CN114933654A - Antibodies targeting CD123, chimeric antigen receptors and uses thereof - Google Patents

Antibodies targeting CD123, chimeric antigen receptors and uses thereof Download PDF

Info

Publication number
CN114933654A
CN114933654A CN202210605703.1A CN202210605703A CN114933654A CN 114933654 A CN114933654 A CN 114933654A CN 202210605703 A CN202210605703 A CN 202210605703A CN 114933654 A CN114933654 A CN 114933654A
Authority
CN
China
Prior art keywords
antigen
antibody
cell
domain
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210605703.1A
Other languages
Chinese (zh)
Inventor
赵阳兵
朱庚振
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Youtijisheng Biomedical Co ltd
Original Assignee
Shanghai Youtijisheng Biomedical Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Youtijisheng Biomedical Co ltd filed Critical Shanghai Youtijisheng Biomedical Co ltd
Priority to CN202210605703.1A priority Critical patent/CN114933654A/en
Priority claimed from CN202180005561.9A external-priority patent/CN116018351A/en
Publication of CN114933654A publication Critical patent/CN114933654A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001116—Receptors for cytokines
    • A61K39/001119—Receptors for interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C12N5/0638—Cytotoxic T lymphocytes [CTL] or lymphokine activated killer cells [LAK]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0646—Natural killers cells [NK], NKT cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5158—Antigen-pulsed cells, e.g. T-cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Abstract

anti-CD 123 antibodies and antigen-binding fragments, chimeric antigen receptors ("CARs") and antigen-binding fragments ("CD123 CARs") having such anti-CD 123 antibodies and antigen-binding fragments, and immune effector cells having genetic modifications of such CD123 CARs are disclosed. The invention also provides polynucleotides encoding anti-CD 123 antibodies and antigen-binding fragments, and CD123 CARs. The invention further provides compositions comprising CD123 antibodies and antigen-binding fragments, and CD123 CARs. The invention also relates to anti-CD 123 antibodies and antigen-binding fragments and the use of immune effector cells with genetic modifications of such CD123 CARs in the treatment of cancer.

Description

Antibodies targeting CD123, chimeric antigen receptors and uses thereof
1. Field of the invention
The present invention relates to molecular biology, cell biology and immunooncology. In particular, the invention provides anti-CD 123 antibodies, Chimeric Antigen Receptors (CARs) comprising the anti-CD 123 antibodies ("CD123 CARs"), genetically engineered immune effector cells expressing the CD123 CARs, and their use in treating tumors or cancers.
2. Background of the invention
CD123 is widely expressed in various hematological malignancies, including Acute Myeloid Leukemia (AML), blast cell plasmacytoid dendritic cell tumor (BPDCN), B-cell precursor acute lymphoid leukemia (BCP-ALL). However, current therapies targeting CD123 have met with limited success. Therefore, there is an ongoing need to develop additional therapeutic options targeting CD 123. The present invention provides compositions and methods that meet these needs and provide other advantages.
3. Summary of the invention
The present invention provides an antibody or antigen-binding fragment thereof that specifically binds to CD123 (e.g., human CD123), comprising (a) a light chain variable region (VL) comprising (1) light chain CDR1(VL CDR1) having the amino acid sequence set forth in SEQ ID NO: 23; (2) a light chain CDR2(VL CDR2) having the amino acid sequence set forth in SEQ ID NO: 50; and (3) a light chain CDR3(VL CDR3) having the amino acid sequence set forth in SEQ ID NO: 82; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs; and/or (b) a heavy chain variable region (VH) comprising (1) a heavy chain CDR1(VH CDR1) having the amino acid sequence set forth in SEQ ID NO: 99; (2) heavy chain CDR2(VH CDR2) having the amino acid sequence set forth in SEQ ID NO: 129; and (3) heavy chain CDR3(VH CDR3) having the amino acid sequence set forth in SEQ ID NO: 157; or variants thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.
In some embodiments, the invention provides an antibody or antigen binding fragment, wherein (a) VL CDR1, CDR2, and CDR3 have the amino acid sequences of SEQ ID NOs 23, 50, and 82, respectively; or a variant thereof having substitutions, additions and/or deletions of up to about 5 amino acids in the VL CDRs; and/or (b) VH CDR1, CDR2 and CDR3 have the amino acid sequences of SEQ ID NOs:99, 129 and 157, respectively; or a variant thereof having substitutions, additions and/or deletions of up to about 5 amino acids in the VH CDRs.
In some embodiments, the antibodies or antigen-binding fragments provided herein comprise VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3, wherein (a) VL CDR1, CDR2, and CDR3 have the amino acid sequences of SEQ ID Nos 23, 50, and 82, respectively; and (b) VH CDR1, CDR2 and CDR3 have amino acid sequences of SEQ ID Nos:99, 129 and 157, respectively.
In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind to CD123 comprise: (a) a light chain variable region (VL) having at least 85%, at least 90%, at least 95%, at least 98% or 100% sequence identity to an amino acid sequence in the group represented by SEQ ID NO: 168; and/or, (b) a heavy chain variable region (VH) having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 203.
In some embodiments, the invention provides an antibody or antigen-binding fragment comprising a VL and a VH, wherein the VL and VH have the amino acid sequences of SEQ ID NO:168 and SEQ ID NO:203, respectively.
In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind to CD123 comprise: (a) a light chain variable region (VL) comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID NO: 168; and/or, (b) a heavy chain variable region (VH) comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a polypeptide having the amino acid sequence set forth in seq id No. b
VH of the amino acid sequence shown in SEQ ID NO. 203.
The invention also provides an antibody or antigen-binding fragment thereof that competes with any of the antibodies or antigen-binding fragments disclosed herein for binding to CD 123.
In some embodiments, the antibodies or antigen binding fragments provided herein are monoclonal antibodies or antigen binding fragments. In some embodiments, the antibodies or antigen-binding fragments provided herein are bispecific or multispecific antibodies or antigen-binding fragments. In some embodiments, the antibodies or antigen binding fragments provided herein are bispecific T cell engagers (bites).
In some embodiments, the antibodies or antigen binding fragments provided herein are selected from the group consisting of an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, and an IgG4 antibody. In some embodiments, the antibodies or antigen binding fragments provided herein are selected from the group consisting of Fab, Fab ', F (ab')2, Fv, scFv, (scFv)2, single domain antibodies (sdAb), and heavy chain antibodies (HCAb). In some embodiments, the antibody or antigen-binding fragment is an scFv.
In some embodiments, the antibodies or antigen-binding fragments provided herein are chimeric antibodies or antigen-binding fragments, humanized antibodies or antigen-binding fragments, or human antibodies or antigen-binding fragments. In some embodiments, the antibody or antigen-binding fragment is a human antibody or antigen-binding fragment.
The invention also provides polynucleotides encoding the antibodies or antigen-binding fragments provided by the invention. In some embodiments, the polynucleotide is a messenger rna (mrna).
The invention also provides a vector comprising any of the polynucleotides of the invention.
The invention also provides a host cell comprising any of the polynucleotides disclosed herein or any of the vectors disclosed herein.
The invention also provides a Chimeric Antigen Receptor (CAR) that specifically binds CD123, comprising from N-terminus to C-terminus: (a) a CD123 binding domain, said CD123 binding domain comprising an anti-CD 123 antibody or antigen-binding fragment disclosed herein; (b) a transmembrane domain; and (c) a cytoplasmic domain.
In some embodiments, the transmembrane domain in the CARs disclosed herein is derived from CD8, CD28, CD3 ζ, CD4,4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3,2B4, BTLA, TCR α chain, TCR β chain, or TCR ζ chain, CD3 epsilon, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, or CD 154.
In some embodiments, the transmembrane domain in the CARs disclosed herein comprises the CD8 transmembrane region or the CD28 transmembrane region.
In some embodiments, the cytoplasmic domain in the CARs disclosed herein comprises a signaling domain derived from CD3 ζ, FcR γ, fcyriia, FcR β, CD3 γ, CD3 δ, CD3 epsilon, CD5, CD22, CD79a, CD79b, DAP10, DAP12, or any combination thereof.
In some embodiments, the cytoplasmic domain in the CARs of the present disclosure further comprises a co-stimulatory domain derived from CD28, 4-1BB (CD137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, GITR, TLR, DR3, CD43, or any combination thereof.
In some embodiments, the cytoplasmic domain in the CARs disclosed herein comprises a CD3 zeta signaling domain and a 4-1BB costimulatory domain. In some embodiments, the cytoplasmic domain in the CARs disclosed herein comprises a CD3 zeta signaling domain and a CD28 costimulatory domain.
In some embodiments, the CARs disclosed herein further comprise a CD8 hinge between the antibody or antigen binding fragment and the transmembrane domain.
In some embodiments, the CARs specifically binding to CD123 disclosed herein comprise the amino acid sequence shown by SEQ ID NO 369.
The invention also provides a polynucleotide encoding a CAR that specifically binds CD123 as disclosed herein. In some embodiments, the polynucleotide is messenger rna (mrna). The invention also provides a vector comprising any of the polynucleotides of the invention.
The invention also provides a cell comprising any of the polynucleotides disclosed herein or any of the vectors disclosed herein. In some embodiments, the cell is an immune effector cell. In some embodiments, the cells are derived from cells isolated from peripheral blood or bone marrow. In some embodiments, the cells are derived from cells differentiated in vitro from stem cells or progenitor cells selected from the group consisting of T cell progenitors, hematopoietic stem/progenitors, hematopoietic multipotent progenitors, embryonic stem cells, and induced pluripotent cells. In some embodiments, the cell is a T cell or an NK cell.
In some embodiments, the cell is a cytotoxic T cell, a helper T cell, a γ δ cell, a CD4+/CD8+ double positive T cell, a CD4+ T cell, a CD8+ T cell, a CD4/CD8 double negative T cell, a CD3+ T cell, a naive T cell, an effector T cell, a helper T cell, a memory T cell, a regulatory T cell, a Th0 cell, a Th1 cell, a Th2 cell, a Th3(Treg) cell, a Th9 cell, a Th17 cell, a Th α β helper cell, a Tfh cell, a stem cell memory TSCM cell, a central memory TCM cell, an effector memory TEM cell, or an effector memory TEMRA cell. In some embodiments, the cell is a cytotoxic T cell.
The invention also provides a cell population comprising any of the cells disclosed herein, wherein the cell population is derived from Peripheral Blood Mononuclear Cells (PBMCs), Peripheral Blood Lymphocytes (PBLs), Tumor Infiltrating Lymphocytes (TILs), cytokine induced killer Cells (CIKs), lymphokine activated killer cells (LAKs), or bone marrow infiltrating lymphocytes (mls).
The invention provides a pharmaceutical composition comprising a therapeutically effective amount of any of the antibodies or antigen-binding fragments disclosed herein and a pharmaceutically acceptable carrier.
The invention also provides a pharmaceutical composition comprising a therapeutically effective amount of any of the cells or cell populations disclosed herein and a pharmaceutically acceptable carrier.
The invention provides the use of any of the antibodies or antigen binding fragments provided by the invention in the treatment of cancer. The invention provides the use of any of the antibodies or antigen binding fragments provided herein in the manufacture of a medicament for the treatment of cancer.
The invention provides the use of any cell or cell population provided herein in the treatment of cancer. The invention provides the use of any cell or cell population provided herein in the manufacture of a medicament for the treatment of cancer.
The invention provides the use of any of the pharmaceutical compositions provided herein in the treatment of cancer. The invention provides the use of any of the pharmaceutical compositions provided herein in the manufacture of a medicament for the treatment of cancer.
In some embodiments of the disclosed uses, the antibody or antigen binding fragment cell, or population of cells is used in conjunction with additional therapies.
In some of the presently disclosed method or use embodiments, the cancer is a solid tumor. In some of the presently disclosed method or use embodiments, the cancer is a hematological cancer. In some embodiments, the cancer is leukemia. In some embodiments, the cancer is Acute Myeloid Leukemia (AML), B acute lymphoid leukemia (B-ALL), T acute lymphoid leukemia (T-ALL), B cell precursor acute lymphoid leukemia (BCP-ALL), or blast cell plasmacytoid dendritic cell tumor (BPDCN). In some embodiments, the cancer is a CD123 expressing cancer. In some embodiments, the cancer is AML expressing CD 123.
The present invention provides methods for preparing mRNA encoding an anti-CD 123 antibody or antigen-binding fragment, comprising in vitro transcription of a polynucleotide disclosed herein encoding an anti-CD 123 antibody or antigen-binding fragment disclosed herein. The invention also provides methods of making an mRNA encoding a CAR that specifically binds CD123, comprising transcribing in vitro a polynucleotide disclosed herein encoding a CAR disclosed herein that specifically binds CD 123.
The invention provides a method of making a cell capable of expressing a CAR that specifically binds CD123, comprising transferring into the cell a polynucleotide disclosed herein, wherein the polynucleotide encodes a CAR that specifically binds CD 123. In some embodiments, the polynucleotide is transferred by electroporation. In some embodiments, the polynucleotide is transferred by viral transduction. In some embodiments, a lentivirus, retrovirus, adenovirus, or adeno-associated virus is used for viral transduction. In some embodiments, the polynucleotide is transferred by a transposon system. In some embodiments, the transposable subsystem is Sleeping Beauty (Sleeping Beauty) or PiggyBac. In some embodiments, the polynucleotide is transferred using gene editing. In some embodiments, the polynucleotide is transferred by a CRISPR-Cas system, a ZFN system, or a TALEN system. In some embodiments, the cell is selected from the group consisting of a T cell, an NK cell, an NKT cell, a macrophage, a neutrophil, and a granulocyte.
4. Description of the drawings
FIG. 1 provides readings from two 96-well plates of an anti-human CD123-Fc monoclonal phage ELISA.
Figure 2 provides a schematic of a pDA-CAR vector for CAR mRNA production.
FIG. 3 provides FACS staining results showing the binding of anti-CD 123 scFv expressed in CART cells to CD123-Fc protein.
Figure 4 provides FACS staining results of isotype and anti-CD 123 antibodies on a549 cells electroporated with varying amounts of CD123 mRNA.
Figure 5 provides killing curves for a549-GFP tumor cells for different mRNA-based anti-CD 123 CART cells at an E/T ratio of 10: 1.
Figure 6 provides killing curves for a549-GFP tumor cells for different mRNA-based anti-CD 123 CART cells at an E/T ratio of 3: 1.
Figure 7 provides killing curves for different mRNA-based anti-CD 123 CART cells against a549-GFP tumor cells electroporated with 10 μ g of CD123mRNA at an E/T ratio of 10: 1.
Figure 8 provides killing curves for different mRNA-based anti-CD 123 CART cells against a549-GFP tumor cells electroporated with 10 μ g of CD123mRNA at an E/T ratio of 3: 1.
FIG. 9 shows the FACS staining results of PE-isotype control and PE-anti-CD 123 mAb on A549, SK-OV3, Jeko-1, Molm-14, SupT-1, 293T, Nalm-6 and PC-3 cells.
FIG. 10 shows CD107a staining of anti-CD 123-C5, anti-CD 123-C7, anti-CD 123-C11 CART cells in co-culture and killing assays with different tumor cells.
5. Detailed description of the preferred embodiments
Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments set forth herein, and that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
The present invention provides novel antibodies that include antigen-binding fragments that specifically bind to CD123 (e.g., human CD 123). In addition, the invention provides Chimeric Antigen Receptors (CARs) comprising an antibody or antigen-binding fragment that specifically binds CD123 (e.g., human CD123), engineered immune effector cells (e.g., T cells), and populations of cells that recombinantly express CARs (e.g., CARs) that specifically bind CD123 (e.g., human CD 123). Also disclosed are pharmaceutical compositions comprising a therapeutically effective amount of the antibodies or antigen-binding fragments, and pharmaceutical compositions comprising a therapeutically effective amount of a cell or cell population. The invention also discloses uses of the pharmaceutical composition for treating cancer (e.g., CD123 expressing cancer) and methods of cancer treatment.
The cyclin 123 homologue, or CD123 (otherwise known as interleukin 3 receptor alpha subunit, IL3RA, HT-1080, PZ32), is a type I transmembrane glycoprotein with a Molecular Weight (MW) of approximately 70 kDa. Exemplary amino acid sequences of human CD123 are found, for example, in the NCBI reference sequence: NP _002174.1, XP _ 005274488.1. Exemplary polynucleotides encoding human CD123 and equivalents are described, for example, in NCBI reference sequence: NM _002183.3, XM _ 005274431.4). An exemplary amino acid sequence of human CD123 is shown below (SEQ ID NO: 321). The extracellular region of CD123 includes three fibronectin type (FnIII) domains that bind IL-3. The extracellular region of CD123 includes amino acid residues 19-305 of SEQ ID NO 321. The transmembrane domain of CD123 comprises amino acid residues 306-325 of SEQ ID NO 321. The cytoplasmic domain of CD123 comprises amino acid residues 326-378 of SEQ ID NO 321.
1 MVLLWLTLLL IALPCLLQTK EDPNPPITNL RMKAKAQQLT WDLNRNVTDI ECVKDADYSM
61 PAVNNSYCQF GAISLCEVTN YTVRVANPPF STWILFPENS GKPWAGAENL TCWIHDVDFL
121 SCSWAVGPGA PADVQYDLYL NVANRRQQYE CLHYKTDAQG TRIGCRFDDI SRLSSGSQSS
181 HILVRGRSAA FGIPCTDKFV VFSQIEILTP PNMTAKCNKT HSFMHWKMRS HFNRKFRYEL
241 QIQKRMQPVI TEQVRDRTSF QLLNPGTYTV QIRARERVYE FLSAWSTPQR FECDQEEGAN
301 TRAWRTSLLI ALGTLLALVC VFVICRRYLV MQRLFPRIPH MKDPIGDSFQ NDKLVVWEAG
361 KAGLEECLVT EVQVVQKT(SEQ ID NO:321)
CD123 binds IL-3 alone with low affinity, and when CD123 forms a complex with the common beta chain and binds IL-3 again, with high affinity. Functionally, CD123 alone binds IL-3 without transducing signal, requiring a common β -chain for downstream signal transduction (Kitamura et al (1991) Cell 66(6): 1165-.
CD123 is reported to be constitutively expressed in monocytes, neutrophils, basophils, eosinophils, megakaryocytes, pre-erythrocytic cells, mast cells, macrophages, hematopoietic stem/progenitor cells, and some CD19+ cells in normal tissues and cells (Testa et al (2014). CD123 outside the hematopoietic system is reported to be expressed in leydig cells, some endothelial cells, and cells of the placenta and brain.
Testa and colleagues systematically studied the expression of CD123 in 79 AML patients, 25 cases of B-acute lymphoblastic leukemia (B-ALL) and 7 cases of T-acute lymphoblastic leukemia (T-ALL). The results showed that CD123 was overexpressed in 40% of B-ALL patients and 45% of AML patients, respectively, and hardly expressed in most of T-ALL patients. They also reported that CD123 expression is closely associated with increased cell proliferation, increased circulatory activity, and poor prognosis (Testa et al (2002) Blood 100(8): 2980-2988). In another study, 846 acute leukemia patients were assessed for CD123 expression levels by detailed flow cytometry analysis, including 139 children AML, 316 adult AML, 193 children BCP-ALL, 69 adult BCP-ALL, 101 children T-ALL and 28 adult T-ALL patients. The results showed that CD123 was expressed in most AML and BCP-ALL patients and not in most T-ALL patients (Bras et al (2019) Cytometry B Clin Cytom 96(2): 134: 142.).
Rollins-Raval and colleagues reported that 40% of AML patients abnormally expressed CD123 based on CD123 Immunohistochemical (IHC) staining of 157 AML bone marrow biopsies. They also found that overexpression of CD123 in AML patients was associated with FLT3-ITD and NPM1 mutations (Rollins-Raval et al (2013) Appl Immunohistochem Mol morphine 21(3): 212-217). In addition to AML and BCP-ALL, other studies have also shown that CD123 is overexpressed in hairy cell leukemia and Hodgkin lymphoma tumor cells (Munoz et al (2001) Haematologica 86(12): 1261-.
Taken together, CD123 is widely expressed in a variety of hematological malignancies, including Acute Myeloid Leukemia (AML), blast cell plasmacytoid dendritic cell tumor (BPDCN), B-cell precursor acute lymphoblastic leukemia (BCP-ALL) (Liu et al (2015), Life Sci 122:59-64, Testa et al (2019), cancers (Basel)11 (9)). Various therapies targeting CD123 have entered clinical trials, but with limited success (Frankel et al (2014) Blood 124 (3): 385-. To address the unmet need, the present invention provides novel cancer therapies comprising targeting CD123 with improvements in both efficacy and safety.
5.1 definition of
Unless defined otherwise, scientific and technical terms used herein shall have the meanings that are commonly understood by those of ordinary skill in the art. Furthermore, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. In general, the use and techniques of the cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization-related terms described herein are all terms well known and commonly used in the art.
The term "antibody" and grammatical equivalents thereof, as used herein, refers to an immunoglobulin molecule that recognizes and specifically binds a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combination of any of the foregoing, through at least one antigen binding site, typically within the variable region of the immunoglobulin molecule. As used herein, the term includes intact polyclonal antibodies, intact monoclonal antibodies, single domain antibodies (sdabs, e.g., camel antibodies, alpaca antibodies), single chain fv (scfv) antibodies, heavy chain antibodies (HCAbs), light chain antibodies (LCAbs), multispecific antibodies, bispecific antibodies, monospecific antibodies, monovalent antibodies, and any other modified immunoglobulin molecule (e.g., a dual variable region immunoglobulin molecule) that comprises an antigen binding site, so long as the antibody exhibits the desired biological activity. The antibodies also include, but are not limited to, mouse antibodies, camelid antibodies, chimeric antibodies, humanized antibodies, and human antibodies. The antibody may be any one of the five major immunoglobulins: IgA, IgD, IgE, IgG, and IgM or subclasses (isotypes) thereof (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), are referred to as α, δ, ε, γ, and μ, respectively, based on the identity of their heavy chain constant regions. The term "antibody" as used herein includes "antigen-binding fragments" of intact antibodies, unless explicitly stated otherwise. The term "antigen-binding fragment" as used herein refers to a portion or fragment of an intact antibody, which is the epitope variable region of an intact antibody. Examples of antigen binding fragments include, but are not limited to, Fab ', F (ab')2, Fv, linear antibodies, single chain antibody molecules (e.g., scFv), heavy chain antibodies (HCAbs), light chain antibodies (LCAbs), disulfide linked scFv (dsscfv), diabodies, triabodies, tetrabodies, minibodies, bivariable region antibodies (DVD), single variable region antibodies (sdabs, e.g., camel antibodies, alpaca antibodies), and single variable regions of heavy chain antibodies (VHH), as well as bispecific or multispecific antibodies formed from antibody fragments.
The term "heavy chain" when referring to an antibody refers to a polypeptide chain of about 50-70kDa wherein the amino terminal portion comprises the variable region of about 120-130 or more amino acids and the carboxy terminal portion comprises the constant region. Depending on the amino acid sequence of the heavy chain constant region, the constant region can be one of five different types, referred to as α, δ, ε, γ, and μ, respectively. The different heavy chains differ in size by the fact that α, δ and γ contain about 450 amino acids, whereas μ and ε contain about 550 amino acids. When combined with light chains, these different types of heavy chains produce five well-known antibodies, IgA, IgD, IgE, IgG and IgM, respectively, and also four subclasses of IgG, i.e., IgGl, IgG2, IgG3 and IgG 4. The heavy chain may be a human heavy chain.
The term "light chain" when referring to an antibody, refers to a polypeptide chain of about 25kDa wherein the amino terminal portion comprises the variable region of about 100-110 or more amino acids and the carboxy terminal portion comprises the constant region. The light chain is approximately 211 to 217 amino acids in length. There are two different types, called λ and κ, respectively, depending on the amino acid sequence of the constant domain. Light chain amino acid sequences are well known in the art. The light chain may be a human light chain.
The term "variable domain" or "variable region" refers to a portion of an antibody light or heavy chain, typically located at the amino-terminus of the light or heavy chain, which is about 120-130 amino acids in the heavy chain and about 100-110 amino acids in the light chain, and which can be used for the binding and specificity of each particular antibody for its particular antigen. Variable domains differ greatly in sequence between different antibodies. The variability of the sequence is concentrated in the CDRs, and the less variable portions of the variable domains are called Framework Regions (FRs). The CDRs of the light and heavy chains are primarily responsible for antibody-antigen interactions. The numbering OF amino acid positions used in the present invention is according to the EU index, e.g. Kabat al. (1991), SEQUENCES OF PROTEINS OF IMMUNOLOGICAL INTEREST (U.S. Deparatment OF Health and Human Services, Washington, D.C.)5 th ed. The variable region may be a human variable region.
A CDR refers to one of the three hypervariable regions (H1, H2, or H3) in the non-framework region of the β -sheet framework in an immunoglobulin (Ig or antibody) VH, or one of the three hypervariable regions (L1, L2, or L3) within the non-framework region of the β -sheet framework in an antibody VL. Thus, the CDRs are variable region sequences interspersed within framework region sequences. CDR regions are well known to those skilled in the art and have been labeled by various methods/systems. These systems and/or markers have been developed and perfected for many years, including Kabat, Chothia, IMGT, AbM, and Contact. For example, Kabat designates the most hypervariable regions within the variable (V) domain of antibodies (Kabat et al, J.biol.chem.252:6609-6616 (1977); Kabat, adv.prot.chem.32:1-75 (1978)). Chothia labeling is based on the location of the structural loop region, defining CDR region sequences as residues that are not part of the conserved β -sheet framework, and thus are able to accommodate different conformations (Chothia and Lesk, J.mol.biol.196:901-917 (1987)). Both terms are well known in the art. Furthermore, the IMGT system is based on sequence variability and location within the variable region structure. AbM labeling is a compromise between Kabat and Chothia. Contact labeling is based on analysis of the crystal structure of available antibodies. Software programs (e.g., abYsis) for analyzing antibody sequences and determining CDRs are available and well known to those of skill in the art. By comparing various structures, the position of the CDRs within a typical antibody variable domain was determined (Al-Lazikani et Al, J.mol.biol.273: 927-279 (1997); Morea et Al, Methods 20:267-279 (2000)). Because of the different numbers of residues within hypervariable regions in different antibodies, in the canonical variable region numbering scheme, additional residues relative to the standard positions are often numbered a, b, c, etc. next to the number of residues (Al-Lazikani et Al, supra (1997)). Such nomenclature is likewise well known to those skilled in the art.
For example, the CDRs, labeled according to Kabat (hypermutation) or Chothia (structure) designations, are shown in the following table.
Kabat 1 Chothia 2 Loop Location
VHCDRl 31-35 26-32 linking B and C strands
VHCDR2 50-65 53-55 linking C’and C”strands
VHCDR3 95-102 96-101 linking F and G strands
VLCDRl 24-34 26-32 linking B and C strands
VLCDR2 50-56 50-52 linking C’and C”strands
VLCDR3 89-97 91-96 linking F and G strands
1 The residue numbering above follows the nomenclature of Kabat et al
2 The above residue numbering follows ChotNomenclature of hia et al
One or more CDRs may also be introduced covalently or non-covalently into the molecule to make it an immunoadhesin. Immunoadhesins can incorporate cdrs(s) as part of a larger polypeptide chain, can covalently link cdrs(s) to another polypeptide chain, or can non-covalently incorporate cdrs(s). The CDRs allow the immunoadhesin to bind to a specific antigen of interest. CDR regions can be analyzed, for example, by the abysis website (http:// abysis. org /).
The term "humanized antibody" as used herein refers to a form of non-human (e.g., murine) antibody that is a specific immunoglobulin chain, chimeric immunoglobulin or fragment thereof that contains minimal non-human sequences. Typically, the humanized antibody is a human immunoglobulin. In some cases, Fv framework region residues of the human immunoglobulin are replaced with corresponding residues in antibodies from non-human species. In some cases, the residues of the CDRs are substituted with residues from CDRs from a non-human species (e.g., mouse, rat, hamster, camel) that have the desired specificity, affinity, and/or binding capacity. Humanized antibodies may be further modified by the substitution of additional residues within the Fv framework regions and/or the substituted non-human residues to improve and optimize antibody specificity, affinity, and/or binding capacity. The term "human antibody" as used herein refers to an antibody produced by a human or an antibody having an amino acid sequence corresponding to an antibody produced by a human, prepared using any technique known in the art.
The terms "epitope" and "antigenic determinant" are used interchangeably herein and refer to a site on the surface of a target molecule to which an antibody or antigen-binding fragment binds, e.g., a localized region on the surface of an antigen. The target molecule may comprise a protein, peptide, nucleic acid, carbohydrate or lipid. The epitope having immunogenic activity is part of a target molecule that elicits an immune response in an animal. Epitopes of target molecules having antigenic activity are part of the target molecule to which the antibody binds and can be determined by any method known in the art, including immunoassays. An epitope need not be immunogenic. Epitopes often consist of chemically active surface groups of molecules, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics as well as specific charge characteristics. The term "epitope" includes linear epitopes and conformational epitopes. The region of the target molecule (e.g., polypeptide) contributing to the epitope may be contiguous amino acids of the polypeptide, or the epitope may be derived from two or more non-contiguous regions of the target molecule. An epitope may or may not be a three-dimensional surface feature of the target molecule. Epitopes formed by contiguous amino acids (also known as linear epitopes) are typically retained when proteins are denatured, while epitopes formed by tertiary folding (also known as conformational epitopes) are typically lost when proteins are denatured. Epitopes typically comprise at least 3, and more typically at least 5, 6, 7 or 8-10 amino acids in a unique spatial conformation.
The term "specifically binds" as used herein refers to the interaction of a polypeptide or molecule with an epitope, protein or target molecule that may be more frequent, rapid, longer lasting, higher affinity, or some combination of the above effects, as compared to a surrogate (including related and unrelated proteins). Binding moieties (e.g., antibodies) that specifically bind to a target molecule (e.g., an antigen) can be identified by immunoassays, ELISAs, SPR (e.g., Biacore), or other techniques known to those skilled in the art. Typically, the specific response will be at least twice the background signal or noise, and may be more than 10 times the background. See, for example, discussion of antibody specificity, Paul, ed.,1989, Fundamental Immunology SECOND, Raven Press, New York at pages 332-. A binding moiety that specifically binds a target molecule can bind the target molecule with a higher affinity than its affinity for a different molecule. In some embodiments, the binding moiety that specifically binds to the target molecule has at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, or 100-fold less affinity for the target molecule than for a molecule other than the target molecule. In some embodiments, a binding moiety that specifically binds to a particular target molecule binds to a molecule other than the target molecule with such low affinity that the binding cannot be detected using an assay described herein or known in the art. In some embodiments, "specifically binds" means that the binding moiety is present at about 0.1m M or lower K D Binding to the molecular target. In some embodiments, "specifically binds" means that the polypeptide or molecule has a K of about 10. mu.M or less D Or at a K of about 1 μ M or less D Binding the target. In some embodiments, "specifically binds" means that the polypeptide or molecule has a K of about 0.1. mu.M or less D Or at a K of about 0.01 μ M or less D Or at a K of about 1nM or less D Binding the target. Due to sequence identity between homologous proteins in different species, specific binding may include polypeptides or molecules that recognize proteins or targets in multiple species. Likewise, due to homology within certain regions of the polypeptide sequences of different proteins, specific binding may include polypeptides or molecules that recognize multiple proteins or targets. It is to be understood that, in some embodiments, a binding moiety (e.g., an antibody) that specifically binds a first target may or may not specifically bind a second target. Thus, "specific binding" does not necessarily require (although may include) exclusive binding, i.e. binding to a single target. Thus, in some embodiments, a binding moiety (e.g., an antibody) can specifically bind to multiple targets. For example, in certain instances, an antibody may comprise two identical antigen binding sites, each of which specifically binds to the same epitope on two or more proteins. In certain alternative embodiments, the antibody may be bispecific and comprise at least two antigen binding sites with different specificities.
The term "binding affinity" as used herein generally refers to the strength of the sum of the non-covalent interactions between a binding moiety (e.g., an antibody) and a molecular target (e.g., an antigen). The binding of the binding moiety to the molecular target is a reversible process, the affinity of which is usually expressed as the equilibrium dissociation constant (K) D )。K D Is the dissociation rate (k) off Or k d ) And the rate of binding (k) on Or k a ) Is measured in the measurement. K of a binding pair D The lower the affinity, the higher the affinity. A variety of methods are known in the art for measuring binding affinity, any of which may be used in the present invention. Specific illustrative embodiments include the following. In some embodimentsIn, K D "or" K D The value "can be measured by assay methods known in the art, e.g., binding assays. K can be determined using the radiolabeled antigen binding assay (RIA) D (Chen,et al.,(1999)J.Mol Biol 293:865-881)。K D Or K D Values may also be measured by Biacore using surface plasmon resonance assays, e.g. using Biacore (tm) -2000 or Biacore (tm) -3000(Biacore, inc., Piscataway, NJ), or by biolayer interferometry, e.g. using the OctetQK384 system (ForteBio, Menlo Park, CA).
The term "variant" as used herein in relation to a protein or polypeptide having a particular sequence characteristic ("reference protein" or "reference polypeptide"), refers to a different protein or polypeptide that includes one or more (e.g., about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, or about 1 to about 5) amino acid substitutions, deletions, and/or additions as compared to the reference protein or reference polypeptide. The change in amino acid sequence may be an amino acid substitution. The change in amino acid sequence may be a conservative amino acid substitution. A functional fragment or functional variant of a protein or polypeptide retains the basic structural and functional properties of a reference protein or polypeptide.
The terms "polypeptide", "peptide", "protein" and grammatical equivalents thereof, as used interchangeably herein, refer to a polymer of amino acids of any length, which may be linear or branched. It may include unnatural or modified amino acids, or be interrupted by non-amino acids. The polypeptide, peptide or protein may also be modified, for example by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other manipulation or modification.
The terms "polynucleotide", "nucleic acid" and grammatical equivalents thereof, used interchangeably herein, refer to a polymer of nucleotides of any length, including DNA and RNA. The nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or may be bound to any substrate in the polymer by DNA or RNA polymerase.
The term "identity," percent "identity," and grammatical equivalents thereof, as used herein in the context of two or more polynucleotides or polypeptides, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, regardless of any conservative amino acid substitutions as part of sequence identity, when compared and aligned (gaps introduced, if necessary) to obtain maximum correspondence. The percentage of sequence can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain an amino acid or nucleotide sequence alignment are well known in the art. These algorithms or software include, but are not limited to, BLAST, ALIGN, Megalign, BestFit, GCG Wisconsin Package, and variants thereof. In some embodiments, the two polynucleotides or polypeptides provided herein are substantially identical, meaning that they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity when compared and aligned for maximum correspondence using a sequence comparison algorithm or by visual inspection. In some embodiments, identity exists over a region of an amino acid sequence that is at least about 10 residues, at least about 20 residues, at least about 40-60 residues, at least about 60-80 residues, or any integer value therebetween in length. In some embodiments, identity exists over a region that is longer than 60-80 residues, e.g., at least about 80-100 residues, and in some embodiments, these sequences are substantially identical over the entire length of the sequences being compared, e.g., the coding region of the protein or antibody of interest. In some embodiments, identity exists over a region of a nucleotide sequence that is at least about 10 bases in length, at least about 20 bases in length, at least about 40-60 bases in length, at least about 60-80 bases in length, or any integer value therebetween. In some embodiments, identity exists over a region longer than 60-80 bases, such as at least about 80-1000 bases or more, and in some embodiments, these sequences are substantially identical over the entire length of the sequences being compared, such as nucleotide sequences encoding proteins of interest.
The term "vector" and its grammatical equivalents as used herein refers to a vector for carrying genetic material (e.g., a polynucleotide sequence) that can be introduced into, replicated in, and/or expressed in a host cell. Vectors that can be used include, for example, expression vectors, plasmids, phage vectors, viral vectors, episomes, and artificial chromosomes, which can include a selection sequence or marker operable for stable integration into the chromosome of the host cell. In addition, the vector may include one or more selectable marker genes and appropriate expression control sequences. The selectable marker gene that may be included can, for example, provide resistance to antibiotics or toxins, supplement auxotrophy, or provide key nutrients not present in the culture medium. The expression control sequences may include constitutive and inducible promoters, transcription enhancers, transcription terminators, and the like, which are well known in the art. When two or more polynucleotides are to be co-expressed, both polynucleotides may be inserted, for example, in a single expression vector or in separate expression vectors. For single vector expression, the encoding polynucleotides may be operably linked to a common expression control sequence, or may be linked to different expression control sequences, such as an inducible promoter and a constitutive promoter. Introduction of the polynucleotide into the host cell can be confirmed using methods well known in the art. It will be understood by those skilled in the art that expression of a polynucleotide in a sufficient amount may result in a desired product (e.g., an anti-CD 123 antibody or antigen-binding fragment as described herein), and further it will be understood that the expression level may be optimized to obtain sufficient expression using methods well known in the art.
The term "chimeric antigen receptor" or "CAR" as used herein refers to an artificially constructed hybrid protein or polypeptide containing a binding moiety (e.g., an antibody) linked to an immune cell (e.g., T cell) signaling or activation domain. In some embodiments, CARs is a synthetic receptor that retards T cells to tumor surface antigens (Sadelain et al, Nat. Rev. Cancer 3(l):35-45 (2003); Sadelain et al, Cancer Discovery 3(4):388-398 (2013)). CARs can provide antigen binding functions and immune cell activation functions on immune cells (e.g., T cells). CARs are able to redirect T cell specificity and reactivity to selected targets in a non-MHC-restricted manner using the antigen binding properties of monoclonal antibodies. non-MHC restricted antigen recognition may enable CARs expressing T cells to recognize antigens independent of antigen processing, thereby bypassing the mechanism of tumor escape.
The term "genetic engineering" or grammatical equivalents thereof, when used in reference to a cell, means the alteration of the genetic material of the cell that is not normally found in naturally occurring cells. Genetic alterations include, for example, modifications introduced into the expressible polynucleotide, other additions, mutations/alterations, deletions and/or other functional disruptions of the cellular gene. Such modifications can be made, for example, in the coding region of the gene and functional fragments thereof. Additional modifications can be made, for example, in non-coding regulatory regions, wherein the modifications alter expression of the gene.
The terms "transfer," "transduction," "transfection," and grammatical equivalents thereof, as used herein, refer to the process of introducing an exogenous polynucleotide into a host cell. A "transferred," "transfected" or "transduced" cell refers to a cell that has been transferred, transduced or transfected with an exogenous polynucleotide. The cells include primary recipient cells and their progeny. Any type of method known in the art may be used to "transfer" a polynucleotide into a host cell, including chemical, physical, or biological methods. Polynucleotides are typically "transduced" into a host cell using a virus. In contrast, polynucleotides are typically "transfected" into host cells using non-viral methods. These terms are sometimes used interchangeably and, when used in context, their meanings are readily understood by those of ordinary skill in the art.
The term "encode" and grammatical equivalents thereof as used herein refers to the inherent nature of a particular nucleotide sequence in a polynucleotide or nucleic acid, such as a gene, cDNA, or mRNA, that serves as a template for the synthesis of other polymers and macromolecules with a particular nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a particular amino acid sequence in a biological process, and the biological properties resulting therefrom. Thus, if transcription and translation of the mRNA corresponding to the gene produces a protein, the gene encodes the protein. Unless otherwise indicated, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate with respect to one another or that encode the same amino acid sequence. Nucleotide sequences encoding proteins and RNAs may include introns.
An "isolated" polypeptide, peptide, protein, antibody, polynucleotide, vector, cell, or composition is in the form of a polypeptide, peptide, protein, antibody, polynucleotide, vector, cell, or composition not found in nature. An isolated polypeptide, protein, antibody, polynucleotide, vector, cell or composition includes those polypeptides, peptides, proteins, antibodies, polynucleotides, vectors, cells or compositions that have been purified to an extent that they no longer exist in the form found in nature. In some embodiments, the isolated polypeptide, peptide, protein, antibody, polynucleotide, vector, cell, or composition is substantially purified.
As used herein and as understood in the art, "immune effector cell" and grammatical equivalents thereof refer to a cell of hematopoietic origin and that plays a direct role in an immune response against a target, such as a pathogen, cancer cell, or foreign substance. Immune effector cells include T cells, B cells, Natural Killer (NK) cells, NKT cells, macrophages, granulocytes, neutrophils, eosinophils, mast cells and basophils.
As used herein, the term "treatment" and grammatical equivalents thereof in connection with a disease or condition, or a subject having a disease or condition, refers to the act of inhibiting, eliminating, reducing, and/or ameliorating symptoms, symptom severity, and/or symptom frequency associated with the disease or disorder being treated. For example, when referring to a cancer or tumor, the term "treating" and grammatical equivalents thereof refers to a act of reducing the severity of, or delaying or slowing the progression of, the cancer or tumor, including (a) inhibiting the growth or arresting the development of the cancer or tumor, (b) causing regression of the cancer or tumor, or (c) delaying, ameliorating or minimizing one or more symptoms associated with the presence of the cancer or tumor.
The term "administration" and grammatical equivalents thereof as used herein refers to the act of delivering or causing the delivery of a therapeutic agent or pharmaceutical composition to the body of a subject by the methods described herein or other methods known in the art. The therapeutic agent may be a compound, polypeptide, cell, or population of cells. Administering the therapeutic agent or pharmaceutical composition comprises prescribing delivery of a therapeutic or pharmaceutical composition to a subject. Typical forms of administration include oral dosage forms such as tablets, capsules, syrups, suspensions; injectable dosage forms, such as Intravenous (IV), Intramuscular (IM), or Intraperitoneal (IP); transdermal dosage forms, including creams, gels, powders, or patches; an oral dosage form; inhalation powders, sprays, suspensions, and rectal suppositories.
As used herein, the terms "effective amount," "therapeutically effective amount," and grammatical equivalents thereof, refer to an amount administered to a subject alone or as part of a pharmaceutical composition, in a single dose, or as part of a series of doses, that is capable of having any detectable positive effect on any symptom, aspect, or characteristic of a disease, disorder, or condition when administered. A therapeutically effective amount can be determined by measuring the relevant physiological effects. The exact amount required will vary from subject to subject, depending on the age, weight and general condition of the subject, the severity of the condition being treated, the judgment of the clinician, and the like. In any individual case, an appropriate "effective amount" may be determined by one of ordinary skill in the art using routine experimentation.
The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable adjuvant" refers to a material suitable for administration to an individual with an active agent without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition.
The term "subject" as used herein refers to any animal (e.g., a mammal), including but not limited to humans, non-human primates, dogs, felines, rodents, etc., which is the animal to be subjected to a particular treatment. The subject may be a human. The subject may be a patient suffering from a particular disease or disorder.
The term "autologous" as used herein refers to any material that is derived from the same individual and subsequently reintroduced into the individual.
The term "allogenic" as used herein refers to grafts derived from different animals in the same species.
The range is as follows: throughout this disclosure, various aspects of the present invention may be presented in a range format. It is to be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range from 1 to 6 should be considered to have disclosed sub-ranges, such as from 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
Exemplary genes and polypeptides are described herein with reference to GenBank accession numbers, GI accession numbers, and/or SEQ ID NOs. It is understood that homologous sequences can be readily identified by one skilled in the art by reference to sequence sources including, but not limited to, GenBank (ncbi. nlm. nih. gov/GenBank /) and EMBL (EMBL. org /).
5.2 anti-CD 123 antibodies and antigen-binding fragments
The invention provides antibodies or antigen-binding fragments thereof that specifically bind to CD123 (e.g., human CD 123). In some embodiments, the invention provides anti-CD 123 antibodies. In some embodiments, the antibody is an IgA, IgD, IgE, IgG, or IgM antibody. In some embodiments, the antibody is an IgA antibody. In some embodiments, the antibody is an IgD antibody. In some embodiments, the antibody is an IgE antibody. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgM antibody. In some embodiments, the antibodies provided herein can be IgG1 antibodies, IgG2 antibodies, IgG3 antibodies, or IgG4 antibodies. In some embodiments, the antibody is an IgG1 antibody. In some embodiments, the antibody is an IgG2 antibody. In some embodiments, the antibody is an IgG3 antibody. In some embodiments, the antibody is an IgG4 antibody.
In some embodiments, the invention provides antigen-binding fragments of anti-CD 123 antibodies. In some embodiments, the antigen binding fragments provided herein can be single domain antibodies (sdabs), heavy chain antibodies (hcabs), fabs ', F (ab') 2 Fv, single chain variable fragment (scFv), or (scFv) 2 . In some embodiments, the antigen-binding fragment of the anti-CD 123 antibody is a single domain antibody (sdAb). In some embodiments, the antigen-binding fragment of the anti-CD 123 antibody is a heavy chain antibody (HCAb). In some embodiments, the antigen-binding fragment of the anti-CD 123 antibody is a Fab. In some embodiments, the antigen-binding fragment of the anti-CD 123 antibody is a Fab'. In some embodiments, the antigen-binding fragment of an anti-CD 123 antibody is F (ab') 2 . In some embodiments, the antigen-binding fragment of the anti-CD 123 antibody is an Fv. In some embodiments, the antigen-binding fragment of the anti-CD 123 antibody is an scFv. In some embodiments, the antigen-binding fragment of the anti-CD 123 antibody is a disulfide-linked scFv [ (scFv) 2 ]. In some embodiments, the antigen-binding fragment of the anti-CD 123 antibody is a double anti (dAb).
In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein include recombinant antibodies or antigen-binding fragments. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein include monoclonal antibodies or antigen-binding fragments. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein include polyclonal antibodies or antigen-binding fragments. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein include camelidae (e.g., camel, dromedary, and llama) antibodies or antigen-binding fragments. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein include chimeric antibodies or antigen-binding fragments. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein include humanized antibodies or antigen-binding fragments. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein comprise human antibodies or antigen-binding fragments. In some embodiments, the invention provides anti-CD 123 human scFvs.
In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein are isolated. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein are substantially purified.
In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein include multispecific antibodies or antigen-binding fragments. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein include bispecific antibodies or antigen-binding fragments. In some embodiments, the invention provides a bispecific T cell engager (BiTE). BiTEs are bispecific antibodies that bind to T cell antigens (e.g., CD3) and tumor antigens. BiTEs have been shown to induce directed lysis of targeted tumor cells, providing a vast potential therapy for cancer and other diseases. In some embodiments, the invention provides BiTEs that specifically bind to CD3 and CD 123. In some embodiments, the BiTEs comprise an anti-CD 123 antibody or antigen-binding fragment provided herein. In some embodiments, the BiTEs comprise an anti-CD 123 scFv provided herein.
In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein comprise a monovalent antigen binding site. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment comprises a monospecific binding site. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment comprises a bivalent binding site.
In some embodiments, the anti-CD 123 antibody or antigen-binding fragment is a monoclonal antibody or antigen-binding fragment. Monoclonal antibodies can be obtained by various methods known to those skilled in the art. One exemplary method is to screen protein expression libraries, such as phage or ribosome display libraries. For example, phage display is described in Ladner et al, U.S. patent No.5,223,409; smith (1985) Science 228: 1315-1317; and WO 92/18619. In some embodiments, recombinant monoclonal antibodies are isolated from phage display libraries expressing the variable regions or CDRs of the desired species. Screening of phage libraries can be accomplished by a variety of techniques known in the art.
In some embodiments, monoclonal antibodies are prepared using hybridoma methods known to those of skill in the art. For example, a hybridoma method is used to immunize a mouse, rat, rabbit, hamster, or other appropriate host animal. In some embodiments, the lymphocytes are immunized in vitro. In some embodiments, the immunizing antigen is a human protein or fragment thereof. In some embodiments, the immunizing antigen is a human protein or fragment thereof.
Following immunization, lymphocytes are isolated and a suitable myeloma cell line is fused using, for example, polyethylene glycol or the like. Hybridoma cells were selected using proprietary media known in the art, and unfused lymphocytes and myeloma cells were unable to survive the selection process described above. Hybridomas that produce monoclonal antibodies to a selected antigen can be identified by a variety of methods, including but not limited to immunoprecipitation, immunoblotting, and in vitro binding assays (e.g., flow cytometry, FACS, ELISA, SPR (e.g., Biacore), and radioimmunoassay). Once hybridoma cells are identified that produce antibodies of the desired specificity, affinity, and/or activity, subcloning may be performed by limiting dilution or other techniques. Hybridomas can be propagated in culture in vitro using standard methods, or as ascites cancer cells in animals. Monoclonal antibodies can be purified from the culture medium or ascites fluid according to standard methods in the art, including, but not limited to, affinity chromatography, ion exchange chromatography, gel electrophoresis, and dialysis.
In some embodiments, monoclonal antibodies are prepared using recombinant DNA techniques known to those skilled in the art. For example, polynucleotides encoding the antibody are isolated from mature B cells or hybridoma cells, and the genes encoding the heavy and light chains of the antibody are specifically amplified by RT-PCR, e.g., using oligonucleotide primers, and their sequences determined using standard techniques. The isolated polynucleotides encoding the heavy and light chains are then cloned into suitable expression vectors, which when transfected into host cells (e.g., E.coli, simian COS cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells) produce monoclonal antibodies that do not produce immunoglobulins.
In some embodiments, the monoclonal antibody is modified by using recombinant DNA techniques to produce a surrogate antibody. In some embodiments, the constant domains of the light and heavy chains of the mouse monoclonal antibody are replaced with the constant regions of a human antibody to produce a chimeric antibody. In some embodiments, the constant region is truncated or removed to produce a desired antibody fragment of the monoclonal antibody. In some embodiments, site-directed or high-density mutagenesis of the variable regions is used to optimize the specificity and/or affinity of the monoclonal antibody.
In some embodiments, the anti-CD 123 antibody or antigen-binding fragment is a humanized antibody or antigen-binding fragment. Various methods for making humanized antibodies are known in the art. Methods for achieving high affinity binding to humanized antibodies are known in the art. One non-limiting example of such a method is the hypermutation of the variable region and the selection of cells expressing such high affinity antibodies (affinity maturation). In addition to the use of display libraries, a given antigen (e.g., recombinant CD123 or an epitope thereof) can be used to immunize a non-human animal, such as a rodent. In certain embodiments, rodent antigen-binding fragments (e.g., mouse antigen-binding fragments) can be generated and isolated using methods known in the art and/or disclosed herein. In some embodiments, a mouse may be immunized with an antigen (e.g., recombinant CD123 or an epitope thereof).
In some embodiments, the anti-CD 123 antibody or antigen-binding fragment is a human antibody or antigen-binding fragment. Various techniques for making human antibodies are known in the art. In some embodiments, the human antibody is produced by immortalized human B lymphocytes immunized in vitro. In some embodiments, the human antibody is produced by lymphocytes isolated from the immunized individual. In any case, cells producing antibodies to the target antigen can be generated and isolated. In some embodiments, the human antibody is selected from a phage library, wherein the phage library expresses human antibodies. Alternatively, phage display technology can be used to produce human antibodies and antibody fragments in vitro from immunoglobulin variable region gene libraries of unimmunized donors. Techniques for generating and using antibody phage libraries are well known in the art. Once antibodies have been identified, higher affinity human antibodies can be generated using affinity maturation strategies known in the art, including but not limited to chain shuffling and site-directed mutagenesis. In some embodiments, the human antibodies are produced in a transgenic mouse containing human immunoglobulin loci. Following immunization, these mice are capable of producing fully human antibodies without the production of endogenous immunoglobulins.
The specific CDR sequences defined in the present invention are generally based on the combination defined by Kabat and Chothia. However, it is understood that reference to one or more heavy chain CDRs, and/or one or more light chain CDRs, of a specific antibody includes all CDR definitions known to those skilled in the art.
The anti-CD 123 antibody or antigen-binding fragment provided by the invention includes the following clones: C5. the sequence characteristics are as follows.
In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein comprise one, two, three, four, five, and/or six CDRs of any of the antibodies described herein. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein comprise a VL that includes one, two, and/or three VL CDRs from table 1. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein comprise a VH comprising one, two, and/or three VH CDRs from table 2. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein comprise one, two, and/or three VL CDRs from table 1, and one, two, and/or three VH CDRs from table 2.
TABLE 1 amino acid sequence of the CDRs (VL CDRs) of the anti-CD 123 Abs light chain variable region
Figure BDA0003670489470000211
TABLE 2 amino acid sequences of the CDRs (VH CDRs) of the anti-CD 123 Abs heavy chain variable region
Figure BDA0003670489470000212
In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof comprises a humanized antibody or antigen-binding fragment. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof comprises the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and/or VH CDR3 of an antibody or antigen-binding fragment described herein. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof comprises a variant of an anti-CD 123 antibody or antigen-binding fragment described herein. In some embodiments, the variant of the anti-CD 123 antibody or antigen-binding fragment comprises 1-30 amino acid substitutions, additions, and/or deletions in the anti-CD 123 antibody or antigen-binding fragment. In some embodiments, the variant of the anti-CD 123 antibody or antigen-binding fragment comprises 1-25 amino acid substitutions, additions, and/or deletions in the anti-CD 123 antibody or antigen-binding fragment. In some embodiments, the variant of the anti-CD 123 antibody or antigen-binding fragment comprises 1-20 amino acid substitutions, additions, and/or deletions in the anti-CD 123 antibody or antigen-binding fragment. In some embodiments, the variant of the anti-CD 123 antibody or antigen-binding fragment comprises 1-15 amino acid substitutions, additions, and/or deletions in the anti-CD 123 antibody or antigen-binding fragment. In some embodiments, the variant of the anti-CD 123 antibody or antigen-binding fragment comprises 1-10 amino acid substitutions, additions, and/or deletions in the anti-CD 123 antibody or antigen-binding fragment. In some embodiments, the variant of the anti-CD 123 antibody or antigen-binding fragment comprises 1-5 conservative amino acid substitutions, additions, and/or deletions in the anti-CD 123 antibody or antigen-binding fragment. In some embodiments, the variant of the anti-CD 123 antibody or antigen-binding fragment comprises 1-3 amino acid substitutions, additions, and/or deletions in the anti-CD 123 antibody or antigen-binding fragment. In some embodiments, the amino acid substitutions, additions, and/or deletions are conservative amino acid substitutions. In some embodiments, the conservative amino acid substitution is in a CDR of the antibody or antigen-binding fragment. In some embodiments, the conservative amino acid substitution is not in a CDR of the antibody or antigen-binding fragment. In some embodiments, the conservative amino acid substitution is in a framework region of the antibody or antigen-binding fragment.
In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds CD123 (e.g., human CD123), comprising a light chain variable region (VL) comprising (1) light chain CDR1(VL CDR1) having the amino acid sequence set forth in SEQ ID No. 23; (2) a light chain CDR2(VL CDR2) having the amino acid sequence set forth in SEQ ID NO: 50; or (3) a light chain CDR3(VL CDR3) having the amino acid sequence set forth in SEQ ID NO: 82; or variants having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions, and/or deletions in the VL CDRs. In some embodiments, the variants have up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs.
In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds CD123 (e.g., human CD123) comprising a light chain variable region (VL) comprising (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 23; (2) VL CDR2 having the amino acid sequence shown by SEQ ID NO. 50; and (3) a VL CDR3 having the amino acid sequence set forth in SEQ ID NO: 82; or variants having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions, and/or deletions in the VL CDRs. In some embodiments, the variants have up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs.
In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds CD123 (e.g., human CD123), comprising a heavy chain variable region (VH) comprising (1) heavy chain CDR1(VH CDR1) having the amino acid sequence set forth in SEQ ID NO: 99; (2) heavy chain CDR2(VH CDR2) having the amino acid sequence set forth in SEQ ID NO: 129; or (3) a heavy chain CDR3(VH CDR3) having the amino acid sequence set forth in SEQ ID NO: 157; or variants having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions, and/or deletions in the VH CDRs. In some embodiments, the variants have up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.
In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds CD123 (e.g., human CD123), comprising a heavy chain variable region (VH) comprising (1) a VH CDR1 having the amino acid sequence set forth in SEQ ID NO: 99; (2) VH CDR2 having the amino acid sequence shown by SEQ ID NO. 129; and (3) a VH CDR3 having the amino acid sequence set forth by SEQ ID NO: 157; or variants having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions, and/or deletions in the VH CDRs. In some embodiments, the variants have up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.
In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind to CD123 comprise: (a) a light chain variable region (VL) comprising (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID NO: 23; (2) VL CDR2 having the amino acid sequence shown by SEQ ID NO. 50; and (3) a VL CDR3 having the amino acid sequence set forth in SEQ ID NO: 82; or a variant having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs, and (b) a heavy chain variable region (VH) comprising (1) VH CDR1 having the amino acid sequence set forth in SEQ ID NO: 99; (2) VH CDR2 having the amino acid sequence shown by SEQ ID NO. 129; and (3) a VH CDR3 having the amino acid sequence set forth by SEQ ID NO: 157; or variants having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.
In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind to CD123 (e.g., human CD123) have a VL and a VH. In some embodiments, VL and VH are connected by a linker. The linker may be a flexible linker or a rigid linker. In some embodiments, the linker has an amino acid sequence of (GGGGS) n, n ═ 1,2,3,4, or 5(SEQ ID NO: 410). In some embodiments, the linker has the amino acid sequence of (EAAAK) n, n ═ 1,2,3,4, or 5(SEQ ID NO: 411). In some embodiments, the linker has the amino acid sequence of (PA) nP, n ═ 1,2,3,4, or 5(SEQ ID NO: 412). In some embodiments, the linker has the amino acid sequence GGGGSGGGGSGGGS (SEQ ID NO: 320). In some embodiments, the linker has the amino acid sequence of GGGGS (SEQ ID NO: 413).
In some embodiments, an antibody or antigen-binding fragment thereof provided herein that specifically binds CD123 (e.g., human CD123) has a VL and a VH, wherein the VL comprises VL CDR1, CDR2, and CDR3, the VH comprises VH CDR1, CDR2, and CDR3, and the VL CDR1, VL CDR2, and VL CDR3, VH CDR1, VH CDR2, and VH CDR3 have the amino acid sequences set forth in SEQ ID NOs:23, 50, 82, 99, 129, and 157, respectively; or a variant having substitutions, additions and/or deletions of up to about 5 amino acids in the CDRs.
In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind to CD123 (e.g., human CD123) provided herein have a light chain variable region (VL) that includes (1) a VL CDR1 having the amino acid sequence of SEQ ID No. 23; (2) VL CDR2 having the amino acid sequence of SEQ ID NO. 50; or (3) VL CDR3 having the amino acid sequence of SEQ ID NO: 82. The VL may have VL CDR1, VL CDR2, and VL CDR3, said VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences of SEQ ID NOs 23, 50, and 82, respectively. In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind to CD123 (e.g., human CD123) provided herein have a heavy chain variable region (VH) comprising (1) a VH CDR1 having the amino acid sequence of SEQ ID NO: 99; (2) VH CDR2 having the amino acid sequence of SEQ ID NO 129; or (3) VH CDR3 having the amino acid sequence of SEQ ID NO: 157. The VH may have VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences of SEQ ID NOs:99, 129 and 157, respectively. In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind to CD123 (e.g., human CD123) provided herein comprise (a) a VL comprising VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences of SEQ ID NOs:23, 50, and 82, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences of SEQ ID NOs:99, 129 and 157, respectively.
In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds CD123 (e.g., human CD123) provided herein comprises a VL that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence set forth in SEQ ID No. 168. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds to CD123 (e.g., human CD123) provided herein comprises a VH having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence set forth in SEQ ID No. 203.
TABLE 4 amino acid sequences of light chain variable regions (VLs) and heavy chain variable regions (VHs) of anti-CD 123 antibodies
Figure BDA0003670489470000241
In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds to CD123 (e.g., human CD123) provided herein includes (a) a VL that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence set forth in SEQ ID No. 168; and (b) a VH having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence set forth in SEQ ID No. 203.
In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds CD123 (e.g., human CD123) provided herein includes a VL, wherein the VL is at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID No. 168. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof has a VL that is at least 85% identical to the amino acid sequence of SEQ ID No. 168. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof has a VL that is at least 90% identical to the amino acid sequence of SEQ ID No. 168. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof has a VL that is at least 95% identical to the amino acid sequence of SEQ ID No. 168. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof has a VL that is at least 98% identical to the amino acid sequence of SEQ ID No. 168. In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind to CD123 (e.g., human CD123) include a VL having the amino acid sequence of SEQ ID NO: 168.
In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind to CD123 (e.g., human CD123) provided herein comprise a VH, wherein the VH has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of SEQ ID No. 203. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof has a VH with at least 85% identity to the amino acid sequence of SEQ ID No. 203. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof has a VH with at least 90% identity to the amino acid sequence of SEQ ID No. 203. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof has a VH with at least 95% identity to the amino acid sequence of SEQ ID No. 203. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment thereof has a VH with at least 98% identity to the amino acid sequence of SEQ ID No. 203. In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind to CD123 (e.g., human CD123) include a VH having the amino acid sequence of SEQ ID No. 203.
In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind to CD123 (e.g., human CD123) provided herein comprise a VL and a VH, wherein the VL and VH have the amino acid sequences of SEQ ID NOs:168 and 203, respectively.
In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind to CD123 (e.g., human CD123) comprise: (a) a light chain variable region (VL) comprising VL CDRs1,2 and 3, said VL CDRs1,2 and 3 being derived from VL having the amino acid sequence of SEQ ID NO: 168; and/or, (b) a heavy chain variable region (VH) comprising VH CDRs1,2 and 3, said VH CDRs1,2 and 3 being derived from a VH having the amino acid sequence of SEQ ID NO: 203.
In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind to CD123 (e.g., human CD123) provided herein comprise a VL, wherein the VL comprises VL CDRs1,2, and 3, wherein the VL CDRs1,2, and 3 are derived from a VL having the amino acid sequence of SEQ ID NO: 168.
In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind to CD123 (e.g., human CD123) provided herein comprise a VH, wherein the VH comprises VH CDRs1,2, and 3, said VH CDRs1,2, and 3 being derived from a VH having the amino acid sequence of SEQ ID No. 203.
In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind to CD123 comprise: a light chain variable region (VL) and a heavy chain variable region (VH), wherein the VL comprises VL CDR1, CDR2 and CDR3, and the VL CDR1, CDR2 and CDR3 are derived from a VL having the amino acid sequence of SEQ ID NO: 168; and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from VH having the amino acid sequence of SEQ ID NO: 203.
In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments thereof provided herein are scFv labeled C5(SEQ ID NO: 379). In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments thereof provided herein have at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO: 379. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein have a VL derived from C5(SEQ ID NO: 168). In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein have a VH derived from C5(SEQ ID NO: 203). The anti-CD 123 antibodies or antigen-binding fragments thereof provided by the present invention can have both VL and VH derived from C5. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein have a VL comprising VL CDRs 1,2 and 3, said VL CDRs 1,2 and 3 being derived from the VL from C5(SEQ ID NO: 168). In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein have a VH comprising VH CDRs 1,2 and 3, which VH CDRs 1,2 and 3 are derived from the VH from C5(SEQ ID NO: 203). The anti-CD 123 antibodies or antigen-binding fragments thereof provided herein can have a VL comprising VL CDRs 1,2, and 3 and a VH comprising VH CDRs 1,2, and 3, the VL CDRs 1,2, and 3 and the VH CDRs 1,2, and 3 being derived from the VL and VH of C5, respectively. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments provided herein are variants of C5. The C5 variant may have a variant from the VL of C5, which variant is represented in SEQ ID NO:168 has substitutions, additions and/or deletions of about 5 amino acids. The C5 variant may have a variant of the VH derived from C5, which variant is represented in SEQ ID NO:203 with substitutions, additions and/or deletions of about 5 amino acids. Amino acid substitutions, additions and/or deletions may be located in the VH CDRs or the VL CDRs. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in CDRs. In some embodiments, the variant of C5 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of C5 has up to about 3 conservative amino acid substitutions.
In some embodiments, the invention also provides antibodies or antibodies as described aboveAn antigen-binding fragment competes for binding to an antibody or antigen-binding fragment of CD123 (e.g., human CD 123). An antibody that "competes with another antibody for binding to a target" refers to an antibody that inhibits (partially or completely) the binding of another antibody to the target. Known competition experiments can be used (e.g.,
Figure BDA0003670489470000271
surface Plasmon Resonance (SPR) analysis) to determine whether two antibodies compete with each other for binding to the target, i.e., whether and to what extent one antibody inhibits the binding of the other antibody to the target. In some embodiments, an anti-CD 123 antibody or antigen-binding fragment competes with another antibody or antigen-binding fragment and inhibits its binding to CD123 by at least 50%, 60%, 70%, 80%, 90%, or 100%. Competition assays can be performed as described, for example, Ed Harlow and David Lane, Cold Spring Harb protocol; 2006; chapter 11 of Doi, l0.H0l/pdb.prot4277 or "Using Antibodies" (Ed Harlow and David Lane, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA 1999).
In some embodiments, the invention provides antibodies or antigen binding fragments that compete with C5 for binding to CD 123.
Other variants and equivalents that are substantially homologous to the recombinant, monoclonal, chimeric, humanized and human antibodies or antibody fragments thereof described herein are also contemplated by the present invention. In some embodiments, it is desirable to increase the binding affinity of an antibody. In some embodiments, it is desirable to modulate a biological property of an antibody, including but not limited to specificity, thermostability, expression level, effector function, glycosylation, immunogenicity, and/or solubility. It will be appreciated by those skilled in the art that amino acid changes may alter post-translational processes of the antibody, such as altering the number or position of glycosylation sites or altering membrane anchoring characteristics.
The variation may be a substitution, deletion or insertion of one or more nucleotides encoding the antibody or polypeptide, resulting in a change in the amino acid sequence as compared to the native antibody or polypeptide sequence. In some embodiments, the amino acid substitution is the result of replacing an amino acid with another amino acid having similar structural and/or chemical properties, such as replacing a leucine with a serine, e.g., a conservative amino acid substitution. Insertions or deletions may range from about 1 to 5 amino acids. In some embodiments, the substitution, deletion, or insertion comprises a substitution of less than 25 amino acids, a substitution of less than 20 amino acids, a substitution of less than 15 amino acids, a substitution of less than 10 amino acids, a substitution of less than 5 amino acids, a substitution of less than 4 amino acids, a substitution of less than 3 amino acids, or a substitution of less than 2 amino acids relative to the parent molecule. In some embodiments, amino acid sequence variations that are of biological use and/or relatedness can be determined by systematically making insertions, deletions, or substitutions in the sequence, and assaying the resulting variant protein for activity as compared to the parent protein.
It is known in the art that the constant regions of antibodies mediate several effector functions, and these effector functions may vary depending on the isotype of the antibody. For example, binding of the C1 region of complement to the Fc region of IgG or IgM antibodies (binding to antigen) activates the complement system. Activation of complement is important in opsonization and lysis of cellular pathogens. Activation of complement also stimulates inflammatory responses and may be involved in autoimmune hypersensitivity. In addition, the Fc region of an antibody can bind to cells that express an Fc receptor (FcR). There are many Fc receptors specific for different classes of antibodies, including IgG (gamma receptor), IgE (epsilon receptor), IgA (alpha receptor) and IgM (mu receptor). Binding of antibodies to cell surface Fc receptors triggers a number of important and diverse biological responses, including phagocytosis and destruction of antibody-coated particles, clearance of immune complexes, killing of cells to lyse antibody-coated target cells (known as antibody-dependent cellular cytotoxicity or ADCC), release of inflammatory mediators, placental transfer, and control of immunoglobulin production. In some embodiments, an anti-CD 123 antibody or antigen-binding fragment of the invention comprises at least one constant region of a human IgA antibody. In some embodiments, an anti-CD 123 antibody or antigen-binding fragment according to the present invention comprises at least one constant region of a human IgD antibody. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments of the invention comprise at least one constant region of a human IgE antibody. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments of the invention comprise at least one constant region of a human IgG antibody. In some embodiments, an anti-CD 123 antibody or antigen-binding fragment of the invention comprises at least one constant region of a human IgM antibody. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments of the invention comprise at least one constant region of a human IgG1 antibody. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments of the invention comprise at least one constant region of a human IgG2 antibody. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments of the invention comprise at least one constant region of a human IgG3 antibody. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments of the invention comprise at least one constant region of a human IgG4 antibody.
In some embodiments, in the anti-CD 123 antibodies or antigen-binding fragments described herein, at least one or more of the constant regions is modified or deleted. In some embodiments, the antibody comprises a modification to one or more of the three heavy chain constant regions (CH1, CH2, or CH3) and/or the light chain constant region (CL). In some embodiments, the heavy chain constant region of the modified antibody comprises at least one human constant region. In some embodiments, the heavy chain constant region of the modified antibody comprises more than one human constant region. In some embodiments, modifications to the constant region include the addition, deletion, or substitution of one or more amino acids in one or more regions. In some embodiments, one or more regions are partially or completely deleted from the constant region of the modified antibody. In some embodiments, the entire CH2 domain is removed from the antibody (Δ CH2 construct). In some embodiments, the deleted constant region is replaced with a short amino acid spacer that provides some of the molecular flexibility normally imparted by the deleted constant region. In some embodiments, the modified antibody comprises a CH3 domain fused directly to the hinge region of the antibody. In some embodiments, the modified antibody comprises a peptide spacer interposed between the hinge region and, the modified CH2 and/or CH3 domain.
In some embodiments, the anti-CD 123 antibody or antigen-binding fragment comprises an Fc region. In some embodiments, the Fc region is fused by a hinge. The hinge may be an IgG1 hinge, an IgG2 hinge, or an IgG3 hinge. The amino acid sequences of the Fc regions of human IgG1, IgG2, IgG3, and IgG4 are known to those of ordinary skill in the art. In some cases, Fc regions with amino acid variations have been identified in natural antibodies. In some embodiments, the modified antibody (e.g., modified Fc region) provides altered effector function, thereby affecting a biological characteristic of the antibody. For example, in some embodiments, deletion or inactivation (by point mutation or otherwise) of the constant region reduces Fc receptor binding in the circulation of the modified antibody. In some embodiments, the constant region modification reduces the immunogenicity of the antibody. In some embodiments, the constant region modification increases the serum half-life of the antibody. In some embodiments, the constant region modification reduces the serum half-life of the antibody. In some embodiments, the constant region modification reduces or removes ADCC and/or Complement Dependent Cytotoxicity (CDC) of the antibody. In some embodiments, specific amino acid substitutions in the Fc region of human IgG1 having corresponding residues of IgG2 or IgG4 reduce effector functions (e.g., ADCC and CDC) in the modified antibody. In some embodiments, the antibody does not have one or more effector functions (e.g., a "null effector" antibody). In some embodiments, the antibody has no ADCC activity and/or no CDC activity. In some embodiments, the antibody does not bind to Fc receptors and/or complement factors. In some embodiments, the antibody does not have effector function. In some embodiments, the constant region modification increases or enhances ADCC and/or CDC of the antibody. In some embodiments, the constant region is modified to eliminate disulfide bonds or oligosaccharide moieties. In some embodiments, the constant region is modified to add/replace one or more amino acids to provide one or more cytotoxic, oligosaccharide or carbohydrate attachment sites. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment comprises a variant Fc region having a substitution of a particular amino acid as compared to the native Fc region. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment of the invention comprises an IgG1 heavy chain constant region, the IgG1 heavy chain constant region comprising one or more amino acid substitutions selected from the group consisting of K214R, L234A, L235E, G237A, D356E, and L358M (according to EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of K214R, L234A, L235E, G237A, a330S, P331S, D356E, and L358M (by EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of K214R, C226S, C229S, and P238S (according to EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of K214R, D356E, and L358M (according to EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of S131C, K133R, G137E, G138S, Q196K, I199T, N203D, K214R, C226S, C229S, and P238S (according to EU numbering).
In some embodiments, a variant may comprise the addition of amino acid residues at the amino and/or carboxy terminus of an antibody or polypeptide. The length of the added amino acid residues may range from one residue to one hundred or more residues. In some embodiments, the variant comprises an N-terminal methionyl residue. In some embodiments, the variant comprises an added polypeptide/protein (e.g., Fc region) to produce a fusion protein. In some embodiments, the variant is designed to be detectable, and may include a detectable label and/or protein (e.g., a fluorescent tag or enzyme).
The variant antibodies or antigen-binding fragments of the invention can be generated using methods known in the art, including but not limited to site-directed mutagenesis, alanine scanning mutagenesis, and PCR mutagenesis.
In some embodiments, variants of the disclosed anti-CD 123 antibodies or antigen-binding fragments may retain the ability to bind CD123 to a similar degree, to the same degree, or to a greater degree, as the parent antibody or antigen-binding fragment. In some embodiments, a variant may be at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more identical in amino acid sequence to a parent antibody or antigen-binding fragment. In certain embodiments, the variant of the anti-CD 123 antibody or antigen-binding fragment comprises the amino acid sequence of a parent anti-CD 123 antibody or antigen-binding fragment with one or more conservative amino acid substitutions. Conservative amino acid substitutions are known in the art and include the replacement of one amino acid with some physical and/or chemical properties with another amino acid with the same or similar chemical or physical properties.
In certain embodiments, the variant of the anti-CD 123 antibody or antigen-binding fragment comprises the amino acid sequence of a parent anti-CD 123 antibody or antigen-binding fragment with one or more non-conservative amino acid substitutions. In some embodiments, a variant of an anti-CD 123 antibody or antigen-binding fragment comprises the amino acid sequence of a parent binding antibody or antigen-binding fragment with one or more non-conservative amino acid substitutions, wherein the one or more non-conservative amino acid substitutions do not interfere with or inhibit one or more biological activities of the variant (e.g., CD123 binding). In certain embodiments, the one or more conservative amino acid substitutions and/or the one or more non-conservative amino acid substitutions may enhance the biological activity of the variant such that the biological activity of the functional variant is increased as compared to the parent binding moiety.
In some embodiments, the variant may have 1, 2, 3, 4, or 5 amino acid substitutions in the CDRs (e.g., VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, and VL CDR3) of the binding moiety.
In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments of the invention have chemical modifications, either native or by intervention. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment has been chemically modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, and/or attachment to cellular ligands or other proteins. Any of a variety of chemical modifications can be made by known techniques. The anti-CD 123 antibody or antigen-binding fragment can comprise one or more analogs of an amino acid (including, for example, unnatural amino acids), as well as other modifications known in the art.
In some embodiments, the anti-CD 123 antibody or antigen-binding fragment (e.g., antibody) has a dissociation constant (K) of about 1 μ Μ or less, about 100nM or less, about 40nM or less, about 20nM or less, about 10nM or less, about 1nM or less, about 0.1nM or less, 50pM or less, 10pM or less, or 1pM or less D ) Binds to CD123 (e.g., human CD 123). In some embodiments, the anti-CD 123 antibody or antigen-binding fragment has a K of about 20nM or less D Binds to CD123 (e.g., human CD 123). In some embodiments, the anti-CD 123 antibody or antigen-binding fragment has a K of about 10nM or less D Binds to CD123 (e.g., human CD 123). In some embodiments, the anti-CD 123 antibody or antigen-binding fragment has a K of about 1nM or less D Binds to CD123 (e.g., human CD 123). In some embodiments, the anti-CD 123 antibody or antigen-binding fragment has a K of about 0.5nM or less D Binds to CD123 (e.g., human CD 123). In some embodiments, the anti-CD 123 antibody or antigen-binding fragment has a K of about 0.1nM or less D Binds to CD123 (e.g., human CD 123). In some embodiments, the anti-CD 123 antibody or antigen-binding fragment has a K of about 50pM or less D Binds to CD123 (e.g., human CD 123). In some embodiments, the anti-CD 123 antibody or antigen-binding fragment has a K of about 25pM or less D Binds to CD123 (e.g., human CD 123). In some embodiments, the anti-CD 123 antibody or antigen-binding fragment has a K of about 10pM or less D Binds to CD123 (e.g., human CD 123). In some embodiments, the anti-CD 123 antibody or antigen-binding fragment has a K of about 1pM or less D Binds to CD123 (e.g., human CD 123). In some embodiments, the dissociation constant of a CD123 binding agent (e.g., antibody) is a solution determined using a CD123 protein immobilized on a Biacore chip and a binding agent flowing through the chipThe distance is constant. In some embodiments, the dissociation constant of a CD123 binding agent (e.g., antibody) is a dissociation constant determined using a binding agent captured with an anti-human IgG antibody on a Biacore chip and soluble CD123 flowing through the chip.
The physical, chemical and/or biological properties of the anti-CD 123 antibodies or antigen-binding fragments of the invention can be analyzed by various methods known in the art. In some embodiments, anti-CD 123 antibodies are tested for their ability to bind CD123 (e.g., human CD 123). Binding assays include, but are not limited to, SPR (e.g., Biacore), ELISA, and FACS. In addition, the solubility, stability, thermostability, viscosity, expression level, expression quality, and/or purification efficiency of the antibody can be assessed.
Epitope mapping is a method of identifying binding sites, regions or epitopes on a target protein to which an antibody binds. Various methods for locating epitopes on a target protein are known in the art. These methods include mutagenesis (including, but not limited to, shotgun mutagenesis, site-directed mutagenesis) and alanine scanning; domain or fragment scanning; peptide scanning (e.g., Pepscan technique); display methods (e.g., phage display, microbial display, and ribosome/mRNA display); methods involving proteolysis and mass spectrometry; and structural assays (e.g., X-ray crystallography and NMR). In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments described herein are characterized using methods including, but not limited to, N-terminal sequencing, amino acid analysis, HPLC, mass spectrometry, ion exchange chromatography, and papain digestion.
In some embodiments, the anti-CD 123 antibody or antigen-binding fragment is conjugated to a cytotoxic drug or cytotoxic moiety. In some embodiments, the anti-CD 123 antibody or antigen-binding fragment is conjugated to a cytotoxic drug to form an ADC (antibody-drug conjugate). In some embodiments, the cytotoxic moiety is a chemotherapeutic agent, including, but not limited to, methotrexate, doxorubicin/adriamycin, melphalan, mitomycin C, chlorambucil, duocarmycin, daunorubicin, Pyrrolobenzodiazepines (PBDs), or other intercalating agents. In some embodiments, the cytotoxic moiety is a microtubule inhibitor, including but not limited to: auristatins (auristatins), maytansinoids (maytansinoids) (e.g., DM1 and DM4), and tubulysins (tubulysins). In some embodiments, the cytotoxic moiety is an enzymatically active toxin or fragment thereof of bacterial, fungal, plant or animal origin, including but not limited to diphtheria a chain, non-binding active fragments of diphtheria toxin, exotoxin a chain, ricin a chain, abrin a chain, gelonin a chain, alpha-sarcin (sarcin), Aleurites fordii (Aleurites fordii) toxic protein, carnation (dianthin) toxic protein, phytolacca americana (phytopaca americana) toxic protein (PAPI, PAPII and PAP-S), Momordica charantia (mordica charrantia) inhibitor, curcin (curcin), crotin (crotin), saponaria officinalis (sapaonaria officinalis) inhibitor, gelonin (gelonin), lincomycin (mitogelonin), restrictocin (restrictocin), phenomycin (trichothecin) and trichothecin (thecin). In some embodiments, the antibody is conjugated to one or more small molecule toxins, such as calicheamicins (calicheamicins), maytansinoids (maytansinoids), trichothecenes, and CC 1065.
In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments of the invention are conjugated to a detectable substance or molecule, allowing the agent to be used for diagnosis and/or detection. Detectable substances may include, but are not limited to, enzymes (e.g., horseradish peroxidase, alkaline phosphatase, beta-galactosidase, and acetylcholinesterase); prosthetic groups (e.g., biotin and flavin); fluorescent materials (e.g., umbelliferone, Fluorescein Isothiocyanate (FITC), rhodamine, tetramethylrhodamine isothiocyanate (TRITC), dichlorotriazinylamine fluorescein (dichlorotriazinylamine fluorescein), dansyl chloride, anthocyanidin (Cy3), and phycoerythrin); bioluminescent materials (e.g., luciferase); the radioactive material (e.g., 212 Bi、 14 C、 57 Co、 51 Cr、 67 Cu、 18 F、 68 Ga、 67 Ga、 153 Gd、 159 Gd、 68 Ge、 3 H、 166 Ho、 131 I、 125 I、 123 I、 121 I、 115 In、 113 In、 112 In、 111 In、 140 La、 177 Lu、 54 Mn、 99 Mo、 32 P、 103 Pd、 149 Pm、 142 Pr、 186 Re、 188 Re、 105 Rh、 97 Ru、 35 S、 47 Sc、 75 Se、 153 Sm、 113 Sn、 117 Sn、 85 Sr、 99m Tc、 201 Ti、 133 XE、 90 Y、 69 Yb、 175 Yb、 65 zn); a positron emitting metal; and a magnetic metal ion positron emitting metal; and magnetic metal ions.
The anti-CD 123 antibodies or antigen-binding fragments of the invention can be attached to a solid support. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride, or polypropylene. In some embodiments, an immobilized anti-CD 123 antibody or antigen-binding fragment is used in an immunoassay. In some embodiments, the target antigen (e.g., human CD123) is purified using an immobilized anti-CD 123 antibody or antigen-binding fragment.
5.3CARs, TCRs and genetically engineered immune effector cells
The anti-CD 123 antibodies or antigen-binding fragments described herein can be used as part of a Chimeric Antigen Receptor (CAR) or T Cell Receptor (TCR) that is expressed in immune effector cells for cancer therapy. Thus, the invention also provides CARs or TCRs that specifically bind CD123 (e.g., human CD123), immune effector cells expressing the CARs or TCRs, and uses of the immune effector cells.
5.3.1TCRs
The present invention provides a T Cell Receptor (TCR) that specifically binds CD123 ("CD 123 TCR"). T Cell Receptors (TCRs) are antigen-specific molecules responsible for recognizing antigenic peptides present in the context of MHC products on the surface of APCs or on the surface of any nucleated cell. This system confers on T cells, via their TCRs, the potential ability to recognize an array of whole intracellular antigens (including viral proteins) expressed by the cells, which are processed into short peptides, bound to intracellular MHC molecules, and delivered to the surface as peptide-MHC complexes. This system allows foreign proteins (such as variant cancer antigens or viral proteins) or aberrantly expressed proteins to be targeted by T cells (e.g., Davis and Bjorkman (1988) Nature,334, 395-402; Davis et al (1998) Annu Rev Immunol,16, 523-544).
The interaction of the TCR and peptide-MHC complexes can drive T cells into different activation states, depending on the affinity (or off-rate) of binding. The TCR recognition process allows T cells to distinguish between normal, healthy cells and cells transformed, for example, by viruses or malignancies, by providing a diverse pool of TCRs, where it is likely that one or more TCRs are present whose binding affinity to foreign peptides bound to MHC molecules is above the threshold for stimulating T cell activity (Manning and Kranz (1999) Immunology Today,20, 417-.
Wild-type TCRs isolated from human or mouse T cell clones identified by in vitro culture have been shown to have relatively low binding affinity (K) D 1-300 μ M) (Davis et al (1998) Annu Rev Immunol,16, 523-. This is partly due to the negative selection (tolerance induction) of self-peptide-MHC ligands by developing T cells within the thymus, thus allowing the clearance of T cells with too high affinity (star et al (2003) Annu Rev Immunol, 21,139-76). To compensate for these relatively low affinities, T cells have evolved a co-receptor system in which the cell surface molecules CD4 and CD8 bind to MHC molecules (class II and class I, respectively) and cooperate with TCRs to mediate signaling activity. CD8 is particularly effective in this process, allowing TCRs with very low affinity (e.g., KD 300 μ M) to mediate potent antigen-specific activities.
Directed evolution can be used to generate TCRs with higher affinity for specific peptide-MHC complexes. Methods that can be used include yeast display (Holler et al, (2003) Nat Immunol,4, 55-62; Holler et al, (2000) Proc Natl Acad Sci U S A,97,5387-92), phage display (Li et al, (2005) Nat Biotechnol,23,349-54) and T cell display (Chervin et al, (2008) J Immunol Methods,339,17584). All three approaches involve engineering or modifying TCRs that exhibit the normal, low affinity of the wild-type TCR to increase affinity for the cognate peptide-MHC complex (the original antigen specific for T cells).
Thus, in some embodiments, provided herein are TCRs comprising an anti-CD 123 antibody or antigen-binding fragment of the invention. The anti-CD 123 antibody or antigen-binding fragment thereof can be any anti-CD 123 antibody or antigen-binding fragment described herein. For illustrative purposes, in some embodiments, the TCRs provided herein may include anti-CD 123 antibodies or antigen-binding fragments having a VL and a VH, wherein the VL includes VL CDR1, CDR2 and CDR3, the VH includes VH CDR1, CDR2 and CDR3, and the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 have the amino acid sequences of SEQ ID NOs:23, 50, 82, 99, 129 and 157, respectively. In some embodiments, the TCRs provided herein may include an anti-CD 123 antibody or antigen-binding fragment that is a human scFv designated C5.
In some embodiments, the TCRs provided herein include alpha and beta chains. The constant regions of the α and β chains of the TCR are encoded by TRAC and TRBC, respectively. Human TRAC may have an amino acid sequence corresponding to UniProtKB/Swiss-Prot No. P01848.2 (accession number P01848.2 GI: 1431906459). Human TRBC may have an amino acid sequence corresponding to GenBank sequence ALC78509.1 (accession number: ALC78509.1 GI: 924924895). In some embodiments, the TCRs provided herein comprise TCR α chains comprising the anti-CD 123 antibodies or antigen-binding fragments provided herein. In some embodiments, the TCRs provided herein comprise TCR β chains comprising the anti-CD 123 antibodies or antigen-binding fragments provided herein. In some embodiments, the TCR comprises a gamma chain and a delta chain. The constant regions of the TCR γ and δ chains are encoded by TRGC and TRDC, respectively. Human TRGC may have an amino acid sequence corresponding to UniProtKB/Swiss-Prot: P0CF51.1 (accession No. P0CF51.1 GI:294863156) or UniProtKB/Swiss-Prot: P03986.2 (accession No. P03986.2 GI: 1531253869). Human TRDC may have an amino acid sequence corresponding to UniProtKB/Swiss-Prot: B7Z8K6.2 (accession number: B7Z8K6.2 GI: 294863191). In some embodiments, the TCRs provided herein comprise TCR γ chains comprising the anti-CD 123 antibodies or antigen-binding fragments provided herein. In some embodiments, the TCRs provided herein comprise TCR delta chains comprising the anti-CD 123 antibodies or antigen binding fragments provided herein.
5.3.2 CARs
CARs are engineered receptors that provide antigen binding and immune effector cell activation functions. CARs can be used to specifically transplant antibodies, such as monoclonal antibodies, onto immune effector cells (e.g., T cells, NK cells, or macrophages). CAR can HLA-independent retargete immune effector cells (e.g., T cells) to tumor surface antigens (Sadelain et al, Nat. Rev. cancer.3(1):35-45 (2003); Sadelain et al, Cancer Discovery3(4):388-398 (2013); Rafiq and Brentjens (2016), Nat Rev Clin Oncol 13(6): 370-383). Typical structures of CAR molecules include an extracellular antigen-binding domain (e.g., scFv), a spacer, a transmembrane domain (TM), and an intracellular signaling domain. CAR-expressing T cells ("CART" s) can be classified into three generations based on the presence of intracellular costimulatory signals. The extracellular antigen-binding domain of a CAR is typically derived from a monoclonal antibody (mAb) or a receptor or ligand thereof. Antigen binding by CARs triggers phosphorylation of Immunoreceptor Tyrosine Activation Motifs (ITAMs) within the intracellular domain, initiating the signaling cascade required for cytolytic induction, cytokine secretion and proliferation.
In some embodiments, the CARs provided herein specifically bind to CD123 ("CD 123 CAR"). In some embodiments, the CAR may be a "first generation", "second generation", or "third generation" CAR (see, e.g., Sadelain et al, Cancer Discov.3(4): 388-.
"first generation" CARs generally consist of an extracellular antigen-binding domain, e.g., a single chain variable fragment (scFv), fused to a transmembrane domain, fused to the cytoplasmic/intracellular domain of the T cell receptor chain. "first generation" CARs typically have an intracellular domain from the CD3 ζ -chain, a primary transmitter of endogenous T Cell Receptor (TCRs) signals. The "first generation" CARs provided de novo antigen recognition and caused activation of CD4+ and CD8+ T cells by the CD3 zeta chain signaling domain in a single fusion molecule independent of HLA-mediated antigen presentation. "second generation" CARs include a Cancer antigen-binding domain fused to an intracellular signaling domain capable of activating an immune effector cell (e.g., a T cell) and a costimulatory domain intended to enhance the efficacy and persistence of the immune effector cell (e.g., a T cell) (Sadelain et al, Cancer discov.2013: 388-398 (3)). Thus, CAR design can combine antigen recognition and signal transduction, both functions being physiologically assumed by two independent complexes (TCR heterodimer and CD3 complex). "second generation" CARs include intracellular domains from various costimulatory receptors, such as CD28, 4-1BB, ICOS, OX40, etc., located in the cytoplasmic tail of the CAR to provide additional signals to the cell. "second generation" CARs provide both co-stimulation (e.g., via CD28 or the 4-1BB domain) and activation (e.g., via the CD3 zeta signaling domain). Studies have shown that "second generation" CARs can increase the anti-tumor activity of T cells. In 2017, the FDA approved two anti-CD 19 CAR T cell products for the treatment of relapsed precursor B-cell acute lymphoblastic leukemia (B-ALL) and B-cell non-hodgkin lymphoma. "third generation" CARs provide multiple co-stimulations (e.g., by containing both the domains of CD28 and 4-1 BB), as well as activation (e.g., by containing the CD3 δ activation domain).
Accordingly, the present invention provides CARs that specifically bind to CD123, comprising from N-terminus to C-terminus: (a) a CD123 binding domain, said CD123 binding domain comprising an anti-CD 123 antibody or antigen-binding fragment provided herein; (b) a transmembrane domain; and (c) a cytoplasmic domain.
The anti-CD 123 antibody or antigen-binding fragment thereof can be any anti-CD 123 antibody or antigen-binding fragment described herein. For illustrative purposes, in some embodiments, the CARs provided herein can include an anti-CD 123 antibody or antigen-binding fragment having a VL and a VH, wherein the VL includes VL CDR1, CDR2, and CDR3, and the VH includes VH CDR1, CDR2, and CDR3, VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 have the amino acid sequences of SEQ ID NOs:23, 50, 82, 99, 129, and 157, respectively. In some embodiments, the CARs provided herein can include an anti-CD 123 antibody or antigen-binding fragment that is a human scFv designated C5.
In some embodiments, the transmembrane domain of CARs provided herein comprises a hydrophobic alpha helix spanning at least a portion of the membrane. Different transmembrane domains lead to different receptor stabilities. Upon antigen recognition, the receptor aggregates and transmits a signal to the cell. In one embodiment, the transmembrane domain of a CAR provided herein can be derived from a protein or polypeptide naturally expressed in an immune effector cell. A transmembrane domain derived from a protein or polypeptide means that the transmembrane domain comprises the entire transmembrane region of the protein or polypeptide, or a fragment thereof. In some embodiments, the CAR provided herein has a transmembrane domain derived from CD8, CD28, CD3 ζ, CD4,4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3,2B4, BTLA, T Cell Receptor (TCR) α chain, TCR β chain, or TCR ζ chain, CD3 epsilon, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154, or other polypeptide expressed in immune effector cells. In some embodiments, the transmembrane domain of the CARs provided herein includes the transmembrane region of CD8, CD28, CD3 zeta, CD4,4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3,2B4, BTLA, T Cell Receptor (TCR) alpha chain, TCR beta chain, or TCR zeta chain, CD3 epsilon, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154, or another polypeptide expressed in immune effector cells.
In some embodiments, the transmembrane domain of CARs provided by the invention is derived from CD 8. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 8. In some embodiments, the transmembrane domain is derived from CD 28. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 8. In some embodiments, the transmembrane domain is derived from CD3 ζ. In some embodiments, the transmembrane domain comprises the transmembrane region of CD3 ζ. In some embodiments, the transmembrane domain is derived from CD 4. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 4. In some embodiments, the transmembrane domain is derived from 4-1 BB. In some embodiments, the transmembrane domain comprises the transmembrane region of 4-1 BB. In some embodiments, the transmembrane domain is derived from OX 40. In some embodiments, the transmembrane domain comprises the transmembrane region of OX 40. In some embodiments, the transmembrane domain is derived from ICOS. In some embodiments, the transmembrane domain comprises the transmembrane region of ICOS. In some embodiments, the transmembrane domain is derived from CTLA-4. In some embodiments, the transmembrane domain comprises a transmembrane region of CTLA-4. In some embodiments, the transmembrane domain is derived from PD-1. In some embodiments, the transmembrane domain comprises the transmembrane region of PD-1. In some embodiments, the transmembrane domain is derived from LAG-3. In some embodiments, the transmembrane domain comprises the transmembrane region of LAG-3. In some embodiments, the transmembrane domain is derived from 2B 4. In some embodiments, the transmembrane domain comprises the transmembrane region of 2B 4. In some embodiments, the transmembrane domain is derived from BTLA. In some embodiments, the transmembrane domain comprises the transmembrane region of BTLA. In some embodiments, the transmembrane domain is derived from a TCR α chain. In some embodiments, the transmembrane domain comprises a transmembrane region of a TCR α chain. In some embodiments, the transmembrane domain is derived from a TCR β chain. In some embodiments, the transmembrane domain comprises a transmembrane region of a TCR β chain. In some embodiments, the transmembrane domain is derived from a TCR zeta chain. In some embodiments, the transmembrane domain comprises a transmembrane region of a TCR zeta chain. In some embodiments, the transmembrane domain is derived from CD3 epsilon. In some embodiments, the transmembrane domain comprises the transmembrane region of CD3 epsilon. In some embodiments, the transmembrane domain is derived from CD 45. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 45. In some embodiments, the transmembrane domain is derived from CD 5. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 5. In some embodiments, the transmembrane domain is derived from CD 8. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 8. In some embodiments, the transmembrane domain is derived from CD 9. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 9. In some embodiments, the transmembrane domain is derived from CD 16. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 16. In some embodiments, the transmembrane domain is derived from CD 22. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 22. In some embodiments, the transmembrane domain is derived from CD 33. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 33.
In some embodiments, the transmembrane domain is derived from CD 37. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 37. In some embodiments, the transmembrane domain is derived from CD 64. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 64. In some embodiments, the transmembrane domain is derived from CD 80. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 80. In some embodiments, the transmembrane domain is derived from CD 86. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 86. In some embodiments, the transmembrane domain is derived from CD 134. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 134. In some embodiments, the transmembrane domain is derived from CD 154. In some embodiments, the transmembrane domain comprises the transmembrane region of CD 154. Exemplary transmembrane domains are described in more detail below.
Alternatively, the transmembrane domain may be artificially synthesized, in which case it comprises predominantly hydrophobic residues, such as leucine and valine. Optionally, the transmembrane domain may be derived from a polypeptide that is not naturally expressed in an immune effector cell, so long as the transmembrane domain is capable of transducing a signal from an antigen bound to the CAR to the intracellular signaling domain and/or the co-stimulatory domain. In some embodiments, the transmembrane domain may include a triplet of phenylalanine, tryptophan, and valine at each end. Optionally, a short oligopeptide or polypeptide linker, preferably between 2 and 10 amino acids in length, can form a link between the transmembrane domain and the cytoplasmic signaling domain of the CAR. Glycine-serine conjugates are particularly suitable linkers.
The CARs cytoplasmic domains provided by the invention can comprise signaling domains that function in CAR-expressing immune effector cells. Such signaling domains may be derived, for example, from CD3 ζ, Fc receptor γ, Fc γ RIIa, FcR β (fcepsilonr 1b), CD3 γ, CD3 δ, CD3 epsilon, CD79a, CD79b, DAP10, or DAP 12. The signaling domain may also be a combination of signaling domains derived from molecules selected from the group consisting of CD3 ζ, Fc receptor γ, Fc γ RIIa, FcR β (fcepsilonr 1b), CD3 γ, CD3 δ, CD3 ∈, CD79a, CD79b, DAP10, and DAP 12. A signaling domain derived from a protein or polypeptide refers to a domain of a protein or polypeptide that is responsible for activating immune effector cells (e.g., T cells), or a fragment thereof that retains the activation function. Typically, the signaling domain induces persistence, transport and/or effector function of transduced immune effector cells (e.g., T cells) (Sharpe et al, Dis. model Mech.8:337-350 (2015); Finney et al, J.Immunol.161:2791-2797 (1998); Krause et al, J.Exp. Med.188:619-626 (1998)). The signaling domain of a protein or polypeptide can be an intracellular domain of a protein or polypeptide. In some embodiments, the signaling domain comprises the intracellular domain of CD3 ζ, FcR γ, fcyriia, FcR β, CD3 γ, CD3 δ, CD3 ε, CD5, CD22, CD79a, CD79b, DAP10, DAP12, or a combination thereof.
In some embodiments, the cytoplasmic domain of CARs provided herein comprises a signaling domain derived from CD3 ζ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 ζ. In some embodiments, the cytoplasmic domain comprises an FcR γ -derived signaling domain. In some embodiments, the signaling domain comprises an intracellular domain of FcR γ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from Fc γ RIIa. In some embodiments, the signaling domain comprises an intracellular domain of Fc γ RIIa. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from FcR β. In some embodiments, the signaling domain comprises an intracellular domain of FcR β. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 γ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 γ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 δ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 δ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 epsilon. In some embodiments, the signaling domain comprises the intracellular domain of CD3 epsilon. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD 5. In some embodiments, the signaling domain comprises the intracellular domain of CD 5. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD 22. In some embodiments, the signaling domain comprises the intracellular domain of CD 22. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD79 a. In some embodiments, the signaling domain comprises the intracellular domain of CD79 a. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD79 b. In some embodiments, the signaling domain comprises the intracellular domain of CD79 b. In some embodiments, the cytoplasmic domain includes a signaling domain derived from DAP 10. In some embodiments, the signaling domain comprises the intracellular domain of DAP 10. In some embodiments, the cytoplasmic domain includes a signaling domain derived from DAP 12. In some embodiments, the signaling domain comprises the intracellular domain of DAP 12. Exemplary signaling domains are described in more detail below.
In some embodiments, the cytoplasmic domains of CARs provided by the invention further comprise a costimulatory domain. In some embodiments, the cytoplasmic domains of CARs provided by the invention further comprise two co-stimulatory domains. Such co-stimulatory domains may increase activation of immune effector cells (e.g., T cells). The co-stimulatory signaling domain may be derived, for example, from CD28, 4-1BB (CD137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, GITR, TLR, DR3, or CD 43. A co-stimulatory domain derived from a protein or polypeptide refers to a domain of a protein or polypeptide that is responsible for increasing the activation of immune effector cells (e.g., T cells), or a fragment that retains its activation function. In some embodiments, the co-stimulatory domain of CARs provided by the invention comprises the intracellular domain of CD28, 4-1BB (CD137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, TIGIT, GITR, TLR, DR3, or CD 43. In some embodiments, the cytoplasmic domains of CARs provided herein include a costimulatory domain derived from CD 28. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 28. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from 4-1 BB. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 4-1 BB. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from OX 40. In some embodiments, the co-stimulatory domain comprises the intracellular domain of OX 40. In some embodiments, the cytoplasmic domain comprises an ICOS-derived costimulatory domain. In some embodiments, the co-stimulatory domain comprises the intracellular domain of ICOS. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from DAP 10. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DAP 10. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from 2B 4. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 2B 4. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from CD 27. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 27. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from CD 30. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 30. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from CD 40. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 40. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from CD 2. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 2. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from CD 7. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 7. In some embodiments, the cytoplasmic domain includes a co-stimulatory domain derived from LIGHT. In some embodiments, the co-stimulatory domain comprises the intracellular domain of LIGHT. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from TIGIT. In some embodiments, the co-stimulatory domain comprises the intracellular domain of TIGIT. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from GITR. In some embodiments, the co-stimulatory domain comprises an intracellular domain of GITR. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from a TLR. In some embodiments, the co-stimulatory domain comprises an intracellular domain of a TLR. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from DR 3. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DR 3. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from CD 43. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 43. Exemplary co-stimulatory domains are described in more detail below.
CARs have been previously described that contain an intracellular domain that contains a costimulatory domain derived from 4-1BB, ICOS or DAP-10 (see U.S. Pat. No. 7,446,190, which is incorporated herein by reference, which also describes representative sequences of 4-1BB, ICOS and DAP-10). In some embodiments, the cytoplasmic domain of the CAR can include two costimulatory domains including two costimulatory receptors, e.g., CD28 and 4-1BB (see Sadelain et al, Cancer Discov.3(4):388-398(2013)), or CD28 and OX40, or a combination of other costimulatory ligands disclosed herein.
The extracellular domain of the CAR can be fused to a leader peptide or signal peptide that directs the nascent protein into the endoplasmic reticulum and subsequent transport to the cell surface. It will be appreciated that once the polypeptide containing the signal peptide is expressed on the cell surface, the signal peptide will generally have been proteolytically removed during processing and translocation of the polypeptide in the endoplasmic reticulum to the cell surface. Thus, a polypeptide, such as a CAR, is typically expressed on the cell surface as a mature protein lacking a signal peptide, while a precursor form of the polypeptide includes the signal peptide. A signal peptide or leader may be essential if the CAR is to be glycosylated and/or anchored in the cell membrane. The signal sequence or leader sequence is a peptide sequence, usually present at the N-terminus of newly synthesized proteins, that directs them into the secretory pathway. The signal peptide is covalently attached as a fusion protein to the N-terminus of the extracellular antigen-binding domain of the CAR. As is well known in the art, any suitable signal peptide may be used in the CAR to provide cell surface expression in immune cells (see Gierasch, biochem.28:923-930 (1989); von Heijne, J.mol. biol.184(1): 99-105 (1985)). Particularly useful signal peptides may be derived from cell surface proteins naturally expressed in immune cells provided herein, including any of the signal peptides of the polypeptides disclosed herein. Thus, any suitable signal peptide may be used to direct the expression of the CAR on the cell surface of the immune effector cells provided by the invention.
In some embodiments, the CAR may include a spacer or sequence that interconnects the domains of the CAR. For example, a spacer may be included between the signal peptide and the antigen binding domain, between the antigen binding domain and the transmembrane domain, between the transmembrane domain and the intracellular domain, and/or between domains within the intracellular domain, e.g., between the stimulatory domain and the co-stimulatory domain. The spacer may be flexible enough to allow interaction of the various domains with other polypeptides, e.g., to allow flexibility in the orientation of the antigen binding domain to facilitate antigen recognition. The spacer may be, for example, a hinge region from IgG, a CH2CH3 (constant) region of an immunoglobulin, and/or a portion of CD3 (cluster 3) or some other sequence suitable as a spacer. In some embodiments, the disclosed CARs include a hinge domain that connects the CD123 binding domain and the transmembrane domain. In some embodiments, the hinge domain comprises a human CD8 hinge domain. In some embodiments, the hinge domain comprises a human CD28 hinge domain.
The following provides some exemplary molecules from which the domains of CARs provided by the invention can be derived.
CD3ζCD3 ζ comprises 3 immunoreceptor tyrosine-based activation motifs (ITAMs) and transmits activation signals to cells, e.g., cells of the lymphoid lineage, such as T cells, upon antigen binding. The CD3 ζ polypeptide may have an amino acid sequence corresponding to the sequence provided below (GenBank No. NP-932170 (NP-932170.1, GI:37595565)), or a fragment thereof. In some embodiments, the CD3 zeta signaling domain has the amino acid sequence of amino acids 52 to 164 of the CD3 zeta polypeptide sequence provided below, or sufficient for signaling an active fragment. See GenBank NP _932170 for reference to a domain within CD3 ζ, e.g., a signal peptide of amino acids 1-21; an extracellular domain of amino acids 22-30; a transmembrane domain of amino acids 31-51; an intracellular domain of amino acids 52-164. In some embodiments, the CAR can have a transmembrane domain derived from CD3 ζ. The transmembrane domain may comprise the transmembrane region of CD3 ζ (e.g., 31 to 51 amino acids of the following sequence), or a fragment thereof. In some embodiments, the cytoplasmic domain of CARs can include a signaling domain derived from CD3 ζ. In some embodiments, the signaling domain of CD3 ζ can comprise an intracellular domain of CD3 ζ (e.g., amino acids 52-164 of the following sequence), or a fragment thereof. It is understood that a CD3 ζ sequence that is shorter or longer than a particular described domain may be included in a CAR, if desired.
1 MKWKALFTAA ILQAQLPITE AQSFGLLDPK LCYLLDGILF IYGVILTALF LRVKFSRSAD
61 APAYQQGQNQ LYNELNLGRR EEYDVLDKRR GRDPEMGGKP QRRKNPQEGL YNELQKDKMA
121 EAYSEIGMKG ERRRGKGHDG LYQGLSTATK DTYDALHMQA LPPR(SEQ ID NO:322)
FCRγ
The type of activation of IgG receptor Fc γ Rs forms multimeric complexes that include Fc receptor γ chains (fcrγ) that contain Intracellular Tyrosine Activation Motifs (ITAMs), the activation of which triggers burst of active oxygen, cytokine release, phagocytosis, antibody-dependent cell-mediated cytotoxicity, and degranulation. The FcR γ polypeptide may have a sequence identical to the NCBI reference sequence: NP-004097.1 (GI: 4758344), or a fragment thereof. See GenBank NP _004097 for reference to domains within FcR γ, e.g., signal peptides of amino acids 1-18; an extracellular domain of amino acids 19-23; a transmembrane region of amino acids 24-44; an intracellular domain of amino acids 45-86. In some embodiments, the CAR may include a transmembrane domain derived from FcR γ. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of FcR γ, or a fragment thereof. In some embodiments, the cytoplasmic domain of CARs may include a signaling domain derived from FcR γ. In some embodiments, the signaling domain comprises an intracellular domain of FcR γ or a fragment thereof. It is understood that FcR γ sequences shorter or longer than the particular described domain may be included in the CAR if desired.
FcγRIIaAre cell surface receptors found on phagocytic cells such as macrophages and neutrophils that are involved in the process of phagocytosis and clearance of immune complexes. By binding to IgG, it can initiate a cellular response against pathogens and soluble antigens. Fc γ RIIa also promotes phagocytosis of opsonic antigens. The Fc γ RIIa polypeptide may have a sequence identical to NCBI reference sequence: the amino acid sequence corresponding to NP-001129691.1, or a fragment thereof. See NCBI reference sequence NP _001129691.1 for reference to domains within Fc γ RIIa, e.g., signal peptides of amino acids 1-33; an extracellular domain of amino acids 34-217; 218-240 amino acid transmembrane domain; 241-317 amino acid intracellular domain. In some embodiments, the CAR may comprise a transmembrane domain derived from Fc γ RIIa. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of Fc γ RIIa or a fragment thereof. In some embodiments, the CAR is cytoplasmicThe domain may comprise a signaling domain derived from Fc γ RIIa. In some embodiments, the signaling domain comprises an intracellular domain of Fc γ RIIa or a fragment thereof. It will be appreciated that Fc γ RIIa sequences shorter or longer than the particular described domains may be included in the CAR if desired.
FcRβ(FcεR1b)Is a high affinity receptor that binds to the Fc region of immunoglobulins epsilon. Intact mast cell responses require aggregation of FcR β by multivalent antigens, including release of preformed mediators (such as histamine) by degranulation and release of de novo-produced lipid mediators and cytokines. FcR β also mediates secretion of important lymphokines. Binding of allergens to receptor-bound IgE results in cellular activation and release of mediators responsible for the manifestation of allergy. The FcR β polypeptide may have a sequence that is identical to the NCBI reference sequence: NP _000130.1 or a fragment thereof. See NCBI reference sequence NP _000130.1 for domains within FcR β, e.g., the intracellular domains at amino acids 1-59, 118-130 and 201-244; (ii) transmembrane domains of amino acids 60-79, 98-117, 131-; 80-97 and 151-180 amino acids. In some embodiments, the cytoplasmic domain of CARs may include a signaling domain derived from FcR β. In some embodiments, the signaling domain comprises an intracellular domain of FcR β or a fragment thereof. It is understood that FcR β sequences shorter or longer than the particular described domain may be included in a CAR if desired.
CD3 gamma (T cell surface glycoprotein CD3 gamma chain)Is part of the TCR-CD3 complex present on the surface of T lymphocytes and plays a crucial role in adaptive immune responses. CD3 γ contains Immunoreceptor Tyrosine Activation Motifs (ITAMs) in its cytoplasmic domain. In addition to playing a role in signal transduction in T cell activation, CD3 γ also plays an essential role in the dynamic regulation of TCR expression on the cell surface. The CD3 γ polypeptide may have a sequence similar to the NCBI reference sequence: NP-004097.1 (GI:4758344), or a fragment thereof. See NCBI reference sequence NP _004097 for reference to domains within CD3 γ, e.g., signal peptides of amino acids 1-22; extracellular knot of amino acids 23-116A domain; 117-137 amino acid transmembrane domain; 138-182 amino acid. In some embodiments, the CAR may comprise a transmembrane domain derived from CD3 γ. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of CD3 γ, or a fragment thereof. In some embodiments, the cytoplasmic domain of CARs may include a signaling domain derived from CD3 γ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 γ or a fragment thereof. It is understood that, if desired, CD3 γ sequences that are shorter or longer than the particular described domain may be included in the CAR.
CD3 delta (T cell surface glycoprotein CD3 delta chain)Is part of the TCR-CD3 complex present on the surface of T lymphocytes and plays a crucial role in adaptive immune responses. CD3 δ contains Immunoreceptor Tyrosine Activation Motifs (ITAMs) in its cytoplasmic domain. In addition to serving as a signal transducer in T cell activation, CD3 δ plays a crucial role in thymocyte differentiation and is involved in the proper assembly and surface expression of the TCR-CD3 complex within cells. CD3 δ interacts with CD4 and CD8, establishing a functional link between TCR and the co-receptors CD4 and CD8, which are required for CD4 or CD 8T cell activation and positive selection. The CD3 δ polypeptide may have a sequence identical to the NCBI reference sequence: the amino acid sequence corresponding to NP-000723.1, or a fragment thereof. See NCBI reference sequence NP _000723.1 for reference to domains within CD3 δ, e.g., signal peptides of amino acids 1-21; an extracellular domain of amino acids 22-105; 106-126 amino acid transmembrane domain; 127-171 amino acid intracellular domain. In some embodiments, the CAR may include a transmembrane domain derived from CD3 δ. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of CD3 δ, or a fragment thereof. In some embodiments, the cytoplasmic domain of the CAR can include a signaling domain derived from CD3 δ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 δ or a fragment thereof. It is understood that a CD3 δ sequence that is shorter or longer than a particular described domain may be included in a CAR if desired.
CD3 epsilon (T cell surface)Glycoprotein CD3 epsilon chainIs part of the TCR-CD3 complex present on the surface of T lymphocytes and plays a crucial role in adaptive immune responses. CD3 epsilon contains Immunoreceptor Tyrosine Activation Motifs (ITAMs) in its cytoplasmic domain. In addition to serving as a signal transducer in T cell activation, CD3 epsilon plays an important role in the proper development of T cells. CD3 e 0 initiates TCR-CD3 complex assembly by forming two heterodimers, CD3 δ/CD3 γ and CD3 γ/CD3 γ. The CD3 epsilon polypeptide may have a sequence similar to the NCBI reference sequence: the amino acid sequence corresponding to NP-000724.1, or a fragment thereof. See NCBI reference sequence NP _000724.1 for reference to domains within CD3 epsilon, e.g., signal peptides of amino acids 1-22; an extracellular domain of amino acids 23-126; a transmembrane domain of amino acid 127-152; 153-207 amino acid. In some embodiments, the CAR may include a transmembrane domain derived from CD3 epsilon. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of CD3 epsilon or a fragment thereof. In some embodiments, the cytoplasmic domain of the CAR can include a signaling domain derived from CD3 epsilon. In some embodiments, the signaling domain comprises the intracellular domain of CD3 epsilon or a fragment thereof. It is understood that sequences of CD3 epsilon that are shorter or longer than the particular described domain can be included in the CAR if desired.
CD79a (B cell antigen receptor complex associated protein alpha chain)Cooperation with CD79B is required to initiate a signaling cascade activated by antigen binding to the B cell antigen receptor complex (BCR), leading to complex internalization, translocation into late endosomes, and antigen presentation. CD79a stimulates SYK autophosphorylation and activation. CD79a also binds to BLNK, brings BLNK into proximity with SYK, phosphorylates BLNK by SYK, and interacts with and increases the activity of certain Src family tyrosine kinases. The CD79a polypeptide may have a sequence that is identical to the NCBI reference sequence: the amino acid sequence corresponding to NP-001774.1, or a fragment thereof. See NCBI reference sequence NP _001774.1 for reference to domains within CD79a, e.g., signal peptides of amino acids 1-32; an extracellular domain of amino acids 33-143; 144-165 amino acid transmembrane domain; 166-226 amino acid intracellular domain. In some embodiments, the CAR can compriseDerived from the transmembrane domain of CD79 a. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of CD79a, or a fragment thereof. In some embodiments, the cytoplasmic domain of the CAR may include a signaling domain derived from CD79 a. In some embodiments, the signaling domain comprises the intracellular domain of CD79a or a fragment thereof. It is understood that, if desired, CD79a sequences shorter or longer than the particular described domain can be included in the CAR.
CD79B (B cell antigen receptor complex associated protein beta chain)Cooperation with CD79a is required to initiate a signaling cascade activated by the antigen and B cell antigen receptor complex (BCR) leading to complex internalization, translocation to late endosomes and antigen presentation. CD79b enhanced phosphorylation of CD79 a. The CD79b polypeptide may have a sequence that is identical to the NCBI reference sequence: NP _000617.1 or a fragment thereof. See NCBI reference sequence NP _000617.1 for reference to domains within CD79b, e.g., signal peptides of amino acids 1-28; an extracellular domain of amino acids 29-159; 160-180 amino acid transmembrane domain; 181-229 amino acid. In some embodiments, the CAR may include a transmembrane domain derived from CD79 b. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of CD79b, or a fragment thereof. In some embodiments, the cytoplasmic domain of the CAR may include a signaling domain derived from CD79 b. In some embodiments, the signaling domain comprises the intracellular domain of CD79b or a fragment thereof. It is understood that, if desired, CD79b sequences shorter or longer than the particular described domain can be included in the CAR.
DAP10
DAP10, also known as a hematopoietic cell signal transducer, is a signaling subunit closely related to the receptor family in hematopoietic cells. The DAP10 polypeptide may have an amino acid sequence corresponding to GenBank No. NP 055081.1(GI:15826850) or a fragment thereof. See NCBI reference sequence NP _055081 for reference to domains within DAP10, e.g., signal peptides of amino acids 1 to 18; an extracellular domain of amino acids 19-48; a transmembrane domain of amino acids 49-69; an intracellular domain of amino acids 70-93. In some embodiments, the cytoplasmic domain of the CAR may include a signaling domain derived from DAP 10. In some embodiments, the signaling domain comprises the intracellular domain of DAP10 or a fragment thereof. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from DAP 10. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DAP10 or a fragment thereof. It is understood that DAP10 sequences shorter or longer than the particular described domain may be included in the CAR if desired.
DAP12
DAP12 is present in myeloid cells, such as macrophages and granulocytes, where, for example, DAP12 is associated with a trigger receptor expressed on myeloid cell members (TREMs) and MDL1 (myeloid DAP 12-related lectin 1/CLEC5A), both of which are involved in inflammatory responses against pathogens, such as viruses and bacteria. In lymphoid lineage cells, DAP12 is expressed in NK cells and is associated with activating receptors (e.g., C-type lectin receptor NKG2C), natural cytotoxic receptor NKp44, short-tailed KIR3DS1, and KIR2DS1/2/5, respectively. In particular, NGK2C is the major activating NK cell receptor used to control CMV infection in humans and mice. It was found that DAP 12-containing CARs cross-linked with their Ag produce sufficient activation signals in NK cells.
Figure BDA0003670489470000471
et al, J Immunol.194:3201-12 (2015). The DAP12 polypeptide may have an amino acid sequence corresponding to GenBank No. AAD09437.1(GI:2905996) or a fragment thereof. See GenBank No. aad09437.1 for reference to a domain within DAP12, e.g., a signal peptide of amino acids 1-21; an extracellular domain of amino acids 22-40; a transmembrane domain of amino acids 41-61; an intracellular domain of amino acids 62-113. In some embodiments, the cytoplasmic domain of the CAR may include a signaling domain derived from DAP 12. In some embodiments, the signaling domain comprises the intracellular domain of DAP12 or a fragment thereof. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from DAP 12. In some embodiments, theThe costimulatory domain comprises the intracellular domain of DAP12 or a fragment thereof. It is understood that DAP12 sequences shorter or longer than the particular described domain may be included in the CAR if desired.
CD28
Cluster of differentiation 28(CD28) is a protein expressed on T cells that provides a costimulatory signal for the activation and survival of T cells. CD28 is a receptor for CD80(B7.1) and CD86(B7.2) proteins. The CD28 polypeptide may have an amino acid sequence corresponding to the sequence provided below (GenBank No. P10747(P10747.1, GI:115973) or NP-006130 (NP-006130.1, GI:5453611)) or a fragment thereof. See GenBank NP _006130 for reference to domains within CD28, e.g., signal peptides of amino acids 1-18; an extracellular domain of amino acids 19-152; 153-179 amino acid transmembrane domain; 180-220 amino acid intracellular domain. In some embodiments, the CAR may comprise a hinge domain derived from CD28 (e.g., amino acids 114 to 152 of the following sequence), or a fragment thereof. In some embodiments, the CAR may include a transmembrane domain derived from CD 28. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of CD28 (e.g., amino acids 153 to 179 of the following sequence), or a fragment thereof. In some embodiments, the cytoplasmic domain of the CAR can include a costimulatory domain derived from CD 28. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD28 (e.g., amino acids 180 to 220 of the following sequence), or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD28, a costimulatory signaling domain and a transmembrane domain, respectively. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of CD28, and the CAR includes amino acids 153 to 220 of CD 28. In some embodiments, the CAR may include three domains derived from CD28, a transmembrane domain, a hinge domain, and a costimulatory signaling domain, respectively. In another embodiment, the CAR comprises amino acids 114 to 220 of CD 28. It is understood that, if desired, CD28 sequences that are shorter or longer than the particular described domain can be included in the CAR.
1 MLRLLLALNL FPSIQVTGNK ILVKQSPMLV AYDNAVNLSC KYSYNLFSRE FRASLHKGLD
61 SAVEVCVVYG NYSQQLQVYS KTGFNCDGKL GNESVTFYLQ NLYVNQTDIY FCKIEVMYPP
121 PYLDNEKSNG TIIHVKGKHL CPSPLFPGPS KPFWVLVVVG GVLACYSLLV TVAFIIFWVR
181 SKRSRLLHSD YMNMTPRRPG PTRKHYQPYA PPRDFAAYRS(SEQ ID NO:333)
4-1BB
4-1BB, also known as TNF receptor superfamily member 9, can act as a TNF ligand and has stimulatory activity. The 4-1BB polypeptide may have an amino acid sequence corresponding to the sequence provided below (GenBank No. P41273(P41273.1, GI:728739) or NP-001552 (NP-001552.2, GI:5730095)) or a fragment thereof. See GenBank NP-001552 for reference to a domain within 4-1BB, e.g., the signal peptide at amino acids 1-17; an extracellular domain of amino acids 18-186; 187-213 amino acid transmembrane domain; 214-an intracellular domain of amino acid 255. In some embodiments, the CAR can include a transmembrane domain derived from 4-1 BB. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of 4-1BB (e.g., amino acids 187 to 213 of the following sequence), or a fragment thereof. In some embodiments, the cytoplasmic domain of the CAR can include a co-stimulatory domain derived from 4-1 BB. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 4-1BB (e.g., amino acids 214 to 255 of the following sequence), or a fragment thereof. In some embodiments, the CAR may comprise two domains derived from 4-1BB, a costimulatory signaling domain and a transmembrane domain, respectively. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of 4-1BB, and the CAR includes amino acids 187 to 255 of 4-1 BB. It is understood that 4-1BB sequences shorter or longer than the particular described domain can be included in the CAR, if desired.
1 MGNSCYNIVA TLLLVLNFER TRSLQDPCSN CPAGTFCDNN RNQICSPCPP NSFSSAGGQR
61 TCDICRQCKG VFRTRKECSS TSNAECDCTP GFHCLGAGCS MCEQDCKQGQ ELTKKGCKDC
121 CFGTFNDQKR GICRPWTNCS LDGKSVLVNG TKERDVVCGP SPADLSPGAS SVTPPAPARE
181 PGHSPQIISF FLALTSTALL FLLFFLTLRF SVVKRGRKKL LYIFKQPFMR PVQTTQEEDG
241 CSCRFPEEEE GGCEL(SEQ ID NO:334)
OX40
OX40, also known as tumor necrosis factor receptor superfamily member 4 precursor or CD134, is a member of the TNFR-receptor superfamily. OX40 polypeptides may have an amino acid sequence corresponding to GenBank No. P43489(P43489.1, GI:1171933) or NP-003318 (NP-003318.1, GI:4507579), or a fragment thereof. See GenBank NP _003318 for reference to domains within OX40, e.g., signal peptide of amino acids 1-28; an extracellular domain of amino acids 29 to 214; 215-235 amino acid transmembrane domain; 236-277 amino acids. It is understood that OX40 sequences that are shorter or longer than the particular described domain can be included in the CAR, if desired. In some embodiments, the CAR may include a transmembrane domain derived from OX 40. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of OX40 or a fragment thereof. In some embodiments, the cytoplasmic domain of the CAR can include a costimulatory domain derived from OX 40. In some embodiments, the co-stimulatory domain comprises the intracellular domain of OX40 or a fragment thereof. In some embodiments, the CAR may include two domains derived from OX40, a costimulatory signaling domain and a transmembrane domain, respectively. In some embodiments, the CAR has an amino acid sequence comprising the transmembrane domain and the intracellular domain of OX40, and the CAR comprises amino acids 215 to 277 of OX 40.
ICOS
ICOS inducible T cell costimulatory molecule precursor (ICOS), also known as CD278, is a CD28 superfamily costimulatory receptor expressed on activated T cells. The ICOS polypeptide may have an amino acid sequence corresponding to GenBank No. NP036224(NP036224.1, GI:15029518) or a fragment thereof. See GenBank NP — 036224 for reference to domains within ICOS, e.g., signal peptides of amino acids 1 to 20; an extracellular domain of amino acids 21-140; 141-161 amino acid transmembrane domain; 162-199 amino acid in the intracellular domain. In some embodiments, the CAR may include a transmembrane domain derived from ICOS. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of ICOS, or a fragment thereof. In some embodiments, the cytoplasmic domain of the CAR can include a costimulatory domain derived from ICOS. In some embodiments, the co-stimulatory domain comprises the intracellular domain of ICOS or a fragment thereof. In some embodiments, the CAR may comprise two ICOS-derived domains, respectively a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of ICOS, and the CAR includes amino acids 141 to 199 of ICOS. It is understood that ICOS sequences shorter or longer than the particular described domain may be included in the CAR if desired.
2B4
2B4(CD244) is a co-stimulatory receptor expressed on both NK cells and CD8+ T cells. Their targets are hematopoietic cells (including B-cells and T-cells) and non-MHC like molecules expressed on activated monocytes and granulocytes (CD 48).
2B4 is activated by its ligand binding to the target cell, resulting in NK (or T cell) activation and killing of the target cell. The 2B4 polypeptide may have an amino acid sequence corresponding to GenBank accession No. Q9BZW8.2 (NP-001160135.1; GI:47605541) or a fragment thereof. See GenBank NP _001160135.1 for reference to a domain within 2B4, e.g., a signal peptide of amino acids 1-21; an extracellular domain of amino acids 22-229; 230-250 amino acid transmembrane domain; 251-370 amino acid intracellular domain. In some embodiments, the CAR may include a transmembrane domain derived from 2B 4. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of 2B4, or a fragment thereof. In some embodiments, the cytoplasmic domain of the CAR can include a costimulatory domain derived from 2B 4. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 2B4 or a fragment thereof. In some embodiments, the CAR may include two domains derived from 2B4, a costimulatory signaling domain and a transmembrane domain, respectively. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of 2B4, and the CAR includes amino acids 230 to 370 of 2B 4. It is understood that 2B4 sequences shorter or longer than the particular described domain can be included in the CAR if desired.
CD27：CD27(TNFRSF7) is a transmembrane receptor expressed on human CD8+ and CD4+ T cell subsets, NKT cells, NK cell subsets and hematopoietic progenitor cells and induced in FOXP3+ CD4T cells and B cell subsets. Previous studies found that CD27 can actively provide co-stimulatory signals in vivo, increasing human T cell survival and anti-tumor activity. (see Song and Powell; Oncoimmunology 1, No.4(2012): 547-549). The CD27 polypeptide may have an amino acid sequence corresponding to UniProtKB/Swiss-Prot No.: P26842.2(GenBank NP-001233.1; GI:269849546)) or a fragment thereof. See GenBank NP _001233 for reference to domains within CD27, e.g., signal peptide of amino acids 1-19; an extracellular domain of amino acids 20-191; 192-212 amino acid transmembrane domain; 213-260 amino acid intracellular domain. In some embodiments, the CAR may include a transmembrane domain derived from CD 27. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of CD27, or a fragment thereof. In some embodiments, the cytoplasmic domain of the CAR can include a costimulatory domain derived from CD 27. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD27 or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD27, a costimulatory signaling domain and a transmembrane domain, respectively. In some embodiments, the CAR has an amino acid sequence comprising the transmembrane domain and intracellular domain of CD27, and the CAR comprises amino acids 192 to 260 of CD 27. It is understood that, if desired, CD27 sequences that are shorter or longer than the particular described domain can be included in the CAR.
CD30: CD30 and its ligand (CD30L) belong to members of the Tumor Necrosis Factor Receptor (TNFR) and Tumor Necrosis Factor (TNF) superfamily, respectively. CD30 behaves in many ways similar to OX40 and enhances proliferation and cytokine production induced by TCR stimulation (Goronzy and Weyand, Arthritis Research)&Therapy 10,no.S1(2008):S3). The CD30 polypeptide may have an amino acid sequence corresponding to GenBank No. AAA51947.1(GenBank NP-001234.3; GI:180096) or a fragment thereof. See GenBank NP _001234.3 for reference to domains within CD30, e.g., signal peptides of amino acids 1-18; an extracellular domain of amino acids 19-385; a transmembrane domain of amino acids 386-406; 407-595 amino acid. In some embodiments, the CAR may comprise a transmembrane domain derived from CD 30. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD30, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from CD 30. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD30 or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD30, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of CD30, and the CAR includes amino acids 386 to 595 of CD 30. It is understood that a CD30 sequence that is shorter or longer than the particular described domain can be included in the CAR if desired.
CD40: CD40 is a 48kD transmembrane glycoprotein surface receptor, one of the members of the Tumor Necrosis Factor Receptor Superfamily (TNFRSF). Exemplary amino acid sequences of CD40 are found, for example, in accession numbers: ALQ33424.1, GenBank NP-001241.1, GI: 957949089. CD40 was originally thought to be a costimulatory receptor expressed on APCs, playing a central role in B cell and T cell activation. The ligand CD154 of CD40 (also known as TRAP, T-BAM, CD40 ligand or CD40L) is a type II integral membrane protein. See GenBank NP _001241.1 for reference to domains within CD40, e.g., signal peptides of amino acids 1-20; an extracellular domain of amino acids 21-193; 194-215 amino acid transmembrane domain; 216-277 amino acids. In some embodiments, the CAR may comprise a transmembrane domain derived from CD 40. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD40, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from CD 40. In some embodiments, the co-stinging isThe stimulatory domain includes the intracellular domain of CD40 or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD40, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of CD40, and the CAR includes amino acids 194 to 277 of CD 40. It is understood that a CD40 sequence that is shorter or longer than the particular described domain can be included in the CAR if desired.
CD2
The binding of the CD2 molecule to its ligand, CD58, in combination stimulates the proliferation, cytokine production and effector function of the T cells, particularly the CD 28-deficient T cell subset. CD58 is widely expressed on APCs, including dendritic cells. Binding of CD2 amplified TCR signaling in CD28-CD8+ T cells, indicating that the CD2-CD58 interaction has a true co-stimulatory effect. CD2 signals promote control of viral infection by CD28-CD8+ T cells, but also promote sustained expansion of CD28-CD8+ T cells under chronic stimulation with sustained Ag (Judith Leitner Jet et al, Immunol, 2015, 195(2) 477-487). The CD2 polypeptide may have a sequence identity to the sequence No.: NP-001758.2 GI:156071472 or a fragment thereof. See GenBank NP _001758.2 for reference to domains within CD2, e.g., signal peptides of amino acids 1-24; an extracellular domain of amino acids 25-209; 210-235 amino acid transmembrane structural domain; 236-351 amino acids. In some embodiments, the CAR may comprise a transmembrane domain derived from CD 2. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD2, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from CD 2. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD2 or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD2, a costimulatory transduction domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of CD2, and the CAR includes amino acids 210 to 351 of CD 2. It is understood that a CD2 sequence that is shorter or longer than the particular described domain can be included in the CAR if desired.
LIGHT
TNF superfamily member 14 (also known as LTg, CD258, HVEML and LIGHT) is a co-stimulatory receptor involved in cellular immune responses. LIGHT can act as a co-stimulatory factor to activate lymphoid cells and as a block for herpes virus infection. LIGHT has been shown to stimulate T cell proliferation, triggering apoptosis in a variety of tumor cells. LIGHT is present in T cells and stromal cells. LIGHT is expressed on immature Dendritic Cells (DCs) produced by human PBMCs. LIGHT is involved in co-stimulating human T cell proliferation, amplifying the NF-. kappa.B signaling pathway, and preferentially inducing the production of IFN-. gamma.rather than IL-4 in the presence of an antigenic signal. (Tamada Ket al., J Immunol, 2000,164(8) 4105-. The LIGHT polypeptide may have an amino acid sequence similar to GenBank accession no: NP-001363816.1 (GI: 1777376047), or a fragment thereof. See GenBank NP _001363816.1 for reference to domains within LIGHT, such as the intracellular domain of amino acids 1-37; a transmembrane domain of amino acids 38-58; an extracellular domain of amino acids 59-240. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from LIGHT. In some embodiments, the co-stimulatory domain comprises the intracellular domain of LIGHT, or a fragment thereof. It is understood that LIGHT sequences shorter or longer than the particular described domain can be included in the CAR if desired.
GITR
TNF receptor superfamily member 18 (also known as TNFRSF18, AITR, GITR; CD 357; GITR-D; ENERGEN) is increased in expression upon T cell activation. Stimulation of T cells by GITR can enhance immunity to tumor and viral pathogens and exacerbate autoimmune disease. The effect of stimulation by GITR is generally thought to be due to a reduction in the effector activity of immunosuppressive CD4+ CD25+ regulatory t (treg) cells. (Shevach, E.and Stephens, G.Nat Rev Immunol 6, 613-. GITR polypeptides may have a sequence similar to GenBank accession No.: AAI52382.1, GenBank NP — 004186.1, GI: 158931986 or a fragment thereof. See GenBank NP _004186.1 for reference to domains within GITR, e.g., signal peptides of amino acids 1-25; an extracellular domain of amino acids 26-162; a transmembrane domain of amino acid 163-183; 184-241 amino acid. In some embodiments, the CAR can include a transmembrane domain derived from GITR. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of GITR, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from GITR. In some embodiments, the co-stimulatory domain comprises an intracellular domain of GITR or a fragment thereof. In some embodiments, the CAR may include two domains derived from GITR, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of GITR, and the CAR includes amino acids 163 to 241 of GITR. It is understood that, if desired, GITR sequences shorter or longer than the particular described domain may be included in the CAR.
DR3
TNF receptor superfamily member 25 (also known as DR3, TR3, DDR3, LARD, APO-3, TRAMP, WSL-1, GEF720, WSL-LR, PLEKHG5, or TNFRSF12) is preferentially expressed in lymphocyte-rich tissues and plays a role in regulating lymphocyte homeostasis. This receptor stimulates NF-. kappa.B activation and regulates apoptosis. The signal transduction of this receptor is mediated by various adaptor-containing death domains. This gene has been reported to encode multiple alternatively spliced transcript variants of different isoforms, most of which are potential secreted molecules. The selective splicing of this gene in B and T cells, which mainly produces full length membrane-bound subtypes and is involved in controlling T cell activation-induced lymphocyte proliferation, encounters programmed changes upon T cell activation. DR3 polypeptides may have a sequence compatible with GenBank accession No.: AAI17190.1, GenBank NP-003781.1 GI:109658976 or a fragment thereof. See GenBank NP _003781.1 for reference to domains within DR3, e.g., signal peptides of amino acids 1-24; an extracellular domain of amino acids 25-199; 200-220 amino acid transmembrane domain; 221-417 amino acid intracellular domain. In some embodiments, the CAR may include a transmembrane domain derived from DR 3. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of DR3 or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from DR 3. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DR3 or a fragment thereof. In some embodiments, the CAR may include two domains derived from DR3, a costimulatory signaling domain and a transmembrane domain. In one embodiment, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of DR3, and the CAR includes amino acids 200 to 417 of DR 3. It is understood that DR3 sequences shorter or longer than the particular described domain can be included in the CAR if desired.
CD43
CD43 (also known as SPN sialoprotein, LSN, GALGP, GPL115) is a highly sialylated glycoprotein that plays a role in antigen-specific activation of T cells and is present on the surface of thymocytes, T lymphocytes, monocytes, granulocytes, and some B lymphocytes. CD43 comprises a mucin-like extracellular domain, a transmembrane region, and a carboxy-terminal intracellular region. In stimulated immune effector cells, the extracellular domain of certain cell types undergoes proteolytic cleavage, releasing soluble extracellular fragments. The CD43 polypeptide may have an amino acid sequence that is homologous to GenBank NP _003114.1, accession No.: EAW80016.1GI: 119600422 or a fragment thereof. See GenBank NP _003114.1 for reference to domains within CD43, such as signal peptides of amino acids 1-19; an extracellular domain of amino acids 20-253; a transmembrane domain of amino acids 254-276; 277-400 amino acid intracellular domain. In some embodiments, the CAR may comprise a transmembrane domain derived from CD 43. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD43, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from CD 43. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD43 or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD43, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of CD43, and the CAR includes amino acids 254 to 400 of CD 43. It is understood that a CD43 sequence that is shorter or longer than the particular described domain can be included in the CAR if desired.
CD4
Cluster of differentiation 4(CD4), also known as T cell surface glycoprotein CD4, is a glycoprotein present on the surface of immune cells such as helper T cells, monocytes, macrophages and dendritic cells. In some embodiments, the CAR may comprise a transmembrane domain derived from CD 4. CD4 exists in a variety of isoforms. It will be appreciated that any isomer may be selected to achieve the desired function. Exemplary isomers include isomer 1 (NP-000607.1, GI:10835167), isomer 2 (NP-001181943.1, GI:303522479), isomer 3 (NP-001181944.1, GI: 303522485; or NP-001181945.1, GI: 303522491; or NP-001181946.1, GI:303522569), and the like. The sequence of an exemplary isomer, isomer 1, is provided below. See GenBank NP _000607.1 for reference to domains within CD4, e.g., signal peptides such as amino acids 1-25; an extracellular domain of amino acids 26-396; 397-418 amino acid transmembrane domain; 419-458 amino acid of the intracellular domain. In some embodiments, the CAR may comprise a transmembrane domain derived from CD 4. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD4, or a fragment thereof. It will be appreciated that additional sequences of CD4 beyond the transmembrane domain of amino acids 397 to 418 may be included in the CAR if desired. It is further understood that, if desired, CD4 sequences that are shorter or longer than the particular described domain can be included in the CAR.
CD8
Cluster of differentiation 8(CD8) is a transmembrane glycoprotein that acts as a co-receptor for the T Cell Receptor (TCR). CD8 binds to Major Histocompatibility Complex (MHC) molecules and is specific for MHC class I proteins. In some embodiments, the CAR may comprise a transmembrane domain derived from CD 8. The CD8 polypeptide may have an amino acid sequence corresponding to the sequence provided below (GenBank No.: NP _001139345.1(GI:225007536)) or a fragment thereof. See GenBank NP _001139345.1 for reference to domains within CD8, e.g., signal peptides of amino acids 1-21; an extracellular domain of amino acids 22-182; 183-203 amino acid transmembrane domain; 204-235 amino acids. In some embodiments, the CAR may comprise a hinge domain derived from CD 8. In some embodiments, the hinge domain may include amino acids 137-182 of the CD8 polypeptide provided below. In some embodiments, the CAR may comprise a signal peptide derived from CD8 (e.g., amino acids 1 to 21 of the sequence described below). In some embodiments, the CAR may include a transmembrane domain derived from CD 8. In some embodiments, the transmembrane domain of the CAR comprises the transmembrane region of CD8 (e.g., amino acids 183 to 203 of the sequence described below), or a fragment thereof. In another embodiment, the CAR can comprise amino acids 137-203 of the CD8 polypeptide provided below. In another embodiment, the CAR may comprise amino acids 137 to 209 of a CD8 polypeptide provided below. It will be appreciated that additional CD8 sequences in addition to the hinge domain of amino acids 137 to 182 and the transmembrane domain of amino acids 183 to 203 may be included in the CAR if desired. It is further understood that, if desired, CD8 sequences that are shorter or longer than the particular described domain can be included in the CAR.
1 MALPVTALLL PLALLLHAAR PSQFRVSPLD RTWNLGETVE LKCQVLLSNP TSGCSWLFQP
61 RGAAASPTFL LYLSQNKPKA AEGLDTQRFS GKRLGDTFVL TLSDFRRENE GYYFCSALSN
121 SIMYFSHFVP VFLPAKPTTT PAPRPPTPAP TIASQPLSLR PEACRPAAGG AVHTRGLDFA
181 CDIYIWAPLA GTCGVLLLSL VITLYCNHRN RRRVCKCPRP VVKSGDKPSL SARYV(SEQ ID NO:347)
Thus, for exemplary purposes, a CAR disclosed herein can include, from N-terminus to C-terminus, an anti-CD 123 antibody or antigen binding fragment (e.g., a scFvs disclosed herein), a hinge (e.g., a CD8 hinge or a CD28 hinge), a transmembrane region (e.g., a CD8 transmembrane region or a CD28 transmembrane region), a costimulatory domain (e.g., an intracellular signaling domain of 4-1BB, CD28, or both), and a signaling domain (e.g., a T cell signaling domain of CD3 ζ).
In some embodiments, the anti-CD 123 CARs provided herein have an amino acid sequence of SEQ ID No. 369, which can be encoded by a nucleotide sequence of, for example, SEQ ID No. 372. In some embodiments, the CAR provided herein has an amino acid sequence that is at least 85% identical to SEQ ID No. 369. In some embodiments, the CAR provided herein has an amino acid sequence that is at least 88% identical to SEQ ID No. 369. In some embodiments, the CAR provided herein has an amino acid sequence that is at least 90% identical to SEQ ID No. 369. In some embodiments, the CAR provided herein has an amino acid sequence that is at least 95% identical to SEQ ID No. 369. In some embodiments, the CAR provided herein has an amino acid sequence that is at least 97% identical to SEQ ID No. 369. In some embodiments, the CAR provided herein has an amino acid sequence that is at least 99% identical to SEQ ID No. 369.
Figure BDA0003670489470000571
5.4 Polynucleotide and vectors
The invention also provides polynucleotides encoding a polypeptide described herein (e.g., an anti-CD 123 antibody or antigen-binding fragment or a CAR that specifically binds CD 123). The term "polynucleotide encoding a polypeptide" encompasses: a polynucleotide comprising only the coding sequence for the polypeptide; and polynucleotides comprising additional coding and/or non-coding sequences. The polynucleotide of the present invention may be in the form of RNA or in the form of DNA. The DNA may be cDNA, genomic DNA or synthetic DNA, and may be double-stranded or single-stranded. Single-stranded DNA may be the coding strand or the non-coding (antisense) strand. The polynucleotides disclosed herein may be mRNA.
The present invention specifically contemplates polynucleotides encoding any of the anti-CD 123 antibodies or antigen-binding fragments disclosed herein. In some embodiments, the polynucleotides provided herein encode an anti-CD 123 antibody or antigen-binding fragment disclosed herein, comprising: (a) a light chain variable region (VL) comprising (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID NO: 23; (2) VL CDR2 having the amino acid sequence shown by SEQ ID NO. 50; and (3) a VL CDR3 having the amino acid sequence set forth in SEQ ID NO: 82; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs, and/or, (b) a heavy chain variable region (VH) comprising (1) a VH CDR1 having the amino acid sequence set forth in SEQ ID NO: 99; (2) VH CDR2 having the amino acid sequence shown by SEQ ID NO. 129; and (3) a VH CDR3 having the amino acid sequence set forth by SEQ ID NO: 157; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs. In some embodiments, the polynucleotides provided herein encode an anti-CD 123 antibody or antigen-binding fragment disclosed herein, said CD123 antibody or antigen-binding fragment comprising: (a) a light chain variable region (VL) having at least 85%, at least 90%, at least 95%, at least 98% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 168; and/or, (b) a heavy chain variable region (VH) having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 203. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.
In some embodiments, the polynucleotides provided herein encode an anti-CD 123 antibody or antigen-binding fragment disclosed herein comprising a VL and a VH, wherein the VL comprises VL CDR1, CDR2, and CDR3, and the VH comprises VH CDR1, CDR2, and CDR3, wherein VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 have SEQ ID NOs 23, 50, 82, 99, 129, and 157, respectively; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the CDRs. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.
In some embodiments, the polynucleotides provided herein encode an anti-CD 123 antibody or antigen-binding fragment disclosed herein comprising a VL and a VH, wherein the VL and VH have SEQ ID NOs:168 and 203, respectively. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.
In some embodiments, the polynucleotides provided herein encode an anti-CD 123 antibody or antigen-binding fragment disclosed herein that comprises a VL having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID No. 168. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence set forth in SEQ ID No. 238. The present invention also provides a polynucleotide that hybridizes to a polynucleotide having a nucleotide sequence set forth in SEQ ID NOs: 238. In some embodiments, the hybridization is performed under highly stringent conditions known to those skilled in the art. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.
In some embodiments, the polynucleotides provided herein encode an anti-CD 123 antibody or antigen-binding fragment disclosed herein, which anti-CD 123 antibody or antigen-binding fragment comprises a VH having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID No. 203. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence set forth in SEQ ID No. 273. The present invention also provides a polynucleotide that hybridizes with the polynucleotide having the nucleotide sequence shown by SEQ ID NO. 273. In some embodiments, the hybridization is performed under highly stringent conditions known to those skilled in the art. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.
In some embodiments, the VL and VH are connected by a linker. The linker may be a flexible linker or a rigid linker. In some embodiments, the linker has an amino acid sequence of (GGGGS) n, n ═ 1,2,3,4, or 5(SEQ ID NO: 410). In some embodiments, the linker has an amino acid sequence of (EAAAK) n, n ═ 1,2,3,4, or 5(SEQ ID NO: 411). In some embodiments, the linker has the amino acid sequence of (PA) nP, n ═ 1,2,3,4, or 5(SEQ ID NO: 412). In some embodiments, the linker has the amino acid sequence GGGGSGGGGSGGGS (SEQ ID NO: 320). In some embodiments, the linker has the amino acid sequence of GGGGS (SEQ ID NO: 413).
The invention also provides variants of the polynucleotides of the invention, wherein the variants encode, for example, fragments, analogs and/or derivatives of the anti-CD 123 antibodies or antigen-binding fragments of the invention. In some embodiments, the present invention provides a polynucleotide whose nucleotide sequence is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a polynucleotide sequence encoding an anti-CD 123 antibody or antigen-binding fragment of the present invention. In some embodiments, the present invention provides a polynucleotide whose nucleotide sequence is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a polynucleotide sequence encoding an anti-CD 123 antibody or antigen-binding fragment of the present invention.
In some embodiments, the polynucleotides provided herein encode an anti-CD 123 antibody or antigen-binding fragment, which is a human scFv designated C5. In some embodiments, the polynucleotides provided herein encode an anti-CD 123 antibody or antigen-binding fragment having the amino acid sequence set forth in SEQ ID NO: 379.
The invention also provides polynucleotides encoding the TCRs described herein. In some embodiments, the polynucleotides provided herein encode TCR α chains comprising an anti-CD 123 antibody or antigen-binding fragment of the invention. In some embodiments, the polynucleotides provided herein encode TCR β chains comprising an anti-CD 123 antibody or antigen-binding fragment of the invention. In some embodiments, the polynucleotides provided herein encode TCR γ chains comprising an anti-CD 123 antibody or antigen-binding fragment described herein. In some embodiments, the polynucleotides provided herein encode TCR delta chains comprising an anti-CD 123 antibody or antigen-binding fragment described herein. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.
The invention also provides a polynucleotide encoding a CAR of the invention. In some embodiments, the invention provides a polynucleotide encoding a CAR that specifically binds CD123, the CAR comprising: from N-terminus to C-terminus (a) a CD123 binding domain, said CD123 binding domain comprising an anti-CD 123 antibody or antigen-binding fragment provided herein; (b) a transmembrane domain; and (c) a cytoplasmic domain. The transmembrane domain and cytoplasmic domain can be any of the transmembrane and cytoplasmic domains disclosed herein. For illustrative purposes, the invention provides, e.g., a CAR that specifically binds CD123, the CAR comprising, from N-terminus to C-terminus: (a) a CD123 binding domain, said CD123 binding domain comprising an anti-CD 123 scFv provided herein; (b) a transmembrane domain comprising a CD28 transmembrane region; and (c) a cytoplasmic domain comprising a CD3 zeta signaling domain and a 4-1BB co-stimulatory domain. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.
As used herein, the phrase "a polynucleotide having a nucleotide sequence that is at least about 95% identical to a polynucleotide sequence" means that the nucleotide sequence of the polynucleotide is identical to the reference sequence, except that up to 5 point mutations may be included in every 100 nucleotides of the reference sequence. In other words, to obtain a polynucleotide whose sequence has at least 95% identity to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or replaced with other nucleotides, or up to 5% of the total number of nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence can occur at the 5 'or 3' terminal sites of the reference nucleotide sequence or anywhere between these terminal sites, interspersed individually between nucleotides in the reference sequence or in one or more contiguous groups in the reference sequence.
The polynucleotide variants may comprise alterations at the coding regions, the non-coding regions, or both. In some embodiments, a polynucleotide variant comprises an alteration that produces a silent substitution, addition, or deletion, but does not alter the property or activity of the encoded polypeptide. In some embodiments, a polynucleotide variant comprises silent substitutions (due to the degeneracy of the genetic code) that result in no alteration of the amino acid sequence of the polypeptide. Polynucleotide variants are produced for a variety of reasons, e.g., to optimize codon expression for a particular host (e.g., to change codons in human mRNA to codons preferred by bacteria, such as e. In some embodiments, a polynucleotide variant comprises at least one silent mutation in a non-coding region or a coding region of a sequence.
In some embodiments, polynucleotide variants are prepared to modulate or alter the expression (or level of expression) of the encoded polypeptide. In some embodiments, polynucleotide variants are prepared to increase expression of the encoded polypeptide. In some embodiments, polynucleotide variants are prepared to reduce expression of the encoded polypeptide. In some embodiments, the polynucleotide variant increases expression of the encoded polypeptide compared to the parent polynucleotide sequence. In some embodiments, the polynucleotide variant reduces the expression of the encoded polypeptide compared to the parent polynucleotide sequence.
In some embodiments, the polynucleotide has a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a polynucleotide encoding the amino acid sequence of SEQ ID No. 168. The present invention also provides a polynucleotide that hybridizes to a polynucleotide encoding the amino acid sequence of SEQ ID NO. 203. In some embodiments, the hybridization is performed under highly stringent conditions known to those skilled in the art.
In some embodiments, the polynucleotide comprises a coding sequence for a polypeptide (e.g., a CAR or an antibody) fused in the same reading frame to a polynucleotide that facilitates expression and secretion of the polypeptide from the host cell (e.g., a leader sequence that is a secretory sequence that controls the transport of the polypeptide). The polypeptide may have a leader sequence which is cleaved by the host cell to form a "mature" polypeptide form.
In some embodiments, a polynucleotide includes a coding sequence for a polypeptide (e.g., a CAR or an antibody) fused in the same reading frame to a tag or label sequence. For example, in some embodiments, the tag sequence is a hexa-histidine tag (HIS-tag), which allows for efficient purification of polypeptides fused to the tag. In some embodiments, when a mammalian host (e.g., COS-7 cells) is used, the marker sequence is a Hemagglutinin (HA) tag derived from an influenza hemagglutinin protein. In some embodiments, the marker sequence is FLAG TM And (4) a label. In some embodiments, the label may be used in combination with other labels or tags.
In some embodiments, the polynucleotide is isolated. In some embodiments, the polynucleotide is substantially purified.
The invention also provides vectors and cells comprising the polynucleotides of the invention. In some embodiments, vectors comprising a polynucleotide provided herein are provided. The vector may be an expression vector. In some embodiments, the invention provides vectors comprising polynucleotides encoding the anti-CD 123 antibodies or antigen-binding fragments of the invention. In some embodiments, the vectors provided herein comprise a polynucleotide encoding a polypeptide that is part of an anti-CD 123 antibody or antigen-binding fragment of the invention. In some embodiments, the invention provides a vector comprising a polynucleotide encoding a CAR or TCR of the invention. In some embodiments, the invention provides a vector comprising a polynucleotide encoding a polypeptide that is part of a CAR or TCR of the invention.
In some embodiments, the invention provides recombinant expression vectors that can be used to amplify and express a polynucleotide encoding a CAR/TCR of the invention that specifically binds CD123 or the anti-CD 123 antibody or antigen-binding fragment. For example, the recombinant expression vector can be a replicable DNA construct comprising a DNA fragment, synthetic or derived from a cDNA, encoding a polypeptide chain of a CAR/TCR or anti-CD 123 antibody, operably linked to suitable transcriptional and/or translational regulatory elements derived from a mammalian, microbial, viral, or insect gene. In some embodiments, a viral vector is used. DNA regions are "operably linked" when they are functionally related to each other. For example, a promoter is operably linked to a coding sequence if it controls the transcription of that sequence; or is operably linked to a coding sequence if the position of the ribosome binding site allows translation. In some embodiments, the structural elements intended for certain expression systems include a leader sequence that enables the host cell to secrete the translated protein extracellularly. In some embodiments, the polypeptide may include an N-terminal methionine residue in the absence of a leader or transporter sequence for expression of the recombinant protein.
Various combinations of expression hosts/vectors may be used. Expression vectors useful for eukaryotic hosts include, for example, vectors containing expression control sequences from SV40, bovine papilloma virus, adenovirus, and cytomegalovirus. Expression vectors useful for bacterial hosts include known bacterial plasmids, such as those from E.coli, including pCR1, pBR322, pMB9, and derivatives thereof, as well as a broader host range of plasmids such as M13 and other filamentous single stranded DNA phages.
In some embodiments, the CAR/TCR of the invention or the anti-CD 123 antibody or antigen-binding fragment is expressed in one or more vectors. Suitable host cells for expression include prokaryotes, yeast cells, insect cells or higher eukaryotic cells under the control of an appropriate promoter. Suitable cloning and expression vectors for bacterial, fungal, yeast and mammalian cell hosts, as well as methods of protein production, including antibody production, are well known in the art.
Examples of suitable mammalian host cell lines include, but are not limited to, COS-7 (derived from monkey kidney), L-929 (derived from murine fibroblasts), C127 (derived from murine breast tumor), 3T3 (derived from murine fibroblasts), CHO (derived from Chinese hamster ovary), HeLa (derived from human cervical cancer), BHK (derived from hamster kidney fibroblasts), HEK-293 (derived from human embryonic kidney) cell lines, and variants thereof. Mammalian expression vectors can include non-transcriptional elements (e.g., origins of replication), suitable promoters and enhancers for linkage to the gene to be expressed, and other 5 'or 3' flanking non-transcribed and 5 'or 3' untranslated sequences (e.g., necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and transcriptional termination sequences). Expression of recombinant proteins in insect cell culture systems (e.g., baculovirus) also provides a powerful method for producing correctly folded and biologically functional proteins. Baculovirus systems for the production of heterologous proteins in insect cells are well known to those skilled in the art.
The invention also provides a host cell comprising a polypeptide of the invention, a polynucleotide encoding a polypeptide of the invention, or a vector comprising such a polynucleotide. In some embodiments, the invention provides a host cell comprising a vector comprising a polynucleotide of the invention. In some embodiments, the present invention provides a host cell comprising a vector comprising a polynucleotide encoding an anti-CD 123 antibody or antigen-binding fragment of the present invention. In some embodiments, the present invention provides a host cell comprising a vector comprising a polynucleotide encoding a polypeptide that is part of an anti-CD 123 antibody or antigen-binding fragment of the present invention. In some embodiments, the invention provides a host cell comprising a polynucleotide encoding an anti-CD 123 antibody or antigen-binding fragment of the invention. In some embodiments, the cell produces an anti-CD 123 antibody or antigen-binding fragment of the invention. In some embodiments, the invention provides a host cell comprising a vector comprising a polynucleotide encoding a CAR or TCR of the invention. In some embodiments, the invention provides a host cell comprising a vector comprising a polynucleotide molecule encoding a polypeptide that is part of a CAR or TCR of the invention. In some embodiments, the invention provides a host cell comprising a polynucleotide encoding a CAR or TCR of the invention. In some embodiments, the host cell produces the CD123CARs or TCRs of the invention.
5.5 cells
The invention also provides cells comprising a polynucleotide of the invention. In some embodiments, the invention provides a cell comprising a polynucleotide encoding a polypeptide of the invention. In some embodiments, the invention provides a cell comprising a vector comprising a polynucleotide of the invention. In some embodiments, the invention provides a cell capable of recombinantly expressing a polypeptide of the invention. The polypeptide may be an anti-CD 123 antibody or antigen-binding fragment. The polypeptide may be a CD123 CAR. The polypeptide may be a CD123 TCR.
In some embodiments, the cells provided herein are immune effector cells. In some embodiments, the immune effector cell is selected from the group consisting of a T cell, a B cell, a Natural Killer (NK) cell, an NKT cell, a macrophage, a granulocyte, a neutrophil, an eosinophil, a mast cell, and a basophil. In some embodiments, the immune effector cells provided by the present invention are selected from the group consisting of T cells, NK cells, NKT cells, macrophages, neutrophils, and granulocytes. In some embodiments, the immune effector cells provided herein are T cells. In some embodiments, the immune effector cells provided herein are NK cells. In some embodiments, the immune effector cells provided herein are NKT cells. In some embodiments, the immune effector cell provided herein is a macrophage. In some embodiments, the immune effector cells provided herein are neutrophils. In some embodiments, the immune effector cells provided herein are granulocytes.
In some embodiments, the immune effector cells provided by the present invention may be genetically engineered. In some embodiments, the genetically engineered immune effector cells provided herein are isolated. In some embodiments, the genetically engineered immune effector cells provided herein are substantially purified.
Thus, in some embodiments, the invention provides immune effector cells that recombinantly express a polypeptide (e.g., an antibody or CAR) described herein. The invention also provides an immune effector cell (e.g., a T cell) comprising a polynucleotide encoding a polypeptide (e.g., an antibody or CAR) disclosed herein or a vector comprising a polynucleotide disclosed herein. In some embodiments, the invention provides an immune effector cell (e.g., a T cell) comprising a polynucleotide encoding an anti-CD 123 antibody or antigen-binding fragment described herein. In some embodiments, the invention provides immune effector cells (e.g., T cells) recombinantly expressing an anti-CD 123 antibody or antigen-binding fragment described herein. In some embodiments, the invention provides an immune effector cell comprising a polynucleotide encoding a CD123 CAR described herein. In some embodiments, the invention provides immune effector cells (e.g., T cells; e.g., CD123 CART cells) capable of recombinantly expressing a CD123 CAR disclosed herein.
In some embodiments, the immune effector cells provided herein are T cells. The T cell may be a cytotoxic T cell, a helper T cell, or a γ δ T, CD4+/CD8+ double positive T cell, CD4+ T cell, CD8+ T cell, CD4/CD8 double negative T cell, CD3+ T cell, naive T cell, effector T cell, cytotoxic T cell, helper T cell, memory T cell, regulatory T cell, Th0 cell, Th1 cell, Th2 cell, Th3(Treg) cell, Th9 cell, Th17 cell, Th α β helper cell, Tfh cell, stem cell-like central memory TSCM cell, central memory cell, TCM cell, effector memory TEM cell, effector memory TEMRA cell, or γ δ T cell. In some embodiments, the T cell is a cytotoxic T cell. In some embodiments, the T cell is a genetically engineered cell. In some embodiments, the T cells provided herein are isolated. In some embodiments, the T cells provided herein are substantially purified.
In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from a subject. As used herein, a genetically engineered cell derived from a source cell refers to a genetically engineered cell obtained by obtaining a source cell and genetically manipulating the source cell. The source cell may be from a natural source. For example, the source cell can be a primary cell isolated from a subject. The subject may be an animal or a human. The source cell may also be a cell that has been passaged or genetically manipulated in vitro.
In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from a human. Immune effector cells (e.g., T cells) can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, T cell lines available in the art may be used. In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from peripheral blood. In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from bone marrow. In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from Peripheral Blood Mononuclear Cells (PBMCs).
In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from stem cells or progenitor cells. In some embodiments, the stem or progenitor cells are selected from the group consisting of T cell progenitors, hematopoietic stem/progenitors, hematopoietic multipotent progenitors, embryonic stem cells, and induced pluripotent cells. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from T cell progenitors. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from hematopoietic stem/progenitor cells. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from hematopoietic pluripotent progenitor cells. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from embryonic stem cells. In some embodiments, the genetically engineered cells provided herein are derived from cells that induce the differentiation of pluripotent cells in vitro.
In some embodiments, the invention provides a population of cells comprising a cell disclosed herein. The cells of the invention may comprise a polynucleotide encoding a polypeptide of the invention, or recombinantly express a polypeptide of the invention. The polypeptide may be an anti-CD 123 antibody or antigen-binding fragment, or a CD123 CAR or TCR. The cell population may be a homogenous cell population. The cell population may be a heterogeneous cell population. In some embodiments, the cell population can be a heterogeneous cell population comprising any combination of the cells disclosed herein. In some embodiments, the cell populations provided herein are derived from Peripheral Blood Mononuclear Cells (PBMCs), Peripheral Blood Lymphocytes (PBLs), Tumor Infiltrating Lymphocytes (TILs), cytokine-induced killer Cells (CIKs), lymphokine-activated killer cells (LAKs), or bone Marrow Infiltrating Lymphocytes (MILs). In some embodiments, the cell populations provided herein are derived from PBMCs. In some embodiments, the cell populations provided herein are derived from PBLs. In some embodiments, the cell populations provided herein are derived from TIL. In some embodiments, the cell populations provided herein are derived from CIK. In some embodiments, the cell population provided herein is derived from LAK. In some embodiments, the cell populations provided herein are derived from MILs. A population of cells can be genetically engineered to recombinantly express a polypeptide (e.g., an antibody or CAR) of the invention. In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding a polypeptide (e.g., an antibody or CAR) disclosed herein or a vector bearing a polynucleotide disclosed herein. In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding an anti-CD 123 antibody or antigen-binding fragment disclosed herein. In some embodiments, the invention provides a population of cells recombinantly expressing an anti-CD 123 antibody or antigen-binding fragment disclosed herein. In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding a disclosed CD123 CAR/TCR. In some embodiments, the invention provides a population of cells (e.g., CD123 CART cells) that are capable of recombinantly expressing the disclosed CD123 CARs.
5.6 pharmaceutical compositions
The invention also provides pharmaceutical compositions comprising the anti-CD 123 antibodies or antigen-binding fragments disclosed herein. The invention also provides a pharmaceutical composition comprising the genetically engineered immune effector cell disclosed by the invention. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of an anti-CD 123 antibody or antigen-binding fragment thereof disclosed herein, and further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises a pharmaceutically effective amount of the genetically engineered cells disclosed herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is useful in immunotherapy. In some embodiments, the pharmaceutical composition is useful in immuno-oncology. In some embodiments, the pharmaceutical composition is useful in inhibiting tumor growth in a subject (e.g., a human patient). In some embodiments, the pharmaceutical composition is useful in treating cancer in a subject (e.g., a human patient).
In some embodiments, the pharmaceutical compositions provided herein comprise an anti-CD 123 antibody or antigen-binding fragment provided herein. The anti-CD 123 antibody or antigen-binding fragment can be present at various concentrations. In some embodiments, the pharmaceutical compositions provided herein comprise 1-1000mg/ml of a soluble anti-CD 123 antibody or antigen-binding fragment provided herein. In some embodiments, the pharmaceutical composition comprises a soluble anti-CD 123 antibody or antigen-binding fragment provided herein in an amount of 10-500mg/ml, 10-400mg/ml, 10-300mg/ml, 10-200mg/ml, 10-100mg/ml, 20-100mg/ml, or 50-100 mg/ml. In some embodiments, the pharmaceutical compositions provided herein comprise an anti-CD 123 antibody or antigen-binding fragment provided herein in an amount of about 10mg/ml, about 20mg/ml, about 30mg/ml, about 40mg/ml, about 50mg/ml, about 60mg/ml, about 70mg/ml, about 80mg/ml, about 90mg/ml, about 100mg/ml, about 120mg/ml, about 150mg/ml, about 180mg/ml, about 200mg/ml, about 300mg/ml, about 500mg/ml, about 800mg/ml, or about 1000 mg/ml.
The pharmaceutical composition comprising genetically engineered cells (e.g., T cells) can comprise a purified population of cells. As described herein, the percentage of cells in a cell population can be determined by one skilled in the art using a variety of well-known methods. The purity of a population of cells comprising genetically engineered cells provided herein can range from about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 55% to about 60%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%; from about 85% to about 90%, from about 90% to about 95%, or, from about 95% to about 100%. In some embodiments, the purity of a population of cells comprising genetically engineered cells provided herein can range from about 20% to about 30%, about 20% to about 50%, about 20% to about 80%, about 20% to about 100%, about 50% to about 80%, or, about 50% to about 100%. The person skilled in the art can adjust the dosage; for example, a decrease in purity may require an increase in dosage.
The invention also provides a kit for preparing a pharmaceutical composition comprising an anti-CD 123 antibody or antigen-binding fragment disclosed herein. In some embodiments, the kit comprises an anti-CD 123 antibody or antigen-binding fragment disclosed herein, in one or more containers, and a pharmaceutically acceptable carrier. In another embodiment, the kit may include an anti-CD 123 antibody or antigen-binding fragment disclosed herein for administration to a subject. In particular embodiments, the kit includes instructions for the preparation and/or administration of an anti-CD 123 antibody or antigen-binding fragment.
The invention also provides kits for preparing the cells disclosed herein. In some embodiments, the kit includes one or more vectors for generating genetically engineered cells (e.g., T cells) expressing the anti-CD 123 antibodies or antigen binding fragments disclosed herein. The kit can be used to generate genetically engineered cells from autologous or non-autologous cells for administration to a compatible subject. In another embodiment, the kit can include a cell disclosed herein for administration to a subject. In particular embodiments, the kit comprises the disclosed cells in one or more containers. In particular embodiments, the kit includes instructions for the preparation and/or administration of the genetically engineered cells.
In some embodiments, the invention provides a pharmaceutical composition comprising an anti-CD 123 antibody or antigen-binding fragment or cell provided herein, wherein the pharmaceutical composition is suitable for topical administration. In some embodiments, local administration includes intratumoral injection, peritumoral injection, paratumoral injection, intralesional injection, and/or injection into tumor draining lymph nodes, or essentially any tumor targeting injection in which an anti-neoplastic agent is expected to leak into primary lymph nodes adjacent to a targeted solid tumor.
Pharmaceutically acceptable carriers that may be used in the compositions provided herein include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. In some embodiments, the vector is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal, or epidermal administration (e.g., by injection or infusion). Depending on the route of administration, the active ingredient (i.e., the anti-CD 123 antibody or antigen-binding fragment or immune effector cell provided herein) may be coated in a material to protect the active ingredient from acids and other natural conditions that may inactivate the active ingredient.
The invention also provides pharmaceutical compositions or formulations that improve the stability of an anti-CD 123 antibody or antigen-binding fragment to allow long-term storage thereof. In some embodiments, the pharmaceutical compositions or formulations disclosed herein comprise: (a) an anti-CD 123 antibody or antigen-binding fragment disclosed herein; (b) a buffering agent; (c) a stabilizer; (d) salt; (e) a filler; and/or (f) a surfactant. In some embodiments, the pharmaceutical composition or formulation is stable for at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 1 year, at least 2 years, at least 3 years, at least 5 years, or longer. In some embodiments, the pharmaceutical composition or formulation is stable when stored at 4 ℃, 25 ℃, or 40 ℃.
The pharmaceutical compositions disclosed herein may further include one or more of a buffering system, a preservative, a tonicity agent, a chelating agent, a stabilizer, and/or a surfactant, and various combinations thereof. The use of preservatives, isotonicity agents, chelating agents, stabilizers and surfactants in pharmaceutical compositions is well known to those skilled in the art. Reference may be made to REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY,19th edition, 1995. The pharmaceutical compositions disclosed herein may also include a pharmaceutically acceptable antioxidant. These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.
In some embodiments, the pharmaceutical composition is an aqueous formulation. Such formulations are typically solutions or suspensions, but may also include colloids, dispersions, emulsions, and multiphase materials. The term "aqueous formulation" is defined as a formulation containing at least 50% w/w water. Likewise, the term "aqueous solution" is defined as a solution comprising at least 50% w/w water and the term "aqueous suspension" is defined as a suspension comprising at least 50% w/w water.
In some embodiments, the pharmaceutical compositions disclosed herein are lyophilized to which a solvent and/or diluent is added by the physician or patient prior to use.
Examples of suitable aqueous and nonaqueous carriers that can be used in the pharmaceutical compositions or formulations of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Proper fluidity can be maintained, for example, by the use of a coating material, such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Such media and agents for pharmaceutically active substances are known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the pharmaceutical compositions of the invention is contemplated. The pharmaceutical composition or formulation may or may not include a preservative. Supplementary active compounds may be incorporated into the composition.
Pharmaceutical compositions or formulations generally must be sterile and stable under the conditions of manufacture and storage. The composition may be formulated as a solution, microemulsion, liposome, or other ordered structure suitable for high drug concentrations. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, the composition can include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or the composition, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by the addition to the compositions of agents delaying absorption, for example, monostearate salts and gelatin.
If desired, sterile injectable solutions can be prepared by incorporating one or more of the ingredients into the active compound in the required amount in the appropriate solvent, followed by sterile microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients enumerated herein. In the case of sterile powders for the preparation of sterile injectable solutions, some methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
The amount of active ingredient that may be combined with the carrier material in the pharmaceutical compositions or formulations disclosed herein may vary. In some embodiments, the amount of active ingredient that can be combined with the carrier material is that amount which produces a therapeutic effect. Typically, in the 100% range, the active ingredient is present in a range of about 0.01% to about 99%, the active ingredient is present in combination with a pharmaceutically acceptable carrier in a range of about 0.1% to about 70%, or about 1% to about 30%.
The pharmaceutical compositions disclosed herein can be prepared with carriers that protect the active ingredient from rapid release, such as controlled release formulations, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid may be used. Many methods for preparing such formulations have been patented or are generally known to those skilled in the art. See, for example, SUSTAINED AND CONTROLLED RELEASE DRUG DELIVERY SYSTEMS, J.R.Robinson, ed., Marcel Dekker, Inc., New York, 1978.
In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments or cells described herein can be formulated to ensure proper distribution in vivo. For example, the Blood Brain Barrier (BBB) excludes many highly hydrophilic compounds. To ensure that the activating components of the invention cross the BBB (if desired, e.g., for brain cancer), they can be formulated, for example, in liposomes. For methods of making liposomes, see, U.S. patents 4,522,811; 5,374,548, respectively; and5,399,331. Liposomes can include one or more groups that selectively transport to a particular cell or organ, thereby enhancing targeted drug delivery (see, e.g., v.v. ranade (1989) j.clin.pharmacol.29: 685). Examples of targeting groups include folate or biotin (see, e.g., U.S. Pat. No. 5,416,016to Low et al), mannosides (Umezawa et al, (1988) biochem. biophysis. Res. Commun.153:1038), antibodies (P.G. Blaeman et al, (1995) FEBS Lett.357: 140; M.Owais et al, (1995) antibodies. Agents Chemother.39:180), surfactant protein A receptors (Briscoe et al, (1995) am.J.physiol.1233:134), pl20(Schreier et al, (1994) J.biol.Chem.269 909090), also see K.Keinanen; M.L. Laukkanen (1994) FEBS Lett.346: 123; j.j.killion; fidler (1994) Immunomethods 4: 273.
5.7 methods and uses
The invention also provides methods of using anti-CD 123 antibodies or antigen-binding fragments, CD123 CARs, polynucleotides encoding such anti-CD 123 antibodies or antigen-binding fragments and CD123 CARs, vectors comprising such polynucleotides, cells expressing a CD123CAR, or pharmaceutical compositions having such cells disclosed herein, in the treatment of cancer. Without being bound by theory, the anti-CD 123 antibodies or antigen-binding fragments and CD123 CAR-expressing cells disclosed herein can specifically target CD 123-expressing cancer cells in vivo, thereby achieving a therapeutic effect in which they eliminate, lyse, and/or kill cancer cells. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of an anti-CD 123 antibody or antigen-binding fragment of the invention. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a CD123 CAR-expressing immune effector cell of the invention. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a CD123CART of the present invention.
In some embodiments, the present invention provides a method of treating a tumor or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-CD 123 antibody or antigen-binding fragment disclosed herein. In some embodiments, the invention provides the use of an anti-CD 123 antibody or antigen-binding fragment disclosed herein in the treatment of a tumor or cancer. In some embodiments, the invention provides the use of an anti-CD 123 antibody or antigen-binding fragment disclosed herein in the preparation of a medicament for the treatment of a tumor or cancer.
In some embodiments, the invention provides methods of treating a tumor or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an immune effector cell disclosed herein (e.g., CD123 cart). In some embodiments, the invention provides the use of immune effector cells (e.g., CD123 cart) disclosed herein in the treatment of tumors or cancers. In some embodiments, the invention provides for the use of immune effector cells (e.g., CD123 cart) disclosed herein in the preparation of a medicament for treating a tumor or cancer. In some embodiments, the cell populations comprising immune effector cells disclosed herein are used in therapy. The cell population may be homologous. The cell population may be heterologous.
In some embodiments, the present invention provides a method of treating a tumor or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition disclosed herein. In some embodiments, the invention provides the use of the disclosed pharmaceutical compositions in the treatment of a tumor or cancer. In some embodiments, the present invention provides the use of a pharmaceutical composition disclosed herein for the preparation of a medicament for the treatment of a tumor or cancer.
The actual dosage level of the active ingredient in the pharmaceutical compositions of the invention (i.e., the anti-CD 123 antibodies or antigen-binding fragments, or immune effector cells, provided herein) can be varied to obtain amounts, compositions, and modes of administration of the active ingredient effective to achieve the desired therapeutic response for a particular patient without toxicity to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular composition of the invention, the route of administration, the time of administration, the rate of excretion, the duration of the treatment, other drugs, compounds and/or materials used in conjunction with the particular composition being used, the age, sex, body weight, condition, general health and past medical history of the patient being treated, and like factors well known in the medical arts.
The anti-CD 123 antibody or antigen-binding fragment may be administered as a sustained release formulation, in which case frequent administration is not required. The dose and frequency will vary depending on the half-life of the anti-CD 123 antibody or antigen-binding fragment in the patient. In therapeutic applications, it is sometimes desirable to administer relatively high doses over a relatively short time interval until progression of the disease is reduced or terminated, and until the patient exhibits partial or complete amelioration of the symptoms of the disease.
In some casesIn embodiments, immune effector cells recombinantly expressing the CD123 CARs disclosed herein are useful in the therapeutic methods disclosed herein. When cell therapy is employed, the cells provided by the invention can be administered at a dose per kilogram of cells (cells/kg) based on the body weight of the subject to which the cells are administered. Cell dose is about 10 4 To 10 10 cell/kg body weight, e.g., about 10 5 To about 10 9 About 10 5 To about 10 8 About 10 5 To about 10 7 Or about 10 5 To about 10 6 cells/kg body weight, depending on the mode and location of administration. Generally, in the case of systemic administration, higher doses are used than for regional administration (administration of the immune effector cells in the tumor region). As noted above, the precise determination of what is an effective dose can be based on individual factors for each subject, including their size, age, sex, weight, and the condition of the particular subject. Dosages can be readily determined by those skilled in the art based on the present disclosure and the present knowledge in the art.
The anti-CD 123 antibodies or antigen-binding fragments, immune effector cells, and pharmaceutical compositions provided herein can be administered to a subject by any method known in the art, including, but not limited to, thoracic administration, intravenous administration, subcutaneous administration, intra-nodal administration (intratumoral administration), intratumoral administration, intramuscular administration, intradermal administration, intrathecal administration, intrapleural administration, intraperitoneal administration, intracranial administration, spinal cord, or other parenteral routes of administration, e.g., by injection or infusion, or direct administration via the thymus. The phrase "parenteral administration" as used herein refers to modes of administration other than enteral and topical administration, typically by injection, including but not limited to intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intraperitoneal injection and infusion. In some embodiments, subcutaneous administration is employed. In some embodiments, intravenous administration is employed. In some embodiments, oral administration is employed. In one embodiment, the cells provided herein can be delivered locally to a tumor using well known methods, including but not limited to hepatic or aortic pumps; limb, lung or liver perfusion; in the portal vein; by venous shunting; in the lumen or vein near the tumor, etc. In another embodiment, the cells provided herein can be administered systemically. In a preferred embodiment, the cells are administered locally at the tumor site. The cells may also be administered intratumorally, e.g., by direct injection of the cells at the tumor site and/or into the tumor vasculature. For example, in the case of malignant pleural disease, mesothelioma or lung cancer, intrapleural administration is preferred (see, Adusumili et al, Science relative Medicine 6(261):261ra151 (2014)). One skilled in the art can select an appropriate mode of administration based on the type and/or location of the tumor to be treated. The cells may be introduced by injection or catheter. In one embodiment, the subject in need thereof is administered intrapleurally, e.g., using an intrapleural catheter. Optionally, administration of the subject expansion/differentiation agent before, during, or after administration of the cells can be selected to increase in vivo cell production provided by the invention.
The proliferation of cells provided by the present invention is generally performed in vitro prior to administration to a subject, and may also be desirable in vivo following administration to a subject (see Kaiser et al, Cancer Gene Therapy 22:72-78 (2015)). Cell proliferation should be accompanied by cell survival to allow for expansion and persistence of cells (e.g., T cells).
In some embodiments, the cancer or tumor that can be treated with the anti-CD 123 antibodies or antigen-binding fragments, cells, or pharmaceutical compositions disclosed herein is a hematologic cancer. The hematologic cancer may be a CD123 expressing hematologic cancer. In some embodiments, the hematologic cancer can be leukemia, lymphoma, Multiple Myeloma (MM), or myelodysplastic syndrome (MDS). In some embodiments, the hematologic cancer can be acute leukemia, Acute Myeloid Leukemia (AML), B acute lymphoid leukemia (B-ALL), T acute lymphoid leukemia (T-ALL), B cell precursor acute lymphocytic leukemia (BCP-ALL), blastic plasmacytoid dendritic cell tumor (BPDCN), acute lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, Chronic Myelogenous Leukemia (CML), chronic myelogenous leukemia, chronic lymphocytic leukemia, chronic myelomonocytic leukemia (CMML), natural killer cell leukemia (NK leukemia), hodgkin's disease, non-hodgkin's disease, fahrenheit macroglobulinemia, lymphocytic lymphoma, Primary CNS lymphoma, T cell lymphoma, natural killer cell lymphoma (NK lymphoma), Cutaneous T Cell Lymphoma (CTCL), or Peripheral T Cell Lymphoma (PTCL). In some embodiments, the cancer or tumor that can be treated with the anti-CD 123 antibodies or antigen-binding fragments, cells, or pharmaceutical compositions disclosed herein is leukemia. In some embodiments, the leukemia is AML. In some embodiments, the leukemia is B-ALL. In some embodiments, the leukemia is T-ALL. In some embodiments, the leukemia is BCP-ALL. In some embodiments, the leukemia is BPDCN.
In some embodiments, the present invention provides methods of treating a leukemia expressing CD123 in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-CD 123 antibody or antigen-binding fragment disclosed herein, CD123 cart, or a pharmaceutical composition.
In some embodiments, the cancer or tumor that can be treated with the anti-CD 123 antibodies or antigen-binding fragments, cells, or pharmaceutical compositions disclosed herein is a solid tumor. In some embodiments, the cancer or tumor can be a carcinoma, sarcoma, melanoma (e.g., cutaneous or intraocular malignant melanoma), glioma (glioma), glioblastoma, brain and spinal cord tumors, germ cell tumors, neuroendocrine tumors, carcinoid tumors, gastric cancer (gastric cancer), esophageal cancer, liver cancer (liver cancer), lung cancer (e.g., small cell lung cancer or non-small cell lung cancer), head and neck cancer, skin cancer, nasopharyngeal cancer, kidney cancer (kidney cancer), colorectal cancer, breast cancer, pancreatic cancer, testicular cancer, cervical cancer, ovarian cancer, uterine cancer, prostate cancer (e.g., hormone refractory prostate cancer), bladder cancer, colon cancer, endocrine cancer, basal cell cancer, squamous cell cancer, dermatofibrosarcoma protruberans, mesothelioma, merkel cell cancer, bone cancer, intestinal cancer, renal cancer (e.g., clear cell cancer) (renal cer), Laryngeal, rectal, anal, brain, stomach (stomach cancer), fallopian tube, endometrial, cervical, vaginal, vulvar, small intestine, thyroid, parathyroid, adrenal, soft tissue sarcoma, urinary tract, penile, solid tumors of childhood, ureter, renal pelvis, Central Nervous System (CNS) tumors, spinal axonal tumors, brain stem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermoid carcinoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovium, Ewing's sarcoma, leiomyosarcoma, rhabdomyosarcoma, squamous cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchopulmonary carcinoma, papillary carcinoma, carcinoma of the like, Liver cancer (hepatoma), bile duct cancer, choriocarcinoma, seminoma, embryonal carcinoma, wilms' tumor, epithelial cancer, glioma (glioma), astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, meningioma, neuroblastoma or retinoblastoma.
In cancer treatment, the cancer or tumor cells of a subject can be eliminated, but any clinical improvement would be beneficial. The anti-tumor effect can be manifested by a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with the cancer condition. The anti-tumor effect can also be manifested by the ability of the cells or pharmaceutical compositions provided by the invention to prevent tumorigenesis at the first time. In some embodiments, an "anti-tumor effect" may be manifested by a reduction in cancer-induced immunosuppression. Clinical improvement includes a reduction in the risk or rate of progression or a reduction in the pathological consequences of the cancer or tumor. It is also understood that the method of treating cancer may include any effect that ameliorates a sign or symptom associated with the cancer. Such signs or symptoms include, but are not limited to, reduction in tumor burden, including inhibition of tumor growth, reduction in tumor growth rate, reduction in tumor size, reduction in tumor number, elimination of tumors, all of which can be measured using conventional tumor imaging techniques well known in the art. Other signs or symptoms associated with cancer include, but are not limited to, fatigue, pain, weight loss, and other signs or symptoms associated with various cancers.
In some embodiments, the methods or uses provided herein can reduce tumor burden. Thus, administration of the anti-CD 123 antibodies or antigen-binding fragments, cells, or pharmaceutical compositions disclosed herein can reduce the number of tumor cells, reduce the size of the tumor, and/or eradicate the tumor in the subject. Methods for monitoring a patient's response to administration of the disclosed pharmaceutical compositions are known in the art and can be used in accordance with the disclosed methods.
In the presently disclosed methods, a therapeutically effective amount of an anti-CD 123 antibody or antigen-binding fragment, cell, or pharmaceutical composition disclosed herein is administered to a subject in need of cancer treatment. The subject may be a mammal. In some embodiments, the subject is a human. In some embodiments, the individuals do not have clinically measurable tumors. However, they are suspected of being at risk for disease progression, either near the original tumor site or through metastasis. This population can be further subdivided into high risk and low risk individuals. The subdivision is based on features observed before or after the initial processing. These features are known in the clinic and are defined appropriately for different types of cancer. The high risk subgroup is typically characterized by tumor invasion of adjacent tissues, or evidence of lymph node involvement.
The anti-CD 123 antibodies or antigen-binding fragments, cells, or pharmaceutical compositions provided herein can be administered in conjunction with medical devices known in the art. For example, in some embodiments, needleless hypodermic injection devices such as those described in U.S. patent nos.5,399,163; 5,383,851, respectively; 5,312,335, respectively; 5,064,413, respectively; 4,941,880; 4,790,824; or4,596,556. Examples of well known implants and modules for use in accordance with the present invention include: U.S. patent No.4,487,603, which discloses an implantable micro infusion pump for dispensing medication at a controlled rate; U.S. patent No.4,486,194, which discloses a therapeutic device for transdermal drug delivery; U.S. patent No.4,447,233, which discloses a medication infusion pump for delivering medication at an accurate infusion rate; U.S. patent No.4,447,224, which discloses a variable flow implantable infusion device for continuous administration; U.S. patent No.4,439,196, which discloses an osmotic drug delivery system having multiple chambers; and U.S. patent No.4,475,196, which discloses an osmotic drug delivery system. These patents are incorporated by reference into the present invention. Many other such implants, delivery systems and modules are known to those skilled in the art.
Combination therapy with agents of different mechanisms of action may produce additive or synergistic effects. Combination therapy may allow for lower doses of each agent than are used in monotherapy, thereby reducing toxic side effects and/or increasing the therapeutic index of the agents disclosed herein. Combination therapy can reduce the likelihood of drug-resistant cancer cell development. In some embodiments, the additional treatment results in an increase in the therapeutic index of the cells or pharmaceutical compositions described herein. In some embodiments, the additional treatment results in a reduction in toxicity and/or side effects of the cells or pharmaceutical compositions described herein. In some embodiments, the anti-CD 123 antibodies or antigen-binding fragments, cells, or pharmaceutical compositions described herein may be administered in combination with additional therapies. In some embodiments, the additional treatment may be surgical resection, radiation therapy, or chemotherapy.
The additional therapy may be administered prior to, concurrently with, or subsequent to the administration of the anti-CD 123 antibody or antigen-binding fragment, cell, or pharmaceutical composition of the invention. The combined administration may include co-administration, either as a single pharmaceutical formulation, or as separate formulations, or sequentially in either order, but generally over a period of time such that all of the active agents exert their biological activities simultaneously. One skilled in the art can readily determine the appropriate regimen for administration of the pharmaceutical compositions of the present invention and combination adjunctive therapy, including the timing and dosage of the additional agents used in the combination therapy, based on the needs of the subject being treated.
5.8 preparation method
5.8.1 polynucleotides, polypeptides and antibodies
Polynucleotides provided by the present invention can be prepared, manipulated and/or expressed using any of a variety of well-established techniques known and available in the art. Many vectors can be used. Examples of vectors are plasmids, autonomously replicating sequences and transposable elements. Typical transposon systems, such as Sleeping Beauty (Sleeping Beauty) and PiggyBac, which can be stably integrated into the genome can be used (e.g., Ivics et al, Cell,91(4): 501-510 (1997);
Figure BDA0003670489470000751
et al, (2007) Nucleic Acids Research,35(12): e 87). Other exemplary vectors include, but are not limited to, plasmids, phages, cosmids, artificial chromosomes (such as Yeast Artificial Chromosomes (YACs), Bacterial Artificial Chromosomes (BACs), or P1-derived artificial chromosomes (PACs)), phages (such as lambda phage or M13 phage), and animal viruses. Examples of animal virus species that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papilloma viruses, and papovaviruses (e.g., SV 40). Examples of expression vectors are the pClneo vector (Promega) for expression in mammalian cells; plenti4/V5-Dest for lentivirus-mediated gene transduction and expression in mammalian cells TM 、Plenti6/V5-Dest TM And Plenti6.2/V5-GW/Lacz (Invitrogen).
In some embodiments, the vector is an episomal vector or an extrachromosomal vector. As used herein, the term "episomal" refers to a vector that is capable of replication without integration into the chromosomal DNA of the host and without gradual loss from dividing host cells, and also means that the vector replicates extrachromosomally or in episomal form. The vector is engineered to contain a sequence encoding a DNA origin of replication or "ori" from a lymphotrophic or gamma herpes virus, adenovirus, SV40, bovine papilloma virus or yeast, particularly an origin of replication of a lymphotrophic or gamma herpes virus corresponding to oriP of EBV. In some embodiments, the lymphotrophic herpes virus can be Epstein Barr Virus (EBV), Kaposi's Sarcoma Herpes Virus (KSHV), Herpesvirus Saimiri (HS), or Marek's Disease Virus (MDV). Epstein Barr Virus (EBV) and Kaposi's Sarcoma Herpes Virus (KSHV) are also examples of gamma herpes viruses. Typically, the host cell includes a viral replication transactivator that activates replication.
"expression control sequences", "control elements" or "regulatory sequences" present in an expression vector refer to the untranslated regions of the vector (such as origins of replication, selection agents, promoters, enhancers, translational initiation signal (Shine Dalgarno sequence or Kozak sequence) introns, polyadenylation sequences, 5 'and 3' untranslated regions) that interact with host cell proteins for transcription and translation. The strength and specificity of these elements vary. Any number of suitable transcription and translation elements may be used, including ubiquitous promoters and inducible promoters, depending on the vector system and host used.
Illustrative universal expression control sequences useful in the present invention include, but are not limited to, Cytomegalovirus (CMV) immediate early promoter, viral monkey virus (SV40) promoter (e.g., early or late), moloney murine leukemia virus (MoMLV) LTR promoter, Rous Sarcoma Virus (RSV) LTR, Herpes Simplex Virus (HSV) (thymidine kinase) promoter, H5, P7.5 and P11 promoters from vaccinia virus, elongation factor 1-alpha (EF1a) promoter, early growth response factor 1(EGR1), ferritin H (FerH), ferritin L (FerL), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), eukaryotic translation initiation factor 4A1(EIF4A1), heat shock 70kDa protein 5(HSPA5), heat shock protein 90 beta-member 1 (90 kDa 1), heat shock protein 70kDa (HSP70), beta-kinesin (beta-KIN), human ROSA 26 gene site (Irions et al, Nature Biotechnology 25, 14771482 (2007)), ubiquitin C promoter (UBC), phosphoglycerate kinase-1 (PGK) promoter, cytomegalovirus enhancer/chicken β -actin (CAG) promoter and β -actin promoter.
Illustrative examples of inducible promoters/systems include, but are not limited to, steroid-inducible promoters (e.g., promoters of genes encoding glucocorticoid or estrogen receptor (induced by treatment with the corresponding hormone)), metallothionein promoters (induced by treatment with various heavy metals), MX-1 promoters (induced by interferon), "Gene switch" mifepristone-regulatory system (Sirin et al, 2003, Gene,323:67), cumate-inducible Gene switch (WO2002/088346), tetracycline-dependent regulatory systems, and the like.
The anti-CD 123 antibodies or antigen-binding fragments of the invention can be prepared by any method known in the art, including chemical synthesis, recombinant expression, conventional monoclonal antibody methods, e.g., standard somatic hybridization techniques (see, e.g., Kohler and Milstein, Nature 256:495(1975)), viral or oncogenic transformation of B lymphocytes. The practice of the present invention employs, unless otherwise indicated, molecular biology, microbiology, genetic analysis, recombinant DNA, organic chemistry, biochemistry, PCR, oligonucleotide synthesis and modification, nucleic acid hybridization, and the like, which are conventional in the art. These techniques are described in the references cited herein and are fully explained in the literature. See, e.g., Maniatis et al (1982) Molecular CLONING, A LABORATORY MANUAL, Cold Spring Harbor LABORATORY Press; sambrook et al (1989), Molecular CLONING, A Laboratory Manual, Second Edition, Cold Spring Harbor LABORATORY Press; sambrook et al (2001) Molecular CLONING, A Laborary Manual, Cold Spring Harbor LABORATORY Press, Cold Spring Harbor, NY; ausubel et al, Current PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons (1987and annual updates); CURRENT PROTOCOLS IN IMMUNOLOGY, John Wiley & Sons (1987and annual updates) Gait (ed.) (1984) OLIGONUCLEOTIDE SYNTHESIS: A PRACTICAL APPROACH, IRL Press; eckstein (ed.) (1991) Oligonucletides AND ANALOGUES: A PRACTICAL APPROACH, IRL Press; birren et al, (eds.) (1999) GENOME ANALYSIS: A LABORATORY MANUAL, Cold Spring Harbor LABORATORY Press; borebaeck (ed.) (1995) ANTIBODY Engine, Second Edition, Oxford University Press; lo (ed.) (2006) ANTIBODY entering: METHODS AND PROTOCOLS (METHODS IN MOLECULAR BIOLOGY); vol.248, Humana Press, Inc; each of which is incorporated by reference herein in its entirety.
The polypeptides of the invention (e.g., the anti-CD 123 antibodies or antigen-binding fragments) can be produced and isolated using methods well known in the art. Peptides can be synthesized in whole or in part using chemical methods (see, e.g., Caruthers (1980), Nucleic Acids Res. Symp. Ser.215; horns (1980); and Banga, A.K., THERAPEUTIC PEPTIDES AND PROTECTION, FORMULATION, PROCESSING AND DELIVERY SYSTEMS (1995)
Technical Publishing co., Lancaster, PA). Peptide synthesis can be performed using various solid phase techniques (see, e.g., Roberge, Science 269:202 (1995); Merrifield, methods. enzymol.289:3(1997)) and automated synthesis can be achieved, e.g., using the ABI 431A peptide synthesizer (Perkin Elmer) according to the manufacturer's instructions. Peptides may also be synthesized using combinatorial approaches. Synthetic residues and polypeptides can be synthesized using various procedures and methods known in the art (see, e.g., ORGANIC SYNTHESES COLLECTIVE VOLUMES, Gilman, et al (Eds.) John Wiley & Sons, Inc., NY). Modified polypeptides can be produced by chemical modification methods (see, e.g., Belousov, Nucleic Acids Res.25:3440 (1997); Frenkel, Free Radic.biol.Med.19:373 (1995); and Blommers, Biochemistry 33:7886 (1994)). Peptide sequence variations, derivatives, substitutions and modifications may also be made using oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning and PCR-based mutagenesis, among others. Site-directed mutagenesis (Carter et al, Nucl. acids Res.,13:4331 (1986); Zoller et al, Nucl. acids Res.10:6487(1987)), cassette mutagenesis (Wells et al, Gene 34:315(1985)), restriction selection mutagenesis (Wells et al, Pholes. Trans. R. Soc. London SerA 317:415(1986)), and other techniques can be performed on cloned DNA to produce the peptide sequences, variants, fusions and chimeras of the invention, as well as variants, derivatives, substitutions and modifications thereof.
The polypeptides of the invention can be prepared using a variety of techniques known in the art, including the use of hybridoma and recombinant techniques, or a combination thereof. In some embodiments, the recombinant expression vector is used to express a polynucleotide encoding a polypeptide of the invention. For example, a recombinant expression vector can be a replicable DNA construct comprising a synthetic or cDNA-derived DNA segment encoding a polypeptide operably linked to suitable transcriptional and/or translational regulatory elements derived from a mammalian, microbial, viral, or insect gene. In some embodiments, the coding sequence for the disclosed polypeptides may be ligated into these expression vectors for expression in mammalian cells. In some embodiments, a viral vector is used. When the DNA regions are functionally related, they are operably linked. For example, a promoter is operably linked to a coding sequence if it controls the transcription of that sequence; or operably linked to a coding sequence if the ribosome binding site is positioned so as to permit translation. In some embodiments, a structural element intended for use in a yeast expression system comprises a leader sequence that enables the host cell to secrete a translated protein extracellularly. In some embodiments, the polypeptide may include an N-terminal methionine residue in the absence of a leader or transport sequence for expression of the recombinant protein.
Various combinations of expression hosts/vectors may be used. Suitable host cells for expression include prokaryotes, yeast cells, insect cells or higher eukaryotic cells under the control of an appropriate promoter. Suitable cloning and expression vectors for bacterial, fungal, yeast and mammalian cell hosts, as well as methods of protein production, including antibody production, are well known in the art. Expression vectors useful for bacterial hosts include known bacterial plasmids, such as plasmids from e.coli, including pCR1, pBR322, pMB9, and derivatives thereof, as well as a broader host range of plasmids such as M13 and other filamentous single stranded DNA phages.
Expression vectors useful for eukaryotic hosts include, for example, vectors containing expression control sequences from SV40, bovine papilloma virus, adenovirus, and cytomegalovirus. Examples of suitable mammalian host cell lines include, but are not limited to, COS-7 (derived from monkey kidney), L-929 (derived from murine fibroblasts), C127 (derived from murine breast tumor), 3T3 (derived from murine fibroblasts), CHO (derived from Chinese hamster ovary), HeLa (derived from human cervical cancer), BHK (derived from hamster kidney fibroblasts), HEK-293 (derived from human embryonic kidney) cell lines, and variants thereof. Mammalian expression vectors can include non-transcriptional elements (e.g., origins of replication), suitable promoters and enhancers for linkage to the gene to be expressed, and other 5 'or 3' flanking non-transcribed and 5 'or 3' untranslated sequences (e.g., necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and transcriptional termination sequences). Expression of recombinant proteins in insect cell culture systems (e.g., baculovirus) also provides a powerful method for producing correctly folded and biologically functional proteins. Baculovirus systems for the production of heterologous proteins in insect cells are well known to those skilled in the art.
The anti-CD 123 antibodies and antigen-binding fragments provided herein include, but are not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, and antigen-binding fragments thereof.
Methods for the preparation of antibodies are well known in the art. See, e.g., Harlow et al, ANTIBODIES: ALABORATORY MANUAL, (Cold Spring Harbor Laboratory Press,2nd ed.1988); hammerling et al, in: MONOCLONAL ANTIBODIES AND T-CELL HYBRIDOMAS 563681 (Elsevier, N.Y.,1981), each of which is incorporated herein by reference in its entirety. For antibodies used in vivo in humans, it may be preferable to use human antibodies. Fully human antibodies are particularly desirable for therapeutic treatment of human subjects. Human antibodies can be made by a variety of methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences, including improvements to these techniques. See also, U.S. Pat. nos.4,444,887and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO98/16654, WO 96/34096, WO96/33735, and WO 91/10741; each of which is incorporated by reference herein in its entirety. A human antibody can also be an antibody in which the heavy and light chains are encoded by nucleotide sequences derived from one or more human DNA sources.
Human antibodies can also be produced using transgenic mice that do not express functional endogenous immunoglobulins, but express human immunoglobulin genes. For example, human heavy and light chain immunoglobulin gene complexes can be introduced into mouse embryonic stem cells at random or by homologous recombination. In addition, human variable, constant and diversity regions can be introduced into mouse embryonic stem cells in addition to human heavy and light chain genes. The mouse heavy chain and light chain immunoglobulin genes can be introduced into the position of the human immunoglobulin genes by means of homologous recombination, so that the heavy chain and light chain immunoglobulin genes of the mouse are independently or simultaneously disabled. For example, it is described that homozygous deletion of the antibody heavy chain joining region (JH) gene in chimeras and germ line mutant mice results in complete inhibition of endogenous antibody production. The modified embryonic stem cells were expanded and microinjected into blastocysts to generate chimeric mice. Chimeric mice are then bred to produce homozygous progeny expressing human antibodies. Transgenic mice are immunized in a normal manner with a selected antigen (e.g., a polypeptide of the invention in whole or in part). For example, anti-CD 123 antibodies against human CD123 antigen can be obtained from immunized transgenic mice using conventional hybridoma techniques. The transgenic mice harbor human immunoglobulin transgenes that undergo rearrangement during B cell differentiation, followed by class switching and somatic mutation. Thus, using such techniques, therapeutically useful IgG, IgA, IgM, and IgE antibodies, including but not limited to IgG1(γ 1) and IgG3, can be produced. For a summary of techniques for producing human antibodies, see Lonberg and Huszar (int. Rev. Immunol.,13:65-93 (1995)). For a detailed discussion of techniques for producing human antibodies and human monoclonal antibodies, and protocols for producing such antibodies, see, e.g., PCT Publication nos. WO 98/24893, WO 96/34096, and WO 96/33735; and U.S. Pat. nos.5,413, 923; 5,625,126, respectively; 5,633,425, respectively; 5,569,825; 5,661,016, respectively; 5,545,806; 5,814, 318; and 5,939,598, each of which is incorporated by reference herein in its entirety. In addition, Abgenix, Inc (Freemont, Calif.) and Genpharm (Jose, Calif.) can provide human antibodies to selected antigens using methods similar to those described above. For a specific discussion of transduction of human germline immunoglobulin gene arrays in germline mutant mice, see, e.g., Jakobovits et al, proc.natl.acad.sci.usa,90:2551 (1993); jakobovits et al, Nature,362: 255-; bruggermann et al, Yeast in Immunol, 7:33 (1993); and Duchosal et al, Nature,355:258(1992), which would result in the production of human antibodies upon antigen challenge.
Human antibodies can also be obtained from phage display libraries (Hoogenboom et al, J.mol.biol.,227:381 (1991); Marks et al, J.mol.biol.,222:581-597 (1991); Vaughan et al, Nature Biotech.,14:309 (1996)). Phage display technology (McCafferty et al, Nature,348:552-553(1990)) can be used to produce human antibodies and antibody fragments in vitro from the immunoglobulin variable (V) region gene repertoire of an unimmunized donor. According to this technique, antibody V region genes are cloned into the framework of the major or minor coat protein genes of filamentous phage, such as M13 or fd, and displayed as functional antibody fragments on the surface of the phage particle. Since the filamentous particle contains copies of the single-stranded DNA of the phage genome, selection based on antibody functionality will also result in selection of genes encoding antibodies with these properties. Thus, the phage mimics certain properties of B cells. Phage display can be performed in a variety of formats; for a review of them, see, e.g., Johnson and Chiswell, Current Opinion in Structural Biology 3:564, 571 (1993). Several sources of V gene fragments are available for phage display. Clackson et al, Nature,352:624628(1991) isolated a panel of different anti-oxazolone antibodies from a small random combinatorial library of spleen-derived V genes from unimmunized mice. V gene libraries from non-immunized human donors can be constructed and antibodies to a variety of antigens, including self-antigens, can be isolated by the methods described in Marks et al, J.mol.biol.,222:581-597(1991), or Griffith et al, EMBO J.,12:725-734 (1993). Reference is also made to U.S. Pat. nos.5,565,332and 5,573,905, each of which is incorporated herein by reference in its entirety.
Human antibodies can also be produced by B cells activated in vitro (see, u.s.pat. nos.5,567,610and5,229,275, each of which is incorporated by reference herein in its entirety). Human antibodies can also be produced in vitro using hybridoma technology, such as, but not limited to, the technology described in Roder et al (Methods enzymol.,121:140-167 (1986)).
Alternatively, in some embodiments, a non-human antibody is humanized, wherein specific sequences or regions of the antibody are modified to increase similarity to an antibody naturally occurring in a human. In some embodiments, the antigen binding domain portion is humanized.
Humanized antibodies can be produced using a variety of techniques known in the art, including, but not limited to, CDR-grafting (see, e.g., European Patent No. EP 239,400; International Publication No. WO 91/09967; and U.S. Pat. No.5,225,539, 5,530,101, and5,585,089, each of which is incorporated herein by reference in its entirety), veneering (texturing), or resurfacing (see, e.g., European Patent No. EP 592,106and EP 519,596; Padlan,1991, Molecular Immunology,28(4/5): 489-; Studinking et al, 1994, Protein Engineering,7 (805), (6): 814; Rogusa et al, AS,91: 91, wherein each of which is incorporated herein by reference in its entirety, e.g., PNP 0042664, each of which is incorporated herein by reference in its entirety, U.S. patent Application Publication No. US2005/0048617, U.S. patent No.6,407,213, U.S. patent No.5,766,886, International Publication No. WO 9317105, Tan et al, J.Immunol.,169:1119-25(2002), Caldas et al, Protein Eng.,13(5), 353-60(2000), Morea et al, Methods,20(3), 267-79(2000), Baca et al, J.biol.Chem.,272(16), 10678-84(1997), Roguska et al, Protein Eng.,9(10), 895: 904, to 171722, Cancer et al, 55 (23-55), Sangusin 5973, 1994, 598, 2000, 73, 1995-59150, 1995-598, 1995-5973, and 73, incorporated by reference herein, in its entirety, et al, 76, 1995, 73, 1995, 73, et al. Typically, framework residues in the framework regions may be substituted with corresponding residues from a CDR donor antibody to alter, preferably to improve, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by mimicking the interaction of CDRs with framework residues to identify framework residues important for antigen binding and by sequence comparison to identify framework residues that are aberrant at particular positions. (see, e.g., Queen et al, U.S. Pat. No.5,585, 089; and Riechmann et al, 1988, Nature,332:323, each of which is incorporated herein by reference in its entirety.)
Humanized antibodies have one or more amino acid residues introduced from a source that is not human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable region. Thus, a humanized antibody comprises one or more CDRs from a non-human immunoglobulin molecule and framework regions from a human. Humanization of antibodies is well known in the art and can be performed essentially as described by Winter and co-workers (Jones et al, Nature,321:522-525 (1986); Riechmann et al, Nature,332:323-327 (1988); Verhoeyen et al, Science,239:1534-1536(1988)), using rodent CDRs or CDR sequences in place of the corresponding sequences of human antibodies, i.e., CDR-grafting ( EP 239, 400; PCT Publication No. WO 91/09967; and U.S. Pat. No. 4,816, 567; 6,331, 415; 5,225, 539; 5,530, 101; 5,585, 089; 6,548,640, the contents of which are hereby incorporated by reference in their entirety). In such humanized chimeric antibodies, significantly less than the entire human variable domain is replaced by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. Humanization of antibodies may also be achieved by either the veneering (tunneling) or resurfacing (EP 592,106; EP 519,596; Padlan,1991, Molecular Immunology,28(4/5): 489-498; studnika et al, Protein Engineering,7(6):805-814(1994) and Roguska et al, PNAS,91:969-973(1994)) or chain shuffling (U.S. Pat. No.5,565,332), the contents of which are hereby incorporated by reference in their entirety.
In making humanized antibodies, human variable domains (including light and heavy chains) are selected to reduce antigenicity. According to the so-called "best-fit" method, the sequence of the variable domains of rodent antibodies is screened against the entire library of known human variable region sequences. The human sequence closest to the rodent sequence was then used as the human Framework (FR) for the humanized antibody (Sims et al, J.Immunol.,151:2296 (1993); Chothia et al, J.mol.biol.,196:901(1987), the contents of which are herein incorporated by reference in their entirety). Another approach uses a specific framework derived from the consensus sequence of all human antibodies of a specific subgroup of light or heavy chains. The same framework can be used for several different humanized antibodies (Carter et al, Proc. Natl. Acad. Sci. USA,89:4285 (1992); Presta et al, J.Immunol.,151:2623(1993), the contents of which are herein incorporated by reference in their entirety).
Antibodies can be humanized and retain high affinity for the antigen of interest and other favorable biological properties. For example, humanized antibodies can be prepared by analyzing the parent sequence and various conceptual humanized products using three-dimensional models of the parent sequence and the humanized sequence. Three-dimensional immunoglobulin models are generally available and familiar to those skilled in the art. The computer program may illustrate and display the possible three-dimensional conformational structures of the selected candidate immunoglobulin sequence. Examination of these displays allows analysis of the likely role of the residues in the function of the candidate immunoglobulin sequence, i.e., analysis of residues that affect the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the acceptor and import sequences such that the desired antibody characteristics, such as enhanced affinity for the target antigen, are achieved. Generally, CDR residues are directly and most fundamentally involved in the effect on antigen binding.
"humanized" antibodies retain antigen specificity similar to the original antibody, e.g., the ability to bind to human CD123 antigen. However, using certain humanization methods, "directed evolution" methods can be used to increase the affinity and/or specificity of an antibody for binding to a particular antigen, which are described in Wu et al, J.mol.biol.,294:151(1999), the contents of which are hereby incorporated by reference in their entirety.
5.8.2 genetically engineered immune Effector cells
In some embodiments, the invention provides genetically engineered immune effector cells that recombinantly express the CD123 CARs disclosed herein. In some embodiments, the invention provides genetically engineered immune effector cells comprising polynucleotides encoding the CD123 CARs disclosed herein. In some embodiments, the invention provides genetically engineered immune effector cells comprising a vector comprising a polynucleotide encoding a CD123 CAR disclosed herein. In some embodiments, the immune effector cell is a T cell.
5.8.2.1 genetic engineering method
For the production of cells recombinantly expressing a CD123 CAR disclosed herein, one or more polynucleotides encoding a CD123 CAR are introduced into a target cell using a suitable expression vector. Transferring one or more polynucleotides encoding a CD123 CAR to a target immune effector cell (e.g., a T cell). The genetically engineered cells may also express the anti-CD 123 antibodies or antigen binding fragments disclosed herein.
In some embodiments, the invention provides methods for genetically engineering immune effector cells by transferring polynucleotides provided by the invention to immune effector cells using a non-viral delivery system. The polynucleotide encoding a CD123CAR may be an mRNA, which allows for transient expression and self-elimination of immune effector cells expressing such CD123 CARs. Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. In some embodiments, RNA electroporation (Van Driessche et al, Folia histochemica et cytobiologica 43: 4213-216 (2005)) may be used. The method may further comprise preparing mRNA by in vitro transcription of the polynucleotide of the invention. In some embodiments, the present invention provides methods of genetically engineering immune effector cells into which polynucleotides encoding the anti-CD 123 antibodies or antigen-binding fragments provided herein are transferred using electroporation. In some embodiments, the present invention provides methods of genetically engineering immune effector cells into which polynucleotides encoding CD123 CARs are transferred using electroporation.
In some embodiments, DNA transfection and transposons may be used. In some embodiments, a Sleeping Beauty system or a piggyBac system is used (e.g., Ivics et al, Cell,91(4): 501-;
Figure BDA0003670489470000841
et al (2007) Nucleic Acids research.35(12): e 87). Chemical methods for introducing polynucleotides into host cells include colloidally dispersed systems such as macromolecular complexes, nanocapsules, microspheres, microbeads, and lipid systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Exemplary colloidal systems for use as delivery vehicles in vitro and in vivo are liposomes (e.g., artificial membrane vesicles).
For example, a polynucleotide encoding a CD123 CAR as disclosed herein can be cloned into a suitable vector and introduced into a target cell using well-known MOLECULAR BIOLOGY techniques (see Ausubel et al, Current promoters IN MOLECULAR BIOLOGY, John Wiley and Sons, Baltimore, Md. (1999)). Any vector suitable for expression in cells, particularly human cells, may be used. The vector contains suitable expression elements, such as a promoter, that provide for expression of the encoding nucleic acid in the target cell.
Particularly useful vectors for expressing the disclosed CARs or antibodies include vectors that have been used in human gene therapy. In some embodiments, the vector is a retroviral vector. The use of retroviral vectors for expression in T cells or other immune effector cells, including engineered T cells, has been described (see, Scholler et al, Sci. Transl. Med.4:132- & 153 (2012; Parente-Pereira et al, J. biol. methods 1(2): e7(1-9) (2014); Lamers et al, Blood 117(1):72-82 (2011); Reviere et al, Proc. Natl. Acad. Sci. USA 92:6733- & 6737 (1995)). in some embodiments, the vector is a gamma retrovirus. in one embodiment, the vector is an SGF retroviral vector, e.g., an SGF gamma-retroviral vector, which is a Moloney mouse based retroviral vector leukemia y15: 1454-. Selective activation of cells can increase transduction efficiency (see, Parente-Pereira et al, J.biol. methods 1(2) e7(doi 10.14440/jbm.2014.30) (2014); Movasssagh et al, hum. Gene ther.11:1189-1200 (2000); Rettig et al, mol. Ther.8:29-41 (2003); Agarwal et al, J.Virol.72:3720-3728 (1998); Pollok et al, hum. Gene ther.10:2221-2236 (1998); Quinn et al, hum. Gene r.9:1457-1467 (1998); and also commercially available methods such as Dynabeads TM Human T cell activator product, Thermo Fisher Scientific, Waltham, Mass.).
It will be appreciated that any suitable viral vector or non-viral delivery system may be used. Combinations of retroviral vectors and appropriate packaging cell lines are also suitable, where the capsid proteins will act to infect human cells. Various cell lines producing the bipolaris virus (amphotropic virus) are known, including but not limited to PA12(Miller et al, mol.cell.biol.5:431-437 (1985)); PA317(Miller et al, mol.cell.biol.6:2895-2902 (1986)); and CRIP (Danos et al, Proc. Natl. Acad. Sci. USA 85:6460-6464 (1988)). Non-bi-finless particles are also suitable, for example, with VSVG, RD114 or GALV envelopes and any other pseudotype particles known in the art (Relander et al, mol. Therap.11: 452-. Possible transduction methods also include co-culturing the cells with production cells either directly (e.g., Bregni et al, Blood 80: 1418-.
Other viral vectors that may be used include, for example, adenovirus, lentivirus and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus derived vectors or herpes viruses, such as Epstein-Barr virus (see, for example, Miller, hum. Gene Ther.1(1):5-14 (1990); Friedman, Science 244: 1275. sup. laid-open 1281 (1989); Eglitis et al, BioTechniques 6: 608. sup. 614 (1988); Tolstosh et al, Current Opin. Biotechnol.1:55-61 (1990); Sharp, Lancet 337: 1277. sup. laid-open 1278 (1991); Cornetta et al, prog. Acid Nul. mol. biol.36: 311. sup. 322 (1989); Anderson, Science 226:401 (1984); Sand glass et al, Sand Acid. laid-open milk. laid-open No. 12. Mol. Biotechn 989; 1989; Johnson, 1989; Gallery 989; 1984; Sand laid-open No. 12; 1987; Gallery 989; 1988; Gall laid-open No. 12; 1988; Gall laid-open No. 11; 1989; Gall laid-open, 1989; see, 1989; Gall laid-open No. 11; Gall laid-open, 1989; Gall laid-open No. 11; see, 1989; see, chest 107:83S (1995)). Retroviral vectors are well developed and have been used clinically (Rosenberg et al, N.Engl. J.Med.323:370 (1990); Anderson et al, U.S. Pat.No.5,399, 346). In general, the vectors of choice exhibit high efficiency of infection as well as stable integration and expression (see, e.g., Cayoutte et al, Human Gene Therapy 8: 423-.
The vectors used in the present invention are expressed in a particular host cell using a suitable promoter. The promoter may be an inducible promoter or a constitutive promoter. In some embodiments, the promoter of the expression vector provides expression in a stem cell (e.g., hematopoietic stem cell). In some embodiments, the promoter of the expression vector provides expression in immune effector cells (e.g., T cells). Non-viral vectors may also be used, so long as the vector contains expression elements suitable for expression in the target cell. Some vectors, such as retroviral vectors, can integrate into the host genome.
In some embodiments, the invention provides methods for genetically engineering immune effector cells by transferring polynucleotides provided by the invention into immune effector cells using gene editing. If desired, site-directed integration can be achieved using techniques such as nucleases, transcription activator-like effector nucleases (TALENs), Zinc Finger Nucleases (ZFNs), regularly clustered short palindromic repeats (CRISPRs), homologous recombination, non-homologous end joining, microhomology-mediated end joining, homology-mediated end joining, etc. (Gersbach et al, Nucl. acids Res.39:7868-7878 (2011); Vasieleva, et al. cell Death Dis.6: e1831 (Jul 232015); Sonthimer, hum. Gene Ther.26(7):413-424 (2015); Yao. cell Research 27,801-814 (2017)). In some embodiments, the methods provided herein use ZFN systems. Zinc finger nucleases include DNA recognition domains and non-specific endonucleases. The DNA recognition domain comprises a series of Cys2-His2 zinc finger proteins in tandem, each zinc finger unit comprising about 30 amino acids for specific binding to DNA. The non-specific endonuclease is a fokl endonuclease, which forms dimers to cleave DNA. In some embodiments, the methods provided herein use TALEN systems. TALENs are transcription activator-like effector nucleases. TALE proteins are core components of the DNA binding domain and typically comprise multiple basic repeat units in tandem. The series of units designed and combined can specifically recognize DNA sequences and cut specific DNA sequences by coupling with FokI endonuclease.
In some embodiments, the methods provided herein use CRISPR-Cas systems. The CRISPR-Cas system may be a CRISPR-Cas9 system. The CRISPR/Cas system is a nuclease system comprising regularly clustered interspaced short palindromic repeats (CRISPR) and CRISPR-binding proteins (i.e., Cas proteins) that can cleave almost all genomic sequences adjacent to a Protospacer Adjacent Motif (PAM) in eukaryotic cells (Cong et al. science 2013.339: 819. sup. 823). The "CRISPR/Cas system" is used to collectively refer to the transcripts of a CRISPR-associated ("Cas") gene, as well as to other elements that relate to its expression or direct its activity, including sequences encoding the Cas gene, tracr (trans-activated CRISPR) sequences (e.g., tracrRNA or active portions of tracrRNA), tracr mate sequences (in the context of endogenous CRISPR systems, covering "direct repeats" and processed portions of direct repeats), guide sequences, or other sequences from CRISPR sites and transcripts. In general, CRISPR systems are characterized by elements (also referred to as pre-spacers in endogenous CRISPR systems) that promote the formation of CRISPR complexes at the site of the target sequence. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7 (also known as Csn 7 and Csx 7), Cas7, Csy 7, Cse 7, Csc 7, Csa 7, Csn 7, Csm 7, Cmr 7, Csb 7, Csx 7, CsaX 7, Csx 36f 7, Csx 36f 7, Csx 36f, Csx 7, Csf, or a modified forms thereof. In some embodiments, the Cas protein is a Cas9 protein (gasitunas, Barrangou et al.2012; Jinek, chlorinski et al.2012; Deltcheva, chlorinski et al.2011; Makarova, Grishin et al. (2006)). The amino acid sequence of Cas9 protein is known in the art. Example sequences can be found, for example, in the SwissProt database under accession number Q99ZW2, in the UniProt database under accession number A1IQ68, Q03LF7 or J7RUA 5.
Vectors and constructs can optionally be designed to include a reporter. For example, the vector can be designed to express a reporter protein that can be used to identify a cell that contains the vector or a polynucleotide provided on the vector (e.g., a polynucleotide that has integrated into the host chromosome). In one embodiment, the reporter may be expressed as a bicistronic or polycistronic expression construct with an anti-CD 123 antibody or antigen binding fragment or a CD123 CAR. Exemplary reporter proteins include, but are not limited to, fluorescent proteins such as mCherry, Green Fluorescent Protein (GFP), blue fluorescent proteins (e.g., EBFP2, Azurite, and mKalama1), cyan fluorescent proteins (e.g., ECFP, Cerulean, and CyPet), and yellow fluorescent proteins (e.g., YFP, Citrine, Venus, and YPet).
Experiments using conventional molecular biology techniques can be used to determine transduction efficiency. If a marker (e.g., a fluorescent protein) is included in the construct, gene transfer efficiency can be monitored by FACS analysis to quantify the proportion of transduced (e.g., GFP +) immune effector cells (e.g., T cells), and/or by quantitative PCR. Using a well established co-culture system (Gade et al, Cancer Res.65:9080-9088 (2005); Gong et al, Neoplasia 1:123-127 (1999); Latouche et al, nat. Biotechnol.18:405-409(2000)), it was determined whether fibroblast AAPCs expressing Cancer antigens, compared to controls, direct the release of cytokines from transduced immune effector cells, such as CAR-expressing T cells (cell supernatants LUMINEX (Austin TX)) assays for IL-2, IL-4, IL-10, IFN- γ, TNF- α and GM-CSF), T cell proliferation (via carboxyfluorescein succinimidyl ester (CFSE) labeling) and T cell survival (via Annexin V staining). The effect of CD80 and/or 4-1BBL on T cell survival, proliferation and efficacy can be evaluated. T cells can be exposed to repeated stimulation of cancer antigen-positive target cells and it can be determined whether T cell proliferation and cytokine response remain similar or diminish with repeated stimulation. Cancer antigen CAR constructs can be compared side-by-side under equivalent experimental conditions. Various E's can be performed using the chromium release test: cytotoxicity test of T ratio.
Combinations and permutations of the various methods described herein or otherwise known in the art are expressly contemplated for making the genetically engineered cells disclosed herein.
5.8.2.2 manipulation of immune effector cells
The immune effector cells provided by the invention can be obtained from a subject. Sources of immune effector cells provided by the present invention include, but are not limited to, hematopoietic cells from peripheral blood, cord blood, bone marrow, or other sources. Immune effector cells (e.g., T cells) can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, cell lines available in the art may be used. Immune effector cells provided by the present invention can be isolated by methods well known in the art, including commercially available isolation methods (see, e.g., Rowland Jones et al, LYMPHOCYTES: A PRACTICAL APPROACH, Oxford University Press, New York (1999)). Various methods for isolating immune effector cells have been previously described and may be used including, but not limited to, the use of peripheral donor lymphocytes (Sadelain et al, Nat. Rev. Cancer 3:35-45 (2003); Morgan et al, Science 314: 126-.
In certain embodiments, the immune effector cells (e.g., T cells) disclosed herein can use any technique known to those of skill in the art (e.g., Ficoll) TM Isolating) blood collected from a subjectObtained in the unit. In some embodiments, the cells from the circulating blood of the individual are obtained by apheresis. The apheresis product typically contains lymphocytes including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. In some embodiments, cells collected by apheresis may be washed to remove the plasma fraction and the cells placed in an appropriate buffer or medium for subsequent processing steps. In some embodiments, the cells are washed with Phosphate Buffered Saline (PBS). In another embodiment, the wash solution is devoid of calcium, and may be devoid of magnesium, or may be devoid of many (if not all) divalent cations. In the absence of calcium, the initial activation step results in amplified activation. As will be readily appreciated by those of ordinary skill in the art, the washing step may be accomplished by methods known to those of skill in the art, such as using a semi-automatic "flow-through" centrifuge (e.g., Cobe 2991 cell processor, Baxter CytoMate, or autologous blood salvage machine 5) according to the manufacturer's instructions. After washing, the cells can be resuspended in various biocompatible buffers, such as Ca2+ free, Mg2+ free PBS, boehmeria a (plasmalyte a), or other physiological saline solutions with or without buffer. Alternatively, undesired components of the apheresis sample may be removed and the cells resuspended directly in culture.
In another embodiment, by lysing erythrocytes and depleting monocytes (e.g., by Percoll) TM Gradient centrifugation or countercurrent centrifugation) to separate T cells from peripheral blood lymphocytes. A particular subset of T cells, such as CD3+, CD28+, CD4+, CD8+, CD45RA + and CD45RO + T cells, can be further isolated by positive or negative selection techniques. For example, in one embodiment, the microbeads are coupled (e.g., by coupling to anti-CD 3/anti-CD 28 (i.e., 3X 28))
Figure BDA0003670489470000891
M-450CD3/CD 28T) for a sufficient period of time for positive selection of the desired T cells. In one embodiment, the time period is about 30 minutes. In another embodiment, the time period ranges from 30 minutes to 36 hours or moreLong, and all integer values included therebetween. In another embodiment, the period of time is at least 1, 2, 3, 4, 5, or 6 hours. In yet another preferred embodiment, the period of time is from 10 to 24 hours. In a preferred embodiment, the incubation period is 24 hours. For T cell isolation in leukemia patients, cell yield can be increased using longer incubation times (e.g., 24 hours). In any case where there are fewer T cells than other cell types, longer incubation times can be used to isolate T cells, such as Tumor Infiltrating Lymphocytes (TILs) from tumor tissue or immunocompromised individuals. Furthermore, the efficiency of capturing CD8+ T cells can be improved using longer incubation times. Thus, by simply shortening or extending the time for T cells to bind to CD3/CD28 microbeads and/or by increasing or decreasing the ratio of microbeads to T cells (as further described herein), a subset of T cells can be preferentially selected or eliminated at the beginning of the culture or at other time points in the process. In addition, by increasing or decreasing the proportion of anti-CD 3 and/or anti-CD 28 antibodies on microbeads or other surfaces, T cell subsets can be preferentially selected or depleted at the start of the culture or at other desired time points. Those skilled in the art will recognize that multiple rounds of selection may also be used in the context of the present invention.
Various techniques can be employed to isolate cells to enrich for desired immune effector cells. For example, negative selection methods can be used to remove cells that are not the desired immune effector cells. In addition, a positive selection method may be used to isolate or enrich for desired immune effector cells or their precursor cells, or a combination of positive and negative selection methods may be used. Monoclonal antibodies (MAbs) are particularly useful for identifying markers associated with a particular cell lineage and/or differentiation stage for both positive and negative selection. If a particular type of CELL is to be isolated, for example a particular type of T CELL, various CELL surface markers or combinations of markers can be used to isolate the CELL, including but not limited to CD3, CD4, CD8, CD34 (for hematopoietic stem/progenitor CELLs), AND the like, as is well known IN the art (see, Kearse, T CELL PROTOCOLS: DEVELOPMENT AND ACTIVATION, Humana Press, Totowa NJ (2000); De Libero, T CELL PROTOCOLS, Vol.51of 4 METHODS IN MOLECULAR BIOLOGY, Humana Press, Totowa NJ (2009)). In some embodiments, enrichment of the T cell population by negative selection can be accomplished with antibody binding to a surface marker specific for the negative selection cells. One approach is cell sorting and/or selection by negative magnetic immunoadhesion or flow cytometry using a mixture of monoclonal antibodies directed against cell surface markers present on negatively selected cells. For example, to enrich for CD4+ cells by negative selection, monoclonal antibody mixtures typically include CD14, CD20, CD11b, CD16, HLA-DR, and CD8 antibodies. In certain embodiments, it may be desirable to enrich for or positively select regulatory T cells that typically express CD4+, CD25+, CD62Lhi, GITR + and FoxP3 +. Alternatively, in certain embodiments, T regulatory cells are eliminated by coupling anti-C25 to microbeads or other similar selection methods.
Isolation procedures for immune effector cells include, but are not limited to, density gradient centrifugation, coupling of particles that modify cell density, magnetic separation with antibody-coated magnetic beads, affinity chromatography; cytotoxic agents used in conjunction or conjugation with monoclonal antibodies (mabs) include, but are not limited to, complement AND cytotoxins, as well as antibody panning attached to a solid substrate, such as a plate or chip, elution, flow cytometry, or any other convenient technique (see, e.g., Recktenwald et al, CELL SEPARATION METHODS AND APPLICATIONS, Marcel Dekker, inc., New York (1998)). It is understood that the immune effector cells used in the methods provided herein can be purified cells or can be a polyclonal population. In some embodiments, the polyclonal population can be enriched for the desired immune effector cells. This enrichment can be performed before or after the cells are genetically engineered to express the CD123 CARs provided by the invention, as desired.
The immune effector cells may be autologous or non-autologous to the subject to whom they are administered according to the disclosed methods of treatment. Autologous cells are isolated from the subject to which the engineered cells are administered. Optionally, the cells may be obtained by leukapheresis, wherein the leukapheresis is selectively removed from the extracted blood, made into recombinants, and then infused into the donor. Alternatively, allogeneic cells from non-autologous donors of non-subjects may be used. In the case of non-autologous donors, the cells are typed and matched with Human Leukocyte Antigens (HLA) to determine the appropriate level of compatibility, as is well known in the art. Cells may optionally be cryopreserved after isolation and/or genetic engineering and/or expansion of genetically engineered cells (see Kaiser et al, supra, 2015)). Methods for cryopreservation OF CELLs are well known in the art (see, e.g., Freshney, CURTURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUES,4th ed., Wiley-Liss, New York (2000); Harrison and Rae, GENERAL TECHNIQUES OF CELL CULTURE, Cambridge University Press (1997)).
In some embodiments, the isolated immune effector cell is genetically engineered in vitro for recombinant expression of a polypeptide (e.g., CAR). In some embodiments, the isolated immune effector cells are genetically engineered in vitro for recombinant expression of a CD123 CAR. In some embodiments, the immune effector cells provided herein are obtained by in vitro priming (sensitization), wherein the priming reaction can occur before or after the immune effector cells are genetically engineered to recombinantly express the polypeptides disclosed herein. In one embodiment, the primed immune effector cells (e.g., T cells) are isolated from an in vivo source, and it will be self-evident that genetic engineering of primed immune effector cells will occur.
It is also contemplated in the present invention that a blood sample or apheresis product is collected from a subject for a period of time before the genetically engineered cells according to the present invention may be needed. Thus, the source of cells to be expanded can be collected at any necessary point in time, and the desired cells (e.g., T cells) isolated and frozen for later use in T cell therapy for any number of diseases or disorders that would benefit from T cell therapy, such as those described herein. In one embodiment, a blood sample or fraction is taken from a generally healthy subject. In certain embodiments, a blood sample or single is taken from a generally healthy subject at risk of developing the disease but who has not yet developed the disease, and the desired cells are isolated and frozen for later use. In certain embodiments, the T cells may be expanded, frozen, and used at a later time. In certain embodiments, a sample is collected from a patient shortly after diagnosis of a particular disease as described herein, but prior to any treatment. In another embodiment, the cells are isolated from a blood sample or a single sample from the subject prior to any number of related treatment modalities, including, but not limited to, treatment with drugs (e.g., natalizumab, efletuzumab, antiviral agents), chemotherapy, radiation therapy, immunosuppressive agents (e.g., cyclosporine, azathioprine, methotrexate, mycophenolic acid, and FK506), antibodies or other immunosuppressive agents (e.g., CAMPATH, anti-CD 3 antibodies, cyclophosphamide, fludarabine, cyclosporine, FK506, rapamycin, mycophenolic acid, steroids, FR901228), and irradiation. These drugs inhibit the calcium-dependent phosphatases calcineurin (cyclosporin and FK506) or inhibit the p70S6 kinase (rapamycin) important for growth factor-induced signaling (Liu et al, Cell 66:807-815, 1991; Henderson et al, Immun73:316-321, 1991; Bierer et al, curr. Opin. Immun.5:763-773, 1993). In further embodiments, the cells are isolated and frozen for subsequent use in conjunction with bone marrow transplantation or stem cell transplantation (e.g., prior to, concurrent with, or after transplantation), T cell ablation therapy with a chemotherapeutic agent (e.g., fludarabine), external electron beam radiation therapy (XRT), cyclophosphamide, or an antibody (e.g., OKT3 or CAMPATH). In another embodiment, the cells are isolated prior to B-cell ablation therapy and can be frozen for later use in later therapy, such as drugs that react with CD20 (e.g., Rituxan).
In further embodiments, the T cells are obtained directly from the patient after treatment. In this respect, it has been observed that after certain cancer treatments, in particular treatments with drugs that damage the immune system, the patient is usually recovered from the treatment within a period of time shortly after the treatment, and the quality of the T cells obtained can be optimized or improved due to their capacity to expand in vitro. Likewise, these cells can be in a preferred state for enhanced transplantation and in vivo expansion following in vitro manipulation using the methods described herein. Therefore, it is contemplated that blood cells, including T cells, NK cells, or other immune effector cells of the hematopoietic lineage, are collected at this stage of recovery. Furthermore, in certain embodiments, mobilization (e.g., mobilization with GM-CSF) and conditioning regimens can be used to create conditions in a subject that favor the re-proliferation, recycling, regeneration, and/or expansion of a particular cell type, particularly during a defined time window following treatment. Exemplary cell types include T cells, B cells, dendritic cells, and other cells of the immune system.
The immune effector cells disclosed herein may be subjected to conditions known in the art to facilitate cell maintenance or expansion. (De Libero, T Cell Protocols, Vol.514of METHODS IN MOLECULAR BIOLOGY, Humana Press, Totowa NJ (2009); Parente-Pereira et al, J.Biol.methods 1(2) e7(doi10.14440/jbm.2014.30) (2014); Movasssagh et al, Hum.Gene ther.11:11891200 (2000); Rettig et al, mol.Ther.8:29-41 (2003); Agarwal et al, J.Virol.72: 3720-28 (1998); Pollok et al, Hum.Gene Ther.10:2221-2236 (1999); Quinn et al, Gene Hum.9: 1457 (1998) TM Human T cell activator product, Thermo Fisher Scientific, Waltham, MA)). Immune effector cells (e.g., T cells) disclosed herein can optionally be expanded prior to or after in vitro genetic engineering. Expansion of cells is particularly useful for increasing the number of cells in a subject for administration. Such methods for cell expansion are well known in the art (see, e.g., Kaiser et al, Cancer Gene Therapy 22:72-78 (2015); Wolfl et al, nat. protocols 9: 950-. In addition, the cells may optionally be cryopreserved after isolation and/or genetic engineering and/or expansion of genetically engineered cells (see Kaiser et al, supra, 2015)). Methods for cryopreserving CELLs are well known in the art (see, e.g., Freshney, CURTURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUES,4th ed., Wiley-Liss, New York (2000); Harrison and Rae, GENERAL TECHNIQUES OF CELL CURTURE, Cambridge University Press (1997)).
In general, the T cells provided herein can be expanded by contacting a surface having attached thereto an agent that stimulates a signal associated with the CD3/TCR complex and a ligand that stimulates a co-stimulatory receptor on the surface of the T cell. In particular, a population of T cells can be stimulated as described herein, for example by contact with an anti-CD 3 antibody or antigen-binding fragment thereof, or an anti-CD 2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) that binds calcium ionophore. To co-stimulate accessory molecules on the surface of T cells, ligands that bind the accessory molecules are used. For example, an anti-CD 3 antibody and an anti-CD 28 antibody are contacted with a population of T cells under conditions suitable to stimulate T cell proliferation. To stimulate proliferation of CD4+ T cells or CD8+ T cells, anti-CD 3 antibodies and anti-CD 28 antibodies may be used to stimulate proliferation of CD4+ T cells or CD8+ T cells. Examples of anti-CD 28 antibodies include 9.3, B-T3, XR-CD28(Diaclone, Besancon, France), other methods common in the art may also be used (Berg et al, transfer Proc.30(8):3975-3977, 1998; Haanen et al, J.Exp.Med.190(9):13191328,1999; Garland et al, J.Immunol meth.227(1-2):53-63,1999).
The invention has been described herein in language specific to numerous embodiments. The invention also specifically includes embodiments that wholly or partially exclude a particular subject matter, such as a substance or material, method steps and conditions, protocols, procedures, assays, or assays. Thus, even if the present invention is not generally expressed in a content that is not included in the present invention, aspects that are not explicitly included in the present invention are still disclosed in the present invention.
Specific embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of the disclosed embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description, and it is contemplated that such variations may be suitably employed by those skilled in the art. Accordingly, this invention is intended to be practiced otherwise than as specifically described, and this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
All publications, patent applications, accession numbers and other references cited in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated herein by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the description in the experiment is intended to illustrate but not limit the scope of the invention described in the claims.
6. Experiment of
6.1 background
Interleukin 3(IL-3) is produced primarily by activated T lymphocytes, a pluripotent cytokine required for proliferation and differentiation of a wide range of primitive hematopoietic progenitors and lineage-committed cells, including granulocytes, macrophages, megakaryocytes, erythroid cells, and mast cells, promoting the formation of multiple lineages (Ihle 1992, Broughton, Nero et al 2015). IL-3 belongs to the family of β -chain common (β c) cytokines, which signal by activating heterodimeric cell surface receptors, the heterodimer consisting of an interleukin-3 receptor alpha chain (IL-3R α, also known as CD123) and a shared β c subunit. The IL-3 receptor heterodimer complex activates JAK2/STAT5 and the MAP kinase pathway and promotes cell proliferation and differentiation (Hercus, Dhagat et al.2013, Broughton, Nero et al.2015).
6.2 preparation of human anti-CD 123 antibodies
The following steps were taken to prepare fully human anti-CD 123 antibodies:
1) expression and purification of phage display libraries: log phase TG1 library cultures were infected with freshly thawed M13K07 helper phage with a multiple infection rate of 20: 1 (phage to cell ratio) and induced overnight with IPTG; the phage library was purified by PEG/NaCl precipitation and then the phage titer was determined.
2) Selection of CD 123-specific scFv-phages: in the first round of selection, Maxisorp plates were coated with 20. mu.g/ml of CD123-6His protein overnight at 4 ℃, washed with PBS, blocked with 5% milk + 1% BSA in 1 XPBS, incubated in phage solution for 2 hours, and washed 10 times with PBST. The scFv phage bound to the antigen were eluted using acid elution buffer (ph2.2), neutralized, inoculated in 15 ml log phase TG1 culture (OD600 ═ 0.5), incubated at 37 ℃ for 30 minutes with shaking for 30 minutes, inoculated on 2xYT-GA agar plates, and incubated overnight at 30 ℃ for subsequent selection. In subsequent rounds of selection, more stringent selection conditions were used, including decreasing the coated protein concentration (2. mu.g/ml for the second round and 0.5. mu.g/ml for the third round) and increasing the wash cycle (20 for the second round and 30 for the third round).
3) And (4) screening by using mpELISA. After three rounds of screening, 292 positive colonies were selected for monoclonal phage elisa (mpelisa) screening. Phage supernatants generated from individual colony clones were incubated with pre-blocked Maxisorp plates coated with 2. mu.g/mL CD123-6His protein. After three washes, 100. mu.l/well of HRP-conjugated anti-M13 antibody diluted 1:5000 in blocking buffer (5% milk + 1% BSA, 1 XPBS) was added followed by incubation for 60 min at ambient temperature. After washing the plate 5 times with PBST, 100. mu.l/well of TMB substrate solution was added and incubated for 10-30min until a blue color appeared. By adding 50. mu.l/well of stop solution (2N H) 2 SO 4 ) To terminate the reaction. The absorbance at 450nm was read in a microplate reader. Figure 1 shows the absorbance readings from the mpELISA screening. As shown, some positive colonies (absorbance. gtoreq.0.5 at 450 nm) were identified as producing anti-CD 123 antibodies capable of binding to CD123-6His protein (FIG. 1).
4) Cloning and sequence analysis: positive clones were screened for ELISA results and used as templates for PCR cloning of scFv sequences (forward primer sequence: tgcagctggcacgacaggtttc, reverse primer sequence: cgtcagactgtagcacgtt). The PCR product was then sequenced by the sanger sequencing method (forward primer sequence: aacaattgaattcaggagga, reverse primer sequence: cctcctaagaagcgtagtc). The CDR regions of the scFv were analyzed by the abysis website (http:// abysis. org /), see tables 1 and 2 above.
6.3 preparation of CD123 CAR
Vectors for the production of anti-CD 123 CAR mRNA were constructed. First, the scFv sequence and CAR fragment (from the hinge domain to the CD3-zeta domain) were amplified by PCR and cloned into the pDA vector (Xba1/Sal 1). Figure 2 provides a schematic of a pDA-CAR vector for generating CAR mRNA. Second, CD123 CAR mRNA was prepared by In Vitro Transcription (IVT). The pDA-CAR plasmid was linearized by Spe1 digestion and purified by PCR Cleanup kit. After measuring the DNA concentration with nanodrop and checking by running agarose DNA gels, IVT was performed according to the manufacturer's instructions (Thermofoiser, Cat No: AM 13455). The concentration of the RNA product was determined by nanodrop and checked by running a PAGE gel.
6.4 preparation and characterization of CD123 CARTs
Introduction of CD123 CAR mRNA into T cells using electroporation by harvesting T cells, washing with Opti-MEM media, and using Opti-MEM media at 1 × 10e 7 Resuspending in/ml; 10 μ g of RNA was aliquoted with 100 μ l of T cells, mixed well and electroporated with the following parameters (BTX machine): 500V, 0.7 ms; the cells were then transferred to pre-warmed medium and cultured at 37 ℃.
Binding of CD123 CART cells to CD123-Fc recombinant protein was measured by FACS staining. As shown in FIG. 3, T cells expressing a CAR with anti-CD 123 scFv-C1, -C2, -C3, -C4, -C5, -C6, -C7, -C9, -C10, -C11, -C13, -C14, -C15, -C16, -C17, -C18, -C19, -C21, -C23, -C24, -C25, -C26, -C27, -C28, -C29, -C30, -C32, -C33, -C34, and-C35 were able to bind to the CD123-Fc recombinant protein. Empty vector (Mock) is a control T cell without CAR molecule.
A549 tumor cells were electroporated with varying amounts of CD123 mRNA. The electroporation process was the same as above, with only the parameters changed, using 300V, 0.5 ms. CD123 expression in a549 tumor cells was measured by FACS staining of a549 cells electroporated with isotype or anti-CD 123 antibodies, varying amounts of CD123 mRNA. As shown in fig. 4, a549 cells weakly express endogenous CD123, and ectopic expression levels of CD123 correlate with the amount of CD123 mRNA electroporated into a549 cells.
The cytotoxicity of CD123 CART cells on tumor cells was measured in an in vitro cytotoxicity assay. EGFP-expressing tumor cells or EGFP-a549 cells electroporated with different amounts of tumor antigen were seeded at 3000 cells/100 ul/well in flat-bottom 96-well plates; CART cells were diluted to appropriate concentrations and seeded at different E/T ratios (e.g., 10:1, 3:1, 1:1) at 100 μ l/well tumor cells, and the co-culture plates were then placed into the IncuCyte S3 machine and the scan parameters set. After 3 days of scanning, the total green object integrated intensity (GCU x μm) was analyzed 2 Per well) to calculate the killing efficiency.
FIGS. 5 and 6 show killing curves for A549-GFP tumor cells for different mRNA-based anti-CD 123 CART cells at E/T ratios of 10:1 (FIG. 5) or 3:1 (FIG. 6). As shown, the anti-CD 123scFv-C2, -C3, -C4, -C6, -C9, -C11, -C13, -C14, -C15, -C16, -C17, -C19, -C21, -C23, -C24, and-C32-expressing CART cells effectively prevented a549 cell growth and even eliminated a549 cells, although a549 cells express low levels of endogenous CD123, indicating that these scFv-based CART cells have higher cytotoxicity to tumor cells.
FIGS. 7 and 8 show killing curves for different mRNA-based anti-CD 123 CART cells against A549-GFP tumor cells expressing exogenous CD123 (electroporated with 10. mu.g of CD123 mRNA) at E/T ratios of 10:1 (FIG. 7) or 3:1 (FIG. 8). As shown, CART cells expressing anti-CD 123 scFv-C1, -C2, -C3, -C4, -C5, -C6, -C7, -C9, -C11, -C13, -C14, -C15, -C16, -C17, -C18, -C19, -C21, -C23, -C24, -C25, -C26, -C27, -C28, -C29, -C30, -C32, -C33, -C34 and-C35 effectively prevented the growth of a549 tumor cells expressing CD123, even reduced the number of a549 tumor cells expressing CD123, confirming their ability to kill tumor cells expressing CD 123.
6.5 CART cell CD107a staining
CD123 expression was measured by FACS staining for different tumor cell lines. FIG. 9 shows FACS staining of A549, SK-OV3, Jeko-1, Molm-14, SupT-1, 293T, Nalm-6 and PC-3 cells with PE-isotype control and PE-anti-CD 123 mAb. As shown, most of the tested tumor cell lines did not express CD123, only Molm-14 expressed relatively high levels of CD 123.
CD107a is an early activation marker for T cells. CD123 cart activation by CD123 expressing tumor cells was measured using CD107a staining by: add 20 μ Ι PE-CD107a mAb to each well of a 96-well plate; tumor cells were diluted to 2 × 10e 6 Per ml and seeded on 96-well disks (100. mu.l/well); CART cells were diluted to 1 × 10e 6 Ml, seeded in 96-well round plates (100. mu.l/well); the plate was centrifuged at 500rpm 5 minutes to make the cells adhere well, and incubated at 37 ℃ for 1 hour; golgi stop was added to each well (20 μ l/well) after being diluted 1500-fold with medium; the cells were further cultured at 37 ℃ for 2.5 hours, stained with anti-CD 3-APC and anti-CD 8-FITC antibodies at 37 ℃ for 30 minutes, washed and analyzed by flow cytometry.
In our study, activation of CARTs (expressing anti-CD 123-C5, anti-CD 123-C7, anti-CD 123-C11) by CD123 expressing tumor cells was measured by CD107a staining. The cells tested included A549, SK-OV3, PC-3, cord blood-derived CD34 hematopoietic stem cells (CD34+ cord), bone marrow-derived hematopoietic stem cells (CD34+ M), Molm-14, Nalm6, Jeko-1 tumor cell line and freshly isolated AML tumor cells (CD123+) electroporated with 10. mu.g, 0.1. mu.g and 0. mu.g of CD123 mRNA. As shown in fig. 10, CART cells expressing anti-CD 123-C5, -C7, and-C11 were specifically activated by tumor cells with relatively high CD123 expression, particularly CD123+ AML tumor cells, but not by tumor cell lines with low CD123 expression. These results indicate that CD123 expressing tumor cells can activate CD123 cart.
7.Electronically submitted sequence listing reference
The application merges the sequence list with the application by reference into an ASCII text file named "613 a002CN02_ st25. txt", created at 19 days 5 months 2022 and 25,587 bytes in size.
Sequence LISTING
<110> Shanghai excellent Biopharmaceutical Co., Ltd
<120> CD123 targeting antibodies, chimeric antigen receptors and uses thereof
<130> 613A002CN02
<150> PCT/CN2021/112748
<151> 2021-08-16
<150> CN202180005561.9
<151> 2022-03-25
<160> 413
<170> PatentIn version 3.5
<210> 23
<211> 13
<212> PRT
<213> Artificial sequence
<220>
<223> LCDR1 sequence
<400> 23
Thr Arg Ser Ser Gly Ser Ile Ala Gly Ser Tyr Val Gln
1 5 10
<210> 50
<211> 7
<212> PRT
<213> Artificial sequence
<220>
<223> LCDR2 sequence
<400> 50
Gln Asp Asn Gln Arg Pro Ser
1 5
<210> 82
<211> 9
<212> PRT
<213> Artificial sequence
<220>
<223> LCDR3 sequence
<400> 82
Gln Ser Tyr Asp Ser Asn Asn Gln Val
1 5
<210> 99
<211> 5
<212> PRT
<213> Artificial sequence
<220>
<223> HCDR1 sequence
<400> 99
Asp Tyr Gly Met Ser
1 5
<210> 129
<211> 17
<212> PRT
<213> Artificial sequence
<220>
<223> HCDR2 sequence
<400> 129
Gly Ile Asn Trp Asn Gly Gly Arg Thr Gly Tyr Ala Asp Ser Val Lys
1 5 10 15
Gly
<210> 157
<211> 13
<212> PRT
<213> Artificial sequence
<220>
<223> HCDR3 sequence
<400> 157
Ala Arg Gly Ser Gly Ser Tyr Phe Gly Tyr Met Asp Val
1 5 10
<210> 168
<211> 110
<212> PRT
<213> Artificial sequence
<220>
<223> VL sequence
<400> 168
Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys
1 5 10 15
Thr Val Thr Leu Ser Cys Thr Arg Ser Ser Gly Ser Ile Ala Gly Ser
20 25 30
Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val
35 40 45
Ile Phe Gln Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser
50 55 60
Gly Ser Ile Asp Lys Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly
65 70 75 80
Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser
85 90 95
Asn Asn Gln Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu
100 105 110
<210> 203
<211> 122
<212> PRT
<213> Artificial sequence
<220>
<223> VH sequence
<400> 203
Glu Val His Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Asp Tyr
20 25 30
Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Gly Ile Asn Trp Asn Gly Gly Arg Thr Gly Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys
85 90 95
Ala Arg Ala Arg Gly Ser Gly Ser Tyr Phe Gly Tyr Met Asp Val Trp
100 105 110
Gly Lys Gly Thr Thr Val Thr Val Ser Ser
115 120
<210> 238
<211> 330
<212> DNA
<213> Artificial sequence
<220>
<223> VL DNA sequence
<400> 238
aattttatgc tgactcagcc ccactctgtg tcggagtctc cggggaagac cgtgaccctc 60
tcctgcaccc gcagcagtgg cagcattgcc ggcagctatg tgcagtggta ccagcagcgc 120
ccgggcagtt cccccaccac tgttatcttt caggataacc aaaggccctc tggggtccct 180
gatcggttct ctggctccat cgacaagtcc tccaactctg cctccctcac catctctgga 240
ctgaagactg aggacgaggc tgactactat tgtcagtctt atgatagcaa caatcaggtg 300
ttcggcggag ggaccaagct gaccgtccta 330
<210> 273
<211> 366
<212> DNA
<213> Artificial sequence
<220>
<223> VH DNA sequence
<400> 273
gaggtgcatc tggtggagtc tgggggaggt gtggtacggc cgggggggtc cctgagactc 60
tcctgtgcag cctctggatt cacctttggt gattatggca tgagctgggt ccgccaagct 120
ccagggaagg ggctggagtg ggtctctggt attaattgga atggtggtag aacaggttat 180
gcagactctg tgaagggccg attcaccatc tccagagaca acgccaagaa ctccctgtat 240
ctgcaaatga acagtctgag agccgaggac acggccttgt attactgtgc gagagcccga 300
ggttcgggga gttacttcgg ctacatggac gtctggggca aagggaccac ggtcactgtc 360
tcctca 366
<210> 320
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> linker
<400> 320
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10 15
<210> 321
<211> 378
<212> PRT
<213> Artificial sequence
<220>
<223> human CD123
<400> 321
Met Val Leu Leu Trp Leu Thr Leu Leu Leu Ile Ala Leu Pro Cys Leu
1 5 10 15
Leu Gln Thr Lys Glu Asp Pro Asn Pro Pro Ile Thr Asn Leu Arg Met
20 25 30
Lys Ala Lys Ala Gln Gln Leu Thr Trp Asp Leu Asn Arg Asn Val Thr
35 40 45
Asp Ile Glu Cys Val Lys Asp Ala Asp Tyr Ser Met Pro Ala Val Asn
50 55 60
Asn Ser Tyr Cys Gln Phe Gly Ala Ile Ser Leu Cys Glu Val Thr Asn
65 70 75 80
Tyr Thr Val Arg Val Ala Asn Pro Pro Phe Ser Thr Trp Ile Leu Phe
85 90 95
Pro Glu Asn Ser Gly Lys Pro Trp Ala Gly Ala Glu Asn Leu Thr Cys
100 105 110
Trp Ile His Asp Val Asp Phe Leu Ser Cys Ser Trp Ala Val Gly Pro
115 120 125
Gly Ala Pro Ala Asp Val Gln Tyr Asp Leu Tyr Leu Asn Val Ala Asn
130 135 140
Arg Arg Gln Gln Tyr Glu Cys Leu His Tyr Lys Thr Asp Ala Gln Gly
145 150 155 160
Thr Arg Ile Gly Cys Arg Phe Asp Asp Ile Ser Arg Leu Ser Ser Gly
165 170 175
Ser Gln Ser Ser His Ile Leu Val Arg Gly Arg Ser Ala Ala Phe Gly
180 185 190
Ile Pro Cys Thr Asp Lys Phe Val Val Phe Ser Gln Ile Glu Ile Leu
195 200 205
Thr Pro Pro Asn Met Thr Ala Lys Cys Asn Lys Thr His Ser Phe Met
210 215 220
His Trp Lys Met Arg Ser His Phe Asn Arg Lys Phe Arg Tyr Glu Leu
225 230 235 240
Gln Ile Gln Lys Arg Met Gln Pro Val Ile Thr Glu Gln Val Arg Asp
245 250 255
Arg Thr Ser Phe Gln Leu Leu Asn Pro Gly Thr Tyr Thr Val Gln Ile
260 265 270
Arg Ala Arg Glu Arg Val Tyr Glu Phe Leu Ser Ala Trp Ser Thr Pro
275 280 285
Gln Arg Phe Glu Cys Asp Gln Glu Glu Gly Ala Asn Thr Arg Ala Trp
290 295 300
Arg Thr Ser Leu Leu Ile Ala Leu Gly Thr Leu Leu Ala Leu Val Cys
305 310 315 320
Val Phe Val Ile Cys Arg Arg Tyr Leu Val Met Gln Arg Leu Phe Pro
325 330 335
Arg Ile Pro His Met Lys Asp Pro Ile Gly Asp Ser Phe Gln Asn Asp
340 345 350
Lys Leu Val Val Trp Glu Ala Gly Lys Ala Gly Leu Glu Glu Cys Leu
355 360 365
Val Thr Glu Val Gln Val Val Gln Lys Thr
370 375
<210> 322
<211> 164
<212> PRT
<213> Artificial sequence
<220>
<223> human CD3zeta
<400> 322
Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu
1 5 10 15
Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys
20 25 30
Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala
35 40 45
Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr
50 55 60
Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg
65 70 75 80
Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met
85 90 95
Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn
100 105 110
Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met
115 120 125
Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly
130 135 140
Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala
145 150 155 160
Leu Pro Pro Arg
<210> 333
<211> 220
<212> PRT
<213> Artificial sequence
<220>
<223> human CD28
<400> 333
Met Leu Arg Leu Leu Leu Ala Leu Asn Leu Phe Pro Ser Ile Gln Val
1 5 10 15
Thr Gly Asn Lys Ile Leu Val Lys Gln Ser Pro Met Leu Val Ala Tyr
20 25 30
Asp Asn Ala Val Asn Leu Ser Cys Lys Tyr Ser Tyr Asn Leu Phe Ser
35 40 45
Arg Glu Phe Arg Ala Ser Leu His Lys Gly Leu Asp Ser Ala Val Glu
50 55 60
Val Cys Val Val Tyr Gly Asn Tyr Ser Gln Gln Leu Gln Val Tyr Ser
65 70 75 80
Lys Thr Gly Phe Asn Cys Asp Gly Lys Leu Gly Asn Glu Ser Val Thr
85 90 95
Phe Tyr Leu Gln Asn Leu Tyr Val Asn Gln Thr Asp Ile Tyr Phe Cys
100 105 110
Lys Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser
115 120 125
Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro
130 135 140
Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly
145 150 155 160
Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile
165 170 175
Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met
180 185 190
Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro
195 200 205
Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser
210 215 220
<210> 334
<211> 255
<212> PRT
<213> Artificial sequence
<220>
<223> human 4-1BB
<400> 334
Met Gly Asn Ser Cys Tyr Asn Ile Val Ala Thr Leu Leu Leu Val Leu
1 5 10 15
Asn Phe Glu Arg Thr Arg Ser Leu Gln Asp Pro Cys Ser Asn Cys Pro
20 25 30
Ala Gly Thr Phe Cys Asp Asn Asn Arg Asn Gln Ile Cys Ser Pro Cys
35 40 45
Pro Pro Asn Ser Phe Ser Ser Ala Gly Gly Gln Arg Thr Cys Asp Ile
50 55 60
Cys Arg Gln Cys Lys Gly Val Phe Arg Thr Arg Lys Glu Cys Ser Ser
65 70 75 80
Thr Ser Asn Ala Glu Cys Asp Cys Thr Pro Gly Phe His Cys Leu Gly
85 90 95
Ala Gly Cys Ser Met Cys Glu Gln Asp Cys Lys Gln Gly Gln Glu Leu
100 105 110
Thr Lys Lys Gly Cys Lys Asp Cys Cys Phe Gly Thr Phe Asn Asp Gln
115 120 125
Lys Arg Gly Ile Cys Arg Pro Trp Thr Asn Cys Ser Leu Asp Gly Lys
130 135 140
Ser Val Leu Val Asn Gly Thr Lys Glu Arg Asp Val Val Cys Gly Pro
145 150 155 160
Ser Pro Ala Asp Leu Ser Pro Gly Ala Ser Ser Val Thr Pro Pro Ala
165 170 175
Pro Ala Arg Glu Pro Gly His Ser Pro Gln Ile Ile Ser Phe Phe Leu
180 185 190
Ala Leu Thr Ser Thr Ala Leu Leu Phe Leu Leu Phe Phe Leu Thr Leu
195 200 205
Arg Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe
210 215 220
Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly
225 230 235 240
Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu
245 250 255
<210> 347
<211> 235
<212> PRT
<213> Artificial sequence
<220>
<223> human CD8
<400> 347
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu
1 5 10 15
His Ala Ala Arg Pro Ser Gln Phe Arg Val Ser Pro Leu Asp Arg Thr
20 25 30
Trp Asn Leu Gly Glu Thr Val Glu Leu Lys Cys Gln Val Leu Leu Ser
35 40 45
Asn Pro Thr Ser Gly Cys Ser Trp Leu Phe Gln Pro Arg Gly Ala Ala
50 55 60
Ala Ser Pro Thr Phe Leu Leu Tyr Leu Ser Gln Asn Lys Pro Lys Ala
65 70 75 80
Ala Glu Gly Leu Asp Thr Gln Arg Phe Ser Gly Lys Arg Leu Gly Asp
85 90 95
Thr Phe Val Leu Thr Leu Ser Asp Phe Arg Arg Glu Asn Glu Gly Tyr
100 105 110
Tyr Phe Cys Ser Ala Leu Ser Asn Ser Ile Met Tyr Phe Ser His Phe
115 120 125
Val Pro Val Phe Leu Pro Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg
130 135 140
Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg
145 150 155 160
Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly
165 170 175
Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr
180 185 190
Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Asn His
195 200 205
Arg Asn Arg Arg Arg Val Cys Lys Cys Pro Arg Pro Val Val Lys Ser
210 215 220
Gly Asp Lys Pro Ser Leu Ser Ala Arg Tyr Val
225 230 235
<210> 369
<211> 491
<212> PRT
<213> Artificial sequence
<220>
<223> anti-CD 123-C5 CAR
<400> 369
Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu
1 5 10 15
His Ala Ala Arg Pro Asn Phe Met Leu Thr Gln Pro His Ser Val Ser
20 25 30
Glu Ser Pro Gly Lys Thr Val Thr Leu Ser Cys Thr Arg Ser Ser Gly
35 40 45
Ser Ile Ala Gly Ser Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser
50 55 60
Ser Pro Thr Thr Val Ile Phe Gln Asp Asn Gln Arg Pro Ser Gly Val
65 70 75 80
Pro Asp Arg Phe Ser Gly Ser Ile Asp Lys Ser Ser Asn Ser Ala Ser
85 90 95
Leu Thr Ile Ser Gly Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys
100 105 110
Gln Ser Tyr Asp Ser Asn Asn Gln Val Phe Gly Gly Gly Thr Lys Leu
115 120 125
Thr Val Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
130 135 140
Gly Ser Glu Val His Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro
145 150 155 160
Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly
165 170 175
Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
180 185 190
Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Arg Thr Gly Tyr Ala Asp
195 200 205
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser
210 215 220
Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr
225 230 235 240
Tyr Cys Ala Arg Ala Arg Gly Ser Gly Ser Tyr Phe Gly Tyr Met Asp
245 250 255
Val Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser Thr Thr Thr Pro
260 265 270
Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu
275 280 285
Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His
290 295 300
Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu
305 310 315 320
Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr
325 330 335
Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe
340 345 350
Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg
355 360 365
Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser
370 375 380
Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr
385 390 395 400
Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys
405 410 415
Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn
420 425 430
Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu
435 440 445
Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly
450 455 460
His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr
465 470 475 480
Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg
485 490
<210> 372
<211> 1476
<212> DNA
<213> Artificial sequence
<220>
<223> anti-CD 123-C5 CAR
<400> 372
atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60
ccgaatttta tgctgactca gccccactct gtgtcggagt ctccggggaa gaccgtgacc 120
ctctcctgca cccgcagcag tggcagcatt gccggcagct atgtgcagtg gtaccagcag 180
cgcccgggca gttcccccac cactgttatc tttcaggata accaaaggcc ctctggggtc 240
cctgatcggt tctctggctc catcgacaag tcctccaact ctgcctccct caccatctct 300
ggactgaaga ctgaggacga ggctgactac tattgtcagt cttatgatag caacaatcag 360
gtgttcggcg gagggaccaa gctgaccgtc ctaggtggtg gtggttctgg cggcggcggc 420
tccggaggtg gtggatccga ggtgcatctg gtggagtctg ggggaggtgt ggtacggccg 480
ggggggtccc tgagactctc ctgtgcagcc tctggattca cctttggtga ttatggcatg 540
agctgggtcc gccaagctcc agggaagggg ctggagtggg tctctggtat taattggaat 600
ggtggtagaa caggttatgc agactctgtg aagggccgat tcaccatctc cagagacaac 660
gccaagaact ccctgtatct gcaaatgaac agtctgagag ccgaggacac ggccttgtat 720
tactgtgcga gagcccgagg ttcggggagt tacttcggct acatggacgt ctggggcaaa 780
gggaccacgg tcactgtctc ctcaaccacg acgccagcgc cgcgaccacc aacaccggcg 840
cccaccatcg cgtcgcagcc cctgtccctg cgcccagagg cgtgccggcc agcggcgggg 900
ggcgcagtgc acacgagggg gctggacttc gcctgtgata tctacatctg ggcgcccttg 960
gccgggactt gtggggtcct tctcctgtca ctggttatca ccctttactg caaacggggc 1020
agaaagaaac tcctgtatat attcaaacaa ccatttatga gaccagtaca aactactcaa 1080
gaggaagatg gctgtagctg ccgatttcca gaagaagaag aaggaggatg tgaactgaga 1140
gtgaagttca gcaggagcgc agacgccccc gcgtacaagc agggccagaa ccagctctat 1200
aacgagctca atctaggacg aagagaggag tacgacgttt tggacaagag acgtggccgg 1260
gaccctgaga tggggggaaa gccgagaagg aagaaccctc aggaaggcct gtacaatgaa 1320
ctgcagaaag ataagatggc ggaggcctac agtgagattg ggatgaaagg cgagcgccgg 1380
aggggcaagg ggcacgatgg cctttaccag ggtctcagta cagccaccaa ggacacctac 1440
gacgcccttc acatgcaggc cctgccccct cgctaa 1476
<210> 379
<211> 247
<212> PRT
<213> Artificial sequence
<220>
<223> scFv:C5
<400> 379
Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys
1 5 10 15
Thr Val Thr Leu Ser Cys Thr Arg Ser Ser Gly Ser Ile Ala Gly Ser
20 25 30
Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val
35 40 45
Ile Phe Gln Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser
50 55 60
Gly Ser Ile Asp Lys Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly
65 70 75 80
Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser
85 90 95
Asn Asn Gln Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gly
100 105 110
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val His
115 120 125
Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly Ser Leu Arg
130 135 140
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Asp Tyr Gly Met Ser
145 150 155 160
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Gly Ile
165 170 175
Asn Trp Asn Gly Gly Arg Thr Gly Tyr Ala Asp Ser Val Lys Gly Arg
180 185 190
Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met
195 200 205
Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys Ala Arg Ala
210 215 220
Arg Gly Ser Gly Ser Tyr Phe Gly Tyr Met Asp Val Trp Gly Lys Gly
225 230 235 240
Thr Thr Val Thr Val Ser Ser
245
<210> 410
<211> 5
<212> PRT
<213> Artificial sequence
<220>
<223> linker
<220>
<221> repetition
<222> (1)..(5)
<223> (GGGGS)n, n=1, 2, 3, 4, or 5
<400> 410
Gly Gly Gly Gly Ser
1 5
<210> 411
<211> 5
<212> PRT
<213> Artificial sequence
<220>
<223> linker
<220>
<221> repetition
<222> (1)..(5)
<223> (EAAAK)n, n=1, 2, 3, 4, or 5
<400> 411
Glu Ala Ala Ala Lys
1 5
<210> 412
<211> 3
<212> PRT
<213> Artificial sequence
<220>
<223> linker
<220>
<221> repetition
<222> (1)..(2)
<223> (PA)nP, n=1, 2,3, 4,or 5
<400> 412
Pro Ala Pro
1
<210> 413
<211> 5
<212> PRT
<213> Artificial sequence
<220>
<223> linker
<400> 413
Gly Gly Gly Gly Ser
1 5

Claims (43)

1. An antibody or antigen-binding fragment thereof that specifically binds to CD123, comprising:
(a) a light chain variable region (VL) comprising light chain CDR1(VL CDR1) having the amino acid sequence set forth in SEQ ID NO: 23; a light chain CDR2(VL CDR2) having the amino acid sequence shown by SEQ ID NO: 50; and a light chain CDR3(VL CDR3) having the amino acid sequence set forth in SEQ ID NO: 82; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs; and/or
(b) A heavy chain variable region (VH) comprising heavy chain CDR1(VH CDR1) having the amino acid sequence set forth in SEQ ID NO: 99; heavy chain CDR2(VH CDR2) having the amino acid sequence shown by SEQ ID NO: 129; and a heavy chain CDR3(VH CDR3) having the amino acid sequence set forth in SEQ ID NO: 157; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.
2. The antibody or antigen-binding fragment of claim 1, comprising a VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3, wherein (a) the VL CDR1, CDR2, and CDR3 have SEQ ID NOs: 23. 50 and 82; and (b) the VH CDR1, CDR2, and CDR3 have SEQ ID NOs: 99. 129 and 157.
3. An antibody or antigen-binding fragment that specifically binds to CD123, comprising: (a) a light chain variable region (VL) that is substantially identical to the light chain variable region (VL) represented by SEQ ID NO: 168 has at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity; and/or (b) a heavy chain variable region (VH) that is substantially identical to the VH consisting of SEQ ID NO: 203 has at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity.
4. The antibody or antigen-binding fragment of claim 3, comprising a VL and a VH, wherein the VL and VH have SEQ ID NOs: 168 and SEQ ID NO: 203, and a pharmaceutically acceptable salt thereof.
5. An antibody or antigen-binding fragment that specifically binds to CD123, comprising: (a) a light chain variable region (VL) comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 being derived from a light chain variable region having a sequence defined by SEQ ID NO: 168, VL of an amino acid sequence set forth in seq id no; and/or, (b) a heavy chain variable region (VH) comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a polypeptide having the amino acid sequence set forth in SEQ ID NO: 203, or a VH of the amino acid sequence shown in 203.
6. An antibody or antigen-binding fragment thereof that competes for binding to CD123 with the antibody or antigen-binding fragment of claim 1.
7. The antibody or antigen-binding fragment of claim 1, which is a monoclonal antibody or antigen-binding fragment.
8. The antibody or antigen-binding fragment of claim 1, which is a bispecific antibody or a multispecific antibody.
9. The antibody or antigen-binding fragment of claim 8, which is a bispecific T cell engager (BiTE).
10. The antibody or antigen binding fragment of claim 1, selected from the group consisting of an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, and an IgG4 antibody.
11. The antibody or antigen binding fragment of claim 1, which is selected from the group consisting of Fab, Fab ', F (ab') 2 、Fv、scFv、(scFv) 2 Single domain antibodies (sdabs) and heavy chain antibodies (hcabs).
12. The antibody or antigen-binding fragment of claim 11, which is an scFv.
13. The antibody or antigen-binding fragment of claim 1, which is a chimeric antibody or antigen-binding fragment, a humanized antibody or antigen-binding fragment, or a human antibody or antigen-binding fragment.
14. The antibody or antigen-binding fragment of claim 13, which is a human antibody or antigen-binding fragment.
15. A polynucleotide encoding the antibody or antigen-binding fragment of any one of claims 1-14.
16. The polynucleotide of claim 15 which is messenger rna (mrna).
17. A vector comprising the polynucleotide of claim 15.
18. A host cell comprising the polynucleotide of claim 15.
19. A Chimeric Antigen Receptor (CAR) that specifically binds CD123, comprising from N-terminus to C-terminus: (a) a CD123 binding domain comprising the antibody or antigen-binding fragment of claim 1; (b) a transmembrane domain; and (c) a cytoplasmic domain.
20. The CAR of claim 19, wherein the transmembrane domain is derived from CD8, CD28, CD3 ζ, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, BTLA, TCR α chain, TCR β chain, or TCR ζ chain, CD3 epsilon, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, or CD 154.
21. The CAR of claim 19, the transmembrane domain comprises a CD8 transmembrane region or a CD28 transmembrane region.
22. The CAR of claim 19, wherein the cytoplasmic domain comprises a signaling domain derived from CD3 ζ, FcR γ, fcyriia, FcR β, CD3 γ, CD3 δ, CD3 ∈, CD5, CD22, CD79a, CD79b, DAP10, DAP12, or any combination thereof.
23. The CAR of claim 22, wherein the cytoplasmic domain further comprises a co-stimulatory domain derived from CD28, 4-1BB (CD137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, GITR, TLR, DR3, CD43, or any combination thereof.
24. The CAR of claim 19, wherein the cytoplasmic domain comprises a CD3 signaling domain and a 4-1BB co-stimulatory domain.
25. The CAR of claim 19, wherein the cytoplasmic domain comprises a CD3 signaling domain and a CD28 co-stimulatory domain.
26. The CAR of claim 19, further comprising a CD8 hinge, the CD8 hinge being located between the antibody or antigen-binding fragment and the transmembrane domain.
27. A CAR that specifically binds CD123, comprising a sequence consisting of SEQ ID NO: 369.
28. A polynucleotide encoding the CAR of any one of claims 19-27.
29. The polynucleotide of claim 28 which is messenger rna (mrna).
30. A vector comprising the polynucleotide of claim 28.
31. A cell comprising the polynucleotide of claim 28.
32. The cell of claim 31, which is an immune effector cell.
33. The cell of claim 32, which is derived from a cell isolated from peripheral blood or bone marrow.
34. The cell of any one of claims 31, which is a T cell or NK cell.
35. A cell population comprising the cells of claim 31, wherein the cell population is derived from Peripheral Blood Mononuclear Cells (PBMCs), Peripheral Blood Lymphocytes (PBLs), Tumor Infiltrating Lymphocytes (TILs), cytokine-induced killer Cells (CIKs), lymphokine-activated killer cells (LAKs), or bone marrow infiltrating lymphocytes (mls).
36. A pharmaceutical composition comprising a therapeutically effective amount of the antibody or antigen-binding fragment of any one of claims 1-14, and a pharmaceutically acceptable carrier.
37. A pharmaceutical composition comprising a therapeutically effective amount of the cell or population of cells of any one of claims 31-35, and a pharmaceutically acceptable carrier.
38. Use of the antibody or antigen-binding fragment of any one of claims 1-14, or the cell or cell population thereof of any one of claims 31-35, in the manufacture of a medicament for the treatment of cancer.
39. The use of claim 38, wherein the antibody or antigen-binding fragment, cell, or population of cells is used in conjunction with an additional therapy.
40. The use of claim 38, wherein the cancer is AML expressing CD 123.
41. A method of making a cell capable of expressing a CAR that specifically binds CD123, comprising transferring the polynucleotide of claim 28 to the cell.
42. The method of claim 41, wherein the polynucleotide is transferred by electroporation.
43. The method of claim 41, wherein the cell is selected from the group consisting of a T cell, an NK cell, an NKT cell, a macrophage, a neutrophil, and a granulocyte.
CN202210605703.1A 2021-08-16 2021-08-16 Antibodies targeting CD123, chimeric antigen receptors and uses thereof Pending CN114933654A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210605703.1A CN114933654A (en) 2021-08-16 2021-08-16 Antibodies targeting CD123, chimeric antigen receptors and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202180005561.9A CN116018351A (en) 2021-08-16 2021-08-16 CD 123-targeting antibodies, chimeric antigen receptors and uses thereof
CN202210605703.1A CN114933654A (en) 2021-08-16 2021-08-16 Antibodies targeting CD123, chimeric antigen receptors and uses thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN202180005561.9A Division CN116018351A (en) 2021-08-16 2021-08-16 CD 123-targeting antibodies, chimeric antigen receptors and uses thereof

Publications (1)

Publication Number Publication Date
CN114933654A true CN114933654A (en) 2022-08-23

Family

ID=82898723

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210605703.1A Pending CN114933654A (en) 2021-08-16 2021-08-16 Antibodies targeting CD123, chimeric antigen receptors and uses thereof

Country Status (1)

Country Link
CN (1) CN114933654A (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014130635A1 (en) * 2013-02-20 2014-08-28 Novartis Ag Effective targeting of primary human leukemia using anti-cd123 chimeric antigen receptor engineered t cells
CA2958553A1 (en) * 2014-08-19 2016-02-25 Novartis Ag Anti-cd123 chimeric antigen receptor (car) for use in cancer treatment
CN107840889A (en) * 2016-09-19 2018-03-27 上海吉倍生物技术有限公司 The anti-CD123 antibody of high-affinity and its application
CN108530536A (en) * 2018-03-27 2018-09-14 刘爽 CART-CD123 and its preparation and application
CN109810195A (en) * 2018-11-27 2019-05-28 中国医学科学院血液病医院（血液学研究所） A kind of anti-human CD123 monoclonal antibody of mouse and application
CN111171155A (en) * 2020-02-05 2020-05-19 北京智仁美博生物科技有限公司 anti-CD 3 and CD123 bispecific antibodies and uses thereof

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014130635A1 (en) * 2013-02-20 2014-08-28 Novartis Ag Effective targeting of primary human leukemia using anti-cd123 chimeric antigen receptor engineered t cells
CA2958553A1 (en) * 2014-08-19 2016-02-25 Novartis Ag Anti-cd123 chimeric antigen receptor (car) for use in cancer treatment
CN107840889A (en) * 2016-09-19 2018-03-27 上海吉倍生物技术有限公司 The anti-CD123 antibody of high-affinity and its application
CN108530536A (en) * 2018-03-27 2018-09-14 刘爽 CART-CD123 and its preparation and application
CN109810195A (en) * 2018-11-27 2019-05-28 中国医学科学院血液病医院（血液学研究所） A kind of anti-human CD123 monoclonal antibody of mouse and application
CN111171155A (en) * 2020-02-05 2020-05-19 北京智仁美博生物科技有限公司 anti-CD 3 and CD123 bispecific antibodies and uses thereof
CN111349163A (en) * 2020-02-05 2020-06-30 北京智仁美博生物科技有限公司 Monoclonal antibodies against CD123

Similar Documents

Publication Publication Date Title
JP7134204B2 (en) Chimeric receptors and methods of use thereof
KR20200130709A (en) Prostate-specific membrane antigen CAR and methods of use thereof
KR20190065999A (en) Chimeric antigen receptors targeting BCMA and methods for their use
KR20170057298A (en) Antibodies and chimeric antigen receptors specific for cd19
KR20180133252A (en) Chimeric and T cell receptors and methods of use
US20210038646A1 (en) Chimeric antigen receptors targeting the tumor microenvironment
CN115052902B (en) Lymphocyte-antigen presenting cell costimulatory factor and application thereof
KR20170128234A (en) Antibodies specific for ROR1 and chimeric antigen receptors
CN112639102A (en) Anti-mesothelin Chimeric Antigen Receptor (CAR) constructs and uses thereof
KR20210138574A (en) DLL3 Targeting Chimeric Antigen Receptor and Binding Agent
CN113412117A (en) Chimeric antigens and T cell receptors and methods of use
US20090202544A1 (en) Methods of Treating Diseases by Targeting Silt3
KR20210089179A (en) Antibodies targeting CLL1 and applications thereof
JP7459046B2 (en) Chimeric receptors for STEAP1 and methods of use thereof
EP3498293A1 (en) Treatment of monogenic diseases with an anti-cd45rc antibody
CN113195542A (en) CD 30-binding moieties, chimeric antigen receptors, and uses thereof
US11897966B2 (en) Mesothelin-targetting antibodies, chimeric antigen receptors, and uses thereof
CN115322257B (en) BCMA targeting antibody, chimeric antigen receptor and application thereof
CN114933654A (en) Antibodies targeting CD123, chimeric antigen receptors and uses thereof
WO2023019396A1 (en) Mesothelin-targetting antibodies, chimeric antigen receptors, and uses thereof
WO2023020471A1 (en) Cd123-targetting antibodies and uses thereof in cancer therapies
WO2023019393A1 (en) Cd123-targetting antibodies, chimeric antigen receptors, and uses thereof
US20230159651A1 (en) Bcma targetting antibodies, chimeric antigen receptors, and uses thereof
WO2023019398A1 (en) Bcma targetting antibodies, chimeric antigen receptors, and uses thereof
WO2023020475A1 (en) Cd40-targetting antibodies and uses thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination