CN114908084A - Primer probe for polyspora oxysporum, aspergillus terreus and aspergillus nidulans and application thereof - Google Patents

Primer probe for polyspora oxysporum, aspergillus terreus and aspergillus nidulans and application thereof Download PDF

Info

Publication number
CN114908084A
CN114908084A CN202210362001.5A CN202210362001A CN114908084A CN 114908084 A CN114908084 A CN 114908084A CN 202210362001 A CN202210362001 A CN 202210362001A CN 114908084 A CN114908084 A CN 114908084A
Authority
CN
China
Prior art keywords
seq
probe
aspergillus
primer
oxysporum
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210362001.5A
Other languages
Chinese (zh)
Inventor
夏江
高学娟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pilot Gene Technologies Hangzhou Co ltd
Original Assignee
Pilot Gene Technologies Hangzhou Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pilot Gene Technologies Hangzhou Co ltd filed Critical Pilot Gene Technologies Hangzhou Co ltd
Priority to CN202210362001.5A priority Critical patent/CN114908084A/en
Publication of CN114908084A publication Critical patent/CN114908084A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides primer probes for detecting polyspora oxysporum, aspergillus terreus and aspergillus nidulans and application thereof, and provides the primer probes for detecting the polyspora oxysporum, the aspergillus terreus and the aspergillus nidulans, and the primer probes are designed for specific regions of ITS of the polyspora oxysporum, the aspergillus terreus and the aspergillus nidulans, and can be combined with a digital PCR technology to quickly detect the polyspora oxysporum, the aspergillus terreus and the aspergillus nidulans.

Description

Primer probe for polyspora oxysporum, aspergillus terreus and aspergillus nidulans and application thereof
Technical Field
The invention relates to the field of biological detection, and particularly relates to a primer probe for polyspora oxysporum, aspergillus terreus and aspergillus nidulans and application thereof.
Background
The fusarium oxysporum is a conditional pathogen with strong invasiveness and pathogenicity, widely exists in polluted environments such as soil, sewage, saprophytes and the like, can invade various organs of a human body to cause various disease forms, and often causes lethal infection. Currently, it is very difficult to diagnose infection with cladosporium cucumerinum clinically because its clinical features and histopathology are very similar to aspergillosis, fusarium disease and other common clear-cut myceliophthora diseases. At present, the mode of diagnosing the neurospora oxysporum is mostly a mode of fungus culture, and as the neurospora oxysporum grows well on a conventional fungus culture medium, but an aspergillus strain cannot grow, the mode is taken as a means for distinguishing the neurospora oxysporum from the aspergillus, but the fungus culture is difficult and grows slowly, and the aspergillosis strain and the neurospora oxysporum cannot be accurately distinguished; in addition, various modes such as histocompatibility, histopathology, radiology, serology and molecular identification are adopted, wherein molecular identification represented by PCR detection can quickly and accurately detect the cyadopsis cepacia, but in consideration of great variability among strains of the strains, a relatively stable interval is required to be selected to successfully detect the genotype similar to the cyadopsis cepacia, namely, the current technology for detecting the cyadopsis cepacia by utilizing the PCR technology still has a technical bottleneck, and if the cyadopsis cepacia cannot be detected, the cyadopsis cepacia cannot be treated in a targeted manner, so that the treatment efficiency of a patient is poor.
In addition, aspergillosis is also a common disease that causes lung disease or damages the immune system in humans. Aspergillosis is usually caused by aspergillus, and the current main method for detecting aspergillus infection is GM detection, which has the disadvantage that influence by certain foods or drugs can cause false positive results. Although there have been related technical studies for detecting aspergillus by PCR, there are still differences between different aspergilli, and there are currently no technical studies for detecting aspergillus of the subfamily aspergillus clinically.
Disclosure of Invention
The invention aims to provide a primer probe for detecting the neurospora oxysporum, the aspergillus terreus and the aspergillus nidulans and application thereof, and provides the primer probe for detecting the neurospora oxysporum, the aspergillus terreus and the aspergillus nidulans, and the primer probe is combined with a digital PCR technology to quickly detect the neurospora oxysporum, the aspergillus terreus and the aspergillus nidulans.
In a first aspect, the present disclosure provides a primer probe for neurospora oxysporum, comprising: primers of nucleotide sequences shown by SEQ ID NO 1-2 and probes of nucleotide sequences shown by SEQ ID NO 3.
Wherein SEQ ID NO: the forward primer shown in 1 is: CGGTTGCCTTCTGCGTAGTAA, respectively;
SEQ ID NO: the reverse primers shown in 2 are: CGCCGGGACCCAATG, respectively;
SEQ ID NO: the probes shown in FIG. 3 were: TCTCTTTTGCAAGCTC is added.
The conserved region SCE-STD design for the Sporopsis tipicola was: 136bp, and the specific sequence is:
CTCGCGACCCCCGTAGGCCCTGAAATACAGTGGCGGTCCCGCCGCGGTTGCCTTCTGCGTAGTA AGTCTCTTTTGCAAGCTCGCATTGGGTCCCGGCGGAGGCCTGCCGTCAAACCACCTAACAACTCCAGA TGGTTGACC。
SEQ ID NO: the 5' end of the probe shown in 3 is marked with a fluorescence reporter group FAM, and the 3 end is marked with a fluorescence quenching group MGB.
In a second aspect, the present disclosure provides a primer probe for aspergillus terreus, comprising: primers of the nucleotide sequences shown in SEQ ID NO 4-5 and probes of the nucleotide sequences shown in SEQ ID NO 6.
Wherein SEQ ID NO: the forward primers shown in 4 are: GTACCTTGTTGCTTCGGCG, respectively;
SEQ ID NO: the reverse primers shown in 5 are: GGGTTCATGTTGGGGTCTCC, respectively;
SEQ ID NO: the probes shown in FIG. 6 were: CGCCAGCGTTGCT are provided.
The conserved region TER-STD design aiming at the aspergillus terreus is characterized in that the length of the conserved region is as follows: 199bp, and the specific sequence is:
TCTTTATGGCCACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTT GCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTC TGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTT CCGGCAT。
SEQ ID NO: the 5' end of the probe shown in 6 is marked with a fluorescence reporter group ROX, and the 3 end is marked with a fluorescence quenching group MGB.
In a third aspect, the present disclosure provides a primer probe for aspergillus nidulans, comprising: primers of the nucleotide sequences shown in SEQ ID NO 7-8 and probes of the nucleotide sequences shown in SEQ ID NO 9.
Wherein SEQ ID NO: the forward primers shown in 7 are: GCGAACTGCGATAAGTAATGTGA, respectively;
SEQ ID NO: the reverse primers shown in 8 are: TGAACGCACATTGCGCC, respectively;
SEQ ID NO: the probes shown in fig. 9 were: TTCAGTGAATCATCGAGTCT are provided.
Designed against the conserved region NID-STD of A.nidulans, the length of the conserved region is: 133bp, and the specific sequence is:
GTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGA ATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCAT TGCTGC。
SEQ ID NO: the 5' end of the probe shown in 9 is marked with a fluorescence reporter group CY5-MGB, and the 3 end is marked with a fluorescence quenching group MGB.
