CN114921429B - Acetylation-regulated lactate dehydrogenase mutant and application thereof - Google Patents
Acetylation-regulated lactate dehydrogenase mutant and application thereof Download PDFInfo
- Publication number
- CN114921429B CN114921429B CN202210485169.5A CN202210485169A CN114921429B CN 114921429 B CN114921429 B CN 114921429B CN 202210485169 A CN202210485169 A CN 202210485169A CN 114921429 B CN114921429 B CN 114921429B
- Authority
- CN
- China
- Prior art keywords
- ldha
- mutant
- strain
- lactate dehydrogenase
- lactic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/56—Lactic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01027—L-Lactate dehydrogenase (1.1.1.27)
Abstract
The invention discloses an acetylation regulated lactic dehydrogenase mutant and application thereof in improving synthesis of lactic acid, wherein the mutant is formed by mutating lysine at the 9 th position of lactic acid dehydrogenase LdhA protein into arginine, and is named as a K9R mutant, and the amino acid sequence of the mutant is shown as SEQ ID NO. 1. The invention also discloses an acetylation-regulated lactate dehydrogenase double mutant and application thereof in inhibiting synthesis of lactic acid, wherein the mutant is formed by mutating lysine at 154 th and 248 th positions of lactate dehydrogenase LdhA protein into glutamine, and is named as K154Q-K248Q double mutant, and the amino acid sequence of the mutant is shown as SEQ ID NO. 2. Experiments prove that the K9R mutant improves the enzyme activity of LdhA by 2.5 times, and the lactic acid yield of the strain over-expressing the K9R mutant is improved by 1.67 times compared with that of the strain over-expressing the wild LdhA; the activity of the K154Q-248Q double mutant is reduced to 12.6% of that of the wild type, and the double mutant strain with the in-situ mutation of the ldhA gene to K154Q-248Q on the genome can realize the effect similar to that of the currently commonly used ldhA gene knockout method in the aspect of inhibiting lactic acid synthesis.
Description
Technical Field
The invention relates to a lactic dehydrogenase mutant and application thereof, in particular to an acetylation-regulated lactic dehydrogenase mutant and application thereof. Belongs to the technical field of genetic engineering.
Background
Lactic acid is an important commodity chemical, and is commonly used as a flavoring agent and preservative for foods. Lactic acid is also a natural moisturizing ingredient with little irritation, and is used in various cosmetics. In medicine, lactic acid is widely used as a preservative, a carrier agent, a cosolvent, a pharmaceutical preparation, a pH adjustor, and the like. Meanwhile, lactic acid can also be used as a monomer to synthesize polylactic acid, so that the polylactic acid is a novel biodegradable plastic. Therefore, lactic acid has wide application in the fields of food, cosmetics, medicines, agriculture, chemical industry, degradable plastics and the like. Currently, the synthesis methods of lactic acid mainly include microbial fermentation and chemical synthesis. The microbial fermentation method is a main method for synthesizing lactic acid due to the advantages of environmental protection, sustainable raw materials and the like.
NAD-dependent lactate dehydrogenase (LdhA) is a conserved enzyme that is widely present in various species, specifically catalyzing the conversion of pyruvate to lactate. In engineering bacteria for synthesizing lactic acid by microorganisms, the increase of lactic acid production is often achieved by overexpressing lactic acid dehydrogenase LdhA. However, the natural enzymatic activity of LdhA limits the efficiency of lactic acid synthesis. Optimizing the catalytic activity of LdhA is an important method to further improve lactic acid production and conversion efficiency.
In addition, lactic acid is also an important byproduct in the synthesis of other bio-based chemicals. When rapid substrate consumption and limited cellular respiration capacity are imbalanced, a large accumulation of pyruvate and NADH results, and LdhA catalyzes the conversion of pyruvate to lactate. The synthesis of lactic acid wastes the carbon source of the synthesis path of the target product, and affects the yield and conversion efficiency of the target product. To avoid synthesis of lactic acid byproducts during synthesis of other bio-based chemicals, a common approach is to knock out the ldhA gene directly on the genome. Direct knockout of the ldhA gene, while inhibiting lactate production, also affects biomass accumulation. Therefore, a novel metabolic regulation method is explored, the synthesis of lactic acid byproducts is inhibited under the condition that the precursors for maintaining the normal biomass accumulation of cells, and the problem of commonality of the accumulation of the lactic acid byproducts in the current microbial synthesis process is hopeful to be solved.
Lysine acetylation modification is a conservative post-translational modification mechanism, and affects the activity of enzymes, metabolic flow distribution, replication transcription and other various cell physiological and metabolic processes. However, there is currently no report on the role of lysine acetylation modification in the activity of bacterial lactate dehydrogenase LdhA and the regulation of lactate synthesis. Furthermore, methods for realizing the regulation of lactic acid synthesis by regulating lysine acetylation modification of lactic acid dehydrogenase, changing the activity of lactic acid dehydrogenase, and related lactate dehydrogenase mutants regulated by acetylation and applications thereof have not been reported yet.
Disclosure of Invention
Aiming at the problem of natural activity limitation of lactic dehydrogenase LdhA in the microbial synthesis process of lactic acid as a target product and the problem of accumulation of lactic acid as a byproduct in the synthesis process of other bio-based chemicals, the invention aims to provide an acetylation-regulated lactic dehydrogenase mutant and application thereof. The synthesis regulation and control of lactic acid is realized by regulating and controlling the specific lysine acetylation site of lactic acid dehydrogenase LdhA and improving or reducing the activity of lactic acid dehydrogenase according to the synthesis requirement.
The lactate dehydrogenase mutant regulated and controlled by acetylation is characterized in that: the mutant is formed by mutating lysine at position 9 of lactic dehydrogenase LdhA protein into arginine, and is named as K9R mutant, and the amino acid sequence of the mutant is shown as SEQ ID NO. 1.
Furthermore, the invention relates to an application of the lactate dehydrogenase mutant regulated and controlled by acetylation in improving the synthesis of lactic acid.
The invention provides an expression strain of the lactate dehydrogenase K9R mutant regulated and controlled by acetylation, which is characterized in that: the strain carries a K9R mutated lactate dehydrogenase gene ldhA shown in SEQ ID NO. 3.
The expression strain of the above-mentioned acetylation-regulated lactic dehydrogenase K9R mutant is preferably a strain designated as E.coli BL21 (DE 3)/pETDuet 1-ldhA (K9R). The construction method comprises the following steps:
1) The genomic DNA of E.coli was used as a template, and the primer pETDuet1-ldhA-5' (CCG)GGATCCGATGAAACTCGCCGTTTATAGC) and pETDuet1-ldhA (K9R) -3' (AGGTACTTCTTGTCGTACTGACGTGTGCTATAAACGGCGAGTT) to obtain an upstream fragment of the K9R mutated lactate dehydrogenase gene ldhA, cloning with primers pETDuet1-ldhA-3' (CCGGAGCTCTTAAACCAGTTCGTTCGGGC) and pETDuet1-ldhA (K9R) -5' (AACTCGCCGTTTATAGCACACG TCAGTA CGACAAG AAGTACCT) to obtain a downstream fragment of the K9R mutated lactate dehydrogenase gene ldhA, and bridging the upstream and downstream fragments of the K9R mutated lactate dehydrogenase gene ldhA by a fragment bridging method to obtain a K9R mutated lactate dehydrogenase gene ldhA, the nucleotide sequence of which is shown in SEQ ID NO. 3;
2) Ligating the K9R mutated lactate dehydrogenase gene ldhA obtained in step 1) to an expression vector to obtain a recombinant plasmid;
3) The recombinant plasmid obtained in the step 2) is introduced into a receptor cell E.coli BL21 (DE 3) to obtain an expression strain E.coli BL21 (DE 3)/pETDuet 1-ldhA (K9R) of the K9R mutant.
Wherein, the expression vector in the step 2) is pETDuet1, which is purchased from Novagen company.
The invention relates to application of an expression strain of a K9R mutant in improving lactic acid yield and conversion efficiency.
Wherein, the preferable technical scheme for improving the yield and the conversion efficiency of lactic acid is as follows: inoculating the K9R mutant expression strain in a lactic acid fermentation medium, and fermenting for 24 hours at 37 ℃ and 100rpm by taking glucose as a carbon source.
The invention also discloses an acetylation-regulated lactate dehydrogenase double mutant, which is characterized in that: the double mutant is formed by mutating lysine at 154 th and 248 th positions of lactate dehydrogenase LdhA protein into glutamine, and is named as K154Q-K248Q double mutant, and the amino acid sequence of the double mutant is shown as SEQ ID NO. 2.
Further, the use of the acetylation-regulated lactate dehydrogenase double mutant in inhibiting the synthesis of lactic acid.
Correspondingly, the invention provides a lactic dehydrogenase K154Q-K248Q double mutant strain regulated by acetylation, which is characterized in that: the lactic dehydrogenase gene ldhA of genome in the strain is mutated and replaced in situ by the lactic dehydrogenase gene ldhA of double mutation of K154Q-K248Q shown in SEQ ID NO.4, and the strain is named as E.coli BL21 (DE 3) ldhA:: ldhA (K154Q-K248Q). The construction method comprises the following steps:
1) Cloning with the genome DNA of Escherichia coli as a template, cloning with primers pRE112-ldhA (K154Q-K248Q) -5 '(CAACATCACTGGAGAAAGTCTTATGAAACTCGCCGTTTATAGC) and ldhA (K154Q) -3' (CGCAGCATCGCCACACCGATCTGACCGGTACCGATAACGCCTG) to obtain an upstream fragment of the K154Q mutated lactate dehydrogenase gene ldhA, cloning with primers pRE112-ldhA (K154Q-K248Q) -3 '(GGTTGCAGGGGAGCGGCAAGATTAAACCAGTTCGTTCGGGC) and ldhA (K154Q) -5' (CAGGCGTTATCGG TACCGGTCAGATCGGTGTGGCGATGCTGCG) to obtain a downstream fragment of the K154Q mutated lactate dehydrogenase gene ldhA, and bridging the upstream and downstream fragments of the K154Q mutated lactate dehydrogenase gene ldhA by using a fragment bridging method to obtain a K154Q mutated lactate dehydrogenase gene ldhA;
2) Cloning to obtain an upstream fragment of the K154Q-K248Q mutant lactate dehydrogenase gene ldhA by using the K154Q mutant lactate dehydrogenase gene ldhA as a template and primers pRE112-ldhA (K154Q-K248Q) -5 '(CAACATCACTGGAGAAAGTCTTATGAAACTCGCCGTTTATAGC) and ldhA (K248Q) -3' (AACGAACCAATTTTCTGATTCTGCAGCGCTTCAATTGCTGCCT), cloning to obtain a downstream fragment of the K154Q-K248Q mutant lactate dehydrogenase gene ldhA by using primers pRE112-ldhA (K154Q-K248Q) -3 '(GGTTGCAGGGGAGCGGCAAGATTAAACCAGTTCGTTCGGGC) and ldhA (K248Q) -5' (AACGAACCAATTTTCTGATTCTGCAGCGCTTCAATTGCTGCCT), and bridging the upstream and downstream fragments of the K154Q-K248Q mutant lactate dehydrogenase gene ldhA by using a fragment bridging method to obtain a K154Q-K248Q double mutant lactate dehydrogenase gene ldhA, the nucleotide sequence of which is shown in SEQ ID NO. 4;
3) The genomic DNA of E.coli was used as a template, and the primer pRE112-up-5' (CCG)TCTAGACAGTTGCTGGATATCAGAGG) and pRE112-Up-3' (GCTATAAACGGCGAGTTTCATAAGACTTTCTCCAGTGATGTTG) to obtain an upstream homologous fragment Up sequence of the ldhA gene, cloning primers pRE112-dwon-5' (GCCCGAACGAACTGGTTTAATCTTGCCGCTCCCCTGCAACC) and pRE112-dwon-3' (CCGGAGCTCGTCGATGTCCAGTAGTGGAG) to obtain a downstream homologous fragment Down sequence of the ldhA gene, and bridging by a fragment bridging method to obtain an Up-ldhA (K154Q-248Q) -Down fragment, wherein the nucleotide sequence is shown as SEQ ID NO. 5.
4) The Up-ldhA (K154Q-248Q) -Down fragment obtained in step 3) is constructed to a suicide plasmid pRE112, and the lactic dehydrogenase gene ldhA of the recipient cell is replaced in situ by the K154Q-K248Q double mutant ldhA gene by utilizing suicide plasmid pRE 112-mediated homologous recombination to obtain the K154Q-K248Q double mutant strain (E.coli BL21 (DE 3) ldhA:: ldhA (K154Q-K248Q).
The invention relates to application of a K154Q-K248Q double mutant strain in inhibiting synthesis of lactic acid.
Wherein, the preferable technical scheme for inhibiting the synthesis of lactic acid is as follows: inoculating the K154Q-K248Q double mutant strain in a 3-hydroxy propionic acid fermentation medium, and fermenting for 48h at 37 ℃ and 180rpm by taking glucose as a carbon source.
The invention discloses application of a K154Q-K248Q double mutant strain in biosynthesis of 3-hydroxy propionic acid.
Wherein, the preferable technical scheme for biosynthesis of the 3-hydroxy propionic acid is as follows:
1) Preparing competent cells of the K154Q-K248Q double mutant strain according to the operation instructions of the competent preparation kit;
2) Introducing synthetic plasmids pA-accADBC and pMCR-N-C-N940V/K1106W/S1114R of 3-hydroxypropionic acid into the competent cells prepared in step 1), and preparing a recombinant strain of 3-hydroxypropionic acid;
3) Inoculating the recombinant strain prepared in the step 2) into a 3-hydroxy propionic acid fermentation medium, and fermenting for 48 hours at 37 ℃ and 180rpm by taking glucose as a carbon source.
The invention discloses an acetylation-regulated lactate dehydrogenase mutant and application thereof. The synthesis regulation of lactic acid is realized by regulating and controlling the specific lysine acetylation modification site of lactic acid dehydrogenase LdhA for the first time and increasing or decreasing the activity of lactic acid dehydrogenase LdhA according to the requirement. Experiments prove that: after lysine (K) at position 9 of LdhA is mutated into arginine (R), the enzyme activity of the K9R mutant is improved by 2.5 times compared with that of the wild type LdhA. When the K9R mutant-containing lactate dehydrogenase gene ldhA was overexpressed, the yield and conversion efficiency of lactic acid were improved 1.63-fold over those of the control strain. After mutation of lysine (K) at positions 154 and 248 of LdhA to glutamine (Q), the enzyme activity of the K154Q-K248Q mutant was reduced to 12.6% of that of the wild type. When the ldhA gene on the genome of E.coli BL21 (DE 3) strain is replaced with the ldhA gene containing the K154Q-K248Q mutant in situ, the accumulation of lactic acid is significantly reduced, and compared with the method for controlling lactic acid synthesis, namely the method for directly knocking out the ldhA, which is commonly used at present, the lactic acid inhibition effect is similar, but the biomass accumulation is significantly higher than that of the ldhA knocked out strain. During synthesis of the bio-based chemical 3-hydroxypropionic acid, the K154Q-K248Q mutant strain was able to reduce the lactic acid by-product by 82.3% similar to the ldhA knockout strain effect. The 3HP production of the double mutant strain was significantly higher than the control strain and the ldhA knockout strain. From this, it is shown that the method of reducing ldhA enzyme activity by protein lysine acetylation modification of the present invention can inhibit lactic acid by-product synthesis and achieve effects similar to those of the currently used method (direct knockout of ldhA gene), but the method of the present invention is more advantageous in terms of cell biomass accumulation and target product synthesis. Furthermore, the lactic acid dehydrogenase mutant is obtained through the lysine acetylation modification site of the regulatory protein for the first time, so that the synthesis of lactic acid can be improved or reduced as required, and the flexible regulation and control of microbial synthesis can be realized. In view of the fact that protein acetylation modification is a very conservative and extensive post-translational modification mechanism, the technical scheme of the invention has reference value in the aspect of synthesis regulation of lactic acid of other species, and can be widely applied to inhibiting accumulation of lactic acid byproducts in the synthesis process of other bio-based chemicals.
Drawings
FIG. 1 shows the effect of mutation at the site of acetylation modification of lactate dehydrogenase on enzyme activity.
FIG. 2 is a graph showing the effect of K9R mutant lactate dehydrogenase on cell growth, lactate synthesis and conversion during lactate synthesis.
FIG. 3 is a comparison of the double mutant strain of K154Q-K248Q with the ldhA knockout strain in terms of cell growth and lactic acid accumulation.
FIG. 4 is a comparison of cell growth, lactic acid accumulation and 3-hydroxypropionic acid synthesis during fermentation of 3-hydroxypropionic acid by the double mutant strain of K154Q-K248Q and the ldhA knockout strain.
Detailed Description
General description:
the materials, reagents, instruments and methods used in the examples below, without any particular description, are conventional in the art and are commercially available.
The enzyme reagent is purchased from MBI Fermentas company, the kit for extracting plasmids and the kit for recovering DNA fragments are purchased from OMEGA company in the United states, and the corresponding operation steps are carried out according to the product specification; all media were formulated with deionized water unless otherwise indicated.
The formula of the culture medium comprises:
1) LB medium: 5g/L yeast powder, 10g/L NaCl,10g/L peptone and the balance water, and sterilizing at 121 ℃ for 20 min.
2) Lactic acid fermentation medium: 0.42g/L citric acid, 2g/L KH 2 PO 4 ，1.6g/L K 2 HPO 4 ，5.4g/L NH 4 Cl，0.25g/L MgSO 4 ·7H 2 O,1/1000 trace element (3.7 g/L (NH) 4 ) 6 Mo 7 O 24 ·4H 2 O,2.9g/L ZnSO 4 ·7H 2 O,24.7g/L H 3 BO 3 ,2.5g/L CuSO 4 ·5H 2 O,15.8g/L MnCl 2 ·4H 2 O)。
3) 3-hydroxypropionic acid fermentation medium: 14g/L K 2 HPO 4 ·3H2O，5.2g/L KH 2 PO，1g/L NaCl，1g/L NH 4 Cl，0.25g/L MgSO 4 ·7H 2 O,0.2g/L yeast powder, 20g/L glucose.
In the actual culture process, antibiotics can be added to the above culture medium at a concentration to maintain the stability of the plasmid, such as 50mg/L chloramphenicol, 100mg/L ampicillin.
The E.coli described in the present invention was E.coli BL21 (DE 3), purchased from Invitrogen corporation.
In the present invention, the lactate dehydrogenase gene ldhA is derived from E.coli BL21 (DE 3).
The method for introducing the recombinant plasmid into host cells is a heat shock transformation method.
The pRE 112-mediated homologous recombination method is one of the common techniques for gene replacement in the field, and can be operated according to a standard operation method.
The recombinant plasmids of 3-hydroxy propionic acid in the example are pA-accADBC and pMCR-N-C-N940V/K1106W/S1114R, and the information and construction method of the recombinant plasmids are shown in Metabolic Engineering (2016) 104-111.
The definitions and abbreviations referred to in the present invention are as follows:
lactate dehydrogenase: ldhA.
3-hydroxypropionic acid: 3HP.
Coli (Escherichia coli): e.coli.
In the present invention, "heat shock transformation" or "heat transformation" refers to a technique of transfection in molecular biology for integrating a foreign gene into a host gene and stably expressing the same, which uses a method of introducing the foreign gene into the host gene or introducing a foreign plasmid into a host protoplast after heat shock, heat shock transformation or heat transformation, etc., by generating a slit in a cell membrane.
Overexpression "in the present invention means that a specific gene is expressed in a large amount in an organism, and the expression amount exceeds a normal level (i.e., a wild-type expression level) can be achieved by enhancing endogenous expression or introducing an exogenous gene.
The present invention uses techniques and methods conventional in the fields of genetic engineering and molecular biology. Those skilled in the art may utilize other conventional techniques, methods and reagents in the art based on the embodiments provided herein and are not limited to the specific examples of the invention.
The technical contents of the present invention are further described with reference to specific examples.
Example 1: construction of an acetylation-regulated lactate dehydrogenase LdhA mutant and enzyme activity assay.
Constructing a lactate dehydrogenase LdhA mutant K9R of which the 9 th lysine of the lactate dehydrogenase LdhA protein is mutated into arginine; or constructing LdhA double mutant K154Q-K248Q in which lysine 154 and lysine 248 of lactic dehydrogenase LdhA protein are mutated into glutamine, and measuring the enzyme activity of the mutant.
The method comprises the following specific steps:
1) Amplification of LdhA mutant
The genomic DNA of E.coli was used as a template, and the primer pETDuet1-ldhA-5' (CCG)GGATCCGATG AAACTCGCCGTTTATAGC) and pETDuet1-ldhA (K9R) -3' (AGGTACTTCTTGTCGTACTGACG TGTGCTATAAACGGCGAGTT) to obtain an upstream fragment of the K9R-mutated lactate dehydrogenase gene ldhA, and using the primers pETDuet1-ldhA-3' (CCGGAGCTCTTAAACCAG TTCGTTCGGGC) and pETDuet1-ldhA (K9R) -5' (AACTCGCCGTTTATAGCACACG TCAGTA CGACAAG AAGTACCT), obtaining a downstream fragment of the K9R-mutated lactate dehydrogenase gene ldhA by PCR cloning, and bridging the K9R mutation by using the fragment bridging methodThe upstream and downstream fragments of the lactate dehydrogenase gene ldhA to obtain a K9R mutated lactate dehydrogenase gene ldhA, the nucleotide sequence of which is shown in SEQ ID NO. 3;
the genomic DNA of E.coli was used as a template, and the primer pETDuet1-ldhA-5' (CCG)GGATCCGATGAAACTCGCCGTTTATAGC) and ldhA (K154Q) -3' (CGCAGCATCGCC ACACCGATCTGACCGGTACCGATAACGCCTG), obtaining an upstream fragment of the K154Q mutated lactate dehydrogenase gene ldhA by PCR cloning, obtaining a downstream fragment of the K154Q mutated lactate dehydrogenase gene ldhA by PCR cloning with primers pETDuet1-ldhA-3' (CCGGAGCTCTTAAACCAG TTCGTTCGGGC) and ldhA (K154Q) -5' (CAGGCGTTATCGGTACCGGTCAGATCGGTGTGGCGATGCTGCG), and bridging the upstream and downstream fragments of the K154Q mutated lactate dehydrogenase gene ldhA by a fragment bridging method to obtain the K154Q mutated lactate dehydrogenase gene ldhA;
the K154Q mutant lactate dehydrogenase gene ldhA was used as a template, and primer pETDuet1-ldhA-5' (CCG)GGATCCGATGAAACTCGCCGTTTATAGC) and ldhA (K248Q) -3' (AACGAACCAATTTTCTGATTCTGCAGCGCTTCAATTGCTGCCT), obtaining an upstream fragment of the K154Q-K248Q mutated lactate dehydrogenase gene ldhA by PCR cloning, obtaining a downstream fragment of the K154Q-K248Q mutated lactate dehydrogenase gene ldhA by PCR cloning with primers pETDuet1-ldhA-3' (CCGGAGCTCTTAAACCAGTTCGTTCGGGC) and ldhA (K248Q) -5' (AACGAACC AATTTTCTGAT TCTGC AGCGC TTCAA TTGCTGCCT), and bridging the upstream and downstream fragments of the K154Q-K248Q mutated lactate dehydrogenase gene ldhA by a fragment bridging method to obtain a K154Q-K248Q double mutated lactate dehydrogenase gene ldhA having the nucleotide sequence shown in SEQ ID NO. 4;
the PCR amplification system was 50. Mu.l, which contained: 25. Mu.L of 2 XPrimeSTARMAX, 1. Mu.L of upstream primer (10. Mu.M) and 1. Mu.L of downstream primer (10. Mu.M), 23. Mu.L of deionized water were added to the E.coli colonies as templates.
The PCR amplification procedure was as follows: 95℃for 3min (95℃30s,58℃30s,72℃1min,30 cycles) and 72℃for 3min.
2) Construction of recombinant plasmids
The K9R-mutated lactate dehydrogenase gene ldhA obtained in step 1) and the K154Q-K248Q-double-mutated lactate dehydrogenase gene ldhA and the expression vector pETDuet1 were digested with BamHI and SacI, respectively, in a 50. Mu.L digestion system, comprising: 20. Mu.L of gene or vector, 1. Mu.L BamHI, 1. Mu.L LSaci, 5. Mu.L 10 Xbuffer, 23. Mu.L deionized water. After the enzyme digestion products are recovered, the mutant ldhA gene fragments and the vector fragments after enzyme digestion are respectively connected by using T4 ligase to obtain recombinant plasmids which are respectively named as follows: pETDuet1-ldhA (K9R) and pETDuet1-ldhA (K154Q-K248Q).
3) Transformation
Preparing competent cells of E.coli BL21 (DE 3) according to the operation instruction of the competent preparation kit, respectively adding the recombinant plasmid prepared in the step 2) into the prepared competent cells, and carrying out ice bath for 30min; after ice bath, putting the mixture into a water bath kettle at 42 ℃ to be heated for 90s; taking out after heat shock, rapidly placing on ice, and carrying out ice bath for 10min; taking out the ice-bath centrifuge tube, adding 500 mu L of liquid LB culture medium, and placing the ice-bath centrifuge tube at 37 ℃ for activation for about 1 hour; after activation, the cells were centrifuged at 4000g for 2min at 4℃and the supernatant was discarded, the cells were resuspended in 100. Mu.L of liquid LB and plated on solid LB plates containing 100mg/L ampicillin, and the plated plates were placed in a 37℃incubator overnight for overnight culture until monoclonal growth, and the expression strain of the lactate dehydrogenase mutant K9R, designated as E.coli BL21 (DE 3)/pETDuet 1-ldhA (K9R) and K154Q-248Q double mutant, designated as E.coli BL21 (DE 3)/pETDuet 1-ldhA (K154Q-248Q) was obtained accordingly.
4) Enzyme activity assay
Respectively inoculating the strains obtained in the step 3) into triangular shake flasks containing 50mL of LB culture medium, adding 0.1mM IPTG to induce expression when the OD600 is about 0.8 at 37 ℃, continuously culturing at 180rpm at 30 ℃ for 18 hours, centrifuging to collect cells, crushing at high pressure to obtain crude protein products, purifying the protein products by using a nickel affinity chromatographic column, correspondingly obtaining pure proteins of K9R mutant and K154Q-K248Q mutant of lactic dehydrogenase, and measuring enzyme activity.
200. Mu.L of the enzyme activity measurement reaction system contains: 0.2M phosphate buffer (solution A: 71.64g Na) 2 HPO 4 .12H 2 O is dissolved in 1L of pure water; solution B31.21 g NaH 2 PO 4 .2H 2 O was dissolved in 1L of pure water: 84ml of A solution and 16ml of B solution are uniformly mixed,pH7.5, i.e.0.2M phosphate buffer), 20mM NADH,20mM sodium pyruvate, 40nM of purified protein sample, absorbance at 340nM was measured using an enzyme-labeled instrument.
As shown in FIG. 1, the enzyme activity of the K9R mutant was 2.5-fold higher than that of the wild-type LdhA, and the enzyme activity of the K154Q-K248Q mutant was reduced to 12.6% of that of the wild-type.
EXAMPLE 2 use of expression strains of K9R mutants for increasing lactic acid production and transformation efficiency
This example will compare the differences in cell growth, lactate accumulation and substrate conversion during lactic acid fermentation of the expression strain of the wild-type lactate dehydrogenase and the expression strain of its K9R mutant. In this example, two experiments were performed to demonstrate the effects that can be achieved by the present invention.
Control group: e.coli BL21 (DE 3)/pETDuet 1-ldhA
Experimental group: e.coli BL21 (DE 3)/pETDuet 1-ldhA (K9R)
The method comprises the following specific steps:
1) Reference example 1 procedure, using genomic DNA of E.coli as a template, and primer pETDuet1-ldhA-5' (CCG)GGATCCGATGAAACTCGCCGTTTATAGC) and pETDuet1-ldhA-3' (CCGGAGCTCTTAA ACCAG TTCGTTCGGGC) were cloned by PCR to obtain a wild-type ldhA gene and constructed into a pETDuet1 expression plasmid to obtain a recombinant plasmid pETDuet1-ldhA, which was transformed into competent cells of E.coli BL21 (DE 3) to obtain an expression strain E.coli BL21 (DE 3)/pETDuet 1-ldhA of the wild-type lactate dehydrogenase (control).
2) The expression strain of the wild-type lactate dehydrogenase (control group) and the expression strain of the K9R mutant (experimental group) were inoculated into a test tube containing 3mL of LB medium, respectively, and cultured overnight at 37 ℃.
2) The strains after overnight culture were inoculated into 250mL shake flasks containing 100mL of lactic acid fermentation medium (containing 100mg/L ampicillin) at a volume ratio of 1:50, and when they were cultured at 37℃and 180rpm until OD600 was about 0.8, 0.1mM IPTG was added to induce protein expression, and the mixture was transferred to 30℃and 100rpm to perform lactic acid fermentation for 24 hours.
3) After the fermentation, the OD600 absorbance of the cells was measured using spectrophotometry, respectively. Meanwhile, 1mL of the fermentation broth was centrifuged at 12000rpm at 4℃for 10min, and the supernatant was filtered through a 0.22 μm filter membrane and the lactic acid concentration was measured by HPLC.
As shown in FIG. 2, the cell biomass accumulation of the K9R mutant expression strain is basically consistent with that of the control group, and the lactic acid yield and the conversion efficiency of the K9R mutant are improved by about 1.63 times compared with those of the control strain.
EXAMPLE 3 use of K154Q-K248Q double mutant Strain in inhibiting lactic acid Synthesis
This example will compare differences in cell growth and lactate synthesis of wild E.coli BL21 (DE 3) strain, lactate dehydrogenase gene ldhA knockout strain (E.coli BL21 (DE 3) ΔldhA) and genomic ldhA's K154Q-K248Q double mutant strain (E.coli BL21 (DE 3) ldhA:: ldhA (K154Q-K248Q)). In this example, three experiments were performed to demonstrate the effects that can be achieved by the present invention.
Control group 1: e.coli BL21 (DE 3)
Control group 2: e.coli BL21 (DE 3) ΔldhA
Experimental group: e.coli BL21 (DE 3) ldhA:: ldhA (K154Q-K248Q)
The method comprises the following specific steps:
1) Construction of the knockout Strain of ldhA
The ldhA gene of E.coli BL21 (DE 3) was knocked out according to the standard experimental procedure of the P1 phage transduction method, to obtain a knocked-out strain of ldhA E.coli BL21 (DE 3) ΔldhA (control group 2).
2) Construction of K154Q-K248Q double mutant Strain
With reference to the PCR amplification system and procedure of example 1, an upstream fragment of the K154Q-mutated lactate dehydrogenase gene ldhA was obtained by cloning with primers pRE112-ldhA (K154Q-K248Q) -5 '(CAACATCACTGGAGAAAGTCTTATGAAACTCGCCGTTTATAGC) and ldhA (K154Q) -3' (CGCAGCATCGCCACACCGATCTGACCGGTACCGATAACGCCTG) using genomic DNA of E.coli as a template, and downstream fragments of the K154Q-mutated lactate dehydrogenase gene ldhA were obtained by cloning with primers pRE112-ldhA (K154Q-K248Q) -3 '(GGTTGCAGGGGAGCGGCAAGATTAAACCAGTTCGTTCGGGC) and ldhA (K154Q) -5' (CAGGCGTTATCGGTACCGGTCAGATCGGTGTGGCGATGCTGCG) and by bridging the upstream and downstream fragments of the K154Q-mutated lactate dehydrogenase gene ldhA using the fragment bridging method;
cloning to obtain an upstream fragment of the K154Q-K248Q mutant lactate dehydrogenase gene ldhA by using the K154Q mutant lactate dehydrogenase gene ldhA as a template and primers pRE112-ldhA (K154Q-K248Q) -5 '(CAACATCACTGGAGAAAGTCTTATGAAACTCGCCGTTTATAGC) and ldhA (K248Q) -3' (AACGAACCAATTTTCTGATTCTGCAGCGCTTCAATTGCTGCCT), cloning to obtain a downstream fragment of the K154Q-K248Q mutant lactate dehydrogenase gene ldhA by using primers pRE112-ldhA (K154Q-K248Q) -3 '(GGTTGCAGGGGAGCGGCAAGATTAAACCAGTTCGTTCGGGC) and ldhA (K248Q) -5' (AACGAACCAATTTTCTGATTCTGCAGCGCTTCAATTGCTGCCT), and bridging the upstream and downstream fragments of the K154Q-K248Q mutant lactate dehydrogenase gene ldhA by using a fragment bridging method to obtain a K154Q-K248Q double mutant lactate dehydrogenase gene ldhA, the nucleotide sequence of which is shown in SEQ ID NO. 4;
the genomic DNA of E.coli was used as a template, and the primer pRE112-up-5' (CCG)TCTAGACAGTTGCTGGATATCAGAGG) and pRE112-Up-3' (GCTATAAACGGCGAGTTTCATAAGACTTTCTCCAGTGATGTTG) to obtain an upstream homologous fragment Up sequence of the ldhA gene, cloning primers pRE112-dwon-5' (GCCCGAACGAACTGGTTTAATCTTGCCGCTCCCCTGCAACC) and pRE112-dwon-3' (CCGGAGCTCGTCGATGTCCAGTAGTGGAG) to obtain a downstream homologous fragment Down sequence of the ldhA gene, and bridging by a fragment bridging method to obtain an Up-ldhA (K154Q-248Q) -Down fragment, wherein the nucleotide sequence is shown as SEQ ID NO. 5.
After double digestion of the Up-ldhA (K154Q-248Q) -Down fragment obtained in step 3) and the suicide plasmid pRE112 with XbaI and SacI, the recombinant plasmid pRE112-Up-ldhA (K154Q-248Q) -Down containing the homology arm was formed by ligation with T4 ligase, and the recombinant plasmid was transformed into a recipient cell E.coli x7213 (method of example 1, step 3) by heat shock transformation, E.coli χ7213 was a DAP auxotroph strain, and 50. Mu.g/mL of DAP was added per mL of medium during cultivation. The E.coli χ7213 strain transferred into the recombinant plasmid is joined with the knockout strain E.coli BL21 (DE 3) delta ldhA of the ldhA and subjected to homologous recombination twice, and the lactate dehydrogenase gene ldhA on the genome is replaced by the K154Q-K248Q double mutant ldhA gene in situ through the mediation of suicide plasmid pRE112, so that the K154Q-K248Q double mutant strain (E.coli BL21 (DE 3) ldhA:: ldhA (K154Q-K248Q) is obtained (experimental group).
3) The ldhA knockout strain (control group 2) constructed in the step 1), the ldhA (K154Q-248Q) double mutant strain (experimental group) constructed in the step 2) and the wild-type E.coli BL21 (DE 3) strain (control group 1) were inoculated into test tubes of 3mL LB medium, respectively, and cultured overnight at 37 ℃. The strains after overnight culture are inoculated into 250mL shake flasks containing 50mL of 3HP fermentation medium according to the volume ratio of 1:50, and are continuously cultured for 48 hours at 37 ℃ at 180rpm, and the cells are sampled and tested for growth and lactic acid accumulation in the fermentation process.
As shown in FIG. 3, both the knock-out strain of ldhA and the double mutant strain of ldhA (K154Q-248Q) were able to control lactic acid at a level of 0.5g/L or less, whereas the lactic acid content of the wild strain was between 1.04g/L and 3.23 g/L. The knockout strain of ldhA and the double mutant strain of ldhA (K154Q-248Q) were superior to the control strain in terms of initial cell growth rate, but the cell biomass accumulation was kept constant after 24 hours, while the cell biomass accumulation of the wild strain and the double mutant strain of ldhA (K154Q-248Q) was continuously increased and similar levels were obtained. Thus, it was demonstrated that the ldhA (K154Q-248Q) double mutant strain achieved similar lactate inhibition ability to the ldhA knockout strain, but was significantly superior to the ldhA knockout strain in terms of cell growth and biomass accumulation.
EXAMPLE 4 use of K154Q-K248Q double mutant strains in 3-hydroxypropionic acid biosynthesis
This example will compare the differences in cell growth, lactate synthesis and 3-hydroxypropionic acid synthesis during fermentation of the bio-based chemical 3-hydroxypropionic acid by the wild E.coli BL21 (DE 3) strain, lactate dehydrogenase gene ldhA knockout strain and K154Q-K248Q double mutant strain. In this example, three experiments were performed to demonstrate the effects that can be achieved by the present invention.
The specific experimental method is as follows:
1) Competent cells of control group 1, control group 2 and experimental group in preparation example 3 were prepared using the competent index kit protocol.
2) The synthetic plasmids pA-accADBC and pMCR-N-C-N940V/K1106W/S1114R of 3-hydroxypropionic acid were respectively introduced into the three competent cells prepared in step 1) by the heat shock transformation method of reference example 1, and recombinant strains were obtained which were synthesized to 3-hydroxypropionic acid, respectively
Control group 1: e.coli BL21 (DE 3)/pA-accADBC/pMCR-N-C-N940V/K1106W/S1114R
Control group 2: e.coli BL21 (DE 3) ΔldhA/pA-accADBC/pMCR-N-C-N940V/K1106W/S1114R
Experimental group: e.coli BL21 (DE 3) ldhA:: ldhA (K154Q-K248Q)/pA-accADBC ≡
pMCR-N-C-N940V/K1106W/S1114R
The information and construction modes of the recombinant plasmids pA-accADBC and pMCR-N-C-N940V/K1106W/S1114R of the 3-hydroxypropionic acid are shown in Metabolic Engineering (2016) 104-111 in detail.
3) The recombinant strains of 3-hydroxypropionic acid obtained in step 2), namely the control group 1, the control group 2 and the experimental group strains described in this example, were inoculated into test tubes of 3mL LB medium, respectively, and cultured overnight at 37 ℃. The overnight cultured strains were inoculated into 250mL shake flasks containing 50mL3HP fermentation medium at a volume ratio of 1:50, cultured at 37℃at 180rpm until OD600 was about 0.8, protein expression was induced by the addition of 0.1M IPTG, and fermentation was continued at 30℃at 180rpm for 48h.
4) After the fermentation, the OD600 absorbance of the cells was measured using spectrophotometry, respectively. Meanwhile, 1mL of the fermentation broth was centrifuged at 12000rpm at 4℃for 10min, and the supernatant was filtered through a 0.22 μm filter membrane and the concentration of 3-hydroxypropionic acid and lactic acid was measured by HPLC.
The results of the fermentation of 3-hydroxypropionic acid are shown in FIG. 4, and the accumulation of lactic acid in experimental group and control group 2 are substantially identical, indicating that the ldhA double mutant strain regulated by the acetylation modification can achieve an effect similar to the ldhA gene knockout in inhibiting lactic acid synthesis. However, the 3-hydroxypropionic acid yield of the experimental group reached 2.05g/L, which was higher than 1.57g/L of the control group 1 and 1.79g/L of the control group 2. The K154Q-K248Q double mutant strain has wide application prospect in biosynthesis of 3-hydroxy propionic acid.
It will be appreciated by those skilled in the art that each of the above steps is performed according to standard molecular cloning techniques.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence list
<110> university of Shandong
<120> an acetylation-controlled lactic dehydrogenase mutant and use thereof
<141> 2022-05-05
<160> 5
<210> 1
<211> 272
<212> PRT
<213> artificial sequence
<221> amino acid sequence of acetylation-controlled lactic dehydrogenase K9R mutant
<222>（1）…（272）
<400> 1
MKLAVYSTRQ YDKKYLQQVN ESFGFELEFF DFLLTEKTAK TANGCEAVCI FVNDDGSRPV 60
LEELKKHGVK YIALRCAGFN NVDLDAAKEL GLKVVRVPAY DPEAVAEHAI GMMMTLNRRI 120
HRAYQRTRDA NFSLEGLTGF TMYGKTAGVI GTGKIGVAML RILKGFGMRL LAFDPYPSAA 180
ALELGVEYVD LPTLFSESDV ISLHCPLTPE NYHLLNEAAF EQMKNGVMIV NTSRGALIDS 240
QAAIEALKNQ KIGSLGMDVY ENERDLFFED KS 272
<210> 2
<211> 272
<212> PRT
<213> artificial sequence
<221> amino acid sequence of acetylation-controlled lactate dehydrogenase K154Q-K248Q double mutant
<222>（1）…（272）
<400> 2
MKLAVYSTKQ YDKKYLQQVN ESFGFELEFF DFLLTEKTAK TANGCEAVCI FVNDDGSRPV 60
LEELKKHGVK YIALRCAGFN NVDLDAAKEL GLKVVRVPAY DPEAVAEHAI GMMMTLNRRI 120
HRAYQRTRDA NFSLEGLTGF TMYGKTAGVI GTGQIGVAML RILKGFGMRL LAFDPYPSAA 180
ALELGVEYVD LPTLFSESDV ISLHCPLTPE NYHLLNEAAF EQMKNGVMIV NTSRGALIDS 240
QAAIEALQNQ KIGSLGMDVY ENERDLFFED KS 272
<210> 3
<211> 990
<212> DNA
<213> artificial sequence
<221> lactic dehydrogenase gene ldhA nucleotide sequence of K9R mutation
<222>（1）…（990）
<400> 3
atgaaactcg ccgtttatag cacacgtcag tacgacaaga agtacctgca acaggtgaac 60
gagtcctttg gctttgagct ggaatttttt gactttctgc tgacggaaaa aaccgctaaa 120
actgccaatg gctgcgaagc ggtatgtatt ttcgtaaacg atgacggcag ccgcccggtg 180
ctggaagagc tgaaaaagca cggcgttaaa tatatcgccc tgcgctgtgc cggtttcaat 240
aacgtcgacc ttgacgcggc aaaagaactg gggctgaaag tagtccgtgt tccagcctat 300
gatccagagg ccgttgctga acacgccatc ggtatgatga tgacgctgaa ccgccgtatt 360
caccgcgcgt atcagcgtac ccgtgatgct aacttctctc tggaaggtct gaccggcttt 420
actatgtatg gcaaaacggc aggcgttatc ggtaccggta aaatcggtgt ggcgatgctg 480
cgcattctga aaggttttgg tatgcgtctg ctggcgttcg atccgtatcc aagtgcagcg 540
gcgctggaac tcggtgtgga gtatgtcgat ctgccaaccc tgttctctga atcagacgtt 600
atctctctgc actgcccgct gacaccggaa aactatcatc tgttgaacga agccgccttc 660
gaacagatga aaaatggcgt gatgatcgtc aataccagtc gcggtgcatt gattgattct 720
caggcagcaa ttgaagcgct gaaaaatcag aaaattggtt cgttgggtat ggacgtgtat 780
gagaacgaac gcgatctatt ctttgaagat aaatccaacg acgtgatcca ggatgacgta 840
ttccgtcgcc tgtctgcctg ccacaacgtg ctgtttaccg ggcaccaggc attcctgaca 900
gcagaagctc tgaccagtat ttctcagact acgctgcaaa acttaagcaa tctggaaaaa 960
ggcgaaacct gcccgaacga actggtttaa 990
<210> 4
<211> 990
<212> DNA
<213> artificial sequence
<221> double mutant lactate dehydrogenase gene ldhA nucleotide sequence of K154Q-K248Q
<222>（1）…（990）
<400> 4
atgaaactcg ccgtttatag cacaaaacag tacgacaaga agtacctgca acaggtgaac 60
gagtcctttg gctttgagct ggaatttttt gactttctgc tgacggaaaa aaccgctaaa 120
actgccaatg gctgcgaagc ggtatgtatt ttcgtaaacg atgacggcag ccgcccggtg 180
ctggaagagc tgaaaaagca cggcgttaaa tatatcgccc tgcgctgtgc cggtttcaat 240
aacgtcgacc ttgacgcggc aaaagaactg gggctgaaag tagtccgtgt tccagcctat 300
gatccagagg ccgttgctga acacgccatc ggtatgatga tgacgctgaa ccgccgtatt 360
caccgcgcgt atcagcgtac ccgtgatgct aacttctctc tggaaggtct gaccggcttt 420
actatgtatg gcaaaacggc aggcgttatc ggtaccggtc agatcggtgt ggcgatgctg 480
cgcattctga aaggttttgg tatgcgtctg ctggcgttcg atccgtatcc aagtgcagcg 540
gcgctggaac tcggtgtgga gtatgtcgat ctgccaaccc tgttctctga atcagacgtt 600
atctctctgc actgcccgct gacaccggaa aactatcatc tgttgaacga agccgccttc 660
gaacagatga aaaatggcgt gatgatcgtc aataccagtc gcggtgcatt gattgattct 720
caggcagcaa ttgaagcgct gcagaatcag aaaattggtt cgttgggtat ggacgtgtat 780
gagaacgaac gcgatctatt ctttgaagat aaatccaacg acgtgatcca ggatgacgta 840
ttccgtcgcc tgtctgcctg ccacaacgtg ctgtttaccg ggcaccaggc attcctgaca 900
gcagaagctc tgaccagtat ttctcagact acgctgcaaa acttaagcaa tctggaaaaa 960
ggcgaaacct gcccgaacga actggtttaa 990
<210> 5
<211> 2351
<212> DNA
<213> artificial sequence
<221> nucleotide sequence of Up-ldhA (K154Q-248Q) -Down
<222>（1）…（2351）
<400> 5
cagttgctgg atatcagagg ttaatgcgag agagagtttt ccctgccatt cctgccaggg 60
agaaaaaatc agtttatcga tattgatcca ggtgttaggc agcatggact gccactgcgc 120
gagggttttt ggagcagctg gcgattgctc cgtctgcggc aatttcgcca gacaagcaga 180
atcaagttct accatgccga cgttcaataa ccagcggctg ggatgtgaaa ggctggcgtt 240
ggtgatatgc gcaagctgac aatctcccac cagataacgg agatcgggaa tgattaaacc 300
tttacgcgta atgcgtgggc tttcatctaa tgcaatacgt gtcccgagcg gtagccagat 360
gcccgccagc gtgggaaccc acagcccgag cgtcatcagc agcgtcaacg gcacaagaat 420
aatcagtaat aacagcgcga gaacggcttt atatttaccc agcatgggta gttaatatcc 480
tgatttagcg aaaaattaag cattcaatac gggtattgtg gcatgtttaa ccgttcagtt 540
gaaggttgcg cctacactaa gcatagttgt tgatgaattt ttcaatatcg ccatagcttt 600
caattatatt tgaaattttg taaaatattt ttagtagctt aaatgtgatt caacatcact 660
ggagaaagtc ttatgaaact cgccgtttat agcacaaaac agtacgacaa gaagtacctg 720
caacaggtga acgagtcctt tggctttgag ctggaatttt ttgactttct gctgacggaa 780
aaaaccgcta aaactgccaa tggctgcgaa gcggtatgta ttttcgtaaa cgatgacggc 840
agccgcccgg tgctggaaga gctgaaaaag cacggcgtta aatatatcgc cctgcgctgt 900
gccggtttca ataacgtcga ccttgacgcg gcaaaagaac tggggctgaa agtagtccgt 960
gttccagcct atgatccaga ggccgttgct gaacacgcca tcggtatgat gatgacgctg 1020
aaccgccgta ttcaccgcgc gtatcagcgt acccgtgatg ctaacttctc tctggaaggt 1080
ctgaccggct ttactatgta tggcaaaacg gcaggcgtta tcggtaccgg tcagatcggt 1140
gtggcgatgc tgcgcattct gaaaggtttt ggtatgcgtc tgctggcgtt cgatccgtat 1200
ccaagtgcag cggcgctgga actcggtgtg gagtatgtcg atctgccaac cctgttctct 1260
gaatcagacg ttatctctct gcactgcccg ctgacaccgg aaaactatca tctgttgaac 1320
gaagccgcct tcgaacagat gaaaaatggc gtgatgatcg tcaataccag tcgcggtgca 1380
ttgattgatt ctcaggcagc aattgaagcg ctgcagaatc agaaaattgg ttcgttgggt 1440
atggacgtgt atgagaacga acgcgatcta ttctttgaag ataaatccaa cgacgtgatc 1500
caggatgacg tattccgtcg cctgtctgcc tgccacaacg tgctgtttac cgggcaccag 1560
gcattcctga cagcagaagc tctgaccagt atttctcaga ctacgctgca aaacttaagc 1620
aatctggaaa aaggcgaaac ctgcccgaac gaactggttt aatcttgccg ctcccctgca 1680
acccagggga gctgattcag ataatcccca atgacctttc attctctatt cttaaaatag 1740
tcctgagtca gaaactgtaa ttgagaacca caatgaagaa agtagccgcg tttgttgcgc 1800
taagcctgct gatggcggga tgtgtaagta atgacaaaat tgctgttacg ccagaacagc 1860
tacagcatca tcgctttgtg ctggaaagcg taaacggtaa gcccgtgacc agcgataaaa 1920
atccgccaga aatcagcttt ggtgaaaaaa tgatgatttc cggcagcatg tgtaaccgct 1980
ttagcggtga aggcaaactg tctaatggtg aactgacagc caaagggctg gcaatgaccc 2040
gtatgatgtg cgctaacccg cagcttaatg aactcgataa caccattagc gaaatgctga 2100
aagaaggtgc acaagtggat ctgaccgcga accagttaac gctggcgacc gcgaaacaga 2160
cattaactta taagctggcg gatttaatga attaatagct gccacagctc ccggcggcaa 2220
gtgactgttc gctacagcgt ttgccgttgg gtaatgcaca catcccaatc gccgtaccat 2280
ccagttgacg ggcaacagaa agcgaaccgc cgatcattgc acaatttgct tctccactac 2340
tggacatcga c 2351
Claims (10)
1. An acetylation-regulated lactate dehydrogenase mutant, characterized in that: the mutant is formed by mutating lysine at position 9 of lactic dehydrogenase LdhA protein into arginine, and is named as K9R mutant, and the amino acid sequence of the mutant is shown as SEQ ID NO. 1.
2. Use of the acetylation-regulated lactate dehydrogenase mutant according to claim 1 for increasing the synthesis of lactate.
3. An expression strain of an acetylation-regulated lactate dehydrogenase K9R mutant according to claim 1, characterized in that: the strain carries a K9R mutated lactate dehydrogenase gene ldhA shown in SEQ ID NO. 3.
4. An expression strain of an acetylation-regulated lactate dehydrogenase K9R mutant according to claim 3, wherein: the expression strain is a strain named E.coli BL21 (DE 3)/pETDuet 1-ldhA (K9R).
5. Use of an expression strain of a K9R mutant according to claim 3 or 4 for increasing lactic acid production and conversion efficiency.
6. An acetylation-regulated lactate dehydrogenase double mutant, characterized in that: the double mutant is formed by mutating lysine at 154 th and 248 th positions of lactate dehydrogenase LdhA protein into glutamine, and is named as K154Q-K248Q double mutant, and the amino acid sequence of the double mutant is shown as SEQ ID NO. 2.
7. Use of the acetylation-regulated lactate dehydrogenase double mutant according to claim 6 for inhibiting the synthesis of lactate.
8. An acetylation-regulated lactate dehydrogenase K154Q-K248Q double mutant strain according to claim 6, wherein: the lactic dehydrogenase gene ldhA of genome in the strain is mutated and replaced in situ by the lactic dehydrogenase gene ldhA of double mutation of K154Q-K248Q shown in SEQ ID NO.4, and the strain is named as E.coli BL21 (DE 3) ldhA:: ldhA (K154Q-K248Q).
9. Use of the K154Q-K248Q double mutant strain of claim 8 for inhibiting synthesis of lactic acid.
10. Use of the K154Q-K248Q double mutant strain according to claim 8 in 3-hydroxypropionic acid biosynthesis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210485169.5A CN114921429B (en) | 2022-05-06 | 2022-05-06 | Acetylation-regulated lactate dehydrogenase mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210485169.5A CN114921429B (en) | 2022-05-06 | 2022-05-06 | Acetylation-regulated lactate dehydrogenase mutant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114921429A CN114921429A (en) | 2022-08-19 |
| CN114921429B true CN114921429B (en) | 2023-09-19 |
Family
ID=82806568
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210485169.5A Active CN114921429B (en) | 2022-05-06 | 2022-05-06 | Acetylation-regulated lactate dehydrogenase mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114921429B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11725026B2 (en) * | 2019-06-28 | 2023-08-15 | The Research Foundation For The State University Of New York | Compositions and methods for inhibiting lactate dehydrogenase a activity |
-
2022
- 2022-05-06 CN CN202210485169.5A patent/CN114921429B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| HBE2817393.1;NCBI;Genbank;第1页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114921429A (en) | 2022-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101827230B1 (en) | Method for the preparation of diols | |
| CN107384846B (en) | Microorganisms for producing 1, 4-butanediol and related methods | |
| EP3201326B1 (en) | Mutant glutamate dehydrogenase for the conversion of homoserine into 4-hydroxy-2-ketobutyrate | |
| CN108795916B (en) | Lysine decarboxylase mutant, coding gene thereof, expression and application thereof | |
| US20140065697A1 (en) | Cells and methods for producing isobutyric acid | |
| KR20220139351A (en) | Modified Microorganisms and Methods for Improved Production of Ectoins | |
| CN114026246A (en) | Production of chemicals from renewable sources | |
| CN107384847B (en) | Recombinant bacterium for producing ethylene glycol by efficiently converting xylose and application thereof | |
| CN114807206B (en) | Bacterial strain for synthesizing poly (3-hydroxybutyrate-co-4-hydroxybutyrate) and construction method and application thereof | |
| CN113817782B (en) | Full biosynthesis method of pimelic acid | |
| KR102149044B1 (en) | Method of producing 2-hydroxy gamma butyrolactone or 2,4-dihydroxybutanoic acid | |
| CN104630100A (en) | Reconstructed Klebsiella pneumoniae and application of reconstructed Klebsiella pneumoniae in production of R-acetoin | |
| EP2297329B1 (en) | Method of l-lysine production | |
| CN114921429B (en) | Acetylation-regulated lactate dehydrogenase mutant and application thereof | |
| CN110656075B (en) | Universal underpan cell for synthesizing acetyl coenzyme A derivative product and construction method and application thereof | |
| CN110904018B (en) | 5-aminolevulinic acid production strain and construction method and application thereof | |
| CN106929527B (en) | Genetically engineered bacterium with high phloroglucinol synthesis capacity, and construction method and application thereof | |
| US11760988B2 (en) | L-aspartate alpha-decarboxylase mutant and application thereof | |
| CN115927147A (en) | Method for improving antioxidant activity of lactococcus lactis and application thereof | |
| KR20190097250A (en) | Conversion of methylglyoxal to hydroxyacetone using a novel enzyme and its application | |
| CN113913317A (en) | Recombinant saccharomyces cerevisiae and method for improving enzymatic activity of glucose dehydrogenase displayed on surface of recombinant saccharomyces cerevisiae | |
| KR102277907B1 (en) | Microorganism having increased α-ketoglutarate decarboxylase activity and method for producing 1,4-butanediol using same | |
| CN113528495A (en) | Bacillus subtilis for stably expressing chitobiose deacetylase and construction method and application thereof | |
| WO2019168203A1 (en) | Method for producing 4-aminocinnamic acid, and vector and host cell used in same | |
| CN113832087A (en) | Method for full-biological synthesis of malonic acid by using escherichia coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |