaaaagg tattgatttt aaagaagatg 420

gaaacattct tggacacaaa ttggaataca actataactc acacaatgta tacatcatgg 480

cagacaaaca aaagaatgga atcaaagtta acttcaaaat tagacacaac attgaagatg 540

gaagcgttca actagcagac cattatcaac aaaatactcc aattggcgat ggccctgtcc 600

ttttaccaga caaccattac ctgtccacac aatctgccct ttcgaaagat cccaacgaaa 660

agagagacca catggtcctt cttgagtttg taacagctgc tgggattaca catggcatgg 720

atgaactata caaatagcaa agacgttgtt tcatcgcgct attaccaaga aggttacttt 780

acttgttctt gcacatggac gcacgttgtg tgttcatata tatatatata tatatatata 840

tatatttgtg cttgttttca ttgtctctat agttaataca ttctattttt atcgttatat 900

ttgcattctc ttcgcataaa aacttcatga aaattcggca gaaaataagc aaattgtaaa 960

cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca 1020

ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga tagggttgag 1080

tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg 1140

gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct aatcaagttt 1200

tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag 1260

agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc 1320

gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc 1380

gcttaatgcg ccgctacagg gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg 1440

ggaagggcga tcggtgcggg cctcttcgct attacgccag ctggcgaagg ggggatgtgc 1500

tgcaaggcga ttaagttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac 1560

ggccagtgaa ttgtaatacg actcactata gggcgaattg gagctccacc gcggtggcgg 1620

ccgctctaga actagtggat cccccgggct gcaggaattc gatatcaagc ttatcgatac 1680

cgtcgacctc gagggggggc ccggtaccca gcttttgttc cctttagtga gggttaattc 1740

cgagcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa 1800

ttccacacaa cataggagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga 1860

ggtaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt 1920

gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct 1980

cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 2040

cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 2100

acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 2160

ttttccatag gctcggcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 2220

ggcgaaaccc gacaggacta taaagatacc aggcgttccc ccctggaagc tccctcgtgc 2280

gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 2340

gcgtggcgct ttctcaatgc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 2400

ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 2460

actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 2520

gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 2580

ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 2640

ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 2700

gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 2760

tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 2820

tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta 2880

aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg 2940

aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctgcccgtcg 3000

tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc 3060

gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg 3120

agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg 3180

aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag 3240

gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat 3300

caaggcgagt tacatgatcc cccatgttgt gaaaaaaagc ggttagctcc ttcggtcctc 3360

cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc 3420

ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa 3480

ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac 3540

gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt 3600

cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc 3660

gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa 3720

caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca 3780

tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 3840

acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 3900

aagtgccacc tgggtccttt tcatcacgtg ctataaaaat aattataatt taaatttttt 3960

aatataaata tataaattaa aaatagaaag taaaaaaaga aattaaagaa aaaatagttt 4020

ttgttttccg aagatgtaaa agactctagg gggatcgcca acaaatacta ccttttatct 4080

tgctcttcct gctctcaggt attaatgccg aattgtttca tcttgtctgt gtagaagacc 4140

acacacgaaa atcctgtgat tttacatttt acttatcgtt aatcgaatgt atatctattt 4200

aatctgcttt tcttgtctaa taaatatata tgtaaagtac gctttttgtt gaaatttttt 4260

aaacctttgt ttattttttt ttcttcattc cgtaactctt ctaccttctt tatttacttt 4320

ctaaaatcca aatacaaaac ataaaaataa ataaacacag agtaaattcc caaattattc 4380

catcattaaa agatacgagg cgcgtgtaag ttacaggcaa gcgatccgtc ctaagaaacc 4440

attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt tcgtctcgcg 4500

cgtttcggtg atgacggtga aaacctctga cacatgcagc tcccggagac ggtcacagct 4560

tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg gcgcgtcagc gggtgttggc 4620

gggtgtcggg gctggcttaa ctatgcggca tcagagcaga ttgtactgag agtgcaccat 4680

aattccgttt taagagcttg gtgagcgcta ggagtcactg ccaggtatcg tttgaacacg 4740

gcattagtca gggaagtcat aacacagtcc tttcccgcaa ttttcttttt ctattactct 4800

tggcctcctc tagtacactc tatatttttt tatgcctcgg taatgatttt catttttttt 4860

tttccaccta gcggatgact cttttttttt cttagcgatt ggcattatca cataatgaat 4920

tatacattat ataaagtaat gtgatttctt cgaagaatat actaaaaaat gagcaggcaa 4980

gataaacgaa ggcaaagatg acagagcaga aagccctagt aaagcgtatt acaaatgaaa 5040

ccaagattca gattgcgatc tctttaaagg gtggtcccct agcgatagag cactcgatct 5100

tcccagaaaa agaggcagaa gcagtagcag aacaggccac acaatcgcaa gtgattaacg 5160

tccacacagg tatagggttt ctggaccata tgatacatgc tctggccaag cattccggct 5220

ggtcgctaat cgttgagtgc attggtgact tacacataga cgaccatcac accactgaag 5280

actgcgggat tgctctcggt caagctttta aagaggccct actggcgcgt ggagtaaaaa 5340

ggtttggatc aggatttgcg cctttggatg aggcactttc cagagcggtg gtagatcttt 5400

cgaacaggcc gtacgcagtt gtcgaacttg gtttgcaaag ggagaaagta ggagatctct 5460

cttgcgagat gatcccgcat tttcttgaaa gctttgcaga ggctagcaga attaccctcc 5520

acgttgattg tctgcgaggc aagaatgatc atcaccgtag tgagagtgcg ttcaaggctc 5580

ttgcggttgc cataagagaa gccacctcgc ccaatggtac caacgatgtt ccctccacca 5640

aaggtgttct tatgtagtga caccgattat ttaaagctgc agcatacgat atatatacat 5700

gtgtatatat gtatacctat gaatgtcagt aagtatgtat acgaacagta tgatactgaa 5760

gatgacaagg taatgcatca ttctatacgt gtcattctga acgaggcgcg ctttcctttt 5820

ttctttttgc tttttctttt tttttctctt gaactcgacg gatcatatgc ggtgtgaaat 5880

accgcacaga tgcgtaagga gaaaataccg catcaggggc gcgcccctcc ttgaaac 5937

<210> 6

<211> 844

<212> DNA

<213> Artificial sequence

<400> 6

ggagaaaata ccgcatcagg atactagcgt tgaatgttag cgtcaacaac aagaagttta 60

atgacgcgga ggccaaggca aaaagattcc ttgattacgt aagggagtta gaatcatttt 120

gaataaaaaa cacgcttttt cagttcgagt ttatcattat caatactgcc atttcaaaga 180

atacgtaaat aattaatagt agtgattttc ctaactttat ttagtcaaaa aattagcctt 240

ttaattctgc tgtaacccgt acatgcccaa aatagggggc gggttacaca gaatatataa 300

catcgtaggt gtctgggtga acagtttatt cctggcatcc actaaatata atggagcccg 360

ctttttaagc tggcatccag aaaaaaaaag aatcccagca ccaaaatatt gttttcttca 420

ccaaccatca gttcataggt ccattctctt agcgcaacta cagagaacag gggcacaaac 480

aggcaaaaaa cgggcacaac ctcaatggag tgatgcaacc tgcctggagt aaatgatgac 540

acaaggcaat tgacccacgc atgtatctat ctcattttct tacaccttct attaccttct 600

gctctctctg atttggaaaa agctgaaaaa aaaggttgaa accagttccc tgaaattatt 660

cccctacttg actaataagt atataaagac ggtaggtatt gattgtaatt ctgtaaatct 720

atttcttaaa cttcttaaat tctactttta tagttagtct tttttttagt tttaaaacac 780

caagaactta gtttcgaata aacacacata aacaaacaaa atgagtaaag gagaagaact 840

tttc 844

<210> 7

<211> 474

<212> DNA

<213> Artificial sequence

<400> 7

ggagaaaata ccgcatcagg agtgatcccc cacacaccat agcttcaaaa tgtttctact 60

ccttttttac tcttccagat tttctcggac tccgcgcatc gccgtaccac ttcaaaacac 120

ccaagcacag catactaaat ttcccctctt tcttcctcta gggtgtcgtt aattacccgt 180

actaaaggtt tggaaaagaa aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg 240

caataaaaat ttttatcacg tttctttttc ttgaaaattt ttttttttga tttttttctc 300

tttcgatgac ctcccattga tatttaagtt aataaacggt cttcaatttc tcaagtttca 360

gtttcatttt tcttgttcta ttacaacttt ttttacttct tgctcattag aaagaaagca 420

tagcaatcta atctaagttt taattacaaa atgagtaaag gagaagaact tttc 474

<210> 8

<211> 232

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (178)..(183)

<223> n is a, c, g, or t

<400> 8

tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg ggcgcgcccc 60

tccttgaaac tgaaatttta gcatgtgatt aattaacttg taatattcta atcaagctta 120

taaaagagca ctgttgggcg tgagtggagg cgccggaaaa aagcatcgaa aaaatctnnn 180

nnnatgagta aaggagaaga acttttcact ggagttgtcc caattcttgt tg 232

<210> 9

<211> 6030

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (178)..(183)

<223> n is a, c, g, or t

<400> 9

tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg ggcgcgcccc 60

tccttgaaac tgaaatttta gcatgtgatt aattaacttg taatattcta atcaagctta 120

taaaagagca ctgttgggcg tgagtggagg cgccggaaaa aagcatcgaa aaaatctnnn 180

nnnatgagta aaggagaaga acttttcact ggagttgtcc caattcttgt tgaattagat 240

ggtgatgtta atgggcacaa attttctgtc agtggagagg gtgaaggtga tgcaacatac 300

ggaaaactta cccttaaatt tatttgcact actggaaaac tacctgttcc atggccaaca 360

cttgtcacta ctttctctta tggtgttcaa tgcttttcaa gatacccaga tcatatgaaa 420

cggcatgact ttttcaagag tgccatgccc gaaggttatg tacaggaaag aactatattt 480

ttcaaagatg acgggaacta caagacacgt gctgaagtca agtttgaagg tgataccctt 540

gttaatagaa tcgagttaaa aggtattgat tttaaagaag atggaaacat tcttggacac 600

aaattggaat acaactataa ctcacacaat gtatacatca tggcagacaa acaaaagaat 660

ggaatcaaag ttaacttcaa aattagacac aacattgaag atggaagcgt tcaactagca 720

gaccattatc aacaaaatac tccaattggc gatggccctg tccttttacc agacaaccat 780

tacctgtcca cacaatctgc cctttcgaaa gatcccaacg aaaagagaga ccacatggtc 840

cttcttgagt ttgtaacagc tgctgggatt acacatggca tggatgaact atacaaatag 900

caaagacgtt gtttcatcgc gctattacca agaaggttac tttacttgtt cttgcacatg 960

gacgcacgtt gtgtgttcat atatatatat atatatatat atatatattt gtgcttgttt 1020

tcattgtctc tatagttaat acattctatt tttatcgtta tatttgcatt ctcttcgcat 1080

aaaaacttca tgaaaattcg gcagaaaata agcaaattgt aaacgttaat attttgttaa 1140

aattcgcgtt aaatttttgt taaatcagct cattttttaa ccaataggcc gaaatcggca 1200

aaatccctta taaatcaaaa gaatagaccg agatagggtt gagtgttgtt ccagtttgga 1260

acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc 1320

agggcgatgg cccactacgt gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc 1380

gtaaagcact aaatcggaac cctaaaggga gcccccgatt tagagcttga cggggaaagc 1440

cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct agggcgctgg 1500

caagtgtagc ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac 1560

agggcgcgtc gcgccattcg ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc 1620

gggcctcttc gctattacgc cagctggcga aggggggatg tgctgcaagg cgattaagtt 1680

gggtaacgcc agggttttcc cagtcacgac gttgtaaaac gacggccagt gaattgtaat 1740

acgactcact atagggcgaa ttggagctcc accgcggtgg cggccgctct agaactagtg 1800

gatcccccgg gctgcaggaa ttcgatatca agcttatcga taccgtcgac ctcgaggggg 1860

ggcccggtac ccagcttttg ttccctttag tgagggttaa ttccgagctt ggcgtaatca 1920

tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatagga 1980

gccggaagca taaagtgtaa agcctggggt gcctaatgag tgaggtaact cacattaatt 2040

gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga 2100

atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc 2160

actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 2220

gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 2280

cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctcggc 2340

ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 2400

ctataaagat accaggcgtt cccccctgga agctccctcg tgcgctctcc tgttccgacc 2460

ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa 2520

tgctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 2580

cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 2640

aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 2700

gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 2760

agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 2820

ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 2880

cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 2940

tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 3000

aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 3060

tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 3120

atctgtctat ttcgttcatc catagttgcc tgactgcccg tcgtgtagat aactacgata 3180

cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 3240

gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 3300

gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 3360

tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 3420

tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 3480

tcccccatgt tgtgaaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 3540

aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 3600

atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 3660

tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 3720

catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 3780

aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 3840

tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 3900

gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 3960

tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 4020

tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgggtcc 4080

ttttcatcac gtgctataaa aataattata atttaaattt tttaatataa atatataaat 4140

taaaaataga aagtaaaaaa agaaattaaa gaaaaaatag tttttgtttt ccgaagatgt 4200

aaaagactct agggggatcg ccaacaaata ctacctttta tcttgctctt cctgctctca 4260

ggtattaatg ccgaattgtt tcatcttgtc tgtgtagaag accacacacg aaaatcctgt 4320

gattttacat tttacttatc gttaatcgaa tgtatatcta tttaatctgc ttttcttgtc 4380

taataaatat atatgtaaag tacgcttttt gttgaaattt tttaaacctt tgtttatttt 4440

tttttcttca ttccgtaact cttctacctt ctttatttac tttctaaaat ccaaatacaa 4500

aacataaaaa taaataaaca cagagtaaat tcccaaatta ttccatcatt aaaagatacg 4560

aggcgcgtgt aagttacagg caagcgatcc gtcctaagaa accattatta tcatgacatt 4620

aacctataaa aataggcgta tcacgaggcc ctttcgtctc gcgcgtttcg gtgatgacgg 4680

tgaaaacctc tgacacatgc agctcccgga gacggtcaca gcttgtctgt aagcggatgc 4740

cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt ggcgggtgtc ggggctggct 4800

taactatgcg gcatcagagc agattgtact gagagtgcac cataattccg ttttaagagc 4860

ttggtgagcg ctaggagtca ctgccaggta tcgtttgaac acggcattag tcagggaagt 4920

cataacacag tcctttcccg caattttctt tttctattac tcttggcctc ctctagtaca 4980

ctctatattt ttttatgcct cggtaatgat tttcattttt ttttttccac ctagcggatg 5040

actctttttt tttcttagcg attggcatta tcacataatg aattatacat tatataaagt 5100

aatgtgattt cttcgaagaa tatactaaaa aatgagcagg caagataaac gaaggcaaag 5160

atgacagagc agaaagccct agtaaagcgt attacaaatg aaaccaagat tcagattgcg 5220

atctctttaa agggtggtcc cctagcgata gagcactcga tcttcccaga aaaagaggca 5280

gaagcagtag cagaacaggc cacacaatcg caagtgatta acgtccacac aggtataggg 5340

tttctggacc atatgataca tgctctggcc aagcattccg gctggtcgct aatcgttgag 5400

tgcattggtg acttacacat agacgaccat cacaccactg aagactgcgg gattgctctc 5460

ggtcaagctt ttaaagaggc cctactggcg cgtggagtaa aaaggtttgg atcaggattt 5520

gcgcctttgg atgaggcact ttccagagcg gtggtagatc tttcgaacag gccgtacgca 5580

gttgtcgaac ttggtttgca aagggagaaa gtaggagatc tctcttgcga gatgatcccg 5640

cattttcttg aaagctttgc agaggctagc agaattaccc tccacgttga ttgtctgcga 5700

ggcaagaatg atcatcaccg tagtgagagt gcgttcaagg ctcttgcggt tgccataaga 5760

gaagccacct cgcccaatgg taccaacgat gttccctcca ccaaaggtgt tcttatgtag 5820

tgacaccgat tatttaaagc tgcagcatac gatatatata catgtgtata tatgtatacc 5880

tatgaatgtc agtaagtatg tatacgaaca gtatgatact gaagatgaca aggtaatgca 5940

tcattctata cgtgtcattc tgaacgaggc gcgctttcct tttttctttt tgctttttct 6000

ttttttttct cttgaactcg acggatcata 6030

<210> 10

<211> 125

<212> DNA

<213> Artificial sequence

<400> 10

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctt 120

caaca 125

<210> 11

<211> 125

<212> DNA

<213> Artificial sequence

<400> 11

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctc 120

caacc 125

<210> 12

<211> 125

<212> DNA

<213> Artificial sequence

<400> 12

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctg 120

caaag 125

<210> 13

<211> 125

<212> DNA

<213> Artificial sequence

<400> 13

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

taacc 125

<210> 14

<211> 125

<212> DNA

<213> Artificial sequence

<400> 14

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

cgaag 125

<210> 15

<211> 125

<212> DNA

<213> Artificial sequence

<400> 15

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

tctag 125

<210> 16

<211> 125

<212> DNA

<213> Artificial sequence

<400> 16

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctg 120

tcaac 125

<210> 17

<211> 125

<212> DNA

<213> Artificial sequence

<400> 17

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

ctaca 125

<210> 18

<211> 125

<212> DNA

<213> Artificial sequence

<400> 18

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctc 120

caagc 125

<210> 19

<211> 125

<212> DNA

<213> Artificial sequence

<400> 19

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctg 120

caata 125

<210> 20

<211> 125

<212> DNA

<213> Artificial sequence

<400> 20

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctt 120

cagca 125

<210> 21

<211> 125

<212> DNA

<213> Artificial sequence

<400> 21

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctc 120

accaa 125

<210> 22

<211> 125

<212> DNA

<213> Artificial sequence

<400> 22

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

tcgtc 125

<210> 23

<211> 125

<212> DNA

<213> Artificial sequence

<400> 23

cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60

tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120

ttatt 125

Claims (9)

1. The saccharomyces cerevisiae artificial promoter mutant library is obtained by randomly mutating all or part of 1 st to 6 th positions from the 3' end of a nucleotide sequence of a saccharomyces cerevisiae artificial promoter UASF-E-C-core 1.

2. The saccharomyces cerevisiae artificial promoter mutant library of claim 1, wherein: the nucleotide sequence of the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 is shown as 29-153 th site of SEQ ID No. 4.

3. The saccharomyces cerevisiae artificial promoter mutant is any one of the following mutants:

(A1) the nucleotide sequence is shown as SEQ ID No. 19;

(A2) the nucleotide sequence is shown as SEQ ID No. 13;

(A3) the nucleotide sequence is shown as SEQ ID No. 11;

(A4) the nucleotide sequence is shown as SEQ ID No. 10;

(A5) the nucleotide sequence is shown as SEQ ID No. 12;

(A6) the nucleotide sequence is shown as SEQ ID No. 14;

(A7) the nucleotide sequence is shown as SEQ ID No. 20;

(A8) the nucleotide sequence is shown as SEQ ID No. 21;

(A9) the nucleotide sequence is shown as SEQ ID No. 16;

(A10) the nucleotide sequence is shown as SEQ ID No. 18;

(A11) the nucleotide sequence is shown as SEQ ID No. 15;

(A12) the nucleotide sequence is shown as SEQ ID No. 17;

(A13) the nucleotide sequence is shown as SEQ ID No. 22;

(A14) the nucleotide sequence is shown as SEQ ID No. 23.

4. The use of the Saccharomyces cerevisiae artificial promoter mutant of claim 3 to promote the expression of a gene of interest in Saccharomyces cerevisiae.

5. The use of the Saccharomyces cerevisiae artificial promoter mutant of claim 3 for increasing the expression level of a target gene in Saccharomyces cerevisiae.

6. The expression cassette containing the saccharomyces cerevisiae artificial promoter mutant as claimed in claim 3, which consists of the saccharomyces cerevisiae artificial promoter mutant, a target gene and a terminator which are connected in sequence.

7. A recombinant vector comprising the expression cassette of claim 6.

8. A recombinant Saccharomyces cerevisiae containing the recombinant vector of claim 7.

9. Use of the saccharomyces cerevisiae artificial promoter mutant library according to claim 1 or 2 or the saccharomyces cerevisiae artificial promoter mutant according to claim 3 or the expression cassette according to claim 6 or the recombinant vector according to claim 7 or the recombinant saccharomyces cerevisiae according to claim 8 for gene expression regulation of a metabolic pathway of saccharomyces cerevisiae.

Images