CN114921584A - Primer and rapid detection method for detection of FCR disease resistance gene - Google Patents

Abstract

The present invention provides a primer for detecting FCR disease resistance gene and a rapid detection method. The primers include an upstream primer InFrl-F and a downstream primer InFrl-R, wherein the sequence of the upstream primer InFrl-F is CAAGTGAAGTTAAAAATGCTAAT, and the sequence of the downstream primer InFrl-F is CAAGTGAAGTTAAAAATGCTAAT. The sequence is AACTCCAAATGTAGTACGCTTAC, which amplified a fragment size of 177 bp in resistant varieties and a 243 bp fragment in susceptible varieties. The sequence of the tomato resistance gene Frl-related marker in the present invention is an Indel marker with smaller fragment and stronger polymorphism developed on the basis of the reported SCAR _Frl primer sequence, which has strong specificity and high accuracy. Features.

Description

Primer and rapid detection method for detection of FCR disease resistance gene

technical field

The invention belongs to the technical field of agricultural biotechnology, and in particular relates to a rapid detection of the disease resistance gene FCR of tomato root cap and root rot based on different electrophoresis media, which has important practical significance for the rapid detection of diseases caused by tomato root cap and root rot in agricultural production. value.

Background technique

Tomato root crown and root rot (Fusarium crown and root rot, FCR for short) is an important disease caused by Fusarium oxysporum f.sp.radicis-lycopersici (FORL) of soil-borne diseases. Tomato root-cap root rot mainly damages the roots of tomato plants. The main symptoms are obvious dark brown lesions at the junction of soil and tomato plants. The leaflets of stems and leaves are discolored, the leaf margins are dehydrated, and then the leaves are brown and dry; when the disease is severe, the diseased roots are obviously swollen and thickened, the vascular bundles of the stems are brown lesions, the stems appear hollow and dead, and the roots gradually turn brown and rot. The disease was first identified in Japan in 1974, followed in 1976 in California, USA, and then broke out in many countries and caused major losses in tomato production (Yamamoto et al., 1974). The disease has been reported in Jiangsu, Shandong, Liaoning and other places in my country, and the incidence is increasing year by year (Geng Lihua et al., 2012).

Tomato root, cap and root rot is a fungal disease. The pathogen can survive in the soil for a long time, up to 6 years. Therefore, continuous cropping of tomato will lead to the accumulation of fungi in the soil for a long time, and gradually increase the damage to crops. bring great economic losses. At present, there is no effective chemical control method for tomato root-cap root rot on the market. Therefore, breeding new varieties resistant to tomato root-cap root rot is the most scientific and effective method to control the disease. Studies have shown that the resistance gene of tomato root, cap and root rot is controlled by a single dominant gene Frl, and the three resistance materials carry the same Frl allele, and the disease resistance gene Frl has been located in 9. On chromosome number, Vakalounakis et al. (1997) showed that the disease resistance genes Frl and Tm-2 are closely linked. Fazio et al. (1999) combined different resistance materials and near-isogenic lines to develop 3 genes with tomato root cap root rot. RAPD molecular markers linked to disease resistance genes (UBC-116, 194 and 655), although UBC-116 was converted into a co-dominant SCAR marker, because the distance between this marker and the resistance gene Frl was 7 cm, the Markers cannot be used for resistance assessment (Truong et al., 2011). In 2014, Staniaszek et al. developed the CAPS marker C2-25 from the conserved sequence site C2_At2g38025, which is about 3 cm away from the disease resistance gene Frl in the F2 population, but the CAPS marker requires enzyme cleavage, the cost is high, the experimental procedure is cumbersome, and the detection efficiency is low (Staniaszek et al. et al., 2014). Nedim et al. crossed the resistant material "Fla.7781" against tomato root-cap root rot and the susceptible material "B560", and F1 was self-crossed and backcrossed to "B560" to generate segregated F2 and BC1 populations, and developed a total of The dominant SCAR marker SCAR _Frl , but the detection efficiency of this marker is not high, and the bands of 950bp and 1000bp were amplified in resistant and susceptible varieties, respectively.

To sum up, so far, there is a lack of molecular markers that can effectively identify the Frl gene in tomato breeding, which restricts the breeding process of tomato root cap rot and root rot resistant varieties. Although the SCAR _Frl marker can also detect whether it is resistant to root cap and root rot, its amplified fragment is too large, and the difference between the resistant materials is small and difficult to distinguish. Therefore, a molecular marker of the Frl gene with high polymorphism, easy operation and short fragment was developed. It is of great significance for the selection and breeding of excellent tomato varieties resistant to root, cap and root rot.

SUMMARY OF THE INVENTION

The present invention uses the tomato backbone strain independently selected and bred by Jiangsu Lvgang Modern Agriculture Development Co., Ltd. as the test material, and uses the reported primer SCAR _Frl related to the disease resistance gene (Frl) of tomato root cap and root rot to carry out PCR amplification, agarose The PCR product was cloned and sequenced by gel electrophoresis, and the high-efficiency marker InFrl linked to the tomato root-cap root rot resistance gene was designed using the software Primer 5. The purpose of the present invention is to design more specific primers according to the conserved sequence of the reported tomato root rot resistance gene Frl, to detect the tomato root rot resistance gene (Frl) more accurately and efficiently. The primer fragment Short, high polymorphism, can be used for both agarose gel electrophoresis detection and polyacrylamide gel electrophoresis detection, and has higher amplification efficiency and better specificity.

The technical scheme adopted in the present invention:

A primer for detecting FCR disease resistance gene, the primers include an upstream primer InFrl-F and a downstream primer InFrl-R, wherein the sequence of the upstream primer InFrl-F is CAAGTGAAGTTAAAAATGCTAAT, and the sequence of the downstream primer InFrl-F is AACTCCAAATGTAGTACGCTTAC.

A method for rapidly detecting FCR disease resistance gene using above-mentioned primers, comprising the following steps:

(1) Extracting the leaf genomic DNA of tomato root-cap root rot resistant material;

(2) using the primer of claim 1 to carry out PCR amplification to the tomato material extracted in step (1);

(3) Perform 2% agarose gel electrophoresis and 8% polyacrylamide gel electrophoresis on the amplified product in step (2), respectively, for color development and staining.

(4) Judging according to the result of step (3).

Further, in the step (1), the genomic DNA of tomato leaves is extracted by using a modified CTAB method.

Further, the reaction system used for PCR amplification in the step (2) is a 20 μL system, wherein 1 μL of tomato leaf genomic DNA is extracted, 0.2 μL of dNTP (10 mM), 2 μL of 10*Buffer (Mg+), 0.4 of Taq enzyme, The forward and reverse primers were 1 μL each, and sterilized ultrapure water was added to make up to 20 μL; the reaction procedure for PCR amplification was: 94°C pre-denaturation for 2 min; then 35 cycles were performed, each cycle included denaturation at 94°C for 30s, annealing at 58°C for 30s, Extend at 72°C for 45s; the final extension is 2min, and store at 4°C.

Further, in the step (4), a fragment size of 177 bp is amplified in the disease-resistant variety, and the nucleotide sequence table thereof is shown in SEQ ID NO. 5, and a fragment of 243 bp is amplified in the susceptible variety, Its nucleotide sequence table is shown in SEQ ID NO.6.

Beneficial effects of the present invention:

1. The sequence of the tomato resistance gene Frl related marker in the present invention is an Indel marker with a smaller fragment and stronger polymorphism developed on the basis of the reported SCAR _Fr1 primer sequence, and it has strong specificity and high accuracy. high characteristic.

2. Using the primers and methods for markers related to tomato resistance genes of the present invention, it is possible to detect whether the tomato material has the resistance gene Frl of tomato root, cap and root rot.

3. The primers and method of the tomato disease resistance gene-related marker of the present invention, the PCR product can be detected by polyacrylamide gel electrophoresis or agarose gel electrophoresis, and the amplification band pattern is clear and the accuracy is better. high.

4. The present invention avoids that traditional tomato breeding mainly depends on the performance selection of plants. Various factors such as environmental conditions, intergene interactions, genotype and environment interactions will affect the phenotype selection efficiency, greatly shorten the identification time, and improve the identification accuracy. It has strong commercial application value.

Description of drawings

Figure 1-2 shows the agarose gel electrophoresis images of 48 tomato materials amplified with the reported tomato root-cap root rot resistance gene (Frl) related marker SCAR _Frl , wherein the sequence fragment size of the susceptible materials is 1000bp, The size of the sequence fragment of the disease-resistant material is 950bp.

Figure 3 shows the polyacrylamide gel electrophoresis images of 48 tomato materials amplified with the tomato root-cap root rot resistance gene (Frl)-related marker InFrl developed in this paper, wherein the sequence fragment size of the susceptible materials is 243 bp and the disease resistance The size of the material sequence fragment is 177bp.

Figures 4-5 show the agarose gel electrophoresis images of 48 tomato materials amplified with the tomato root-cap root rot resistance gene (Frl)-related marker InFrl developed in this paper, wherein the size of the sequence fragment of the susceptible material is 243 bp, The size of the sequence fragment of the disease-resistant material is 177bp.

Detailed ways

The high-efficiency marker InFrl-F/InFrl-R of the tomato root-cap root rot resistance gene (Frl) of the invention is characterized in that a fragment size of 177 bp is amplified in the disease-resistant variety, and its nucleotide sequence is The list is shown in SEQ ID NO.5, and a fragment of 243 bp was amplified from the susceptible variety, and its nucleotide sequence list is shown in SEQ ID NO.6.

The above-mentioned tomato root cap root rot resistance gene (Frl) related marker primer sequence is:

SCARFrl-F: CACATTCATCATCTGTTTTTAGTCTATTC (SEQ ID NO. 1)

SCARFrl-R: CACAATCGTTGGCCATTGAATGAAGAAC (SEQ ID NO. 2)

InFrl-F: CAAGTGAAGTTAAAAATGCTAAT (SEQ ID NO. 3)

InFrl-R: AACTCCAAATGTAGTACGCTTAC (SEQ ID NO. 4)

The method for the development of InDel marker primer sequences related to the resistance gene of tomato root cap root rot disease includes the following steps:

(1) Extracting the leaf genomic DNA of the resistant/susceptible parent material of tomato root cap root rot, and selecting 12 materials each;

(2) PCR-amplifying the leaf genomic DNA of the tomato resistant/susceptible material extracted in step (1) by using the reported tomato root-cap root rot resistance gene marker Frl-related marker SCAR _Frl ;

(3) performing 2% agarose gel electrophoresis on the PCR amplification product of step (2);

(4) cloning and sequencing the electrophoresis product of the resistant tomato material in step (3);

(5) using the software Primer5 to design primers for the sequencing results of the tomato resistant material in step (4);

(6) Extracting the leaf genomic DNA of 48 tomato root cap root rot resistant materials;

(7) PCR amplification was performed on the 48 tomato materials extracted in step (6) using the reported primer SCAR _Frl .

(8) PCR amplification was performed on the 48 tomato materials extracted in step (6) using the primer InFrl developed by our company.

(9) Perform 2% agarose gel electrophoresis on the PCR product of the primer SCAR _Frl in step (7); perform 2% agarose gel electrophoresis and 8% polypropylene on the PCR product of the primer InFrl in step (8), respectively Amide gel electrophoresis, color development and staining;

(10) Compare and analyze the electrophoresis results in step (9).

In the steps (1) and (6), the genomic DNA of tomato leaves is extracted by the improved CTAB method:

①Put 30mg of fresh leaves into a 2ml centrifuge tube, add a steel ball with a diameter of 4mm, close the lid tightly, put it in liquid nitrogen for 60s, and then grind the sample with a tissue grinder;

②Add 600μl of 2% CTAB extract to the ground sample, bathe at 55°C for 20min, shake every 5min;

③ Centrifuge at 12,000 rpm for 5 min, suck 350 μl of supernatant into a clean 1.5 ml centrifuge tube, add 250 μl of chloroform and isoamyl alcohol mixture, and mix thoroughly; the volume ratio of chloroform and isoamyl alcohol in the mixture of chloroform and isoamyl alcohol is 24:1 ;

④ Centrifuge at 13000rpm for 2min, take 250μl of supernatant into another 1.5ml centrifuge tube, add 550μl of absolute ethanol, put it in -20 ℃ refrigerator for 2 hours; absolute ethanol is pre-cooled at -20 ℃ in advance;

⑤ Centrifuge at 12,000 rpm for 10 minutes, discard the supernatant, and place at room temperature;

⑥ When there is no alcohol smell in the centrifuge tube, add 100μl ddH2O to dissolve the DNA; put it in a 4°C refrigerator;

The reaction system used in the PCR amplification in the step (2) is a 25 μL system, in which 2 μL of the extracted tomato leaf genomic DNA, 12.5 μL of 2*Taq MasterMix (Dye), 1 μL of each of the forward and reverse primers, and sterilized ultra-pure water to 25 μL;

The reaction procedure during PCR amplification in the steps (2) and (7) is: pre-denaturation at 94°C for 2 min; then 35 cycles are performed, each cycle including denaturation at 94°C for 30s, annealing at 58°C for 30s, and extension at 72°C for 45s; The final extension was 2 min and stored at 4°C.

During the electrophoresis detection in the step (3), electrophoresis is performed on a 2% agarose gel with 10 μl of red gel added, the electrophoresis buffer is 1*TAE buffer, and the voltage is 150v. After electrophoresis, observe the electrophoresis band in a gel imaging analyzer, analyze the size of the DNA electrophoresis band at a wavelength of 365 nm, scan the image and save it.

In the step (4), the PCR product of the anti/susceptible tomato material in step (3) was excised under an ultraviolet lamp to cut the agarose block containing the target DNA, and the PCR product was purified and recovered with a PCR product purification kit. The 19-T vector was ligated, and the ligated product was transformed into E. coli DH5α competent cells. The positive clones were screened, and the PCR method was used to identify whether they contained foreign target inserts. The transformants containing the target DNA were sequenced. The sequencing work was completed by Hangzhou Shangyase Biotechnology Co., Ltd.

In the step (5), according to the primer sequence sequenced in the step (4), the primer sequence size is controlled between 90bp-300bp using Primer5 software.

The method of step (6) is as in step (1).

In the step (7), the reported primer SCARFr1 is used for PCR amplification, and the method is as described in the step (2);

In the step (8), the reaction system used for PCR amplification with the primer InFrl independently developed by our company is a 20 μL system, in which 1 μL of tomato leaf genomic DNA is extracted, 0.2 μL of dNTP (10 mM), and 2 μL of 10*Buffer (Mg+) , Taq enzyme 0.4, 1 μL each of forward and reverse primers, add sterilized ultrapure water to 20 μL; the reaction program during PCR amplification is: 94 °C pre-denaturation for 2 min; then 35 cycles, each cycle includes 94 °C denaturation for 30s, Annealed at 58°C for 30s, extended at 72°C for 45s; the final extension was 2min, and stored at 4°C.

The 2% agarose gel electrophoresis method in the step (9) is the same as the step (3), the amplified PCR is separated on 8% polyacrylamide gel electrophoresis, the electrophoresis buffer is 0.5*TBE buffer, and the voltage is 150V , The electrophoresis time is about 120min. After electrophoresis, it is first dyed in silver nitrate solution, then developed in sodium hydroxide solution with formaldehyde, rinsed with water, and then placed on a white light plate to take pictures for analysis and processing.

In step (10), agarose gel electrophoresis of the reported primers in step (9) and polyacrylamide gel electrophoresis of the primers developed in this paper are compared to the size of the anti-susceptible fragments. The anti-sense fragment of the primer is smaller than the reported primer fragment, and the band pattern is clearer, and the marker can also be used for agarose gel electrophoresis detection, with wider selectivity.

SEQ ID NO. 5:

caagtgaagttaaaaatgctaattttacccttgatcttaatttaaaatgatttatagcaaaacaaacattttcaaacctgtttcttatg aaaggaaaagtattgaaaaaagggtttattatacactgggaattgaacccaaatccacacctatagtaagcgtactacatttg gagtt

SEQ ID NO. 6:

caagtgaacttaaaaatgctaattttaccttgattttaattttaaaatgatttatatagcaaaacaaacatgacttatttcagatcac aagtttcaaaacctggtttttagtttcttaaactccgtgtccgtgtcaaaaggaaaagtattgaaaaaaggtttctttatacaatgg

(1) Materials and methods

1. Plant material

The study used 48 tomato backbone materials with known disease resistance (Table 1), which were provided by Jiangsu Lugang Modern Agriculture Development Company (Lugang for short). These varieties can be ordered from Jiangsu Lugang Modern Agriculture Development Company. Sowing, colonization and field management were carried out according to the experimental method of Green Harbor.

2. DNA extraction and detection

Using the modified CTAB method, tomato genomic DNA was extracted from fresh plant leaves about 21 days old. The steps are: ① Take 30 mg of fresh leaves into a 2 ml centrifuge tube, add a steel ball with a diameter of 4 mm, close the lid, put it in liquid nitrogen for 2 minutes, and then use a tissue grinder to grind the sample. ②Add 600μl CTAB to the ground sample (CTAB needs to be preheated in advance), and water bath at 55℃ for 15min. ③ Centrifuge at 12000 rpm for 5 min, draw 500 μl of supernatant into a clean 1.5 ml centrifuge tube, add 250 μl of chloroform:isoamyl alcohol (24:1), and mix well. ④ Centrifuge at 13000rpm for 90s, take 350μl of supernatant into another 1.5ml centrifuge tube, add 600μl of absolute ethanol (pre-cooled at -20°C in advance) and 60μl of ammonium acetate, mix well, and put in -20°C refrigerator for 1 hour. ⑤ Centrifuge at 13,000 rpm for 5 min, discard the supernatant, and place at room temperature. ⑥ When there is no alcohol smell in the centrifuge tube, add 100 μl ddH ₂ O to dissolve the DNA.

Electrophoresis and spectrophotometry detect DNA quality and concentration.

3. Primer Design

PCR amplification and agarose gel electrophoresis were carried out using the reported primer SCAR _Frl related to the disease resistance gene (Frl) of tomato root cap root rot, the PCR product was cloned and sequenced, and the tomato root cap was designed by the software Primer 5. Root rot resistance gene-linked high-efficiency marker InFrl. The marker amplified a 177bp fragment in resistant varieties and a 243bp fragment in susceptible varieties.

Forward primer sequence InFrl-F: 5'-CAAGTGAAGTTAAAAATGCTAAT-3'

Reverse primer sequence InFrl-R: 5'-AACTCCAAATGTAGTACGCTTAC-3'

4. PCR amplification and detection

(1) PCR amplification was performed on 48 tomato backbone materials using the reported primer SCARFrl on a LY96G Thermocycler ^TM amplifier from Huasheng Company, China. MasterMix (Dye) 12.5μL, forward and reverse primers 1μL each, add sterilized ultrapure water to 25μL. The reaction program for PCR amplification was: pre-denaturation at 94°C for 2 min; then 35 cycles were performed, each cycle included denaturation at 94°C for 30s, annealing at 58°C for 30s, and extension at 72°C for 45s; the final extension was 2min, and stored at 4°C. During electrophoresis detection, electrophoresis was performed on a 2% agarose gel with 10 μl of red gel added, the electrophoresis buffer was 1*TAE buffer, and the voltage was 150v. After electrophoresis, observe the electrophoresis band in a gel imaging analyzer, analyze the size of the DNA electrophoresis band at a wavelength of 365 nm, scan the image and save it.

(2) PCR amplification was carried out on 48 tomato backbone materials using the newly developed marker InFrl, which was carried out on the LY96G Thermocycler ^TM amplifying instrument of Huasheng Company in China,

Include 12.5 μL 2×Taq MasterMix, 1 μL DNA extract, 1 μL each of 10 μM forward and reverse primers, and 9.5 μL ddH2O. The reaction program was pre-denaturation at 94 °C for 2 min, [denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s], 35 cycles, extension at 72 °C for 2 min, and then the reaction was kept at 4 °C. PCR amplified fragments were separated on 8% polyacrylamide gel electrophoresis, silver stained, and visualized under white light.

(2) Results and Analysis

1. Detection and analysis of genomic DNA of selected materials

Using an ultra-trace UV-Vis spectrophotometer (DeNovix DS-11) to detect the concentration of genomic DNA from 48 tomato leaves extracted in this study, it was found that the concentration of the extracted DNA was higher than 100ng/μl, and the OD260/OD280 was basically between 1.8 and 1.8. 2.0. DNA of different concentrations was detected by 2% agarose electrophoresis, the electrophoresis was clear and bright, and there was no obvious tailing, indicating that the quality of the extracted DNA was good. Therefore, the extracted high-quality tomato leaf genomic DNA is suitable for biological tests of molecular markers such as PCR amplification and SSR.

2. PCR amplification and electrophoresis

(1) Apply the reported tomato root cap root rot marker SCARFrl-F:

CACATTCATCATCTGTTTTTAGTCTAT TC, SCARFrl-R:

CACAATCGTTGGCCATTGAATGAAGAAC PCR amplification was performed on 48 tomato backbone materials, and agarose gel electrophoresis was carried out for detection. The detection results are shown in Figure 1-2.

(2) applying the new marker InFrl-F of tomato root cap root rot of the present invention:

5'-CAAGTGAAGTTAAAAATGCTAAT-3', InFrl-R:

5'-AACTCCAAATGTAGTACGCTTAC-3' was used to amplify 48 tomato backbone materials by PCR, and the amplified products were detected by agarose gel electrophoresis and polyacrylamide gel electrophoresis respectively. The results are shown in Figure 3-4. It can be seen that a 243bp band is amplified in the susceptible variety, while a 177bp fragment is amplified in the disease resistant variety, and the detection results are completely consistent with the sequencing results.

Table 1. 48 Tomato Backbone Materials

Figure 1-5 is the detection of 48 tomato material root cap root rot resistance genes (Frl), it can be seen from Figure 1-2 that 36 susceptible tomato materials and 12 disease resistant materials were detected with the reported primer SCAR _Frl It can be seen from Figure 3-5 that 36 susceptible tomato materials and 12 disease resistant materials were detected with the primer InFrl developed in this paper.

It can be seen from the figure that the markers developed in this paper have the same detection results as the reported markers, and the markers developed in this paper have stronger polymorphism and clearer band patterns, which can be detected by agarose gel electrophoresis and polyacrylamide gel electrophoresis at the same time. The detection results are more accurate than the reported primer sequence results.

Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, and substitutions can be made in these embodiments without departing from the principle and spirit of the invention and modifications, the scope of the present invention is defined by the appended claims and their equivalents.

sequence listing

<110> Suqian Lvgang Modern Agriculture Research Institute Co., Ltd.

Jiangsu Lvgang Modern Agriculture Development Co., Ltd.

<120> Primers and rapid detection methods for detecting FCR disease resistance genes

<141> 2022-05-26

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 1

cacattcatc atctgttttt agtctattc 29

<210> 2

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 2

cacaatcgtt ggccattgaa tgaagaac 28

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 3

caagtgaagt taaaaatgct aat 23

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 4

aactccaaat gtagtacgct tac 23

<210> 5

<211> 177

<212> DNA

<213> Artificial Sequence

<400> 5

caagtgaagt taaaaatgct aattttaccc ttgatcttaa tttaaaatga tttatagcaa 60

aacaaacatt ttcaaacctg ttcttatga aaggaaaagt attgaaaaaa gggtttatta 120

tacactggga attgaaccca aatccacacc tatagtaagc gtactacatt tggagtt 177

<210> 6

<211> 243

<212> DNA

<213> Artificial Sequence

<400> 6

caagtgaact taaaaatgct aattttacct tgattttaat tttaaaatga tttatatagc 60

aaaacaaaca tgacttattt cagatcacaa gtttcaaaac ctggttttta gtttcttaaa 120

ctccgtgtcc gtgtcaaaag gaaaagtatt gaaaaaaggt ttcttataca atgggaattg 180

aacccaaatc cacacctatt gtttcgaaga ctctgagata gtaagcgtac tacatttcga 240

gtt 243

Claims (5)

1. a primer for detecting FCR disease resistance gene, is characterized in that, described primer comprises upstream primer InFrl-F and downstream primer InFrl-R, wherein the sequence of upstream primer InFrl-F is CAAGTGAAGTTAAAAATGCTAAT, the sequence of downstream primer InFrl-F is AACTCCAAATGTAGTACGCTTAC. 2. a method for adopting primers in claim 1 to rapidly detect FCR disease resistance gene, is characterized in that, comprises the following steps: (1) Extracting the leaf genomic DNA of tomato root-cap root rot resistant material; (2) using the primer of claim 1 to carry out PCR amplification to the tomato material extracted in step (1); (3) Perform 2% agarose gel electrophoresis and 8% polyacrylamide gel electrophoresis on the amplified product in step (2), respectively, for color development and staining. (4) Judging according to the result of step (3). 3 . The method for rapidly detecting FCR disease resistance genes according to claim 2 , wherein, in the step (1), the genomic DNA of tomato leaves is extracted by using a modified CTAB method. 4 . 4. the method for rapidly detecting FCR disease resistance gene according to claim 2, is characterized in that, the reaction system adopted when carrying out PCR amplification in described step (2) is 20 μL system, wherein extracts 1 μL of tomato leaf genomic DNA, dNTP (10mM) 0.2μL, 10*Buffer (Mg+) 2μL, Taq enzyme 0.4, forward and reverse primers 1μL each, add sterilized ultrapure water to 20μL; PCR amplification reaction program: 94 ℃ pre-denaturation for 2min; then Thirty-five cycles were performed, each including denaturation at 94°C for 30s, annealing at 58°C for 30s, and extension at 72°C for 45s; the final extension was 2min, and the cells were stored at 4°C. 5. the method for fast detection of FCR disease-resistant gene according to claim 2, is characterized in that, in described step (4), the fragment size of 177bp is amplified in disease-resistant variety, and its nucleotide sequence table is such as SEQ As shown in ID NO. 5, a fragment of 243 bp was amplified in the susceptible variety, and its nucleotide sequence table is shown in SEQ ID NO. 6.

Images