CN114921584A - Primer for detecting FCR disease-resistant gene and rapid detection method - Google Patents

Abstract

The invention provides a primer for detecting an FCR disease-resistant gene and a rapid detection method, wherein the primer comprises an upstream primer InFrl-F and a downstream primer InFrl-R, the sequence of the upstream primer InFrl-F is CAAGTGAAGTTAAAAATGCTAAT, the sequence of the downstream primer InFrl-F is AACTCCAAATGTAGTACGCTTAC, 177bp fragments are amplified in a disease-resistant variety, and 243bp fragments are amplified in a susceptible variety. The sequence of the related marker of the tomato resistance gene Frl in the invention is the SCAR reported _Frl The Indel marker with smaller fragment and stronger polymorphism developed on the basis of the primer sequence has the characteristics of strong specificity and high accuracy.

Description

Primer for detecting FCR disease-resistant gene and rapid detection method

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to rapid detection of tomato root cap root rot disease-resistant genes FCR based on different electrophoresis media, which has important practical value for rapid detection of diseases caused by tomato root cap root rot bacteria in agricultural production.

Background

The tomato root crown root rot (FCR) is an important soil-borne disease caused by Fusarium oxysporum tomato neck rot specialization type (FORL). The root crown and root rot of the tomato mainly damage the roots of tomato plants, and the main symptoms are that obvious dark brown disease spots exist at the joint of soil and the tomato plants; in the early stage of infection, the withered stems and leaves at the top end of the plant are so thin that the withered stems and leaves are not discolored, the leaf margin is dehydrated, and then the leaves are brown and dry; when the disease is serious, the diseased roots are obviously swollen and thickened, the vascular bundles of the stems are brown, the hollow stems die, and the roots gradually become brown and are rotten. The disease was first discovered in japan in 1974, and subsequently emerged in california in the united states in 1976, after which it erupted in many countries and caused significant losses to tomato production (Yamamoto et al, 1974). The disease is reported in Jiangsu, Shandong, Liaoning places and the like in China, and the disease incidence tends to increase year by year (Gunn Lihua and the like, 2012).

The tomato root crown root rot belongs to fungal diseases, and pathogenic bacteria can survive in soil for a long time which can reach 6 years, so that the continuous cropping of tomatoes can cause the fungi to accumulate in the soil for a long time, gradually aggravate the damage to crops and bring great economic loss to farmers. At present, no effective medicament control method for the tomato root crown and root rot exists in the market, so that the method for breeding a new variety for resisting the tomato root crown and root rot is the most scientific and effective method for controlling the disease. It has been shown that the resistance gene to root crown rot of tomato is controlled by a single dominant gene Frl, and that 3 resistant materials carry the same Frl allele, and that the disease resistance gene Frl has been mapped to chromosome 9, Vakalounakis et al (1997) studies showed that the disease resistance gene Frl is located on chromosome 9Due to the close linkage between Frl and Tm-2, Fazio et al (1999) developed, in combination with different resistant materials and near isogenic lines, 3 RAPD molecular markers (UBC-116, 194 and 655) linked to the tomato root crown rot resistance gene, which cannot be used for resistance evaluation because the marker is 7 cm away from the resistance gene Frl, although UBC-116 is converted to a co-dominant SCAR marker (Truong et al, 2011). In 2014, Staniaszek et al developed CAPS marker C2-25 from conserved sequence site C2_ At2g38025 about 3cm away from disease-resistant gene Frl in F2 population, but CAPS marker requires enzyme digestion, and has high cost, complicated experimental procedure and low detection efficiency (Staniaszek et al, 2014). Nedim et al developed a co-dominant SCAR marker SCAR using a cross of disease-resistant material "Fla.7781" and susceptible material "B560" for tomato root crown root rot, F1 selfing and backcrossing to "B560" to produce separate F2 and BC1 populations _Frl However, the detection efficiency of the marker is not high, and 950bp and 1000bp bands are respectively amplified in disease-resistant varieties and disease-susceptible varieties.

In conclusion, molecular markers capable of effectively identifying Frl genes are lacked in tomato breeding so far, and the breeding process of tomato root cap rot disease-resistant varieties is restricted. SCAR _Frl Although the marker can also detect whether the tomato resists root crown rot, the amplified fragment is too large, the difference of the anti-infection materials is small, and the differentiation is not easy, so that the development of the Frl gene molecular marker with high polymorphism, easy operation and short fragment has important significance for breeding excellent varieties of tomatoes resisting the root crown rot.

Disclosure of Invention

The invention takes the tomato bone dry product line independently bred by Jiangsu Lugang modern agriculture development Limited company as a test material, and uses the reported primer SCAR related to the disease resistance gene (Frl) of the root-crown root rot of tomato _Frl Carrying out PCR amplification and agarose gel electrophoresis, cloning and sequencing the PCR product, and designing a high-efficiency marker InFrl linked with the tomato root crown root rot resistance gene by using software Primer 5. The invention aims to design more specific primers according to the reported conserved sequence of the tomato root crown root rot disease-resistant gene Frl, detect the tomato root crown root rot disease-resistant gene (Frl) more accurately and efficiently, and realize the detection of the tomato root crown root rot disease-resistant gene (Frl)The primer fragment is short, the polymorphism is high, the primer fragment can be used for agarose gel electrophoresis detection and polyacrylamide gel electrophoresis detection, and the amplification efficiency is higher and the specificity is better.

The technical scheme adopted by the invention is as follows:

a primer for detecting an FCR disease-resistant gene comprises an upstream primer InFrl-F and a downstream primer InFrl-R, wherein the sequence of the upstream primer InFrl-F is CAAGTGAAGTTAAAAATGCTAAT, and the sequence of the downstream primer InFrl-F is AACTCCAAATGTAGTACGCTTAC.

A method for rapidly detecting FCR disease-resistant genes by adopting the primers comprises the following steps:

(1) extracting leaf genome DNA of the tomato root cap root rot disease resistant material;

(2) performing PCR amplification on the tomato material extracted in step (1) by using the primers of claim 1;

(3) and (3) respectively carrying out 2% agarose gel electrophoresis and 8% polyacrylamide gel electrophoresis on the product amplified in the step (2), and developing and dyeing.

(4) And (4) judging according to the result of the step (3).

Further, the genomic DNA of the tomato leaves extracted in the step (1) is extracted by adopting an improved CTAB method.

Further, the reaction system adopted in the PCR amplification in the step (2) is a 20-microliter system, wherein 1 microliter of tomato leaf genome DNA, 0.2 microliter of dNTP (10mM), 2 microliter of 10 × Buffer (Mg +) and 0.4 of Taq enzyme are extracted, 1 microliter of forward and reverse primers are added, and sterilized ultrapure water is added to 20 microliter; the reaction procedure during PCR amplification is as follows: pre-denaturation at 94 ℃ for 2 min; then 35 cycles were performed, each cycle consisting of denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 45 s; finally, the extension is carried out for 2min, and the mixture is stored at 4 ℃.

Furthermore, 177bp fragments are amplified in the disease-resistant variety in the step (4), the nucleotide sequence table of the fragments is shown as SEQ ID NO.5, and 243bp fragments are amplified in the disease-sensitive variety, and the nucleotide sequence table of the fragments is shown as SEQ ID NO. 6.

The invention has the beneficial effects that:

1. resistance of tomato in the inventionThe sequence of the related marker of the gene Frl is the SCAR reported _Frl The Indel marker with smaller fragment and stronger polymorphism developed on the basis of the primer sequence has the characteristics of strong specificity and high accuracy.

2. The primer and the method of the tomato resistance gene related marker can detect whether the tomato material has the anti-infection tomato root crown root rot gene Frl.

3. According to the primers and the method for the tomato disease-resistant gene related marker, the PCR product can be detected by polyacrylamide gel electrophoresis or agarose gel electrophoresis, the amplification band type is clear, and the accuracy is higher.

4. The method avoids the phenomenon that the traditional tomato breeding mainly depends on the expression selection of plants, and various factors such as environmental conditions, gene interaction, genotype and environment interaction can influence the phenotype selection efficiency, greatly shortens the identification time, improves the identification accuracy and has strong commercial application value.

Drawings

FIG. 1-2 shows the reported related marker SCAR of tomato root-crown root rot disease-resistant gene (Frl) _Frl And (3) an agarose gel electrophoresis picture of the amplified 48 parts of tomato materials, wherein the size of the sequence fragment of the disease-sensitive material is 1000bp, and the size of the sequence fragment of the disease-resistant material is 950 bp.

FIG. 3 shows polyacrylamide gel electrophoresis of 48 tomato material amplified with the related marker InFrl of tomato root crown root rot disease-resistant gene (Frl) developed herein, wherein the size of the sequence fragment of the disease-sensitive material is 243bp, and the size of the sequence fragment of the disease-resistant material is 177 bp.

FIGS. 4-5 show agarose gel electrophoresis images showing 48 parts of tomato material amplified using the tomato root crown rot disease resistance gene (Frl) related marker InFrl developed herein, wherein the size of the sequence fragment of the disease-sensitive material is 243bp, and the size of the sequence fragment of the disease-resistant material is 177 bp.

Detailed Description

The invention relates to a high-efficiency marker InFrl-F/InFrl-R of a tomato root cap root rot disease resistance gene (Frl), which is characterized in that: 177bp fragments are amplified in disease-resistant varieties, the nucleotide sequence table is shown as SEQ ID No.5, and 243bp fragments are amplified in disease-susceptible varieties, and the nucleotide sequence table is shown as SEQ ID No. 6.

The related marker primer sequence of the tomato root crown root rot disease resistance gene (Frl) is as follows:

SCARFrl-F：CACATTCATCATCTGTTTTTAGTCTATTC(SEQ ID NO.1)

SCARFrl-R：CACAATCGTTGGCCATTGAATGAAGAAC(SEQ ID NO.2)

InFrl-F:CAAGTGAAGTTAAAAATGCTAAT(SEQ ID NO.3)

InFrl-R:AACTCCAAATGTAGTACGCTTAC(SEQ ID NO.4)

the method for developing the related InDel marker primer sequence of the tomato root cap root rot disease-resistant gene comprises the following steps:

(1) extracting leaf genome DNA of an anti/susceptible parent material of the tomato root cap root rot, and selecting 12 parts of materials respectively;

(2) uses the reported disease-resistant gene mark Frl of tomato root crown root rot as the relative mark SCAR _Frl Carrying out PCR amplification on the leaf genome DNA of the tomato resistance/sensitivity material extracted in the step (1);

(3) carrying out 2% agarose gel electrophoresis on the PCR amplification product in the step (2);

(4) cloning and sequencing the electrophoresis product of the anti-infection tomato material obtained in the step (3);

(5) designing primers for sequencing results of the tomato anti-sense materials in the step (4) by using software Primer 5;

(6) extracting leaf genome DNA of 48 tomato root cap root rot disease resistant materials;

(7) SCAR using reported primers _Frl And (4) carrying out PCR amplification on the 48 tomato materials extracted in the step (6).

(8) The 48 tomato materials extracted in step (6) were subjected to PCR amplification using the primer InFrl developed by the same company.

(9) For the primer SCAR in the step (7) _Frl 2% agarose gel electrophoresis of the PCR product; respectively carrying out 2% agarose gel electrophoresis and 8% polyacrylamide gel electrophoresis on the PCR product of the primer InFrl in the step (8), and carrying out color development and dyeing;

(10) and (4) comparing and analyzing the electrophoresis result of the step (9).

Extracting the tomato leaf genome DNA in the steps (1) and (6) by adopting an improved CTAB method:

putting 30mg of fresh leaves into a 2ml centrifuge tube, adding a steel ball with the diameter of 4mm, covering a cover, putting the centrifuge tube into liquid nitrogen for 60s, and then grinding the sample by using a tissue grinder;

② adding 600 mul of 2 percent CTAB extracting solution into the ground sample, carrying out water bath at 55 ℃ for 20min, and shaking once every 5 min;

③ centrifuging at 12000rpm for 5min, sucking 350 mul of supernatant into a clean 1.5ml centrifuge tube, adding 250 mul of chloroform and isoamyl alcohol mixture, and fully mixing; the volume ratio of chloroform to isoamyl alcohol in the chloroform-isoamyl alcohol mixture is 24: 1;

fourthly, centrifuging for 2min at 13000rpm, taking 250 mu l of supernatant to another 1.5ml centrifuge tube, adding 550 mu l of absolute ethyl alcohol, and placing the centrifuge tube in a refrigerator with the temperature of 20 ℃ below zero for 2 h; pre-cooling absolute ethyl alcohol at-20 ℃ in advance;

fifthly, centrifuging at 12000rpm for 10 minutes, pouring off the supernatant, and standing at room temperature;

sixthly, when no alcohol smell exists in the centrifugal tube, 100 mu l of ddH2O is added to dissolve DNA; placing in a refrigerator at 4 ℃;

the reaction system adopted during PCR amplification in the step (2) is a 25 mu L system, wherein 2 mu L of extracted tomato leaf genome DNA, 12.5 mu L of 2-star Taq MasterMix (Dye) and 1 mu L of forward and reverse primers respectively are added with sterilized ultrapure water to 25 mu L;

the reaction procedures in the PCR amplification in the steps (2) and (7) are as follows: pre-denaturation at 94 ℃ for 2 min; then 35 cycles were performed, each cycle comprising denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 45 s; finally, the extension is carried out for 2min, and the mixture is stored at 4 ℃.

In the electrophoresis detection in the step (3), electrophoresis is performed on a 2% agarose gel to which 10. mu.l of red gel is added, and the electrophoresis buffer is 1X TAE buffer at a voltage of 150 v. And after the electrophoresis is finished, observing an electrophoresis band in a gel imaging analyzer, analyzing the size of the DNA electrophoresis band under the wavelength of 365nm, scanning an image and storing.

And (4) in the step (4), cutting the PCR product of the anti/sensitive tomato material in the step (3) into an agarose gel block containing the target DNA under an ultraviolet lamp, purifying and recovering the PCR product by using a PCR product purification kit, connecting the PCR product with a pMD-19-T vector, and transforming the connecting product into escherichia coli DH5 alpha competent cells. Screening positive clones, identifying whether the foreign target insert fragment is contained or not by a PCR method, sequencing transformants containing target DNA, and completing sequencing work by Hangzhou Shangsai Biotechnology Co.

And (5) controlling the size of the Primer sequence to be between 90bp and 300bp by using Primer5 software according to the Primer sequence sequenced in the step (4).

The step (6) method is as in step (1).

The PCR amplification is carried out in the step (7) by using the reported primer SCARFrl, and the method is as described in the step (2);

in the step (8), a reaction system adopted when primer InFrl which is independently developed by the company is used for PCR amplification is a 20 mu L system, wherein 1 mu L tomato leaf genome DNA, 0.2 mu L dNTP (10mM), 2 mu L10 x Buffer (Mg +) and 0.4 Taq enzyme are extracted, 1 mu L of each positive primer and negative primer are added, and sterilized ultrapure water is added to 20 mu L; the reaction procedure during PCR amplification is as follows: pre-denaturation at 94 ℃ for 2 min; then 35 cycles were performed, each cycle consisting of denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 45 s; finally, the extension is carried out for 2min, and the mixture is stored at 4 ℃.

And (3) separating the amplified PCR on 8% polyacrylamide gel electrophoresis, wherein the electrophoresis buffer solution is 0.5 TBE buffer solution, the voltage is 150V, the electrophoresis time is about 120min, after the electrophoresis is finished, the PCR is firstly dyed in silver nitrate solution, then the color is developed in sodium hydroxide solution added with formaldehyde, and the PCR is placed on a white light plate for photographing after being washed by clear water for analysis treatment.

The step (10) compares and analyzes the sizes of the agarose gel electrophoresis of the reported primer in the step (9) and the polyacrylamide gel electrophoresis anti-infection fragment of the primer developed herein, the inosculation degree of the anti-infection plant reaches 100%, the anti-infection fragment of the primer developed herein is smaller than the reported primer fragment, the band type is clearer, and the mark can also be used for agarose gel electrophoresis detection, and the selectivity is wider.

SEQ ID NO.5：

caagtgaagttaaaaatgctaattttacccttgatcttaatttaaaatgatttatagcaaaacaaacattttcaaacctgtttcttatg aaaggaaaagtattgaaaaaagggtttattatacactgggaattgaacccaaatccacacctatagtaagcgtactacatttg gagtt

SEQ ID NO.6：

caagtgaacttaaaaatgctaattttaccttgattttaattttaaaatgatttatatagcaaaacaaacatgacttatttcagatcac aagtttcaaaacctggtttttagtttcttaaactccgtgtccgtgtcaaaaggaaaagtattgaaaaaaggtttcttatacaatgg gaattgaacccaaatccacacctattgtttcgaagactctgagatagtaagcgtactacatttcgagtt

Materials and methods

1. Plant material

The study was conducted using 48 parts of tomato backbone material of known disease resistance (table 1) supplied by Jiangsu Green harbor modern agriculture development company (abbreviated as Green harbor), which were available for ordering from Jiangsu Green harbor modern agriculture development company. Sowing, field planting and field management are carried out according to the experimental method of hongkong.

Extraction and detection of DNA

Tomato genome DNA is extracted from fresh plant leaves about 21 days by using an improved CTAB method. The method comprises the following steps: putting 30mg of fresh leaves into a 2ml centrifuge tube, adding a steel ball with the diameter of 4mm, covering the steel ball, putting the steel ball into liquid nitrogen for 2min, and then grinding the sample by using a tissue grinder. ② adding 600 mul CTAB (CTAB needs preheating in advance) into the ground sample, and water bathing for 15min at 55 ℃. ③ centrifugation at 12000rpm for 5min, suction 500. mu.l of the supernatant in a clean 1.5ml centrifuge tube, addition of 250. mu.l of chloroform: isoamyl alcohol (24: 1), mixing well. 13000rpm for 90s, taking 350 mul of supernatant, putting into another 1.5ml centrifuge tube, adding 600 mul of absolute ethyl alcohol (precooling at-20 ℃ in advance) and 60 mul of ammonium acetate, mixing evenly, and putting in a refrigerator at-20 ℃ for 1 h. Fifthly, centrifuging at 13000rpm for 5min, pouring out the supernatant, and standing at room temperature. Sixthly, when no alcohol smell exists in the centrifugal tube, 100 mu l ddH is added ₂ O dissolves the DNA.

Electrophoresis and spectrophotometer detect the quality and concentration of DNA.

3. Design of primers

Resistance to root rot by tomato root capPrimer SCAR related to disease gene (Frl) and reported _Frl Carrying out PCR amplification and agarose gel electrophoresis, cloning and sequencing the PCR product, and designing a high-efficiency marker InFrl linked with the tomato root crown root rot resistance gene by software Primer 5. The marker can amplify 177bp fragments in disease-resistant varieties and 243bp fragments in susceptible varieties.

Forward primer sequence InFrl-F: 5'-CAAGTGAAGTTAAAAATGCTAAT-3'

Reverse primer sequence InFrl-R: 5'-AACTCCAAATGTAGTACGCTTAC-3'

PCR amplification and detection

(1) 48 parts of tomato backbone material were PCR amplified using the reported primer SCARFrl, LY96G Thermocycler, Washington, China ^TM The reaction system is 25 muL, wherein the extracted tomato leaf genome DNA is 2 muL, 2 Taq MasterMix (Dye) is 12.5 muL, positive and negative primers are 1 muL respectively, and sterilized ultrapure water is added to 25 muL. The reaction procedure during PCR amplification is as follows: pre-denaturation at 94 ℃ for 2 min; then 35 cycles were performed, each cycle consisting of denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 45 s; finally, the extension is carried out for 2min, and the mixture is stored at 4 ℃. For the detection by electrophoresis, electrophoresis was carried out on a 2% agarose gel containing 10. mu.l of red gel in 1 × TAE buffer at a voltage of 150 v. And after the electrophoresis is finished, observing an electrophoresis band in a gel imaging analyzer, analyzing the size of the DNA electrophoresis band under the wavelength of 365nm, scanning an image and storing.

(2) 48 parts of tomato backbone material was PCR amplified using a newly developed marker InFrl, produced by LY96G Thermocycler, Washington, China ^TM The amplification is carried out on an amplification instrument,

includes 12.5. mu.L of 2 XTaq MasterMix, 1. mu.L of LDNA extract, 10. mu.M of forward and reverse primers, 1. mu.L each, and 9.5. mu.L of ddH 2O. The reaction procedure was 94 ℃ pre-denaturation for 2min, [94 ℃ denaturation for 30s, 55 ℃ annealing for 30s, 72 ℃ extension for 30s ], 35 cycles, 72 ℃ extension for 2min, and then the reaction was maintained at 4 ℃. The PCR amplified fragments were separated on 8% polyacrylamide gel electrophoresis, silver stained and visualized under white light.

(II) results and analysis

1. Detection analysis of genomic DNA of selected materials

The genomic DNA of 48 tomato leaves extracted in the research is subjected to concentration detection by using a ultramicro ultraviolet-visible spectrophotometer (DeNovix DS-11), and the extracted DNA concentration is higher than 100 ng/mu l, and the OD260/OD280 is basically between 1.8 and 2.0. DNA with different concentrations is detected by 2 percent agarose electrophoresis, and an electrophoretogram is clear and bright and has no obvious tailing, which indicates that the quality of the extracted DNA is better. Therefore, the extracted high-quality tomato leaf genome DNA is suitable for molecular marker biological tests such as PCR amplification and SSR.

PCR amplification and electrophoresis

(1) Applying the reported SCARFrl-F marker for tomato root crown root rot:

CACATTCATCATCTGTTTTTAGTCTAT TC，SCARFrl-R：

CACAATCGTTGGCCATTGAATGAAGAAC PCR amplification is carried out to 48 parts of tomato backbone material, agarose gel electrophoresis detection is carried out, and the detection result is shown in figure 1-2.

(2) The tomato root crown root rot new marker InFrl-F provided by the invention is applied:

5'-CAAGTGAAGTTAAAAATGCTAAT-3'，InFrl-R：

5'-AACTCCAAATGTAGTACGCTTAC-3' PCR amplification is carried out to 48 parts of tomato backbone materials, agarose gel electrophoresis detection and polyacrylamide gel electrophoresis detection are respectively carried out to the amplification products, the result is shown in figure 3-4, the figure clearly shows that a 243bp strip is amplified in the susceptible variety, a 177bp fragment is amplified in the disease-resistant variety, and the detection result is completely consistent with the sequencing result.

TABLE 1.48 parts of tomato backbone material

FIGS. 1-5 show disease-resistant genes (Fr) for root rot of 48 tomato material root capsl) detection, it can be seen from FIGS. 1-2 that SCAR was obtained using the reported primers _Frl Detecting 36 infected tomato materials and 12 disease-resistant materials; from FIGS. 3-5, it can be seen that 36 infected tomato materials and 12 disease-resistant materials were detected by using the primer InFrl developed herein.

As can be seen from the figure, the marker developed in the text is the same as the reported detection result of the marker, the polymorphism of the marker developed in the text is stronger, the band type is clearer, the agarose gel electrophoresis and the polyacrylamide gel electrophoresis can be used for detection at the same time, and the detection result is more accurate than the reported primer sequence result.

Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Sequence listing

<110> Hoffy Green harbor modern agriculture research institute Co., Ltd

JIANGSU GREENPORT MODERN AGRICULTURAL DEVELOPMENT Co.,Ltd.

<120> primer for detecting FCR disease-resistant gene and rapid detection method

<141> 2022-05-26

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cacattcatc atctgttttt agtctattc 29

<210> 2

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cacaatcgtt ggccattgaa tgaagaac 28

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

caagtgaagt taaaaatgct aat 23

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aactccaaat gtagtacgct tac 23

<210> 5

<211> 177

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

caagtgaagt taaaaatgct aattttaccc ttgatcttaa tttaaaatga tttatagcaa 60

aacaaacatt ttcaaacctg tttcttatga aaggaaaagt attgaaaaaa gggtttatta 120

tacactggga attgaaccca aatccacacc tatagtaagc gtactacatt tggagtt 177

<210> 6

<211> 243

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caagtgaact taaaaatgct aattttacct tgattttaat tttaaaatga tttatatagc 60

aaaacaaaca tgacttattt cagatcacaa gtttcaaaac ctggttttta gtttcttaaa 120

ctccgtgtcc gtgtcaaaag gaaaagtatt gaaaaaaggt ttcttataca atgggaattg 180

aacccaaatc cacacctatt gtttcgaaga ctctgagata gtaagcgtac tacatttcga 240

gtt 243

Claims (5)

1. The primer for detecting the FCR disease-resistant gene is characterized by comprising an upstream primer InFrl-F and a downstream primer InFrl-R, wherein the sequence of the upstream primer InFrl-F is CAAGTGAAGTTAAAAATGCTAAT, and the sequence of the downstream primer InFrl-F is AACTCCAAATGTAGTACGCTTAC.

2. A method for rapidly detecting an FCR disease-resistant gene by using the primer in claim 1 is characterized by comprising the following steps:

(1) extracting leaf genome DNA of the tomato root cap root rot disease resistant material;

(2) performing PCR amplification on the tomato material extracted in step (1) by using the primers of claim 1;

(3) and (3) respectively carrying out 2% agarose gel electrophoresis and 8% polyacrylamide gel electrophoresis on the product amplified in the step (2), and developing and dyeing.

(4) And (4) judging according to the result of the step (3).

3. The method for rapidly detecting the FCR disease-resistant gene according to claim 2, wherein the genomic DNA of the tomato leaves extracted in the step (1) is extracted by a modified CTAB method.

4. The method for rapidly detecting the disease-resistant gene of the FCR according to claim 2, wherein the PCR amplification in step (2) is performed using a 20 μ L system, wherein 1 μ L tomato leaf genome DNA, 0.2 μ L dNTP (10mM), 2 μ L10 × Buffer (Mg +) and 0.4 Taq enzyme are extracted, 1 μ L of each of forward and reverse primers is added, and sterilized ultrapure water is added to 20 μ L; the reaction procedure during PCR amplification is as follows: pre-denaturation at 94 ℃ for 2 min; then 35 cycles were performed, each cycle consisting of denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 45 s; finally, the extension is carried out for 2min, and the mixture is stored at 4 ℃.

5. The method for rapidly detecting the FCR disease-resistant gene according to claim 2, wherein 177bp of fragment size is amplified in the disease-resistant variety in the step (4), the nucleotide sequence table of the fragment size is shown as SEQ ID No.5, and 243bp of fragment size is amplified in the disease-susceptible variety, and the nucleotide sequence table of the fragment size is shown as SEQ ID No. 6.

Images