CN114940708A

CN114940708A - Application of OsPIL16 gene or protein thereof in regulation and control of rice stem thickness

Info

Publication number: CN114940708A
Application number: CN202210367080.9A
Authority: CN
Inventors: 高勇; 钱静洁; 张冬平; 李倩; 吴美娣; 全敦凡
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2022-04-08
Filing date: 2022-04-08
Publication date: 2022-08-26
Anticipated expiration: 2042-04-08
Also published as: CN114940708B

Abstract

The invention belongs to the technical field of agricultural biology, and discloses an application of an OsPIL16 gene or a protein thereof in regulation and control of rice stem thickness, and further discloses a method for improving rice stem thickness. After the inventor uses CRISPR/Cas9 technology to knock out OsPIL16 gene, the stem thickness of rice is obviously improved, and the fact that the OsPIL16 gene can obviously regulate and control the stem thickness of the rice shows that the method has important theoretical and practical significance for genetic improvement of the stem thickness and cultivation of lodging resistance of the rice.

Description

Application of OsPIL16 gene or protein thereof in regulation and control of rice stem thickness

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to an application of an OsPIL16 gene or protein thereof in regulation and control of rice stem thickness.

Background

In recent years, with the increasing population, the worsening environment and the decreasing cultivated land area, the rice productivity and planting area are decreasing, resulting in that the rice yield is facing a severe crisis. Increasing yield has become an important task in rice production, however, with high yield is the problem of lodging. After the rice is lodging, the canopy structure of the plant is damaged, the photosynthetic capacity is weakened, and the setting rate and the thousand seed weight are reduced. Meanwhile, the appearance, cooking taste and nutritional quality of the rice are also seriously influenced. The lodging resistance of rice is determined by the shape of the stem, wherein the influence of the stem thickness on lodging resistance is large. Therefore, the genetic mechanism related to the increase of the stem thickness of rice itself has been the focus of research of rice genetic breeders.

The stem thickness of rice is an important influence factor influencing lodging resistance and rice yield, is a typical quantitative character, is controlled by a plurality of genes, and is researched by a plurality of scholars at home and abroad. Through years of research, certain achievements are achieved in the aspect of molecular genetic mechanism of rice stem thickness at present, but the number of genes available for breeding is small, and reports of improving the rice stem thickness through a genetic engineering technology are quite limited, so that the selection of genes available for breeding by utilizing the genetic engineering technology is the key point of research.

The OsPIL16 gene is a member of the cytochrome-interacting factor (PIF) family in rice and is identified in the rice genome by homology analysis by Nakamura et al (2007). At present, the gene is known to participate in the aspects of plant height, spike length, tiller number regulation, environmental tolerance and the like of rice, and reports related to the stem thickness of the rice are not found.

Disclosure of Invention

The invention provides application of OsPIL16 gene or protein thereof in regulation and control of rice stem thickness, provides a good theoretical basis for genetic improvement of stem thickness and cultivation of rice lodging resistance and high yield, and also provides a scientific basis for further fully exploiting rice production potential and improving rice yield.

The technical scheme provided by the invention is as follows:

the OsPIL16 protein composed of the amino acid sequence shown in SEQ ID NO. 1 or the gene which is shown in SEQ ID NO. 2 and codes the protein or the expression cassette, the recombinant vector and the recombinant microorganism which contain the gene are applied to the regulation and control of the stem thickness of rice.

Furthermore, the rice stem thickness is regulated and controlled to improve the rice stem thickness.

The invention also provides a method for improving the rice stem thickness, which can inhibit the expression of the rice OsPIL16 gene and/or reduce the activity of the protein coded by the OsPIL16 gene.

The invention also provides a method for cultivating rice with thick stems, which selects rice plants with reduced or no expression of OsPIL16 gene expression level, reduced or no expression of OsPIL16 protein expression level and/or reduced or no activity of OsPIL16 gene protein to obtain rice with thick stems.

Further, in breeding rice, at least one parent is the rice with thick stalk according to claim 4.

Furthermore, the OsPIL16 gene in rice is knocked out.

The invention also provides a method for cultivating high-yield rice, which selects rice plants with reduced or no expression of OsPIL16 gene expression level, reduced or no expression of OsPIL16 protein expression level and/or reduced or no activity of OsPIL16 gene protein to obtain rice with thick stems.

Furthermore, the OsPIL16 gene in rice is knocked out.

The invention also provides a method for cultivating lodging-resistant rice, which selects rice plants with reduced or no expression of OsPIL16 gene expression level, reduced or no expression of OsPIL16 protein expression level and/or reduced or no activity of OsPIL16 gene protein to obtain rice with thick stems.

Furthermore, the OsPIL16 gene in rice is knocked out.

The invention aims to provide a new application of rice OsPIL16 gene.

The invention provides application of a rice OsPIL16 gene or a protein thereof in regulation and control of rice stem thickness.

The invention also provides application of the OsPIL16 gene or the protein thereof in screening of rice with thick stems.

The invention also provides a method for screening the rice with thick stems, which comprises the following steps:

selecting rice plants with reduced or no expression of OsPIL16 gene expression level, reduced or no expression of OsPIL16 protein expression level, and/or reduced or no activity of OsPIL16 gene protein.

Advantageous effects

The rice stem thickness is a key factor influencing the rice yield and lodging resistance, and researches also find that the yield is increased along with the increase of the rice stem thickness and the grain number of ears in a linear relation. Meanwhile, the rice stem becomes thick, the lodging resistance is also enhanced, the photosynthesis of rice is promoted, the filling of rice is promoted, and the increase of the rice yield can be further promoted, so that the screening of the gene capable of thickening the rice stem has important significance for the increase of the rice yield. We find that after the OsPIL16 gene in rice is knocked out, the stem thickness is obviously improved, the lodging resistance is improved, the yield is also increased, a good theoretical basis is provided for genetic improvement of the stem thickness and cultivation of lodging resistance and high yield of the rice, a scientific basis is provided for further fully exploiting the rice production potential and improving the rice yield, and the application prospect is good.

Drawings

FIG. 1 is an electrophoretogram of OsPIL16 overexpression strain OE 22: m: marker DL 2000; 1-10: T ₂ Identifying PCR product bands by the generative pure line, 11, negative control; 12 positive control, plasmid

FIG. 2 shows the expression level analysis of OsPIL16 in over-expression strains OE9 and OE22

FIG. 3 is a graph comparing the stem thicknesses of different rice lines;

FIG. 4 is a statistical chart of different rice lines.

Detailed Description

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Example 1 construction and characterization of OsPIL16 overexpression lines

Construction of overexpression vector of OsPIL16 gene

The full length OsPIL16 gene (SEQ ID NO:2) has been cloned from Nipponbare in the early stage, and OsPIL16 encodes a protein consisting of 506 amino acids (SEQ ID NO: 1). Then carrying out double enzyme digestion on a p1011 vector containing BamHI + KpnI enzyme digestion sites, adding homologous arms with sequences at two ends of the vector enzyme digestion sites at two ends of OsPIL16, recovering the enzyme digested vector and OsPIL16 with the homologous arms by using a DNA recovery kit, carrying out homologous recombination on OsPIL16 and the enzyme digested vector, naming the obtained vector as p1011-OsPIL16, sending the vector to a Baige gene company for rice transformation, obtaining T0 generation transgenic seedlings, and identifying positive seedlings.

OsPIL16 full-length sequence in Nipponbare (SEQ ID NO:2, 1518bp)

ATGCTACGCGGGAACGACACCGGCAGCGACCTGGCCGAGCTGCTCTGGGACAACGGCGCCCCGGCGCCGCTCAGGCCGCCTCCGCCTCCGCCCTTCCAGCCCTTCACCTGCAGCGCCGCCGCCACCACGTCGCCGCCGGCGCACGACTACCTCTTCATCAAGAATCTCATGCGGGGCGGCGGCGCCGCCAACCACCACCACCACGATGACGATGACGACGACGACGACGACGTGCCGTGGTTGCATTACCACCCTGTCGTGGACGACGACGACGACGCCGACGCTGACACGGCGCCGCTGCCTCCCGACTACTGCGCCGCCTTGCTCTCCGGCCTCTCCGACCACCTCCCGCCGCCCGCCGCTGCGGCGAGCAGGGTGGACCCCGACCCCTGCTCCTCCTCCCACGGCGCCGTCGTCCCGTCCACGTCCGCCGCCGCCGCCAAGCAGGCTCGCACGAGCGGCGGCGGCGGCGGCGGCGTCATGAACTTCACCTTCTTCTCGAGGCCTCTGCAGCAGCGCCCCTCCGGCGGCGAGACCGCGTCGGCGTCGGCGTCGGCGGCGGCCACCTCGACCGTCCCCGTCGAGTCGACGGTGGTGCAGGCGGCGACGAACCGGCTGAGAAGCACCCCGCTCTTCTCCGACCAGAGGATGGCATGGCTGCACCCGCCCAAGCCGTCGCCACGCGCCGCCGCACCGCCGCCGCCGCCGCCTCTGGCCCCTACCACTCGGCACCGACTCGACACCGCCGCCGCGACGGCGACGGTGGCGCAGAGGTTGCCGCCGTCCGAGGCAAGAGCTCCCGACGCGCCCCCGCCTGCCGCGACCGCGACGGCGACGACCTCGTCCGTCTGCTCCGGCAACGGCGACCGGAGACAGCTCAATTGGAGGGACAGCCACAACAACCAGTCCGCCGAGTGGTCGGCCAGTCAAGACGAGCTGGACCTCGACGACGAGCTCGCAGGCGTCCACCGGAGGTCGGCGGCGAGGAGCTCCAAGCGCAGCCGCACCGCCGAAGTCCACAACCTGTCAGAGCGGGTAAGCACACACACCATGCACCATCCACAACACCCGCGTCGTGTCATGACGTCATCTCATCTCGCCATTGAATTGCTTTCGAGCTCGCAGAGGAGAAGAGACCGGATCAACGAGAAGATGCGGGCGCTGCAAGAGCTCATCCCAAACTGCAACAAGATTGACAAGGCGTCGATGCTGGAGGAAGCCATCGAGTACCTCAAGACGCTGCAGCTGCAGGTGCAGATGATGTCGATGGGGACGGGGATGTTCGTGCCGCCGATGATGCTGCCGGCGGCGGCGGCGGCAATGCAGCACCACCACATGCAGATGCAGCAGATGGCCGGGCCAATGGCGGCGGCGGCGCATTTCCCCCACCTCGGCGCCGCCGCCGCCATGGGGCTCGCCGGCTTCGGCATGCCCGCCGCCGCGCAGTTCCCTTGCCCGATGTTCCCCGCCGCGCCGCCGATGTCCATGTTCGCGCCGCCGCCGCCGCCGCCGCCGTTCCCTCACGCGGCCGCCACCGCCGTCGAGCAGACGCCGTCTCCGCCGGGAGCAGCAGACGCCGGCAACGCCCCCGCCGTGAAGCAGGCGTGA。

OsPIL16 amino acid sequence (SEQ ID NO:1)

MLRGNDTGSDLAELLWDNGAPAPLRPPPPPPFQPFTCSAAATTSPPAHDYLFIKNLMRGGGAANHHHHDDDDDDDDDVPWLHYHPVVDDDDDADADTAPLPPDYCAALLSGLSDHLPPPAAAASRVDPDPCSSSHGAVVPSTSAAAAKQARTSGGGGGGVMNFTFFSRPLQQRPSGGETASASASAAATSTVPVESTVVQAATNRLRSTPLFSDQRMAWLHPPKPSPRAAAPPPPPPLAPTTRHRLDTAAATATVAQRLPPSEAKAPDAPPPAATATATTSSVCSGNGDRRQLNWRDSHNNQSAEWSASQARLDLDDELAGVHRRSAARSSKRSRTAEVHNLSERREKRPDQREDAGAARAHPKLQQVDKASMLEEAIEYLKTLQLQVQMMSMGTGMFVPPMMLPAAAAAMQHHHMQMQQMAGPMAAAAHFPHLGAAAAMGLAGFGMPAAAQFPCPMFPAAPPMSMFAPPPPPPPFPHAAATAVEQTPSPPGAADAGNAPAVKQA。

II, identification of overexpression pure line of OsPIL16 gene

DNA of the OsPIL16 transgenic positive plant is extracted by adopting a plant genome DNA extraction kit of Novophilia. Mu.l of transgenic rice DNA was used as a template for detection of the primers.

F:5’-:ATGCTCACCCTGTTGTTTGG-3’(SEQ ID NO.3)，

5'-CACGACAGGGTGGTAATGC-3' (SEQ ID NO.4) was subjected to PCR amplification,

the amplification conditions were: preheating for 5min at 95 ℃; 38 cycles of 95 ℃,30s,62 ℃,30s,72 ℃,15 s; 72 ℃ for 10 min.

A target fragment with the length of 313bp is amplified (shown in figure 2), the sequencing proves that the fragment is a fragment of a recombinant vector p1011-OsPIL16, the recombinant vector is transformed into rice, and more than 10 individuals are positive according to a pure line calculation method, namely, the strain is a pure line, so that the strain is named as OE22, and the early stage of OE9 is identified.

Example 2OsPIL16 knockout line construction and pure line identification

Constructing a knockout vector of OsPIL16 and transforming rice in Baige corporation, obtaining a positive seedling, identifying to obtain an OsPIL16 knockout strain pure line, and naming the pure line as OsPIL16-10, wherein knockout sites are as follows:

WT：ATGCTACGCGGGAACGACAC

ospil16-10：ATGCTACGCGGGAAC..CAC

example 3 determination of expression amounts of OsPIL16 overexpression and knockout lines

Extraction of total RNA of rice and synthesis of cDNA

Nipponbare, OE9, OE22 were grown to the trilobate one-heart stage, following the instruction for use of the product from the Takara company RNAisso Plus. The method comprises the steps of quickly grinding a rice sample into powder in liquid nitrogen, adding RNAioso Plus, placing on ice for a period of time after violent shaking, centrifuging, sucking supernatant, adding chloroform for extraction, and uniformly mixing the supernatant with equal amount of isopropanol to precipitate RNA. After removing isopropanol by centrifugation, washing the RNA precipitate with 75% alcohol, and after the alcohol is volatilized, dissolving the RNA with DEPC water. The cDNA is then reverse transcribed with the extracted total RNA. PrimeScript of Takara was used for cDNA ^TM RT Master Mix (Perfect Real Time) reagent synthesis.

Second, fluorescent quantitative PCR analysis of gene expression

Gene expression was quantitatively analyzed by fluorescence using a 7300 fluorescence quantitative analyzer from ABI. The reference gene is qUBI. The primers of the reference gene and the target gene are as follows:

qUBI-F 5'-TGGTCAGTAATCAGCCAGTTTGG-3'(SEQ ID NO.5)

qUBI-R 5'-GCACCACAAATACTTGACGAACAG-3'(SEQ ID NO.6)

qOsPIL16-F1 5'-CTCCGCCCTTCCAGCCCT-3'(SEQ ID NO.7)

qOsPIL16-R1 5'-CGCCCCGCATGAGATTCTTG-3'(SEQ ID NO.8)

the expression level of OsPIL16 in Nipponbare, OE9 and OE22 is shown in FIG. 2.

Example 4 verification of effect of OsPIL16 on regulation of rice stem thickness

The identified OsPIL16 knock-out strain OsPIL16-10(16-10) and overexpression strains OE9 and OE22 are planted in the lower river farmlands in the city of Yangzhou respectively, and after the plants are mature, the plants are harvested and the stem thickness is counted.

Among them, 30 WT (wild type) strains were counted, 30 knockout strains 16-10 were counted, and 30 overexpression strains OE9 and OE22 were counted, respectively.

Statistical data was analyzed using software as prism5.0, with the analysis method being One-way ANOVA.

The statistical results are shown in Table 1.

The table is labeled: significant difference compared to WT; the differences were very significant.

TABLE 1 Stem thickness statistics of different Rice lines

Line of plants	Stem diameter (mm)
		WT	4.08±0.34
OE9	3.23±0.23**
		OE22	3.19±0.18**
16-10	4.74±0.22**

As can be seen from table 1, compared with the wild type variety, the stem thickness of the OsPIL16 overexpression strain was significantly narrowed, while the stem thickness of the OsPIL16 knockout strain was significantly widened, indicating that OsPIL16 plays an important role in controlling the stem thickness of rice.

In conclusion, the OsPIL16 gene can obviously regulate and control the stem thickness of rice, and can be used for genetic improvement of the stem thickness and improvement of lodging resistance and yield.

Sequence listing

<110> Yangzhou university

<120> application of OsPIL16 gene or protein thereof in regulation and control of rice stem thickness

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 505

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Leu Arg Gly Asn Asp Thr Gly Ser Asp Leu Ala Glu Leu Leu Trp

1 5 10 15

Asp Asn Gly Ala Pro Ala Pro Leu Arg Pro Pro Pro Pro Pro Pro Phe

20 25 30

Gln Pro Phe Thr Cys Ser Ala Ala Ala Thr Thr Ser Pro Pro Ala His

35 40 45

Asp Tyr Leu Phe Ile Lys Asn Leu Met Arg Gly Gly Gly Ala Ala Asn

50 55 60

His His His His Asp Asp Asp Asp Asp Asp Asp Asp Asp Val Pro Trp

65 70 75 80

Leu His Tyr His Pro Val Val Asp Asp Asp Asp Asp Ala Asp Ala Asp

85 90 95

Thr Ala Pro Leu Pro Pro Asp Tyr Cys Ala Ala Leu Leu Ser Gly Leu

100 105 110

Ser Asp His Leu Pro Pro Pro Ala Ala Ala Ala Ser Arg Val Asp Pro

115 120 125

Asp Pro Cys Ser Ser Ser His Gly Ala Val Val Pro Ser Thr Ser Ala

130 135 140

Ala Ala Ala Lys Gln Ala Arg Thr Ser Gly Gly Gly Gly Gly Gly Val

145 150 155 160

Met Asn Phe Thr Phe Phe Ser Arg Pro Leu Gln Gln Arg Pro Ser Gly

165 170 175

Gly Glu Thr Ala Ser Ala Ser Ala Ser Ala Ala Ala Thr Ser Thr Val

180 185 190

Pro Val Glu Ser Thr Val Val Gln Ala Ala Thr Asn Arg Leu Arg Ser

195 200 205

Thr Pro Leu Phe Ser Asp Gln Arg Met Ala Trp Leu His Pro Pro Lys

210 215 220

Pro Ser Pro Arg Ala Ala Ala Pro Pro Pro Pro Pro Pro Leu Ala Pro

225 230 235 240

Thr Thr Arg His Arg Leu Asp Thr Ala Ala Ala Thr Ala Thr Val Ala

245 250 255

Gln Arg Leu Pro Pro Ser Glu Ala Lys Ala Pro Asp Ala Pro Pro Pro

260 265 270

Ala Ala Thr Ala Thr Ala Thr Thr Ser Ser Val Cys Ser Gly Asn Gly

275 280 285

Asp Arg Arg Gln Leu Asn Trp Arg Asp Ser His Asn Asn Gln Ser Ala

290 295 300

Glu Trp Ser Ala Ser Gln Ala Arg Leu Asp Leu Asp Asp Glu Leu Ala

305 310 315 320

Gly Val His Arg Arg Ser Ala Ala Arg Ser Ser Lys Arg Ser Arg Thr

325 330 335

Ala Glu Val His Asn Leu Ser Glu Arg Arg Glu Lys Arg Pro Asp Gln

340 345 350

Arg Glu Asp Ala Gly Ala Ala Arg Ala His Pro Lys Leu Gln Gln Val

355 360 365

Asp Lys Ala Ser Met Leu Glu Glu Ala Ile Glu Tyr Leu Lys Thr Leu

370 375 380

Gln Leu Gln Val Gln Met Met Ser Met Gly Thr Gly Met Phe Val Pro

385 390 395 400

Pro Met Met Leu Pro Ala Ala Ala Ala Ala Met Gln His His His Met

405 410 415

Gln Met Gln Gln Met Ala Gly Pro Met Ala Ala Ala Ala His Phe Pro

420 425 430

His Leu Gly Ala Ala Ala Ala Met Gly Leu Ala Gly Phe Gly Met Pro

435 440 445

Ala Ala Ala Gln Phe Pro Cys Pro Met Phe Pro Ala Ala Pro Pro Met

450 455 460

Ser Met Phe Ala Pro Pro Pro Pro Pro Pro Pro Phe Pro His Ala Ala

465 470 475 480

Ala Thr Ala Val Glu Gln Thr Pro Ser Pro Pro Gly Ala Ala Asp Ala

485 490 495

Gly Asn Ala Pro Ala Val Lys Gln Ala

500 505

<210> 2

<211> 1608

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgctacgcg ggaacgacac cggcagcgac ctggccgagc tgctctggga caacggcgcc 60

ccggcgccgc tcaggccgcc tccgcctccg cccttccagc ccttcacctg cagcgccgcc 120

gccaccacgt cgccgccggc gcacgactac ctcttcatca agaatctcat gcggggcggc 180

ggcgccgcca accaccacca ccacgatgac gatgacgacg acgacgacga cgtgccgtgg 240

ttgcattacc accctgtcgt ggacgacgac gacgacgccg acgctgacac ggcgccgctg 300

cctcccgact actgcgccgc cttgctctcc ggcctctccg accacctccc gccgcccgcc 360

gctgcggcga gcagggtgga ccccgacccc tgctcctcct cccacggcgc cgtcgtcccg 420

tccacgtccg ccgccgccgc caagcaggct cgcacgagcg gcggcggcgg cggcggcgtc 480

atgaacttca ccttcttctc gaggcctctg cagcagcgcc cctccggcgg cgagaccgcg 540

tcggcgtcgg cgtcggcggc ggccacctcg accgtccccg tcgagtcgac ggtggtgcag 600

gcggcgacga accggctgag aagcaccccg ctcttctccg accagaggat ggcatggctg 660

cacccgccca agccgtcgcc acgcgccgcc gcaccgccgc cgccgccgcc tctggcccct 720

accactcggc accgactcga caccgccgcc gcgacggcga cggtggcgca gaggttgccg 780

ccgtccgagg caagagctcc cgacgcgccc ccgcctgccg cgaccgcgac ggcgacgacc 840

tcgtccgtct gctccggcaa cggcgaccgg agacagctca attggaggga cagccacaac 900

aaccagtccg ccgagtggtc ggccagtcaa gacgagctgg acctcgacga cgagctcgca 960

ggcgtccacc ggaggtcggc ggcgaggagc tccaagcgca gccgcaccgc cgaagtccac 1020

aacctgtcag agcgggtaag cacacacacc atgcaccatc cacaacaccc gcgtcgtgtc 1080

atgacgtcat ctcatctcgc cattgaattg ctttcgagct cgcagaggag aagagaccgg 1140

atcaacgaga agatgcgggc gctgcaagag ctcatcccaa actgcaacaa gattgacaag 1200

gcgtcgatgc tggaggaagc catcgagtac ctcaagacgc tgcagctgca ggtgcagatg 1260

atgtcgatgg ggacggggat gttcgtgccg ccgatgatgc tgccggcggc ggcggcggca 1320

atgcagcacc accacatgca gatgcagcag atggccgggc caatggcggc ggcggcgcat 1380

ttcccccacc tcggcgccgc cgccgccatg gggctcgccg gcttcggcat gcccgccgcc 1440

gcgcagttcc cttgcccgat gttccccgcc gcgccgccga tgtccatgtt cgcgccgccg 1500

ccgccgccgc cgccgttccc tcacgcggcc gccaccgccg tcgagcagac gccgtctccg 1560

ccgggagcag cagacgccgg caacgccccc gccgtgaagc aggcgtga 1608

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgctcaccc tgttgtttgg 20

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cacgacaggg tggtaatgc 19

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tggtcagtaa tcagccagtt tgg 23

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcaccacaaa tacttgacga acag 24

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctccgccctt ccagccct 18

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cgccccgcat gagattcttg 20

Claims

1. The OsPIL16 protein composed of the amino acid sequence shown in SEQ ID NO. 1 or the gene which is shown in SEQ ID NO. 2 and codes the protein or the expression cassette, the recombinant vector and the recombinant microorganism which contain the gene are applied to the regulation and control of the stem thickness of rice.

2. The use of claim 1, wherein the modulation of rice stem thickness is an increase in rice stem thickness.

3. A method for increasing the stem thickness of rice, which is characterized by inhibiting the expression of the OsPIL16 gene of rice and/or reducing the activity of protein coded by the OsPIL16 gene.

4. A method for cultivating rice with thick stem is characterized in that rice plants with reduced or no expression of OsPIL16 gene, reduced or no expression of OsPIL16 protein and/or reduced or no activity of OsPIL16 gene protein are selected to obtain rice with thick stem.

5. The method of growing rice with brown-stem according to claim 4, wherein at least one parent of rice is rice with brown-stem according to claim 4.

6. The method of growing rice with brown stem according to claim 4, wherein OsPIL16 gene in rice is knocked out.

7. A method for cultivating high-yield rice is characterized in that rice plants with reduced or no expression of OsPIL16 gene, reduced or no expression of OsPIL16 protein and/or reduced or no activity of OsPIL16 gene protein are selected to obtain rice with thick stems.

8. A method of producing rice with high yield according to claim 7, wherein OsPIL16 gene in rice is knocked out.

9. A method for cultivating lodging-resistant rice is characterized in that rice plants with reduced or no expression of OsPIL16 gene expression level, reduced or no expression of OsPIL16 protein expression level and/or reduced or no activity of OsPIL16 gene protein are selected to obtain rice with thick stems.

10. The method of claim 9, wherein the OsPIL16 gene in rice is knocked out.