In a fourth aspect, the scheme also provides a primer probe set capable of simultaneously detecting the neurospora oxysporum, the aspergillus nidulans and the aspergillus terreus, wherein the primer set comprises the SEQ ID NO 1-2, the SEQ ID NO 4-5 and the SEQ ID NO 7-8, and the probe set comprises the SEQ ID NO 3, the SEQ ID NO 6 and the SEQ ID NO 9, wherein the primers of the SEQ ID NO 1-2 are opposite to the probe of the SEQ ID NO 3, the primers of the SEQ ID NO 4-5 are opposite to the probe of the SEQ ID NO 6, and the primers of the SEQ ID NO 7-8 are opposite to the probe of the SEQ ID NO 9.
In addition, the kit provided by the scheme also comprises a primer and a probe for detecting the exogenous internal reference;
the nucleotide sequence of the primer for detecting the exogenous internal reference is shown as SEQ ID NO. 10-11;
SEQ ID NO: the forward primers shown in 10 are: GCTTCTTGTGGAGCTCGACAA, respectively;
SEQ ID NO: the reverse primers shown in 11 are: ccgtcagcaacttcgttttca, respectively;
the nucleotide sequence of the probe for detecting the exogenous internal reference is shown as SEQ ID NO. 12
SEQ ID NO: the probes shown in FIG. 12 were: CGCGACGGATCTACGTCACAGCG are provided.
Wherein, SEQ ID NO:10-11 and SEQ ID NO:12, designing a probe exogenous internal reference IC-S, wherein the sequence of the IC-S is as follows:
TCACAATCTTGACCTGCACGGCAAAGAGACGCTTCTTGTGGAGCTCGACAACGCAACAACGCGA CGGATCTACGTCACAGCGAGTATAGTGAAAACGAAGTTGCTGACGGCGGAAGCGACATAGGGATCTGT CAGTTGTCATTCGCGAAA。
in a fifth aspect, the kit provided by the scheme can be used for detection of a digital PCR platform, is suitable for detection of various samples, can be used for detection of samples such as sputum and alveolar lavage fluid, and can also be used for detection of food samples and water samples.
Specifically, the scheme provides a method for detecting the staurosporium oxysporum, the aspergillus nidulans and the aspergillus terreus: using DNA of a sample to be detected as a template, adopting a primer group comprising SEQ ID NO 1-2, SEQ ID NO 4-5 and SEQ ID NO 7-8, and a probe group comprising SEQ ID NO 3, SEQ ID NO 6 and SEQ ID NO 9 as described above to amplify, wherein if the SEQ ID NO 1-2 and the SEQ ID NO 3 can realize specific amplification of the DNA of the sample to be detected, the sample to be detected contains the fusarium oxysporum; if the specific amplification of the DNA of the sample to be detected can be realized by SEQ ID NO 4-5 and SEQ ID NO 6, the sample to be detected contains aspergillus terreus; (ii) a If the specific amplification of the DNA of the sample to be detected can be realized by SEQ ID NO 7-8 and SEQ ID NO 9, the sample to be detected contains Aspergillus nidulans. Wherein the procedure for amplification is: 5min at 98 ℃ [ 98 ℃ 15s, 60 ℃ 30s ] 40.
The invention is not particularly limited to the extraction reagent for extracting the DNA of the sample to be detected, and in a specific embodiment, the extraction reagent for extracting the DNA of the sample to be detected is a magnetic bead method DNA extraction reagent.
Compared with the prior art, the technical scheme selects the specific region of the ITS region (internal transcribed spacer region) of the ribosomal gene group of each strain of the Hipposporus tipentosus, the aspergillus terreus and the aspergillus nidulans, the ITS region has higher copy number in the ribosomal RNA gene group, compared with a primer probe with similar amplification efficiency of a single copy gene SCW4, the detection value is greatly improved under the condition that a target bacterial genome template with the same concentration is added in the same system, and the sensitivity in pathogenic bacteria detection can be greatly improved. And through a large number of specific regions screened by experiments, the strains detected by the scheme are not crossed with other strains.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments that can be derived by one of ordinary skill in the art from the embodiments given herein are intended to be within the scope of the present invention.
Example one
Designing a primer probe group:
designing a pair of primers and a probe by using Primer Express software according to sequence analysis results of the staurosporium acremonium, aspergillus terreus and aspergillus nidulans; meanwhile, a group of primer probes of exogenous internal reference are matched, and the following table I shows that:
TABLE-primer Probe combination sequences
Figure BDA0003585654040000061
Figure BDA0003585654040000071
Example two: sample detection
2.1 three types of samples were selected:
bacterial DNA samples: externally purchasing dead bacteria, and extracting genome DNA by a magnetic bead method;
human DNA samples: extracting genome DNA by a magnetic bead method by using sterile sputum/alveolar lavage fluid;
exogenous internal reference template: synthesized by biological companies, and dissolved and diluted for later use.
2.2 design of digital PCR amplification System:
the amplification system is shown in table two below:
probe mixture of primer II
Figure BDA0003585654040000072
Figure BDA0003585654040000081
2.3 design of ddPCR reaction System
The ddPCR reaction system is shown in Table III below:
TABLE TRIDDPCR reaction System
Reagent Volume (μ L) Final concentration
Water (W) 4.85
5XddPCR Mix 3 1X
IC-S 1
DNA 5
Total up to 15
2.4 amplification procedure:
98℃5min【98℃15s，60℃30s】*40。
the following samples were subjected to digital PCR detection according to the primer probes of example 1 and the conditions of example 2, and the results are shown in Table four.
Table four test results
Figure BDA0003585654040000082
Figure BDA0003585654040000091
The results show that the specificity of the system for detecting various common bacterial fungi is normal, and the stability of detecting the three repeats of the staurosporium tipitatum, the aspergillus terreus and the aspergillus nidulans is also better.
EXAMPLE three primer Probe amplification efficiency detection
The scheme selects a specific region of an ITS region, compares the specific region with the amplification efficiency of a single copy gene SCW4, selects the target bacterial genome template with the same system and the same concentration, and has the detection result shown in the table five
Table five detection efficiency comparison
Figure BDA0003585654040000092
Figure BDA0003585654040000101
The results show that the optimal primer probe concentration screened by the scheme is subjected to qPCR with the concentrations of the above 3 artificially synthesized DNA templates, and the Ct value is increased by about 3 once the result concentration is reduced by 10 times. Since the power of 3.3 of 2 is equal to 10, the amplification efficiency of the primer probe in the system is close to 100%.
Example four primer Probe amplification efficiency test
4 samples of sputum positive for A.terreus and A.nidulans were also assayed using the primer-probe system corresponding to the ITS and SCW4 regions of example three. After extraction with the sputum DNA extraction reagent TF1, 5. mu.l of each system was loaded as a template. The measured values are shown in the following table six
Six detection values of the meter
Figure BDA0003585654040000102
It can be seen that when the sample concentration is higher, the same sample is added with the template with the same volume, and the detection value of the ITS primer probe system is 5-7 times that of the SCW4 primer probe system; at lower sample concentrations, the sample concentration is not detected by the SCW4 primer probe system, and the detection by the ITS primer probe system is above the detection threshold.
Example five blank detection Limit (LoB) values
Extracting 20 parts of deionized water every day, using the deionized water as a template, continuously performing three days above different amplifications, analyzing whether the detection result is in normal distribution or not by using a sps 23.0 software S-W except that all detection values are 0, and analyzing LoB values by using a parametric method if the detection result is in normal distribution; if not, LoB values were analyzed nonparametric. The results are shown in Table six below
Detection limit of six blank in the table (LoB)
Aspergillus terreus Aspergillus niger All-grass of Spodoptera frugiperda
Day one 0.35 0.83 0
The next day 0.46 0.62 0
The third day 0.39 0.47 0
The maximum of the 3 calculations was taken to be a value of LoB, i.e., 0.46 copies/. mu.l for A.terreus, 0.83 copies/. mu.l for A.niger and 0 copies/. mu.l for Tourospora oxysporum.
Example six lowest detection Limit (LoD)
If LoB is equal to 0, a probability unit scheme is adopted; if LoB ≠ 0, the classical approach is employed. The largest LOD of 3 reagent batches was formulated as the final reported value.
1.1.1 probability Unit scheme
Using ultrapure water as a substrate, DNAs of different target bacteria at known concentrations were incorporated, respectively, to prepare positive specimens. Then, the samples were diluted with ultrapure water in a gradient manner.
The same set of instruments including a droplet generation instrument, a PCR amplification instrument and a chip reader are used, and 3 batch number reagents are used for respectively and repeatedly detecting different concentration gradients of each target bacterium sample for 30 times.
And respectively calculating the positive detection rate of each concentration gradient of each target bacteria specimen, and selecting the lowest concentration with the positive detection rate of more than or equal to 95 percent as the LoD value of each target bacteria.
1.1.2 classical protocol
Using ultrapure water as a substrate, DNAs of different target bacteria at known concentrations were incorporated, respectively, to prepare positive specimens. Then, the samples were diluted with respective ultrapure water to five concentrations of 1 × LoB, 2 × LoB, 3 × LoB, 4 × LoB and 5 × LoB, respectively, and used as low-value specimens.
The same set of instruments including a droplet generation instrument, a PCR amplification instrument and a chip reader are used, 3 batch number reagents are used, five low-value samples of each target bacterium are repeatedly detected for at least 12 times respectively, and the measurement results of at least 60 low-value samples are counted.
Respectively calculating LoD values of the target bacteria, wherein the method comprises the following steps:
1) the data distribution of at least 60 low value specimen measurements per lot of reagent is analyzed.
2) If the data are normally distributed, a parameter statistical method is adopted for analysis.
3) If the data are distributed in a biased state, a nonparametric statistical method is adopted for analysis.
The results are shown in table seven below:
detection limit for watch seven blank (LoD)
Figure BDA0003585654040000121
The present invention is not limited to the above-mentioned preferred embodiments, and any other products in various forms can be obtained by anyone in the light of the present invention, but any changes in the shape or structure thereof, which have the same or similar technical solutions as those of the present application, fall within the protection scope of the present invention.
SEQUENCE LISTING
<110> pilotage Gene science and technology (Hangzhou) Co., Ltd
<120> primer probe for Staurosporium tipitatum, Aspergillus terreus and Aspergillus nidulans and application thereof
<130> HZPZL1220639
<160> 12
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
cggttgccttc tgcgtagtaa 20
<210> 2
<211> 14
<212> DNA
<213> Artificial sequence
<400> 2
cgccgggaccc aatg 14
<210> 3
<211> 16
<212> DNA
<213> Artificial sequence
<400> 3
tctcttttgc aagctc 16
<210> 4
<211> 19
<212> DNA
<213> Artificial sequence
<400> 4
gtaccttgtt gcttcggcg 19
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<400> 5
gggttcatgt tggggtctcc 20
<210> 6
<211> 13
<212> DNA
<213> Artificial sequence
<400> 6
cgccagcgtt gct 13
<210> 7
<211> 23
<212> DNA
<213> Artificial sequence
<400> 7
gcgaactgcg ataagtaatg tga 23
<210> 8
<211> 17
<212> DNA
<213> Artificial sequence
<400> 8
tgaacgcaca ttgcgcc 17
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<400> 9
ttcagtgaat catcgagtct 20
<210> 10
<211> 21
<212> DNA
<213> Artificial sequence
<400> 10
gcttcttgtg gagctcgacaa 21
<210> 11
<211> 36
<212> DNA
<213> Artificial sequence
<400> 11
ccgtcagcaa cttcgttttca 21
<210> 12
<211> 23
<212> DNA
<213> Artificial sequence
<400> 12
cgcgacggat ctacgtcacagcg 23

Claims (10)

1. A primer probe for detecting the neurospora oxysporum is characterized by comprising the following components: primers of nucleotide sequences shown by SEQ ID NO 1-2 and a probe of nucleotide sequence shown by SEQ ID NO 3.
2. The primer probe of claim 1, wherein the primer probe of SEQ ID NO:3 is marked with a fluorescence reporter group FAM at the 5 'end and a fluorescence quencher group MGB at the 3' end.
3. A primer probe for detecting Aspergillus terreus, comprising: primers of the nucleotide sequences shown in SEQ ID NO 4-5 and probes of the nucleotide sequences shown in SEQ ID NO 6.
4. The primer probe for detecting aspergillus terreus according to claim 3, characterized in that the nucleotide sequence of SEQ ID NO: the 5' end of the probe shown in 6 is marked with a fluorescence reporter group ROX, and the 3 end is marked with a fluorescence quenching group MGB.
5. A primer probe for Aspergillus nidulans, comprising: primers of nucleotide sequences shown by SEQ ID NO 7-8 and a probe of nucleotide sequence shown by SEQ ID NO 9.
6. The A.nidulans primer probe according to claim 5, characterized in that SEQ ID NO: the 5' end of the probe shown in 9 is marked with a fluorescence reporter group CY5-MGB, and the 3 end is marked with a fluorescence quenching group MGB.
7. A kit for detecting Aspergillus terreus, Aspergillus nidulans and Neurospora oxysporum, comprising the primer probes described in at least two of the genera of claims 1 to 6.
8. The kit for the spores of Aspergillus terreus, and Aspergillus nidulans of claim 7, comprising primers and probes for detecting exogenous internal references;
the nucleotide sequence of the primer for detecting the exogenous internal reference is shown as SEQ ID NO. 10-11;
the nucleotide sequence of the probe for detecting the exogenous internal reference is shown as SEQ ID NO. 12.
9. The kit of claim 7, wherein the primer probe is designed to the ITS region of the ribosomal genome of each species of the Neurospora oxysporum, Aspergillus terreus, and Aspergillus nidulans.
10. A method for detecting Sedum oxysporum, Aspergillus terreus and Aspergillus nidulans is characterized in that DNA of a sample to be detected is used as a template, a primer group comprising the above-mentioned SEQ ID NO 1-2, SEQ ID NO 4-5 and SEQ ID NO 7-8 is adopted, a probe group comprising the above-mentioned primer probe groups of SEQ ID NO 3, SEQ ID NO 6 and SEQ ID NO 9 is used for amplification, and if the SEQ ID NO 1-2 and the SEQ ID NO 3 can realize specific amplification of the DNA of the sample to be detected, the sample to be detected contains the Sedum oxysporum; if the specific amplification of the DNA of the sample to be detected can be realized by SEQ ID NO 4-5 and SEQ ID NO 6, the sample to be detected contains aspergillus terreus; if the SEQ ID NO 7-8 and the SEQ ID NO 9 can realize specific amplification of the DNA of the sample to be detected, the sample to be detected contains aspergillus nidulans.
CN202210362001.5A 2022-04-07 2022-04-07 Primer probe for polyspora oxysporum, aspergillus terreus and aspergillus nidulans and application thereof Pending CN114908084A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210362001.5A CN114908084A (en) 2022-04-07 2022-04-07 Primer probe for polyspora oxysporum, aspergillus terreus and aspergillus nidulans and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210362001.5A CN114908084A (en) 2022-04-07 2022-04-07 Primer probe for polyspora oxysporum, aspergillus terreus and aspergillus nidulans and application thereof

Publications (1)

Publication Number Publication Date
CN114908084A true CN114908084A (en) 2022-08-16

Family

ID=82763436

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210362001.5A Pending CN114908084A (en) 2022-04-07 2022-04-07 Primer probe for polyspora oxysporum, aspergillus terreus and aspergillus nidulans and application thereof

Country Status (1)

Country Link
CN (1) CN114908084A (en)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007062442A2 (en) * 2005-11-30 2007-06-07 St. Anna Kinderkrebsforschung Detection of fungi
US20100129821A1 (en) * 2008-11-26 2010-05-27 Fred Hutchinson Cancer Research Center Broad range pcr-based compositions and methods for the detection and identification of fungal pathogens
CN102031296A (en) * 2010-08-18 2011-04-27 李国辉 DNA probe for detecting aspergillus nidulans, gene chip and application thereof
CN102031300A (en) * 2010-08-18 2011-04-27 李国辉 DNA probe and gene chip for detecting aspergillus terreus and application thereof
CN105018575A (en) * 2014-04-18 2015-11-04 安徽理工大学 Application of multiplex PCR (polymerase chain reaction) in fungal detection of septicemia
CN112725475A (en) * 2021-01-05 2021-04-30 四川大学华西医院 Mycobacterium tuberculosis detection primer, probe composition, kit and application
CN112813196A (en) * 2020-12-31 2021-05-18 广州微远基因科技有限公司 Capture probe set, method and kit for detecting pathogenic microorganisms and application
CN113106167A (en) * 2021-04-26 2021-07-13 北京大学第一医院 Primer and probe for invasive aspergillosis pathogenic bacteria, implementation method and detection system thereof

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007062442A2 (en) * 2005-11-30 2007-06-07 St. Anna Kinderkrebsforschung Detection of fungi
US20100129821A1 (en) * 2008-11-26 2010-05-27 Fred Hutchinson Cancer Research Center Broad range pcr-based compositions and methods for the detection and identification of fungal pathogens
CN102031296A (en) * 2010-08-18 2011-04-27 李国辉 DNA probe for detecting aspergillus nidulans, gene chip and application thereof
CN102031300A (en) * 2010-08-18 2011-04-27 李国辉 DNA probe and gene chip for detecting aspergillus terreus and application thereof
CN105018575A (en) * 2014-04-18 2015-11-04 安徽理工大学 Application of multiplex PCR (polymerase chain reaction) in fungal detection of septicemia
CN112813196A (en) * 2020-12-31 2021-05-18 广州微远基因科技有限公司 Capture probe set, method and kit for detecting pathogenic microorganisms and application
CN112725475A (en) * 2021-01-05 2021-04-30 四川大学华西医院 Mycobacterium tuberculosis detection primer, probe composition, kit and application
CN113106167A (en) * 2021-04-26 2021-07-13 北京大学第一医院 Primer and probe for invasive aspergillosis pathogenic bacteria, implementation method and detection system thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MARIA V. CASTELLI ET AL.: "Development and Validation of a Quantitative PCR Assay for Diagnosis of Scedosporiosis", 《JOURNAL OF CLINICAL MICROBIOLOGY》, vol. 46, no. 10, pages 3412 - 3416 *

Similar Documents

Publication Publication Date Title
Iwen et al. Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens
CN111500771B (en) Primer group and kit for detecting novel coronavirus SARS-CoV-2
CN111020062A (en) Triple real-time fluorescent quantitative PCR kit for detecting African swine fever wild strain and gene deletion strain
CN111074005A (en) Double-target-site reverse transcription fluorescence PCR primer, probe and kit for detecting 2019 novel coronavirus
CN114085903B (en) Primer pair probe combination product for detecting mitochondria 3243A &amp; gtG mutation, kit and detection method thereof
CN114958837B (en) Primer composition, kit and method for rapidly and accurately detecting candida auricula
CN115820921A (en) Primer probe combination for detecting three kinds of lung invasive fungi and digital PCR kit thereof
CN113005226A (en) Oligonucleotide and kit for detecting SARS-CoV-2
CN115820922A (en) Primer probe combination and kit for detecting cryptococcus
CN114134219A (en) Multiple nucleic acid detection system and preparation method and application thereof
CN113046452B (en) Composition for detecting Boeck hollandia farci and application thereof
CN113755619A (en) Digital PCR detection kit for Burkholderia
CN111004862B (en) Primer and probe for rapidly detecting and identifying cryptococcus and application thereof
CN113862393A (en) Method for rapidly detecting cryptococcus gatherensis
CN115961070A (en) Primer probe combination and kit for detecting aspergillus
CN114908084A (en) Primer probe for polyspora oxysporum, aspergillus terreus and aspergillus nidulans and application thereof
CN112795673B (en) CRISPR (clustered regularly interspaced short palindromic repeats) detection method for Cronobacter in food and kit thereof
CN109868329B (en) Screening, quarantine and identification method of colletotrichum specific primers
CN111647683A (en) New coronavirus 2019-nCoV nucleic acid detection kit and application thereof
CN114908181A (en) Primer probe for detecting candida keratolytica and candida Norwegian and application thereof
CN114908085A (en) Primer, probe and kit for PCR detection of rhizopus
CN116445476A (en) Primer probe set and kit
CN109207623B (en) Fluorescent PCR (polymerase chain reaction) primer, probe and detection kit for identifying three sporothrix bacteria
CN112708658B (en) Liquid chip primer group for detecting multiple drug-resistant genes and application thereof
CN111411164B (en) Method for detecting tomato canker pathogen by using digital PCR and kit reagent used by method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination