CN114958985A - Multiplex PCR method, primer probe combination and kit for detecting PCM1-JAK2 fusion gene - Google Patents
Multiplex PCR method, primer probe combination and kit for detecting PCM1-JAK2 fusion gene Download PDFInfo
- Publication number
- CN114958985A CN114958985A CN202210494641.1A CN202210494641A CN114958985A CN 114958985 A CN114958985 A CN 114958985A CN 202210494641 A CN202210494641 A CN 202210494641A CN 114958985 A CN114958985 A CN 114958985A
- Authority
- CN
- China
- Prior art keywords
- pcm1
- jak2
- primer
- probe
- fusion gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 239000000523 sample Substances 0.000 title claims abstract description 178
- 230000004927 fusion Effects 0.000 title claims abstract description 120
- 238000000034 method Methods 0.000 title claims abstract description 26
- 238000007403 mPCR Methods 0.000 title claims abstract description 14
- 108090000623 proteins and genes Proteins 0.000 title claims description 98
- 238000001514 detection method Methods 0.000 claims abstract description 38
- 230000003321 amplification Effects 0.000 claims abstract description 24
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 24
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 20
- 210000004698 lymphocyte Anatomy 0.000 claims abstract description 6
- 238000000926 separation method Methods 0.000 claims abstract description 6
- 239000013612 plasmid Substances 0.000 claims description 48
- 238000006243 chemical reaction Methods 0.000 claims description 23
- 239000002299 complementary DNA Substances 0.000 claims description 22
- 230000014509 gene expression Effects 0.000 claims description 18
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 10
- 238000012408 PCR amplification Methods 0.000 claims description 9
- 239000013642 negative control Substances 0.000 claims description 9
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 claims description 8
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 claims description 8
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 claims description 8
- 239000013641 positive control Substances 0.000 claims description 6
- 210000001185 bone marrow Anatomy 0.000 claims description 5
- 239000002773 nucleotide Substances 0.000 claims description 5
- 125000003729 nucleotide group Chemical group 0.000 claims description 5
- 210000004369 blood Anatomy 0.000 claims description 4
- 239000008280 blood Substances 0.000 claims description 4
- 108700039887 Essential Genes Proteins 0.000 claims description 3
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 3
- 239000008367 deionised water Substances 0.000 claims description 3
- 229910021641 deionized water Inorganic materials 0.000 claims description 3
- 239000003550 marker Substances 0.000 claims description 3
- 238000005516 engineering process Methods 0.000 abstract description 4
- 239000012295 chemical reaction liquid Substances 0.000 abstract 1
- 239000007788 liquid Substances 0.000 abstract 1
- 108700026220 vif Genes Proteins 0.000 abstract 1
- 238000002474 experimental method Methods 0.000 description 97
- 239000000243 solution Substances 0.000 description 45
- 108020004414 DNA Proteins 0.000 description 17
- 238000010839 reverse transcription Methods 0.000 description 10
- 230000035945 sensitivity Effects 0.000 description 9
- 238000012360 testing method Methods 0.000 description 7
- 102000042838 JAK family Human genes 0.000 description 6
- 108091082332 JAK family Proteins 0.000 description 6
- 238000012163 sequencing technique Methods 0.000 description 5
- 108700024394 Exon Proteins 0.000 description 4
- 238000001962 electrophoresis Methods 0.000 description 4
- 238000002156 mixing Methods 0.000 description 4
- 239000002244 precipitate Substances 0.000 description 4
- 239000006228 supernatant Substances 0.000 description 4
- 239000007795 chemical reaction product Substances 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 238000002360 preparation method Methods 0.000 description 3
- 239000000047 product Substances 0.000 description 3
- 238000003757 reverse transcription PCR Methods 0.000 description 3
- 101000581507 Homo sapiens Methyl-CpG-binding domain protein 1 Proteins 0.000 description 2
- 101001134861 Homo sapiens Pericentriolar material 1 protein Proteins 0.000 description 2
- 101000997832 Homo sapiens Tyrosine-protein kinase JAK2 Proteins 0.000 description 2
- 102100027383 Methyl-CpG-binding domain protein 1 Human genes 0.000 description 2
- 108091034117 Oligonucleotide Proteins 0.000 description 2
- 239000013614 RNA sample Substances 0.000 description 2
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 2
- 102100033444 Tyrosine-protein kinase JAK2 Human genes 0.000 description 2
- JLCPHMBAVCMARE-UHFFFAOYSA-N [3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-hydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methyl [5-(6-aminopurin-9-yl)-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate Polymers Cc1cn(C2CC(OP(O)(=O)OCC3OC(CC3OP(O)(=O)OCC3OC(CC3O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c3nc(N)[nH]c4=O)C(COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3CO)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cc(C)c(=O)[nH]c3=O)n3cc(C)c(=O)[nH]c3=O)n3ccc(N)nc3=O)n3cc(C)c(=O)[nH]c3=O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)O2)c(=O)[nH]c1=O JLCPHMBAVCMARE-UHFFFAOYSA-N 0.000 description 2
- 239000006285 cell suspension Substances 0.000 description 2
- 239000012530 fluid Substances 0.000 description 2
- 239000002504 physiological saline solution Substances 0.000 description 2
- 238000005406 washing Methods 0.000 description 2
- 102000053602 DNA Human genes 0.000 description 1
- 206010066476 Haematological malignancy Diseases 0.000 description 1
- 208000002250 Hematologic Neoplasms Diseases 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 108020004682 Single-Stranded DNA Proteins 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 238000007664 blowing Methods 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 238000003776 cleavage reaction Methods 0.000 description 1
- 238000012790 confirmation Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 238000001035 drying Methods 0.000 description 1
- 239000007850 fluorescent dye Substances 0.000 description 1
- 238000001215 fluorescent labelling Methods 0.000 description 1
- 210000000265 leukocyte Anatomy 0.000 description 1
- 230000036210 malignancy Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 210000005087 mononuclear cell Anatomy 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 239000011541 reaction mixture Substances 0.000 description 1
- 230000007017 scission Effects 0.000 description 1
- 239000013049 sediment Substances 0.000 description 1
- 238000003756 stirring Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biomedicine, and provides a multiplex PCR method for detecting PCM1-JAK2 fusion genes, a primer probe combination and a kit, wherein the primer probe combination comprises a primer probe combination A1 and a primer probe combination A2: the primer Probe combination A1 comprises an upstream primer PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F, a downstream primer JAK2-E9-R, JAK2-E12-R and a Probe JAK2-E9-Probe, JAK2-E12-Probe, a primer Probe combination A2 comprises an upstream primer PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F, a downstream primer JAK2-E11-R and a Probe JAK2-E11-Probe, the kit comprises a detection system PCR reaction liquid and a lymphocyte separation liquid, and by dividing the primer probes into two combinations, various fusion modes are covered to the maximum extent, the number of the primers is reduced, mutual interference is prevented, the primer probe combination designed by the invention can simultaneously detect a known fusion mode and a possible unknown fusion mode, can simultaneously detect various fusion modes and reduce the detection cost; the multiple PCR technology based on the Taqman probe is adopted, so that the specificity of detection and amplification is ensured.
Description
Technical Field
The invention relates to the technical field of biomedicine, in particular to a multiplex PCR method, a primer probe combination and a kit for detecting PCM1-JAK2 fusion genes. The PCM1-JAK2 fusion gene detected by the invention comprises: PCM1-26/AK2-9, PCM1-28/JAK2-9, PCM1-30/JAK2-9, PCM1-36/JAK2-9, PCM1-29/JAK2-11, PCM1-36/JAK2-11 or PCM1-23/JAK 2-12.
Background
PCM1-JAK2 was produced ectopically from t (8; 9) (p 22; p24), and was first identified in 2005 as a hematological malignancy-associated fusion gene that was present in both myeloid and lymphoid malignancies. Both PCM1 and JAK2 have multiple cleavage sites, and 7 PCM1-JAK2 fusion modes have been reported: E26-E9, E28-E9, E30-E9, E36-E9, E29-E11, E36-E11 and E23-E12 (the literature reports that there are more fusion modes according to the difference of reference transcripts, but after the confirmation of the same transcript (PCM1: NM-006197.4, JAK2: NM-004972.4), the fusion modes are 7 types above).
In the prior art, for example, Chinese patent with application number CN discloses a method, a kit and oligonucleotides for detecting the relative expression quantity of PCM-JAK, wherein the oligonucleotides comprise an upstream primer PCM-JAK-E/E-F for detection, a downstream primer PCM-JAK-E/E-JAK-E-R, a Probe PCM-E-Probe and a Probe PCM-E-Probe, and can detect three PCM-JAK fusion genes, namely PCM-JAK (E/E), PCM-JAK (E/E) or PCM-JAK (E/E).
In the prior art, as disclosed in Chinese invention patent with application number 202011373790.X, a primer probe combination and a kit for detecting Ph-like ALL fusion genes are disclosed, wherein the primer probe combination for detecting Ph-like ALL fusion genes comprises 42 single-stranded DNAs shown in sequences 1-42 in a sequence table and TaqMan probes 1-13; the sequence of the TaqMan probes 1-13 is 43-55 in the sequence table in sequence, and the TaqMan probes cannot detect
PCM1-JAK2(E28/E9), PCM1-JAK2(E29/E11), PCM1-JAK2(E23/E12)23-12 three PCM1-JAK2 fusion genes.
Because PCM1-JAK2 fusion modes are various, the detection range in the prior art cannot cover all PCM1-JAK2 fusion modes, detection omission often occurs in clinic, multiple independent detections are needed for comprehensive detection, the detection efficiency is low, and the economic burden of patients and hospitals is heavy.
Disclosure of Invention
Aiming at the defects and the actual requirements of detecting the PCM1-JAK2 fusion gene in the prior art, the invention provides a multiplex PCR method, a primer probe combination and a kit for detecting the PCM1-JAK2 fusion gene. The invention designs primers, probe sequences and combinations thereof for detecting internal reference/target genes, adopts multiple PCR technology to simultaneously detect a plurality of PCM1-JAK2 fusion genes, optimizes a PCR reaction system and reaction conditions by adjusting the concentration and proportion of the primers and the probes, so that the amplification efficiency and the amplification rate are both optimal, and the detection range covers the disclosed 7 PCM1-JAK2 fusion modes.
The invention provides a primer probe combination for detecting PCM1-JAK2 fusion genes, which comprises a primer probe combination A1 and a primer probe combination A2:
the primer Probe combination A1 comprises an upstream primer PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F, a downstream primer JAK2-E9-R, JAK2-E12-R, a Probe JAK2-E9-Probe and a Probe JAK2-E12-Probe, wherein the base sequences of the primer Probe combination A1 are shown as follows:
PCM1-E23-F：CCAGCCTGGCATCTAAAGATA
PCM1-E26-F：CTAGTGAGAGCCTTGCTACTAC
PCM1-E28-F：CTGGTGCAGGTACTACAGTT
PCM1-E30-F：TGATGAGAGCAAAGAGTTTGTAAAG
PCM1-E36-F：GCTGGAAGTCCTGATACTGA
JAK2-E9-R：ATGTGCATCTGCAGTTAATCTATAA
JAK2-E12-R：TGTTGGTGAGGTTGGTACATC
JAK2-E9-Probe：FAM-CCATCAATTAATGACACGAAAGACA-MGB
JAK2-E12-Probe：HEX-ACACCATTCGTTCTGAAGACTAGA-MGB
the primer Probe combination A2 comprises an upstream primer PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F, a downstream primer JAK2-E11-R and a Probe JAK2-E11-Probe, and the base sequences of the primers are shown as follows:
PCM1-E23-F：CCAGCCTGGCATCTAAAGATA
PCM1-E26-F：CTAGTGAGAGCCTTGCTACTAC
PCM1-E28-F：CTGGTGCAGGTACTACAGTT
PCM1-E30-F：TGATGAGAGCAAAGAGTTTGTAAAG
PCM1-E36-F：GCTGGAAGTCCTGATACTGA
JAK2-E11-R：GAACAGTTTCCATCTGGTAACAAT
JAK2-E11-Probe：JOE-CACTGAGGTTGTACTCTTCATTCT-MGB
furthermore, the 3 'end of each probe in the primer probe combination for detecting the PCM1-JAK2 fusion gene is marked with MGB, and the 5' end of each probe is marked with FAM, JOE or HEX.
Further, the PCM1-JAK2 fusion gene is selected from PCM1-26/AK2-9, PCM1-28/JAK2-9, PCM1-30/JAK2-9, PCM1-36/JAK2-9, PCM1-29/JAK2-11, PCM1-36/JAK2-11 or PCM1-23/JAK 2-12.
Further, primers and probes for amplifying the housekeeping gene Abl as an internal reference are included, and the nucleotide sequences are as follows:
Abl-F：TGGAGATAACACTCTAAGCATAACTAAAGGT
Abl-R：GATGTAGTTGCTTGGGACCCA
Abl-Probe：FAM-CCATTTTTGGTTTGGGCTTCACACCATT-TAM。
a kit for detecting a PCM1-JAK2 fusion gene, the kit comprising a detection system PCR reaction solution, the detection system PCR reaction solution comprising the primer probe combination a1 and the primer probe combination a2 of claim 1;
the detection system PCR reaction solution also comprises a gene expression premix solution, a primer of an internal reference gene Abl and a probe.
Further, the kit also comprises a lymphocyte separation solution.
Further, the kit also comprises a sample RNA extracting solution, wherein the sample RNA extracting solution comprises TRIzol, chloroform, isopropanol, 75% ethanol and DEPC water.
Further, the kit also comprises a positive control, a negative control and a blank control, wherein the positive control is a plasmid solution containing a cDNA sequence of the PCM1-JAK2 fusion gene, the negative control is a plasmid solution not containing the cDNA sequence of the PCM1-JAK2 fusion gene, and the blank control is deionized water.
Further, the PCM1-JAK2 fusion gene is selected from PCM1-26/JAK2-9, PCM1-28/JAK2-9, PCM1-30/JAK2-9, PCM1-36/JAK2-9, PCM1-29/JAK2-11, PCM1-36/JAK2-11 or PCM1-23/JAK 2-12.
Further, the detected concentration of the PCM1-26/JAK2-9 and the PCM1-28/JAK2-9 is at least 3copise/ul, the detected concentration of the PCM1-30/JAK2-9, the PCM1-36/JAK2-9, the PCM1-36/JAK2-11 and the PCM1-23/JAK2-12 is at least 30copise/ul, and the detected concentration of the PCM1-29/JAK2-11 is at least 303 copise/ul.
A multiplex PCR method for detecting PCM1-JAK2 fusion gene comprises the following steps:
s1 extracting RNA from bone marrow blood sample, and reverse transcribing the RNA into cDNA sample;
s2, carrying out PCR amplification, and obtaining a specific amplification product by using a multiple fluorescence PCR method; PCR amplification conditions were 50 ℃ for 2min, 95 ℃ for 10min, 95 ℃ for 15s, and 60 ℃ for 1min (40 cycles of collecting fluorescence signals at 60 ℃);
and interpretation of S3 result:
s3-1, setting the average fluorescence signal of 3-15 cycles as a baseline;
s3-2, analyzing the fluorescent PCR result by using software, wherein the CT value is more than 37 or the non-fluorescent PCR amplification curve is negative, and the CT value is less than 35, and the result is positive; the suspected positive is that the CT value is more than or equal to 35 and less than or equal to 37;
s3-3, taking the suspected positive specimen after PCR reaction in 10ulS3-2, carrying out 2.5% agarose gel electrophoresis, and comparing with the molecular weight marker of cDNA under an ultraviolet lamp to obtain a positive or negative result. .
The invention has the advantages that:
1) the invention designs primers and probes according to the known fusion mode of PCM1-JAK2 fusion gene, considers the possibility of other unknown fusion modes, respectively selects primers designed at 9, 11 and 12 exons by analyzing the base sequence of PCM1-JAK2 fusion gene, respectively shares downstream primers JAK2-E9-R, JAK2-E11-R, JAK2-E12-R with upstream primers PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F, respectively selects probes JAK2-E9-Probe, JAK2-E11-Probe and JAK2-E12-Probe, and divides the primer and Probe into two combinations, so as to cover various fusion modes to the maximum extent, reduce the number of primers and prevent mutual interference Formula (II) is shown.
2) The kit for detecting the PCM1-JAK2 fusion gene adopts a multiple PCR technology based on a Taqman probe, the specificity of detection and amplification is ensured, the positive sample obtained by the method is detected, the sample is determined to be one of exons JAK2-E9, JAK2-E11 or JAK2-E12, in order to determine a specific fusion mode, the corresponding type of fusion gene is detected through a duct, the specific type is further determined, and the reverse sequencing result of the positive sample indicates that the positive sample is determined to be the PCM1-JAK2(E36-E11) fusion mode.
3) The multiplex PCR method for detecting the PCM1-JAK2 fusion gene is simple to operate, can detect various fusion modes simultaneously, reduces the detection cost, judges a large class by positive judgment, then carries out sub-tube detection for type determination, avoids the complexity of single type detection, and can be directly judged as a non-PCM 1-JAK2 fusion gene case if the type is negative.
Drawings
FIG. 1 is a graph showing the amplification of PCM1-JAK2(E26-E9) positive plasmid solution;
FIG. 2 is a graph showing the amplification of PCM1-JAK2(E28-E9/E10/E11) positive plasmid solution;
FIG. 3 is a graph showing the amplification of PCM1-JAK2(E29/30-E9) positive plasmid solution;
FIG. 4 is a graph showing the amplification of PCM1-JAK2(E36-E9/E10/E11) positive plasmid solution;
FIG. 5 is a graph showing the amplification of PCM1-JAK2(E28/E29-E11/E12) positive plasmid solution;
FIG. 6 is a graph showing the amplification of PCM1-JAK2(E36-E11/12) positive plasmid solution;
FIG. 7 is a graph of the amplification of PCM1-JAK2(E23-E12) positive plasmid solution;
FIG. 8 is a graph of positive patient (PCM1-JKA2(E36-E11)) amplification;
FIG. 9 shows the sequencing results of PCM1-JAK2(E23-E12) positive patients;
FIG. 10 shows the results of electrophoresis of single-primer and multi-primer experimental groups in anti-interference experiments;
FIG. 11 shows the results of electrophoresis of the multiple primers and primer combination experimental group in the anti-interference experiment.
Description of reference numerals:
10. set B of standards; 11. a first single primer panel B; 12. a first multi-primer panel B; 21. a first single primer panel B; 22. a second multi-primer panel B; 31. a third single primer panel B; 32 third multiple primer panel B; 41. a fourth single primer panel B; 42 fourth multiple primer panel B; 51 fifth experiment B comprises a fifth single primer experimental set; 52. a fifth multi-primer panel B; 61. a sixth single primer panel B; 62. a sixth multi-primer panel B; 71. a seventh single primer panel B; 72. a seventh multi-primer panel B; 111. a first multi-primer panel C; 121. first primer combination a1 panel C; 211. a second multi-primer panel; 221. second primer combination a1 panel C221; 311 third multiple primer panel C; 321 third primer combination A1 panel C; 411. a fourth multi-primer panel C; 421 fourth primer combination a1 panel C; 711. a seventh multiple primer panel C; 721. seventh primer combination a1 panel C; 511. a fifth multi-primer panel C; 521 fifth primer combination A2 panel C; 611, sixth multiple primer panel C; 621 sixth primer combination a2 panel C; 100. standard set C.
Detailed Description
The present invention is described in further detail, and the examples are given only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.
Example 1 primer Probe combination for detecting PCM1-JAK2 fusion Gene
A primer probe combination for detecting PCM1-JAK2 fusion genes comprises a primer probe combination A1 for detecting PCM1-JAK2 fusion genes and a primer probe combination A2 for detecting PCM1-JAK2 fusion genes:
the primer Probe combination A1 for detecting the PCM1-JAK2 fusion gene comprises an upstream primer PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F, a downstream primer JAK2-E9-R, JAK2-E12-R, a Probe JAK2-E9-Probe and a Probe JAK2-E12-Probe, and is used for detecting the base sequences as shown in the following:
PCM1-E23-F：CCAGCCTGGCATCTAAAGATA
PCM1-E26-F：CTAGTGAGAGCCTTGCTACTAC
PCM1-E28-F：CTGGTGCAGGTACTACAGTT
PCM1-E30-F：TGATGAGAGCAAAGAGTTTGTAAAG
PCM1-E36-F：GCTGGAAGTCCTGATACTGA
JAK2-E9-R：ATGTGCATCTGCAGTTAATCTATAA
JAK2-E12-R：TGTTGGTGAGGTTGGTACATC
JAK2-E9-Probe：FAM-CCATCAATTAATGACACGAAAGACA-MGB
JAK2-E12-Probe：HEX-ACACCATTCGTTCTGAAGACTAGA-MGB。
the primer Probe combination A2 for detecting the PCM1-JAK2 fusion gene comprises an upstream primer PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F, a downstream primer JAK2-E11-R and a Probe JAK2-E11-Probe, and the base sequences of the primer Probe and the Probe are shown as follows:
PCM1-E23-F：CCAGCCTGGCATCTAAAGATA
PCM1-E26-F：CTAGTGAGAGCCTTGCTACTAC
PCM1-E28-F：CTGGTGCAGGTACTACAGTT
PCM1-E30-F：TGATGAGAGCAAAGAGTTTGTAAAG
PCM1-E36-F：GCTGGAAGTCCTGATACTGA
JAK2-E11-R：GAACAGTTTCCATCTGGTAACAAT
JAK2-E11-Probe：JOE-CACTGAGGTTGTACTCTTCATTCT-MGB
the 3 'end of each probe in the primer probe combination for detecting the PCM1-JAK2 fusion gene is marked with MGB, and the 5' end is marked with FAM, JOE or HEX.
The PCM1-JAK2 fusion gene is selected from 7 currently reported PCM1-JAK2 fusion modes: PCM1-26/JAK2-9, PCM1-28/JAK2-9, PCM1-30/JAK2-9, PCM1-36/JAK2-9, PCM1-29/JAK2-11, PCM1-36/JAK2-11 or PCM1-23/JAK 2-12.
The primer probe combination also comprises a primer and a probe for amplifying housekeeping gene Abl serving as an internal reference, which are used for reflecting the quality of cDNA (complementary deoxyribonucleic acid) of a sample specimen, and the nucleotide sequence of the primer probe combination is as follows:
Abl-F：TGGAGATAACACTCTAAGCATAACTAAAGGT
Abl-R：GATGTAGTTGCTTGGGACCCA
Abl-Probe：FAM-CCATTTTTGGTTTGGGCTTCACACCATT-TAM。
in the primer probe combination, when the number of the upstream primers is larger than 1, the number of the moles of the upstream primers is equal, when the number of the downstream primers is larger than 1, the number of the moles of the downstream primers is equal, when the number of the probes is larger than 1, the number of the moles of the probes is equal, meanwhile, the molar ratio of each upstream primer, each downstream primer and each probe is 2:2:1, and each probe is a TaqMan probe.
Example 2 kit for detecting PCM1-JAK2 fusion gene using the primer probe combination
The kit provided by the embodiment comprises a detection system PCR reaction solution, a lymphocyte separation solution, a sample RNA extracting solution and an RNA reverse transcription reagent; the lymphocyte separation fluid selects Biosharp brand (cargo number: BL 590; specification: 200 ml/bottle); the sample RNA extract comprises TRIzol, chloroform, isopropanol, 75% ethanol and DEPC water; the RNA reverse transcription reagent is selected from the best brand (cat # EN 001; specification: 20 test/kit).
The detection system PCR reaction solution comprises a primer probe combination A1, a primer probe combination A2, a gene expression premix solution, a primer and a probe of an internal reference gene Abl in the embodiment 1, wherein:
Abl-F：TGGAGATAACACTCTAAGCATAACTAAAGGT
Abl-R：GATGTAGTTGCTTGGGACCCA
Abl-Probe：FAM-CCATTTTTGGTTTGGGCTTCACACCATT-TAM。
the gene expression premix is a premix for using the probe sequence specific fluorescence labeling detection system described in the present application, and in this embodiment, the gene expression premix is prepared by selecting TaqMan TM Gene expression premix, Applied Biosystems brand (cat # 4369016; specification: 5 ml/vial).
Taking 20ul reaction system as an example, the configuration of each PCR reaction system is as follows:
reaction solution 1: TaqMan TM 10ul of the premixed solution for gene expression, 1ul of each of the upstream primers PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F, 1ul of each of the downstream primers JAK2-E9-R, JAK2-E12-R, 0.5ul of each of the probes JAK2-E9-Probe and JAK2-E12-Probe, and 2ul of the reverse transcription-polymerase chain reaction product in the primer Probe combination A1.
Reaction solution 2: TaqMan TM 10ul of gene expression premixed solution, 1ul of each upstream primer PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F in the primer probe combination A2, 1ul of downstream primer JAK 2-E11-R1 ul, probe JAK2-E11-Probe0.5ul, 1.5ul of DEPC water and 2ul of reverse transcription-polymerase chain reaction product.
Reaction solution 3: TaqMan TM 10ul of gene expression premixed solution, upstream primer Abl-F1 ul, downstream primer Abl-R1 ul, Probe Abl-Probe 0.4ul, DEPC water 5.6ul and reverse transcription-polymerase chain reaction product 2 ul.
Positive control: plasmid solution containing cDNA sequence of PCM1-JAK2 fusion gene
Negative control: plasmid solution without PCM1-JAK2 fusion gene cDNA sequence
Blank control: deionized water.
The PCM1-JAK2 fusion gene is selected from PCM1-26/AK2-9, PCM1-28/JAK2-9, PCM1-30/JAK2-9, PCM1-36/JAK2-9, PCM1-29/JAK2-11, PCM1-36/JAK2-11 or PCM1-23/JAK2-12
The kit for detecting the PCM1-JAK2 fusion gene adopts a multiple PCR technology based on a Taqman probe, the specificity of detection and amplification is ensured, the positive sample obtained by the method is detected to be determined to be one of exons JAK2-E9, JAK2-E11 or JAK2-E12, in order to determine a specific fusion mode, the corresponding type of fusion gene is detected through a pipeline to further determine the specific type, and the reverse sequencing result of the positive sample indicates that the positive sample is determined to be a PCM1-JAK2(E36-E11) fusion mode.
Example 3 multiplex PCR method for detecting PCM1-JAK2 fusion Gene Using the above kit
S1 extracting RNA from bone marrow blood sample, preparing cDNA sample through reverse transcription;
s1-1 sample preparation
Preparing a 15mL centrifuge tube, adding 5mL of anticoagulated bone marrow blood, and a lymphocyte separation fluid with the same volume as the sample, and centrifuging at 4 ℃ and 2000rpm for 15 min; preparing a 15mL centrifuge tube, adding 5-7mL of sterile physiological saline, sucking the sample mononuclear cell layer subjected to centrifugation in the previous step into the centrifuge tube of the sterile physiological saline, centrifuging at 4 ℃ for 10min at 2000 rp; discarding the supernatant, adding 5-7ml sterile normal saline, fully washing the leukocyte precipitate, and centrifuging at 4 deg.C and 2000rpm for 5 min; carefully abandoning the supernatant, remaining a proper amount of normal saline, blowing and stirring the cell sediment uniformly by using a pipette, sucking the cell suspension after uniform mixing into a corresponding 1.5ml EP tube, wherein the sample for extracting RNA is sucked into a 1.5ml EP tube filled with TRIZOL.
Preparation of S1-2 nucleic acid
Mixing 1.5ml of EP tube added with cell suspension in S1-1, adding 200 mul of chloroform, mixing, centrifuging at 12000rpm at 4 ℃ for 15min, sucking upper water phase, adding into 1.5ml of EP tube filled with isopropanol, centrifuging at 12000rpm at 4 ℃ for 10min, discarding supernatant, adding 500 mul of 75% ethanol, washing RNA precipitate gently, centrifuging at 12000rpm at 4 ℃ for 5min, discarding supernatant, drying at room temperature for 5-8 min, adding appropriate amount of DEPC water (determined according to the size of RNA precipitate), dissolving RNA precipitate sufficiently, mixing RNA samples, measuring the concentration and ratio of RNA samples by using nanodrop2000, wherein the ratio of RNA 260/280 is close to 2.0. The concentration of the RNA is uniformly diluted to 300 ng/. mu.L, the sample with the concentration of more than 3000 ng/. mu.L needs to be sucked out and then diluted, and the treated RNA is stored in a refrigerator at the temperature of-20 ℃ and is prepared for RNA reverse transcription experiments.
Reverse transcription of S1-3 RNA
RNA reverse transcription experiments were performed using the RNA extracted in S1-2 as a template and a reverse transcription kit, and the reverse transcription system is shown in Table 1.
TABLE 1 reverse transcription System
S2 using cDNA sample obtained by reverse transcription of S1 as template, carrying out PCR amplification by using the primer probe combination in the embodiment 1, and obtaining a specific amplification product by using a multiplex PCR method; PCR amplification conditions were 50 ℃ for 2min, 95 ℃ for 10min, 95 ℃ for 15s, and 60 ℃ for 1min (40 cycles of collecting fluorescence signals at 60 ℃);
PCR extension reaction System PCR reaction systems were prepared respectively using the preparation ratios of reaction solution 1, reaction solution 2, and reaction solution 3 in example 2.
And (S3) interpretation of results:
s3-1, setting the average fluorescence signal of 3-15 cycles as a baseline, setting the threshold value as the highest point of a sample without an amplification curve (noise line) under the condition that the negative control has no amplification, and determining the initial threshold value on the basis that the negative control has not been detected;
s3-2 the validity of the PCR results of reaction mixtures 1, 2 and 3 in S2 was determined, and the version of the analysis software used was: 7500Software v 2.3. The judgment standard is shown in the table 2, when the internal reference Abl is positive, the detection result is considered to be effective, and when the result is suspected to be positive, the verification is required again;
TABLE 2 validity decision thresholds
S3-3A positive or negative result is obtained by performing 2.5% agarose gel electrophoresis on a sample suspected to be positive in 10ul of S3-2, and comparing the sample with the molecular weight marker of cDNA under an ultraviolet lamp.
The multiplex PCR method for detecting the PCM1-JAK2 fusion gene is simple to operate, can detect various fusion modes simultaneously, reduces the detection cost, judges a large class by positive judgment, then carries out sub-tube detection for type determination, avoids the complexity of single type detection, and can be directly judged as a non-PCM 1-JAK2 fusion gene case if the type is negative.
Example 4 detection of clinical samples from a patient population with positive expression of non-PCM 1-JAK2 fusion genes
20 bone marrow specimens of patients with positive expression of non-PCM 1-JAK2 fusion genes were randomly selected, and the expression level of the PCM1-JAK2 fusion gene was detected by the multiplex PCR method described in example 3 above.
And (3) carrying out positive, negative and blank control experiments on each sample in the detection process. Each sample was repeated 2 times, one positive control, one negative control and one blank control, and the results are shown in Table 3.
TABLE 320 expression levels of PCM1-JAK2 fusion genes in non-PCM 1-JAK2 fusion gene expression positive samples
The results of the internal reference genes of 20 samples shown in Table 3 are positive, which reflects that the quality of the samples is qualified, but the detection results of the PCM1-JAK2 fusion gene of the 20 samples are negative, and the primer probe combination for detecting the PCM1-JAK2 fusion gene has analysis specificity for detecting the PCM1-JAK2 fusion gene.
EXAMPLE 5 Positive plasmid sensitivity detection
Selecting a PCM1-JAK2 fusion gene positive plasmid solution:
(1) PCM1-JAK2(E26-E9) positive plasmid solution, positive plasmid containing (PCM1-JAK2(E26-E9) fusion gene cDNA sequence;
(2) PCM1-JAK2(E28-E9/10/11) positive plasmid solution, positive plasmid containing PCM1-JAK2(E28-E9/10/11) fusion gene cDNA sequence;
(3) PCM1-JAK2(E29/30-E9) positive plasmid solution, positive plasmid containing PCM1-JAK2(E29/30-E9) fusion gene cDNA sequence;
(4) PCM1-JAK2(E36-E9) positive plasmid solution, positive plasmid containing PCM1-JAK2(E36-E9) fusion gene cDNA sequence;
(5) the PCM1-JAK2(E28/29-E11/12) positive plasmid solution contains a positive plasmid of a cDNA sequence of a PCM1-JAK2(E28/29-E11/12) fusion gene;
(6) PCM1-JAK2(E36-E11/12) positive plasmid solution, positive plasmid containing PCM1-JAK2(E36-E11/12) fusion gene cDNA sequence;
(7) PCM1-JAK2(E23-E12) positive plasmid solution, positive plasmid containing PCM1-JAK2(E23-E12) fusion gene cDNA sequence;
the expression level of the PCM1-JAK2 fusion gene was detected by the multiplex PCR method in example 3 for the above 7 positive plasmid solutions.
2ul of each positive plasmid solution is added into a PCR reaction system, and internal reference and blank control experiments are simultaneously carried out, wherein one part of each standard curve of the internal reference gene is used. The amplification curves of the 7 positive plasmid solutions are shown in FIGS. 1-7, respectively.
10 portions of the positive plasmid solution are respectively added -5 、10 -6 、10 -7 、10 -8 The dilution was carried out in a gradient, corresponding to the respective copy number: 303, 30, 3 and 0.3copise/ul, and the expression level of the PCM1-JAK2 fusion gene is detected by using the positive plasmid solution diluted by each gradient as a template, and each concentration is repeated for 3 times, and the detection results are shown in tables 4 to 10.
TABLE 4 PCM1-JAK2(E26-E9) positive plasmid sensitivity test results
TABLE 5 detection results of the sensitivity of PCM1-JAK2(E28-E9/10/11) positive plasmids
TABLE 6 detection results of PCM1-JAK2(E29/30-E9) positive plasmid sensitivity
TABLE 7 PCM1-JAK2(E36-E9) positive plasmid sensitivity test results
TABLE 8 detection results of sensitivity for PCM1-JAK2(E28/29-E11/12) positive plasmids
TABLE 9 PCM1-JAK2(E36-E11/12) positive plasmid sensitivity test results
TABLE 10 PCM1-JAK2(E23-E12) positive plasmid sensitivity test results
As shown in Table 4-Table 10, the present inventors demonstrated that the sensitivity of the present invention to fusion genes PCM1-JAK2(E26-E9), PCM1-JAK2(E28-E9/10/11), PCM1-JAK2 (E29/30-E29), PCM 29-JAK 29 (E29/29-E29/12), PCM 29-JAK 29 (E29-E29/JAK 12), PCM 29-JAK 29 (E29-E29) was 3copise/ul, 30copise/ul, 303copise/ul, 30copise/ul, and 30copise/ul, respectively, and that the present examples of the present invention show that the primer combinations for detecting PCM 29-29 gene fusion were found in the present invention (PCM 29-JAK 29-E29), and the present examples show that the present invention also include PCM 29-JAK 29 (E29/29-E29) Seven fusion modes of PCM1-JAK2(E36-E9), PCM1-JAK2(E28/29-E11/12), PCM1-JAK2(E36-E11/12) and PCM1-JAK2(E23-E12) can be detected.
Example 6 clinical sample PCM1-JAK2 fusion Gene assay results
Referring to FIGS. 1-8, 1 clinical positive case was selected and the detection of the PCM1-JAK2 fusion gene was performed by the method described in example 3. And simultaneously, performing positive plasmid control, negative control, blank control, reference gene detection and one part of standard curve of the target PCM1-JAK2 fusion gene. The test results are shown in Table 11 below, and the Abl was positive in the clinical positive sample test process.
Referring to FIG. 9, the results of the clinical positive samples were subjected to gene sequencing by the first-generation sequencing (reverse) method, and the results are shown in FIG. 9 and analyzed as the PCM1-JAK2(E36-E11) fusion mode in the PCM1-JAK2 fusion gene.
TABLE 11 expression levels of the PCM1-JAK2 fusion gene in clinical samples
EXAMPLE 7 anti-interference experiment with combination of primer and Probe
According to the known fusion mode of PCM1-JAK2 fusion gene, primers and probes are designed, and other unknown fusion modes are considered, and by analyzing the base sequence of PCM1-JAK2 fusion gene, primers are selected from exons 9, 11 and 12, an upstream primer (PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F) and a downstream primer (JAK2-E9-R, JAK2-E11-R, JAK2-E12-R) are selected, and probes (JAK2-E9-Probe, JAK2-E11-Probe and JAK2-E12-Probe) are selected respectively.
As shown in FIG. 10, the method of S2 in example 3 is used, and the forward primer, the backward primer and the probe are used to amplify by using PCM1-JAK2 fusion gene positive plasmid as a template, the PCM1-JAK2 fusion gene positive plasmid is selected from PCM1-JAK2(E26-E9), PCM1-JAK2(E28-E9/10/11), PCM1-JAK2(E29/30-E9), PCM1-JAK2(E36-E9), PCM1-JAK2(E28/29-E11/12), PCM1-JAK2(E36-E11/12), PCM1-JAK2(E23-E12), and the method is divided into a first experiment B, a second experiment B, a third experiment B, a fourth experiment B, a fifth experiment B, a sixth experiment B and a seventh experiment B in sequence. The first experiment B, the second experiment B, the third experiment B, the fourth experiment B, the fifth experiment B, the sixth experiment B and the seventh experiment B are respectively provided with a single-primer experiment group B (a specific upstream primer, a specific downstream primer and a specific probe are selected according to a PCM1-JAK2 fusion gene to verify the effectiveness of the single primer) and a multi-primer experiment group B (namely all upstream primers, all downstream primers and all probes are selected for combined amplification to verify whether interference phenomenon exists in multi-primer amplification).
The first experiment B comprises a first single primer experiment group B11 and a first multi-primer experiment group B12;
the second experiment B comprises a first single primer experiment group B21 and a second multi-primer experiment group B22;
the third experiment B comprises a third single primer experiment group B31 and a third multi-primer experiment group B32;
the fourth experiment B comprises a fourth single primer experiment group B41 and a fourth multi-primer experiment group B42;
the fifth experiment B comprises a fifth single primer experimental group B51 and a fifth multi-primer experimental group B52;
the sixth experiment B comprises a sixth single primer experiment group B61 and a sixth multi-primer experiment group B62;
the seventh experiment B comprises a seventh single primer experiment group B71 and a seventh multi-primer experiment group B72,
set standard B10 for comparison.
As shown in the electrophoresis result of FIG. 10, the single primer experiment group is normally amplified, but the fifth multi-primer experiment group B52 and the sixth multi-primer experiment group B62 in the multi-primer experiment group have obvious bands and lack target bands, and the fifth experiment B and the sixth experiment B respectively select PCM1-JAK2(E28/29-E11/12) positive plasmids and PCM1-JAK2(E36-E11/12) positive plasmids, so that the interference exists in the multi-primer experiment group when the PCM1-JAK2(E28/29-E11/12) fusion genes and the PCM1-JAK2(E36-E11/12) fusion genes are amplified.
As shown in FIG. 11, the amplification is performed by using PCM1-JAK2 fusion gene positive plasmid as a template, the PCM1-JAK2 fusion gene positive plasmid is selected from PCM1-JAK2(E26-E9), PCM1-JAK2(E28-E9/10/11), PCM1-JAK2(E29/30-E9), PCM1-JAK2(E36-E9), PCM1-JAK2(E28/29-E11/12), PCM1-JAK2(E36-E11/12), PCM1-JAK2(E23-E12), and the first experiment C, the second experiment C, the third experiment C, the fourth experiment C, the fifth experiment C, the sixth experiment C and the seventh experiment C are sequentially divided into a first experiment C, a second experiment C, a third experiment C, a fourth experiment C and a seventh experiment C, wherein a plurality of primers are respectively selected (i.e. a plurality of upstream primer sets are respectively selected, Downstream primer and probe combination amplification) and primer combination a1 panel C (i.e., amplification using primer probe combination a 1).
The first experiment C included a first multi-primer experiment set C111 and a first primer combination a1 experiment set C121;
the second experiment C included a second multi-primer experiment set C211 and a second primer combination a1 experiment set C221;
third experiment C included third multi-primer panel C311 and third primer combination a1 panel C321;
fourth experiment C included a fourth multi-primer experiment set C411 and a fourth primer combination a1 experiment set C421;
the seventh experiment C included a seventh multiple primer panel C711 and a seventh primer combination A1 panel C721
The fifth experiment C and the sixth experiment C were set up with the multi-primer experiment set C (i.e., amplified using all the forward primer, the reverse primer and the probe combination) and the primer combination A2 experiment set C (i.e., amplified using the primer probe combination A2), respectively.
Fifth experiment C included a fifth multi-primer panel C511 and a fifth primer combination a2 panel C521;
the sixth experiment C included a sixth multi-primer experiment group C611 and a sixth primer combination a2 experiment group C621;
set standard C100 for comparison.
As shown in the electrophoresis result of FIG. 11, the first experiment C, the second experiment C, the third experiment C, the fourth experiment C and the seventh experiment C all amplified normally, in the fifth experiment C and the sixth experiment C, the fifth multi-primer experiment group C511 and the sixth multi-primer experiment group C611, the fifth multi-primer experiment group B52 and the sixth multi-primer experiment group B62 also generated obvious bands and lacked target bands, but the fifth primer combination A2 experiment group C521 and the sixth primer combination A2 experiment group C621 amplified normally, the fifth primer combination A2 and the sixth primer combination A2 both amplified by using the primer probe combination A2, and the interference existing in the multi-primer experiment group C was eliminated after using the primer probe combination A2.
The primer probe is divided into two combinations, so that various fusion modes are covered to the maximum extent, the number of primers is reduced, and mutual interference is prevented. In the experimental procedure of this example, PCR amplification was performed using step S2 in example 3.
Sequence listing
<110> Tianjin Jiankanghua medical diagnostic technique Co., Ltd
<120> multiplex PCR method, primer probe combination and kit for detecting PCM1-JAK2 fusion gene
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence
<400> 1
ccagcctggc atctaaagat a 21
<210> 2
<211> 22
<212> DNA
<213> Artificial sequence
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
<210> 4
<211> 25
<212> DNA
<213> Artificial sequence
<400> 4
tgatgagagc aaagagtttg taaag 25
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<400> 5
<210> 6
<211> 25
<212> DNA
<213> Artificial sequence
<400> 6
atgtgcatct gcagttaatc tataa 25
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence
<400> 7
gaacagtttc catctggtaa caat 24
<210> 8
<211> 21
<212> DNA
<213> Artificial sequence
<400> 8
tgttggtgag gttggtacat c 21
<210> 9
<211> 25
<212> DNA
<213> Artificial sequence
<400> 9
ccatcaatta atgacacgaa agaca 25
<210> 10
<211> 24
<212> DNA
<213> Artificial sequence
<400> 10
cactgaggtt gtactcttca ttct 24
<210> 11
<211> 24
<212> DNA
<213> Artificial sequence
<400> 11
acaccattcg ttctgaagac taga 24
<210> 12
<211> 31
<212> DNA
<213> Artificial sequence
<400> 12
tggagataac actctaagca taactaaagg t 31
<210> 13
<211> 21
<212> DNA
<213> Artificial sequence
<400> 13
gatgtagttg cttgggaccc a 21
<210> 14
<211> 28
<212> DNA
<213> Artificial sequence
<400> 14
ccatttttgg tttgggcttc acaccatt 28
Claims (11)
1. A primer probe combination for detecting PCM1-JAK2 fusion genes is characterized by comprising a primer probe combination A1 and a primer probe combination A2:
the primer Probe combination A1 comprises an upstream primer PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F, a downstream primer JAK2-E9-R, JAK2-E12-R, a Probe JAK2-E9-Probe and a Probe JAK2-E12-Probe, wherein the base sequences of the primer Probe combination A1 are shown as follows:
PCM1-E23-F：CCAGCCTGGCATCTAAAGATA
PCM1-E26-F：CTAGTGAGAGCCTTGCTACTAC
PCM1-E28-F：CTGGTGCAGGTACTACAGTT
PCM1-E30-F：TGATGAGAGCAAAGAGTTTGTAAAG
PCM1-E36-F：GCTGGAAGTCCTGATACTGA
JAK2-E9-R：ATGTGCATCTGCAGTTAATCTATAA
JAK2-E12-R：TGTTGGTGAGGTTGGTACATC
JAK2-E9-Probe：FAM-CCATCAATTAATGACACGAAAGACA-MGB
JAK2-E12-Probe：HEX-ACACCATTCGTTCTGAAGACTAGA-MGB
the primer Probe combination A2 comprises an upstream primer PCM1-E23-F, PCM1-E26-F, PCM1-E28-F, PCM1-E30-F, PCM1-E36-F, a downstream primer JAK2-E11-R and a Probe JAK2-E11-Probe, and the base sequences of the primers are shown as follows:
PCM1-E23-F：CCAGCCTGGCATCTAAAGATA
PCM1-E26-F：CTAGTGAGAGCCTTGCTACTAC
PCM1-E28-F：CTGGTGCAGGTACTACAGTT
PCM1-E30-F：TGATGAGAGCAAAGAGTTTGTAAAG
PCM1-E36-F：GCTGGAAGTCCTGATACTGA
JAK2-E11-R：GAACAGTTTCCATCTGGTAACAAT
JAK2-E11-Probe：JOE-CACTGAGGTTGTACTCTTCATTCT-MGB
2. the primer probe combination for detecting the PCM1-JAK2 fusion gene as claimed in claim 1, wherein the 3 'end of each probe in the primer probe combination for detecting the PCM1-JAK2 fusion gene is labeled with MGB, and the 5' end of each probe is labeled with FAM, JOE or HEX.
3. The primer and probe combination for detecting PCM1-JAK2 fusion gene according to claim 2, wherein the PCM1-JAK2 fusion gene is selected from PCM1-26/AK2-9, PCM1-28/JAK2-9, PCM1-30/JAK2-9, PCM1-36/JAK2-9, PCM1-29/JAK2-11, PCM1-36/JAK2-11 or PCM1-23/JAK 2-12.
4. The primer probe combination for detecting PCM1-JAK2 fusion gene according to claim 3, further comprising primers and probes for amplifying housekeeping gene Abl as internal reference, wherein the nucleotide sequence is as follows:
Abl-F：TGGAGATAACACTCTAAGCATAACTAAAGGT
Abl-R：GATGTAGTTGCTTGGGACCCA
Abl-Probe：FAM-CCATTTTTGGTTTGGGCTTCACACCATT-TAM。
5. a kit for detecting PCM1-JAK2 fusion gene, which comprises a detection system PCR reaction solution, and is characterized in that the detection system PCR reaction solution comprises the primer probe combination A1 and the primer probe combination A2 of claim 1;
the detection system PCR reaction solution also comprises a gene expression premix solution, a primer of an internal reference gene Abl and a probe.
6. The kit for detecting the PCM1-JAK2 fusion gene of claim 5, wherein the kit further comprises a lymphocyte separation solution.
7. The kit for detecting the PCM1-JAK2 fusion gene of claim 5, wherein the kit further comprises a sample RNA extract comprising TRIzol, chloroform, isopropanol, 75% ethanol and DEPC water.
8. The kit for detecting the PCM1-JAK2 fusion gene, according to claim 5, further comprising a positive control, a negative control and a blank control, wherein the positive control is a plasmid solution containing a cDNA sequence of the PCM1-JAK2 fusion gene, the negative control is a plasmid solution without a cDNA sequence of the PCM1-JAK2 fusion gene, and the blank control is deionized water.
9. The kit for detecting the PCM1-JAK2 fusion gene according to claim 8, wherein the PCM1-JAK2 fusion gene is selected from PCM1-26/JAK2-9, PCM1-28/JAK2-9, PCM1-30/JAK2-9, PCM1-36/JAK2-9, PCM1-29/JAK2-11, PCM1-36/JAK2-11 or PCM1-23/JAK 2-12.
10. The kit for detecting the PCM1-JAK2 fusion gene according to claim 8, wherein the detected concentration of the PCM1-26/JAK2-9 and the detected concentration of the PCM1-28/JAK2-9 are at least 3copise/ul, the detected concentration of the PCM1-30/JAK2-9, the detected concentration of the PCM1-36/JAK2-9, the detected concentration of the PCM1-36/JAK2-11 and the detected concentration of the PCM1-23/JAK2-12 are at least 30copise/ul, and the detected concentration of the PCM1-29/JAK2-11 are at least 303 copise/ul.
11. A multiplex PCR method for detecting PCM1-JAK2 fusion genes is characterized by comprising the following steps:
s1 extracting RNA from bone marrow blood sample, and reverse transcribing the RNA into cDNA sample;
s2, carrying out PCR amplification, and obtaining a specific amplification product by using a multiple fluorescence PCR method; PCR amplification conditions were 50 ℃ for 2min, 95 ℃ for 10min, 95 ℃ for 15s, and 60 ℃ for 1min (40 cycles of collecting fluorescence signals at 60 ℃);
and interpretation of S3 result:
s3-1, setting the average fluorescence signal of 3-15 cycles as a baseline;
s3-2, analyzing the fluorescent PCR result by using software, wherein the CT value is more than 37 or the non-fluorescent PCR amplification curve is negative, and the CT value is less than 35, and the result is positive; the suspected positive is that the CT value is more than or equal to 35 and less than or equal to 37;
s3-3, taking the suspected positive specimen after PCR reaction in 10ulS3-2, carrying out 2.5% agarose gel electrophoresis, and comparing with the molecular weight marker of cDNA under an ultraviolet lamp to obtain a positive or negative result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210494641.1A CN114958985B (en) | 2022-05-07 | Multiplex PCR method, primer probe combination and kit for detecting PCM1-JAK2 fusion gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210494641.1A CN114958985B (en) | 2022-05-07 | Multiplex PCR method, primer probe combination and kit for detecting PCM1-JAK2 fusion gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114958985A true CN114958985A (en) | 2022-08-30 |
| CN114958985B CN114958985B (en) | 2024-09-27 |
Family
ID=
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014172046A2 (en) * | 2013-04-17 | 2014-10-23 | Life Technologies Corporation | Gene fusions and gene variants associated with cancer |
| CN107815494A (en) * | 2017-11-03 | 2018-03-20 | 杭州艾迪康医学检验中心有限公司 | Detect method, kit and the oligonucleotides of PCM1 JAK2 relative expression quantities |
| CN112608997A (en) * | 2020-12-17 | 2021-04-06 | 武汉艾迪康医学检验所有限公司 | Method, primer, probe and composition for screening eosinophilia-related fusion gene by using multiplex fluorescence PCR (polymerase chain reaction) technology |
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014172046A2 (en) * | 2013-04-17 | 2014-10-23 | Life Technologies Corporation | Gene fusions and gene variants associated with cancer |
| CN107815494A (en) * | 2017-11-03 | 2018-03-20 | 杭州艾迪康医学检验中心有限公司 | Detect method, kit and the oligonucleotides of PCM1 JAK2 relative expression quantities |
| CN112608997A (en) * | 2020-12-17 | 2021-04-06 | 武汉艾迪康医学检验所有限公司 | Method, primer, probe and composition for screening eosinophilia-related fusion gene by using multiplex fluorescence PCR (polymerase chain reaction) technology |
Non-Patent Citations (3)
| Title |
|---|
| SYLVIA HOELLER ET AL.: "PCM1-JAK2-fusion: a potential treatment target in myelodysplastic-myeloproliferative and other hemato-lympoid neoplasms", 《EXPERT OPINION ON THERAPEUTIC TARGETS》, vol. 15, no. 1, 31 January 2011 (2011-01-31), pages 53 - 62 * |
| VERENA PATTERER ET AL.: "Hematologic malignancies with PCM1-JAK2 gene fusion share characteristics with myeloid and lymphoid neoplasms with eosinophilia and abnormalities of PDGFRA, PDGFRB, and FGFR1", 《ANNALS OF HEMATOLOGY》, vol. 92, 12 February 2013 (2013-02-12), pages 759 - 769 * |
| 赵敏: "ｔ(8;9)不典型慢性粒细胞白血病1例报告并文献复习", 《内科》, vol. 6, no. 3, 30 June 2011 (2011-06-30), pages 275 - 276 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102337338B (en) | Method for simultaneously and quickly detecting number of five types of chromosomes, and kit and application thereof | |
| KR102493424B1 (en) | A method of detecting rna | |
| RU2730622C2 (en) | Improved detection of short homopolymeric repeats | |
| CN110055312B (en) | Primer, probe and kit for detecting cis-trans mutation of EGFR gene C797S and T790M | |
| CN110541033A (en) | composition for detecting EGFR gene mutation and detection method | |
| CN114672548A (en) | Human venous thrombosis risk gene polymorphism detection kit, process and application | |
| CN109837331B (en) | Primer pair and method for detecting size distribution of Vero cell DNA fragments | |
| CN112280866A (en) | Method, primer and probe for screening 14 fusion genes related to acute promyelocytic leukemia by fluorescent quantitative PCR technology | |
| CN113930500A (en) | Digital PCR (polymerase chain reaction) detection method for human PIK3CA gene mutation and application | |
| CN108913774B (en) | C-KIT somatic mutation gene detection KIT and detection method thereof | |
| CN114438233B (en) | Synchronous typing detection system of X chromosome Multi-DIP for genetic relationship identification | |
| CN114958985A (en) | Multiplex PCR method, primer probe combination and kit for detecting PCM1-JAK2 fusion gene | |
| CN114277110A (en) | Kit for detecting copy number and/or amplification of FGF19 gene, detection method and application | |
| US20100255468A1 (en) | Method of assessing gene examination data, program therefor and apparatus of the same | |
| CN116783308A (en) | Universal cartridge and method for multiplex nucleic acid detection | |
| CN113930501A (en) | Digital PCR detection method for human EGFR gene mutation and application | |
| CN110857451A (en) | Primer combination, MLPA probe, gene chip and kit for detecting microdeletion or/and microduplication of recurrent abortion | |
| CN117904286B (en) | System and method for determining that SMN gene mutation is located in SMN1 gene | |
| CN118326032B (en) | Primer and probe combination and kit for detecting polymorphism of systemic lupus erythematosus associated genes | |
| RU2805864C1 (en) | Method of genotyping tlr8 gene using rs3764880 polymorphism and a set of oligonucleotide primers and probes for its implementation | |
| CN113897430B (en) | Digital PCR detection method for human IDH1/IDH2 gene mutation and application thereof | |
| RU2795410C9 (en) | Biomarker panel and methods for detecting microsatellite instability in various types of cancer | |
| RU2795410C2 (en) | Biomarker panel and methods for detecting microsatellite instability in various types of cancer | |
| CN108103158A (en) | A kind of embryonal system base mutation PCR detection method of high specific | |
| CN118581200A (en) | Method for detecting nucleic acid molecule, detection kit and detection cartridge |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |