CN114958911A - Parkinson disease rabbit model constructed by utilizing eAID-Cas9 and method - Google Patents
Parkinson disease rabbit model constructed by utilizing eAID-Cas9 and method Download PDFInfo
- Publication number
- CN114958911A CN114958911A CN202210521763.5A CN202210521763A CN114958911A CN 114958911 A CN114958911 A CN 114958911A CN 202210521763 A CN202210521763 A CN 202210521763A CN 114958911 A CN114958911 A CN 114958911A
- Authority
- CN
- China
- Prior art keywords
- sgrna
- cas9
- eaid
- fertilized eggs
- parkinson disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/107—Rabbit
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0306—Animal model for genetic diseases
- A01K2267/0318—Animal model for neurodegenerative disease, e.g. non- Alzheimer's
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Environmental Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a Parkinson disease rabbit model constructed by utilizing eAID-Cas9, and also provides a construction method thereof, wherein a mutation site (p.Arg1205His) of the 23 rd exon of EIF4G1 gene is selected, and then a new Parkinson disease rabbit model is constructed by the optimized eAID-BE4max system mutation modification site in the CRISPR/Cas9 technology, so that the behavioral, physiological, anatomical and genetic characterization which is more similar to human Parkinson disease can BE simulated, the research on the disease process, biological markers, new drug tests, diagnostic reagents and the like of diseases can BE facilitated, the research and development risks of new drugs can BE greatly reduced, and an animal model is provided for clinical research.
Description
Technical Field
The invention discloses a Parkinson disease rabbit model constructed by utilizing eAID-Cas9, and also provides a construction method thereof, belonging to the technical field of construction of human disease models.
Background
Parkinson's Disease (PD), also known as paralysis agitans, is a common degenerative disease of the senile nervous system, with the average age of onset being about 60 years. The most prominent pathological change in the disease is degenerative death of the midbrain nigral Dopaminergic (DA) neurons. PD is traditionally classified as a movement disorder, and patients often exhibit bradykinesia, tremor, increased muscle tone, and dyspostural balance. PD patients experience depression, constipation, olfactory disorders and disorders of rapid eye movement sleep behavior in the years before diagnosis. The exact etiology of this pathological change remains unclear, and genetic factors, environmental factors, aging, oxidative stress, etc. may be involved in the development of PD disease. Epidemiology shows that the prevalence rate of PD in people over 65 years old in China is about 1.7%, and the people gradually show a trend of youthful appearance. Since the underlying pathophysiology of PD is still poorly understood, animal models are the best tools for studying the pathogenesis of PD.
There are currently two mainstream methods for constructing PD models: the neurotoxicity model mainly utilizes chemical reagents to damage the nigrostriatal pathway of an animal model so as to simulate pathological damage of PD, but the method has irreversible neurotoxicity damage to the animal model and cannot accurately simulate the pathological occurrence process of human PD diseases. Compared with the prior art, the genetic model can simulate the pathogenesis of PD, is helpful for understanding the generation mechanism of PD, is beneficial to researching potential markers, and provides a powerful basic model tool for early prevention or treatment of PD. In addition to developing models that mimic the etiology of PD, it is also important to select appropriate animals for modeling. Zebrafish, drosophila, mice and the like are animal models which are generally applied in biology, but researches show that some mouse PD models can not accurately simulate the appearance of Lewy bodies, so that the development of PD models by simulating animals which are more similar to human beings in aspects of physiology, anatomy, genetics and the like is urgently needed.
Disclosure of Invention
The invention provides a Parkinson disease rabbit model constructed by using eAID-Cas9 and a method, which can effectively simulate the pathological process of human Parkinson disease.
The invention relates to a Parkinson disease rabbit model constructed by using eAID-Cas9, which is constructed by using 23 rd exon mutation of EIF4G1 gene.
The invention discloses a pair of oligonucleotide chains of a Parkinson disease rabbit model constructed by using eAID-Cas9, which is characterized in that:
designing 1 sgRNA sequence acting target spot at 23 rd exon of EIF4G1 gene, synthesizing a pair of oligonucleotide chains to prepare sgRNA, wherein the oligonucleotide comprises:
sgRNA-F：GCCCGAGGGACTGCGCAAGG；
sgRNA-R：CCTTGCGCAGTCCCTCGGGC。
the invention relates to a method for constructing a Parkinson disease rabbit model by utilizing eAID-Cas9, which comprises the following steps:
1) construction of sgRNA expression vector:
annealing the oligonucleotide chain synthesized by the method to form a double chain, linearizing a PUC57 vector by using BbsI restriction endonuclease, then purifying and recovering the enzyme digestion product, and connecting the annealed sgRNA to a PUC57 vector, thereby completing the construction of a PUC57-sgRNA vector;
2) synthesis of CAS9 mRNA:
the CAS9 expression plasmid is linearized by enzyme digestion, extracted and purified by phenol chloroform, and then dissolved in water without nuclease; carrying out enzyme digestion at 37 ℃ for 3h, and recovering by using a common DNA agarose gel recovery kit after electrophoresis gel running;
3) obtaining and microinjecting fertilized eggs:
injecting follicle-stimulating hormone, then injecting human chorionic gonadotropin to obtain fertilized eggs, and injecting a mixture of premixed Cas9mRNA and sgRNA into the cytoplasm of the fertilized eggs by a microinjection instrument;
4) and (3) culturing and developing fertilized eggs:
transferring the fertilized eggs subjected to microinjection into a culture solution, placing the fertilized eggs into a constant-temperature incubator at 37 ℃ for culture, and transferring a single embryo into a centrifugal tube by using an egg sucking needle when the fertilized eggs develop to a morula stage;
5) embryo transfer and acquisition of model populations:
transplanting the embryo into the oviduct of a female rabbit of the right age, and obtaining a gene editing animal model after the embryo is naturally produced; carrying out genetic identification by using a PCR (polymerase chain reaction) and sequencing method; screening homozygous mutant individuals, monitoring and identifying the heredity and phenotype stability of the homozygous mutant individuals, and performing centralized propagation on the disease models with stable phenotypes to obtain model populations capable of being stably passaged.
Cytidine base editors, consisting of cytidine deaminase and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -associated protein 9 (Cas9) nickase, can efficiently convert C · G base pairs to T · a in various organisms, but BE3 based on catalytic polypeptide 1 is generally inefficient in target Cs immediately downstream of G (GC context). The enhanced AID-Cas9 fusion (edad-BE 4max) optimizes C-to-T editing efficiency in GC environments and reduces bystander activity. Construction of efficient rabbit models can therefore BE performed in the rabbit GC context using the optimized edad-BE 4max system.
The invention has the positive effects that:
a mutation site (p.Arg1205His) of the No. 23 exon of the EIF4G1 gene is selected, and then a new rabbit model for the Parkinson disease is constructed by mutating and changing the site through an eAID-BE4max system optimized in the CRISPR/Cas9 technology, so that the behavioral, physiological, anatomical and genetic characterization which is more similar to the human Parkinson disease can BE simulated, the research on the disease process, biological markers, new drug tests, diagnostic reagents and the like of the disease is facilitated, the risk of new drug research and development is greatly reduced, and an animal model is provided for clinical research.
Drawings
FIG. 1 is a schematic design diagram of an EIF4G1 sgRNA of the present invention;
FIG. 2 is an electrophoresis chart of the PCR product of the invention for identifying the mutation condition of the EIF4G1 gene of the embryo;
wherein M: d2000 is DNA molecular standard weight; 1-10: PCR results for DNA of 10 embryos after microinjection. 11: positive control (normal embryo);
FIG. 3 is a sanger sequencing chart of the PCR product of the invention for identifying the mutation situation of EIF4G1 gene;
the designed identification primer of the EIF4G1 gene is 514bp, and can be obtained from the DNA sequencing result: embryogenesis occurs with 50% C > T mutations;
FIG. 4 shows the results of MRI experiments on the control group and the mutation group after onset of disease, respectively, after identification of the newborn rabbit model obtained by microinjection, from which it can be seen that atrophy occurs in the brain of the rabbit model; respectively recording the weight in the growth process, wherein the picture result shows that the weight of the Parkinson rabbit model is reduced after the disease occurs; and the picture of the experimental result of the involuntary vibration of the hind limb after the disease is recorded shows that the hind limb of the Parkinson rabbit model can generate involuntary vibration;
FIG. 5 shows the results of gait experiments of the control group and the mutation group after the identification of the newborn rabbit model obtained after microinjection, which shows that the Parkinson rabbit model has unstable gait and reduced moving frequency and distance after the onset of disease.
Detailed Description
The present invention is further illustrated by the following examples, which do not limit the present invention in any way, and any modifications or changes which can be easily made by a person skilled in the art without departing from the technical solution of the present invention will fall within the scope of the claims of the present invention.
Example 1
The invention successfully constructs an EIF4G1 point mutation Parkinson disease rabbit model by utilizing an eAID-Cas9 base editor, and the steps are as follows:
1) sgRNA design of eAID-Cas9 system and construction of expression vector
Designing 1 sgRNA sequence acting target spot at 23 rd exon of EIF4G1 gene, synthesizing a pair of oligonucleotide chains for preparing sgRNA:
sgRNA-F：GCCCGAGGGACTGCGCAAGG；
sgRNA-R：CCTTGCGCAGTCCCTCGGGC）；
the selection principle of the oligonucleotide chain of the sgRNA is as follows: selecting an oligonucleotide chain with the position of the mutation base at 5 or 6. Annealing the synthesized oligonucleotide (naturally cooling to room temperature after 5min at 95 ℃), connecting the oligonucleotide with a recovered PUC57-sgRNA expression vector digested by Bbs I to complete sgRNA vector construction, verifying correct connection of fragments through sequencing, cloning, and extracting plasmids for preparing an in vitro transcription template after amplification culture;
enzyme digestion system: plasmid PUC 57: 20ul, 10 XBuffe: 20ul, Bbs I: 1ul, ddH 2 O ：159ul；
Performing enzyme digestion at 37 ℃ for 3h, performing electrophoresis gel running, and then recovering by using a common DNA agarose gel recovery kit (purchased from Tiangen corporation, Beijing, China), wherein the specific operation is performed according to the instruction;
the CAS9 expression plasmid (Addgene, purchased from laboratories), linearized by enzymatic digestion, purified by phenol chloroform extraction, and used as template in nuclease-free water for in vitro transcription. The synthesis of CAS9mRNA was performed in vitro with T7RNA polymerase using the Kit RNeasy Mini Kit (Qiagen, No.74104), and in vitro synthesis of sgRNA was performed in vitro with T7RNA polymerase using the Kit RNeasy Mini Kit (Qiagen, No. 217004);
enzyme digestion system: not I: 4ul, CAS 9: 50. mu.l, BSA: 30. mu.l, Triton: 30. mu.l, 10 XH: 30 mu, ddH 2 O：156μl；
Performing enzyme digestion at 37 ℃ for 3h, performing electrophoresis gel running, and then recovering by using a common DNA agarose gel recovery kit (purchased from Tiangen corporation, Beijing, China), wherein the specific operation is performed according to the instruction;
2) fertilized egg harvesting and microinjection
Injecting Follicle Stimulating Hormone (FSH), followed by Human Chorionic Gonadotropin (HCG) (purchased from Ningbo second hormone factory), obtaining fertilized eggs, and injecting the premixed CAS9mRNA/sgRNA mixture into cytoplasm by microinjection apparatus (CAS9mRNA final concentration is 150ng/ul, sgRNA final concentration is 30 ng/ul);
3) and (3) in-vitro culture and development of fertilized eggs.
Transferring fertilized eggs subjected to microinjection into a culture solution, placing the fertilized eggs in a constant-temperature incubator at 37 ℃ for culture, and transferring a single embryo into a centrifugal tube by using an egg sucking needle when the fertilized eggs develop to a morula stage for later experiments;
4) identification of embryo EIF4G1 gene mutation condition
(1) Embryo lysis
The embryo cracking reagent is NP40, and the cracking conditions are as follows: 1h at 56 ℃; 10min at 95 ℃;
(2) DNA sequencing to identify embryo genotype mutation
Extracting DNA, operating the extraction method according to the instruction of the tissue genome extraction kit (purchased from Tiangen corporation, Beijing, China), carrying out PCR (polymerase chain reaction), electrophoretic identification and DNA sequencing to obtain a genotype identification result;
cracking embryos: the embryo cracking reagent is NP40, and the cracking conditions are as follows: 56 ℃ for 1 h; at 95 ℃ for 10 min;
DNA sequencing to identify embryo genotype mutation: extracting DNA, carrying out PCR, electrophoretic identification and DNA sequencing to obtain a genotype identification result;
a. PCR primers were designed as follows:
an upstream primer: TGGCTTGCCTGTCTTTCTT, respectively;
a downstream primer: ATGTCGTTGAGATGGAGGTATTC, respectively;
b. the PCR reaction system is as follows:
1ul of template DNA;
1ul of upstream primer;
1ul of downstream primer;
2×Taq plus 12.5ul；
ddH 2 O 9.5ul；
c. and (3) PCR reaction conditions:
pre-denaturation at 95 ℃ for 7 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 40 s; 30 cycles; extending for 5min at 72 ℃;
and thirdly, sequencing the PCR product, wherein the sequencing result shows that the complete mutation or the incomplete mutation occurs at the target site designed by the EIF4G1 gene primer, and the sample with the complete mutation or the incomplete mutation at the selected site is the gene mutation.
The sequence of 23 rd exon of rabbit EIF4G1 is SEQ NO. 1; the result of DNA sequencing of the normal embryo PCR product is SEQ NO. 2: the sequence of PUC57-sgRNA is SEQ NO.3, and one oligonucleotide chain of the sgRNA is marked by italic underlining.
Verification example 1
Phenotype identification and genotype analysis of EIF4G1 gene Parkinson disease rabbit model
1) DNA sequencing identification of genotype of EIF4G1 gene Parkinson disease rabbit model
Extracting tissue DNA of the birth rabbit model, operating the extraction method according to the instruction of a tissue genome extraction kit (Tiangen, Beijing, China), performing PCR (polymerase chain reaction), performing nucleic acid electrophoresis identification, and performing DNA sequencing to obtain a genotype identification result;
a. PCR primers were designed as follows:
an upstream primer: TGGCTTGCCTGTCTTTCTT;
a downstream primer: ATGTCGTTGAGATGGAGGTATTC, respectively;
b. the PCR reaction system is as follows:
1ul of template DNA;
1ul of upstream primer;
1ul of downstream primer;
2×Taq plus 12.5ul；
ddH2O 9.5ul；
c. and (3) PCR reaction conditions:
pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 30 s; 35 cycles; extending for 5min at 72 ℃;
sequencing the PCR product, wherein the sequencing result shows that complete mutation or incomplete mutation occurs at a target site designed by an EIF4G1 gene primer, and a sample is the gene mutation;
as shown in FIG. 2, an EIF4G1 gene mutant rabbit model is obtained;
2) weight of rabbit results Collection
The body weights of normal rabbits and mutant rabbits were measured every 3 months at 3-12 months after birth, respectively, as shown in FIG. 4, the EIF4G1 gene mutant rabbit model grew slowly after 6 months of age;
3) rabbit health monitoring
Observing whether the important parts or tissues of the rabbit body are diseased; observing whether the rabbit has motor dysfunction in daily activities and advancing processes; immediately dissecting and observing pathological changes of organs including heart, liver, spleen, kidney, lung, brain, muscle and the like if dead individuals appear in the growth process of the rabbit model, and fixing tissues and then carrying out histopathological section;
4) rabbit model behavioural results collection
Respectively observing the behavior change process of the rabbit model in 3-12 months after birth by a gait experiment, an open field experiment, an olfactory experiment, a Y maze experiment and a step experiment; as shown in FIG. 5, it can be seen that the EIF4G1 gene mutant rabbit has motor dysfunction;
5) imaging analysis of rabbits
At 12 months, the rabbits were anesthetized, mri was performed to obtain a brain image of the rabbits, and analysis of the corresponding results was performed, as shown in fig. 4, it was found that the EIF4G1 gene-mutated rabbits had pathological changes such as brain atrophy.
And (4) conclusion: the invention successfully constructs an EIF4G1(p.Arg1205His) gene mutation rabbit model which has typical Parkinson disease symptoms and is consistent with the results of human clinical cases, and the model constructed by the invention is accurate and reliable.
Sequence listing
<110> Jilin university
<120> Parkinson disease rabbit model constructed by using eAID-Cas9 and method
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 233
<212> DNA
<213> Oryctolagus cuniculus
<400> 1
gagtagcttg agtcgggaac gaggtgagaa agctggggac cgaggagacc gcctagagcg 60
gagtgaacgg ggaggtgacc gaggggaccg gctggaccgc gcacggacac cggccaccaa 120
gcggagcttc agcaaggaag tggaggaacg gagtcgagaa cggccctccc agcccgaggg 180
actgcgcaag gcagctagcc tcacagagga tcgggaccga gggcgggatg cgg 233
<210> 2
<211> 514
<212> DNA
<213> Rabbit (Oryctolagus cuniculus)
<400> 2
tggcttgcct gtctttcttc caggagtagc ttgagtcggg aacgaggtga gaaagctggg 60
gaccgaggag accgcctaga gcggagtgaa cggggaggtg accgagggga ccggctggac 120
cgcgcacgga caccggccac caagcggagc ttcagcaagg aagtggagga acggagtcga 180
gaacggccct cccagcccga gggactgcgc aaggcagcta gcctcacaga ggatcgggac 240
cgagggcggg atgcgggtga gaggccggga gaggagtggt gggggaggct gttggctggt 300
ttgggacaac ctggcctgca aatctcttga gagctccaga ctgtgtgtta gagagcctga 360
aagtgaagag tatctttgat ctgtgttttc ttgctacagc aaagcgggaa gccgccctgc 420
cccctgtgag ctcgccgaag gctgcactct ctgaagagga gctggagaag aaatccaagg 480
ccatcattga ggaatacctc catctcaacg acat 514
<210> 3
<211> 1073
<212> DNA
<213> Rabbit (Oryctolagus cuniculus)
<400> 3
cagtgattgg agatcggtac ttcgcgaatg cgtcgagata ttgggtcttt aaaagcaccg 60
actcggtgcc actttttcaa gttgataacg gactagcctt attttaactt gctatttcta 120
gctctagccc gagggactgc gcaaggccta tagtgagtcg tattaattgg gtatcggatg 180
ccgggaccga cgagtgcaga ggcgtgcaag cgagcttggc gtaatcatgg tcatagctgt 240
ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa 300
agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac 360
tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg 420
cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc 480
gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 540
ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 600
ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 660
atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 720
aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 780
gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 840
ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 900
ttcagcccga ccgctgcgcc ttatccgggt aactatcgtc ttgagtccaa cccggtaaga 960
cacgacttat cgccactggc agcagccact ggtacaggat tagcagagcg agtatgtaag 1020
cgttgctaca gagttcttga agtggtgcct aactacgggc ttaccactaa gga 1073
Claims (3)
1. A rabbit model of Parkinson disease constructed by using eAID-Cas9, which is characterized in that: is constructed by mutation of 23 rd exon of EIF4G1 gene, and is shown in a sequence table SEQINO. 1.
2. A pair of oligonucleotide chains of a Parkinson disease rabbit model constructed by utilizing eAID-Cas9, which is characterized in that:
designing 1 sgRNA sequence acting target spot at 23 rd exon of EIF4G1 gene, synthesizing a pair of oligonucleotide chains to prepare sgRNA, wherein the oligonucleotides are as follows:
sgRNA-F：GCCCGAGGGACTGCGCAAGG；
sgRNA-R：CCTTGCGCAGTCCCTCGGGC。
3. a method for constructing a rabbit model of Parkinson disease by utilizing eAID-Cas9, comprising the following steps of:
1) construction of sgRNA expression vector:
annealing the oligonucleotide strand synthesized according to claim 1 to form a double strand, linearizing a PUC57 vector by using BbsI restriction endonuclease, purifying and recovering the enzyme digestion product, and connecting the annealed sgRNA to a PUC57 vector to complete the construction of the PUC57-sgRNA vector;
2) synthesis of CAS9 mRNA:
the CAS9 expression plasmid is linearized by enzyme digestion, extracted and purified by phenol chloroform, and then dissolved in water without nuclease; carrying out enzyme digestion at 37 ℃ for 3h, and recovering by using a common DNA agarose gel recovery kit after electrophoresis gel running;
3) obtaining and microinjecting fertilized eggs:
injecting follicle-stimulating hormone, then injecting human chorionic gonadotropin to obtain fertilized eggs, and injecting a mixture of premixed Cas9mRNA and sgRNA into the cytoplasm of the fertilized eggs by a microinjection instrument;
4) and (3) culturing and developing fertilized eggs:
transferring the fertilized eggs subjected to microinjection into a culture solution, placing the fertilized eggs into a constant-temperature incubator at 37 ℃ for culture, and transferring a single embryo into a centrifuge tube by using an egg sucking needle when the fertilized eggs develop to a morula stage;
5) embryo transfer and acquisition of model populations:
transplanting the embryo into the oviduct of a female rabbit of the right age, and obtaining a gene editing animal model after the embryo is naturally produced; carrying out genetic identification by using a PCR (polymerase chain reaction) and sequencing method; screening homozygous mutant individuals, monitoring and identifying the genetic and phenotypic stability of the homozygous mutant individuals, and carrying out centralized propagation on disease models with stable phenotypes to obtain model populations capable of being stably passaged.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210521763.5A CN114958911A (en) | 2022-05-13 | 2022-05-13 | Parkinson disease rabbit model constructed by utilizing eAID-Cas9 and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210521763.5A CN114958911A (en) | 2022-05-13 | 2022-05-13 | Parkinson disease rabbit model constructed by utilizing eAID-Cas9 and method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114958911A true CN114958911A (en) | 2022-08-30 |
Family
ID=82982491
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210521763.5A Pending CN114958911A (en) | 2022-05-13 | 2022-05-13 | Parkinson disease rabbit model constructed by utilizing eAID-Cas9 and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114958911A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107630043A (en) * | 2017-11-14 | 2018-01-26 | 吉林大学 | The method that Gadd45a knockout rabbit models are established using knockout technology |
| US20200283755A1 (en) * | 2017-05-18 | 2020-09-10 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
| CN112806323A (en) * | 2021-01-26 | 2021-05-18 | 南方医科大学 | Construction method and application of mouse animal model with Parkinson's syndrome |
-
2022
- 2022-05-13 CN CN202210521763.5A patent/CN114958911A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20200283755A1 (en) * | 2017-05-18 | 2020-09-10 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
| CN107630043A (en) * | 2017-11-14 | 2018-01-26 | 吉林大学 | The method that Gadd45a knockout rabbit models are established using knockout technology |
| CN112806323A (en) * | 2021-01-26 | 2021-05-18 | 南方医科大学 | Construction method and application of mouse animal model with Parkinson's syndrome |
Non-Patent Citations (1)
| Title |
|---|
| MARIE-CHRISTINE等: "Translation initiator EIF4G1 mutations in familial Parkinson disease", 《AM J HUM GENET 》, vol. 89, no. 3, pages 403 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551752B (en) | xCas9n-epBE base editing system and application thereof in genome base replacement | |
| CN106755026A (en) | The foundation of the structure and enamel hypocalcification model of sgRNA expression vectors | |
| CN105063083B (en) | Prevent method for creating and its application of the Rice Engineering maintainer of genetic drift | |
| CN114786733A (en) | Efficient DNA base editor for targeted genome modification mediated by RNA-aptamer recruitment and uses thereof | |
| CN111154758A (en) | Method for knocking out zebra fish slc26a4 gene | |
| CN107827975B (en) | Gene recombinant human albumin expressed by alfalfa and expression method | |
| CN114958911A (en) | Parkinson disease rabbit model constructed by utilizing eAID-Cas9 and method | |
| CN109321576A (en) | A kind of method for creating of the low gossypol Cotton Germplasms of Non-gland body | |
| CN114946766B (en) | Method for constructing congenital hyperinsulinemia model and model | |
| CN114958847A (en) | Humanized cerebral palsy rabbit model with RHOB gene point mutation and construction method | |
| CN104894255B (en) | A kind of method and its application detecting inefficient genome editor based on polyacrylamide gel electrophoresis | |
| CN113061626A (en) | Method for tissue-specifically knocking out zebra fish gene and application | |
| CN105671075B (en) | Application of rice OsCSA gene and site-specific knockout method thereof | |
| CN108949763A (en) | Accurate mutation LamR gene and the application of swine fever virus infection can effectively be inhibited | |
| CN111304257B (en) | Method for gene editing by injecting virus into specific brain region of animal based on PSEN1 gene for non-therapeutic purpose | |
| CN110066797A (en) | Editor's label ben-1 sgRNA target site and its CRISPR/Cas9 are total to editing system and application altogether | |
| CN112695034A (en) | Preparation method of zebra fish with ApoE gene deletion | |
| CN111893119A (en) | Method for obtaining SCD1 gene editing goat embryo by CRISPR/Cas9 system and microinjection | |
| CN111575313A (en) | Method for performing site-directed mutagenesis and detection on rice TDR gene by using CRISPR \ Cas9 system | |
| CN113604502A (en) | Gene editing system of pAPN gene 16 th exon and application thereof | |
| CN107151676B (en) | Preparation and application of fish with fluorescence protein transfer gene for high-sensitivity monitoring of POPs (persistent organic pollutants) | |
| CN111621508A (en) | Tobacco terpene synthase NtTPS7 gene and vector and application thereof | |
| CN116497060A (en) | Method for constructing novel amyotrophic lateral sclerosis model and model | |
| CN114317605B (en) | Construction method of microglial cell potassium ion probe transgenic mouse model | |
| CN107815435A (en) | The gluconacetobacter of cellulose production capacity with enhancing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |