CN114907982B

CN114907982B - Chlorella mutant strain and high-density heterotrophic culture method and application thereof

Info

Publication number: CN114907982B
Application number: CN202210257048.5A
Authority: CN
Inventors: 韩丹翔; 陈桥红
Original assignee: Demeter Biotechnology Zhuhai Co ltd
Current assignee: Demeter Biotechnology Zhuhai Co ltd
Priority date: 2022-03-16
Filing date: 2022-03-16
Publication date: 2023-07-25
Anticipated expiration: 2042-03-16
Also published as: CN114907982A

Abstract

The invention relates to a chlorella mutant strain which can produce lutein, zeaxanthin and beta-carotene under heterotrophic culture conditions, named chlorella CZ-LZM3, which is preserved in China center for type culture collection (CCTCC No) in 12 months of 2021: m20211675, the preservation address is No. 299 of Wuchang district of Wuhan, hubei province. The chlorella mutant strain CZ-LZM3 inherits the excellent characteristics of the chlorella suitable for rapid and high-density heterotrophic culture, and simultaneously has the characteristics of high yield of lutein, zeaxanthin and beta-carotene which are not possessed by the WT type chlorella; during culture, a proper heterotrophic culture condition is provided for accumulating a large amount of biomass, and a special induction means is combined on the premise of obtaining a large amount of biomass to promote the accumulation of lutein, zeaxanthin and beta-carotene with higher specific gravity in a single cell. The technical scheme of the invention provides technical support for commercial production of lutein, zeaxanthin, beta-carotene and other natural pigments by using chlorella.

Description

Chlorella mutant strain and high-density heterotrophic culture method and application thereof

Technical Field

The invention relates to the technical field of microalgae seed cultivation, and relates to a chlorella mutant strain for heterotrophically cultivating lutein, zeaxanthin and beta-carotene and application thereof.

Background

Lutein, zeaxanthin and beta-carotene all belong to carotenoids, which are all liposoluble pigments. Because the 3 pigments have the effects of resisting oxidation, preventing macular degeneration, treating cataract, preventing cardiovascular diseases, relieving atherosclerosis, enhancing organism immunity and the like. In the global market, natural lutein, zeaxanthin and beta-carotene are widely used and increasingly required in the fields of cosmetics, aquaculture, medicine, food, health products and the like. The natural lutein is mainly from flos Tagetis Erectae, the lutein content of the flos Tagetis Erectae is 0.6-2.5%, and the flos Tagetis Erectae is annual herbaceous plant with a flowering period of 8-9 months, so that annual production cannot be realized, and cultivated land is occupied. The main source of natural corn Huang Suzui is corn, the corn belongs to coarse grains, and excessive ingestion of coarse grains can cause cellulose to block intestinal tracts, influence dyspepsia of gastrointestinal tracts and cause lifelong diseases. Natural β -carotene is currently mainly of 3 sources, 1) dunaliella salina: culturing under high illumination and high salinity; 2) Carrot: the content is low, and the production cost is high; 3) Blakeslea trispora). There is a certain safety problem, and intestinal flora imbalance may be caused when the medicine is taken.

Microalgae have attracted attention for the production of high-value carotenoids such as astaxanthin, lutein, zeaxanthin and beta-carotene. Chlorella Chlorella zofingiensis is a single-cell green algae capable of accumulating small amounts of carotenoids such as astaxanthin, lutein, zeaxanthin and beta-carotene in cells when cultured under certain specific conditions, and realizing high-density culture under heterotrophic conditions. Although chlorella Chlorella zofingiensis has the potential to produce lutein, zeaxanthin and beta-carotene, the content of these pigments in the cells is still low. Experiments show that the wild type chlorella is cultured for 12 days under heterotrophic conditions, and the lutein and zeaxanthin content respectively account for 0.05% and 0.011% of the dry weight of cells, so that the process for producing lutein, zeaxanthin and beta-carotene by the wild type chlorella Chlorella zofingiensis has low economic benefit and is difficult to commercialize. If the mutation method is adopted, the algae strain which can inherit the advantage of high-density culture of the chlorella and can improve the lutein and zeaxanthin content in the algae cells can be obtained, and the method has important promotion significance for the commercial application of producing lutein, zeaxanthin and beta-carotene by using the chlorella. Huang et al treat wild type chlorella Chlorella zofingiensis with MNNG as a chemical mutagen to obtain a strain which is stable and high in yield of lutein, zeaxanthin and beta-carotene, wherein the yields of lutein, zeaxanthin and beta-carotene are respectively 0.034g/L, 0.035g/L and 0.024g/L when glucose is used as a carbon source for culture, but the mutant strain is only cultured in a shake flask and is not subjected to large-scale heterotrophic culture, and under the condition of amplified culture, the yields of lutein, zeaxanthin and beta-carotene are often greatly reduced, so that the commercial application prospect of the strain is limited.

Therefore, there is still a need for a chlorella mutant strain that produces lutein, zeaxanthin and beta-carotene with high yield under heterotrophic culture conditions, and at the same time optimizes the heterotrophic induction process, thereby providing technical support for promoting industrialization and commercialization of chlorella mutant strain for producing lutein, zeaxanthin and beta-carotene with high efficiency.

Disclosure of Invention

First, the technical problem to be solved

In view of the defects and shortcomings of the prior art, the invention provides a chlorella mutant strain which can produce lutein, zeaxanthin and beta-carotene in high yield under heterotrophic culture conditions, and then realizes the ultra-high density culture of the chlorella by optimizing the heterotrophic culture method of the chlorella, and further improves the content of the lutein, zeaxanthin and beta-carotene in chlorella cells by adding induction factors during the heterotrophic culture, thereby laying a technical foundation for the commercial production of the lutein, zeaxanthin and beta-carotene by using the chlorella.

(II) technical scheme

In order to achieve the above purpose, the main technical scheme adopted by the invention comprises the following steps:

in a first aspect, the present invention provides a mutant chlorella strain, named chlorella CZ-LZM3, having high yields of lutein, zeaxanthin and β -carotene under heterotrophic culture conditions, with latin name: chlorella zofingiensis CZ-LZM3 has been preserved in China center for type culture Collection (CCTCC No: m20211675, the preservation address is No. 299 of Wuchang district of Wuhan, hubei province.

In a second aspect, the present invention provides a method for heterotrophic culture of chlorella, said method for culturing chlorella CZ-LZM3, said method comprising: the heterotrophic culture process uses a basic culture medium and a feed supplement culture medium, wherein the basic culture medium is a culture medium initially contained in a fermentation tank, the feed supplement culture medium is a culture medium gradually supplemented into the fermentation tank along with the culture, and chlorella CZ-LZM3 is inoculated into the basic culture medium during the culture;

the culturing process is divided into a biomass accumulating process and a pigment inducing process, wherein the culturing of the biomass accumulating process satisfies the following conditions:

a. the nitrogen sources in the basic culture medium and the feed medium are ammonium chloride;

b. the initial carbon-nitrogen ratio of the basal culture medium is 5:1-80:1; the feed medium is a concentrated solution of the basic medium, and the carbon-nitrogen ratio of the concentrated solution is 5-20 times of that of the basic medium;

c. in the process of controlling the culture, the concentration of glucose in the culture medium in the fermentation tank is kept in the range of 5g/L-20g/L by feeding a feed medium, and the C/N in the culture medium in the fermentation tank is a non-constant value;

d. during the cultivation, as the chlorella utilizes the nitrogen source in the fermentation tank to lower the pH of the medium in the fermentation tank, ammonia water is adaptively supplemented to maintain the medium in the fermentation tank within a defined pH range.

Preferably, the culture temperature of the biomass accumulation process is 26-28 ℃, the dissolved oxygen is set to 20% +/-2, the stirring speed and the dissolved oxygen coupling are used for controlling the dissolved oxygen, and the pH is controlled to 6.5+/-0.2.

According to a preferred embodiment of the invention, the pigment accumulation process employs three-factor combined induction: i.e., adding gibberellin, sodium chloride, and suddenly increasing the C/N ratio to the fermentor.

According to a preferred embodiment of the present invention, gibberellin is present in the fermenter at a concentration of 10mg/L, sodium chloride at a concentration of 200mM, and a carbon source is added to achieve a C/N ratio of 180:1.

According to the preferred embodiment of the invention, the biomass accumulation process is switched to the pigment induction process when the end point of the biomass accumulation process is 10 days of culture or the cell dry weight of the chlorella Chlorella zofingiensis mutant strain CZ-LZM3 reaches more than 180 g/L.

According to a preferred embodiment of the invention, the end point of the pigment induction process is: the lutein, zeaxanthin and beta-carotene content is measured by taking samples at the same time point for several continuous days, and the induction process is ended when the lutein, zeaxanthin and beta-carotene content in the samples is unchanged or begins to decrease.

According to the preferred embodiment of the invention, one or more of white light, blue light and yellow-green light are added for synergistic induction in the biomass accumulation process or the pigment induction process.

According to a preferred embodiment of the invention, the intensity of the added white or blue light is 500. Mu. Mol photon m ^-2 ·s ^-1 . The synergistic induction by adding different light can be performed by adding light induction in the biomass accumulation culture stage, the pigment induction culture stage or both stages.

In a third aspect, the present invention provides a method for the efficient production of lutein, zeaxanthin and beta-carotene, which is obtained by heterotrophic culture of chlorella CZ-LZM 3.

In a fourth aspect, the present invention provides a method for efficiently producing lutein, zeaxanthin and beta-carotene, which comprises the heterotrophic culture method for chlorella described in the above examples.

(III) beneficial effects

(1) The invention adopts a chemical mutagenesis method to obtain a chlorella mutant strain with high lutein, zeaxanthin and beta-carotene yield by screening, which is named as chlorella CZ-LZM3, and the mutant strain is proved to accumulate higher lutein, zeaxanthin and beta-carotene in cells under heterotrophic culture conditions, which is far more than the lutein, zeaxanthin and beta-carotene content in the mutant strain reported by Huang et al, thus having better commercial application prospect.

Compared with the wild type, the lutein content, the zeaxanthin content and the beta-carotene content in the chlorella CZ-LZM3 are obviously improved, and the growth is not greatly different from that of the wild type. Under the conventional heterotrophic culture condition, compared with a wild type, the yield of lutein is improved by 1.2 times under the heterotrophic culture condition, the yield of zeaxanthin is improved by 6.4 times, and the yield of beta-carotene is improved by 3.9 times, which shows that the mutant strain CZ-LZM3 obtained in the invention has great application potential.

(2) In order to further improve the efficiency of producing lutein, zeaxanthin and beta-carotene, the invention divides the culture process of chlorella CZ-LZM3 into two stages, wherein one stage is a biomass mass accumulation stage, the stage realizes the high-density culture of chlorella CZ-LZM3 to obtain more chlorella cells, the other stage is a pigment production induction stage, and the other stage introduces three factors for induction, namely plant hormone (specifically gibberellin) +NaCl+high C/N ratio to promote the generation of more pigments in chlorella. Wherein, a certain intensity of illumination is added in the biomass accumulation process or pigment induction process to carry out synergistic induction on the algae cells so as to further improve the content of lutein, zeaxanthin and beta-carotene. Wherein, the white light has the most obvious effect on improving the lutein content, and the blue light has the most obvious effect on improving the zeaxanthin content and the beta-carotene content.

In some experiments, the mutant strain CZ-LZM3 screened by the invention adopts three-factor induction culture, and compared with common heterotrophic culture, the mutant strain CZ-LZM3 has 34% higher lutein content, 42% higher zeaxanthin content and 47% higher beta-carotene content.

Further, compared with the common heterotrophic culture, under the induction condition, white light and blue light are added for induction, so that the lutein content in the algae cells is respectively improved by 75% and 30%; the content of zeaxanthin is respectively improved by 30%, 59% and 46% under the conditions of white light, blue light and yellow-green light; the beta-carotene content is respectively improved by 73%, 100% and 82% under the conditions of white light, blue light and yellow-green light.

In conclusion, the invention obtains the chlorella species with high lutein, zeaxanthin and beta-carotene by mutation means, inherits the excellent characteristics of the chlorella suitable for rapid and high-density heterotrophic culture, and simultaneously has the characteristics of high lutein, zeaxanthin and beta-carotene which are not possessed by the WT type chlorella; during culture, a proper heterotrophic culture condition is provided for accumulating a large amount of biomass, and a special induction means is combined on the premise of obtaining a large amount of biomass to promote the accumulation of lutein, zeaxanthin and beta-carotene with higher specific gravity in a single cell. The technical scheme of the invention provides technical support for commercial production of lutein, zeaxanthin, beta-carotene and other natural pigments by using chlorella.

Drawings

FIG. 1 shows the biomass and cell number of chlorella wild-type and mutant strain CZ-LZM3 when cultured in shake flasks with total nitrogen (a, c) and nitrogen deficiency (b, d).

FIG. 2 is a photomicrograph of color and cell morphology changes of chlorella wild-type and mutant strain CZ-LZM3 when shake flask cultures were performed with total nitrogen (+N) and nitrogen deficient (-N).

FIG. 3 shows the curves of changes in lutein content (a), zeaxanthin content (b) and beta-carotene content (c) of chlorella wild-type and mutant strains CZ-LZM3 when shake flasks were subjected to total nitrogen and nitrogen deficiency culture.

FIG. 4 shows the result of alignment of CDS3 region sequences of BKT1 gene of chlorella wild-type and mutant strain CZ-LZM 3.

FIG. 5 shows changes in Chlorella wild-type and mutant strain CZ-LZM3 biomass (a), lutein content (b), zeaxanthin content (c) and beta-carotene content (d) when cultured in a 7.5L fermenter.

FIG. 6 is the effect of three-factor induction on Chlorella wild-type and mutant LZM3 biomass (a), lutein content (b), zeaxanthin content (c) and beta-carotene content (d) upon cultivation in a 7.5L fermenter

FIG. 7 shows the effect of addition of different photoinduced on mutant CZ-LZM3 biomass (a), lutein content (b), zeaxanthin content (c) and beta-carotene content (d) when cultured in a 7.5L fermenter.

Detailed Description

The invention will be better explained by the following detailed description of the embodiments with reference to the drawings.

The method mainly comprises the steps of determining mutagenesis conditions of chlorella Chlorella zofingiensis, screening high-yield lutein, zeaxanthin and beta-carotene mutant strains, identifying mutation sites of chlorella Chlorella zofingiensis mutant strain CZ-LZM3 and wild type mutant sites, optimizing heterotrophic culture conditions, three-factor induction, light collaborative induction and the like, and respectively describing the following contents:

1. determination of conditions for chemical mutagenesis of Chlorella Chlorella zofingiensis

The culture method of chlorella Chlorella zofingiensis comprises the following steps: after the monoclonal algae (purchased from American ATCC representative culture Collection) grown on the solid modified Endo medium (composition and amount of the modified Endo medium are shown in tables 1-2) was dropped into a 50mL Erlenmeyer flask containing 20mL of the modified Endo medium and cultured for 5 days, the cells were transferred to a 250mL Erlenmeyer flask containing 100mL of the modified Endo medium, and after the cells were grown to logarithmic growth phase, a volume of the algae solution was taken for mutagenesis, at which time the number of cells was about 2X 10 ⁶ cells/ml。

The algae cells are collected by centrifugation, the obtained algae cell precipitate is treated with ethyl methylsulfonate (EMS, sigma-Aldrich, st.Louis, MO, USA) with different concentrations, and the EMS solution is diluted with 0.2M phosphate buffer (phosphate buffer: naH) ₂ PO ₄ ·2H ₂ O31.2g，Na ₂ HPO ₄ ·7H ₂ O53.6 g pH 6.5), EMS final concentration was 0.5%,1.0%,1.5%,2.0%,2.5%,3.0%,3.5%,4.0% (W/V), and placed in a dark environment at 26℃for mutagenesis for 1 hour, after the reaction was completed, 10% sodium thiosulfate was added to terminate the reaction, and centrifugation was carried out for 5min at 3000g to remove sodium thiosulfate, and fresh modified Endo medium was added to wash twice. Then adding a certain amount of fresh modified Endo culture medium, placing in a 26 ℃ incubator, culturing for 24 hours in a dark place, taking 400 cells/flat plate coating plates, culturing for 3 weeks, and observing the change of monoclonal color after the monoclonal grows out.

Table 1 formulation for improved Endo culture Medium

Note that: (1) CaCl (CaCl) ₂ ·2H ₂ And (3) mother liquor: 210g CaCl ₂ ·2H ₂ O is dissolved in 1L ddH ₂ O

(2)FeSO ₄ ·7H ₂ O&EDTA mixed mother liquor: 32g FeSO ₄ ·7H ₂ O and 4.2g EDTA in 1L ddH ₂ O

Table 2 microelement mother liquor formulation

As a result of observation, it was found that only 1.5% (W/V) EMS-treated plates grew golden yellow colonies, whereas other concentrations of EMS-treated plates did not grew colonies or grew white colonies. Thus, a library of mutants producing lutein, zeaxanthin, and β -carotene was subsequently selected with 1.5% (W/V) EMS.

2. Screening, culturing and content determination of high-yield lutein, zeaxanthin and beta-carotene mutant strains

A certain amount of chlorella algae liquid treated by 1.5% (W/V) EMS for 1 hour is coated on a modified Endo solid culture medium, the inoculation amount is 400 cells/plate, after 3 weeks of culture, the color change is observed, and golden yellow monoclonal is selected and placed in the modified Endo culture medium for culture. Shake flask culture was performed at 2X 10 ⁶ After the cell number of cells/ml was inoculated, the cells were placed in a dark shaker at 26℃and 180rpm for total nitrogen culture, and then inoculated into a nitrogen-deficient medium at 6g/L of the same dry weight for total nitrogen culture under the same conditions as in total nitrogen culture. Cell dry weight, cell number and micrograph of the mutant strain were measured daily while shaking culture. Lutein content, zeaxanthin content, beta-carotene content were measured daily from day 4. The lutein content, zeaxanthin and beta-carotene content are mainly measured by High Performance Liquid Chromatography (HPLC), and the specific method for extracting and measuring the pigment is as follows:

(1) A small scoop of glass beads was scooped into the glass bead breaking tube.

(2) About 20mg of the lyophilized algal powder was weighed into a glass bead crushing tube.

(3) 0.5mL of pre-chilled extract (methanol: dichloromethane=3:1, V/V) was added, and the mixture was shaken 3 times on a glass bead breaker at 3000rpm for 20s each time, and cooled at intervals for 1min.

(4) After being taken out and placed in an ice box for cooling, 16000g was centrifuged for 5min, and the supernatant was transferred to a 5mL glass bottle with a Pasteur pipette.

(5) Adding the extractive solution, repeating the steps 3-4 for two to three times until the algae residue is colorless.

(6) And (3) drying the collected supernatant nitrogen, re-dissolving the supernatant nitrogen by using 0.5mL of extracting solution, shaking and uniformly mixing, filtering the supernatant nitrogen into a brown sample bottle inserted with an inner cannula by using a disposable syringe and an organic filter membrane of 0.22 mu m, and performing on-machine detection.

(7) HPLC assay conditions were as follows:

lutein, zeaxanthin and beta-carotene standard (Sigma Biochemical Co., ltd.) powder were weighed separately, dissolved in 1.75mL of methylene chloride at a concentration of 2. 2mg/mL, and diluted with the extract to 0.1mg/mL, 0.05mg/mL, 0.02mg/mL, 0.01mg/mL, 0.005mg/mL, 0.002mg/mL and 0.001mg/mL in order, and transferred to HPLC brown sample bottles equipped with inner cannulas from low concentration to high concentration.

The lutein, zeaxanthin and beta-carotene were determined as follows: the chromatographic column is as follows: YMC Caroteoid (250X 4.6mm,5 μm) at a separation temperature of 30 ℃. Waters e2695 high Performance liquid chromatograph (Water Associates, milford, mass., USA) was equipped with a 2998 photodiode at a loading of 10. Mu.L. Mobile phase a was (methanol: methyl tert-butyl ether: water=81:15:4, v/v) and mobile phase B was (methanol: methyl tert-butyl ether: water=43.5:52.5:4, v/v). The linear gradient procedure was: 100% A was run for 45min, then 100% B was run for 2min, and finally 100% A was run for 8min at a flow rate of 1.0mL/min.

Table 3: the dry weight, cell number and pigment content at day 4 of nitrogen-deficient culture are shown in the following table

By comparison, the mutant strain with the CZ-LZM3 number has the greatest cell number, the greatest dry weight and the highest content of zeaxanthin and beta-carotene, and finally the monoclonal strain with the CZ-LZM3 number is used as the target mutant strain through comprehensive calculation.

The wild type chlorella and CZ-LZM3 were continuously cultured in shake flasks with total nitrogen and nitrogen deficiency, and the biomass and cell number were compared and the results were shown in FIG. 1 (total nitrogen for a. C and nitrogen deficiency for b. D): biomass and cell numbers of wild type chlorella and mutant CZ-LZM3 are both on the rise. By comparing the biomass and cell number of wild-type Chlorella and mutant strain CZ-LZM3 under the conditions of total nitrogen and nitrogen deficiency, it was found that the biomass and cell number of mutant strain CZ-LZM3 were significantly higher than those of wild-type strain (p<0.05). The biomass and cell number of the mutant strain CZ-LZM3 on day 4 of the total nitrogen culture were 11.35g/L and 67.7X10, respectively ⁶ cells/mL 26.4% and 83% higher than wild type. The biomass and cell number of the mutant strain CZ-LZM3 on day 4 of nitrogen-deficient culture were 13.7g/L and 76.75X10, respectively ⁶ cells/mL, 17% and 12% higher than wild type.

Photomicrographs were continuously observed and taken, as shown in FIG. 2, of the wild-type Chlorella and mutant strain CZ-LZM3 both changed in color from pale yellow to dark yellow upon total nitrogen cultivation (+N). Cell morphology was observed to show that cells began to divide and many small cells appeared. The color of wild Chlorella gradually changes from yellow to orange when nitrogen deficiency culture (-N) is carried out, and the color of mutant strain changes from yellow to golden. The cell morphology was observed to show that the nitrogen-deficient cultured cells still divide, and that some small cells appear, and the cell size of the mutant strain CZ-LZM3 was changed from large to small, as in the wild type Chlorella.

The changes in lutein content (a), zeaxanthin content (b) and beta-carotene content (c) of chlorella wild-type and mutant strain CZ-LZM3 were compared when shake flask culture was performed with total nitrogen and nitrogen deficiency. The results are shown in FIG. 3: after the total nitrogen culture is changed into the nitrogen deficiency culture, the content of lutein in wild chlorella and mutant strain CZ-LZM3 is in a decreasing trend, and compared with the wild chlorella, the content of zeaxanthin and beta-carotene is in an increasing trend. The lutein content at day 5 of nitrogen deficiency culture (day 9 of fig. 3) is 0.124% of the dry weight of cells, 0.97 times of that of wild type chlorella; the content of zeaxanthin is 0.216% of dry weight of cells, and is 3.4 times of that of wild type chlorella; the content of beta-carotene is 0.093% of the dry weight of the cells, which is 3 times that of wild type chlorella.

3. Identification of Chlorella Chlorella zofingiensis mutant CZ-LZM3 and wild-type mutation sites

And amplifying the designated gene fragment by designing a specific primer to obtain the base sequence of the target gene. And comparing the base sequences of different samples, and analyzing the potential snp locus of the target gene. The BKT1 gene of wild-type Chlorella and Chlorella mutant strain CZ-LZM3 was determined, and 4 pairs of forward and reverse primers were designed, respectively, because the CDS region of the BKT1 gene was divided into four segments (see the list below). PCR amplification (5 min pre-denaturation at 95 ℃, 5min denaturation at 95 ℃,30 sec annealing at 60 ℃, 45sec extension at 72 ℃, 5min final extension at 72 ℃, 1min at 16 ℃ for a total of 35 cycles) was performed and sequencing was performed by Sanger sequencing (3730 xl DNA Analyzer sequencer from ABI). The ab1 format raw data is exported from the ABI 3730xl instrument, imported into Chromas analysis software, quality control of a sequencing peak diagram is carried out, and a corresponding sequence file seq format is exported. Finally, the sequenced good full-length sequence is subjected to multi-sequence alignment in SeqMan software.

The 4 pairs of forward and reverse primers are as follows:

BKT1-CDS 1-F5'TAACTAGAAACCACATCCGC 3' and BKT1-CDS 1-R5 'CAACAAGGTGTACTCAGCG 3';

BKT1-CDS 2-F5'CATGAAGGTTGTTGCAAAG 3' and BKT1-CDS 2-R5 'ACAGTTTCCCATTGTGATTC 3';

BKT1-CDS 3-F5'GCACCGTTCATTGCTTAG 3' and BKT1-CDS 3-R5 'GGTGGTAATAGAGAAGCAGC 3';

BKT1-CDS4-F:5'CATGTGTGCAGCAATGAC3' and BKT1-CDS4-R:5 'AAACAAGCGAATTGTGAATC'.

The comparison result is shown in FIG. 4, and the boxes are the bases of the mutant strain increased compared with the WT type. The insertion CAGACTTCC at position 502 of the CDS3 sequence of the ketolase gene BKT1 of the catalytic zeaxanthin Cheng Haqing causes the mutant strain CZ-LZM3 to undergo insertion mutation.

4. Heterotrophic culture of Chlorella Chlorella zofingiensis mutant CZ-LZM3

In order to solve the problems that the proliferation speed of cells is slow and the biomass is low when nitrate nitrogen and fixed carbon nitrogen are used in the high-density culture process of the conventional chlorella Chlorella zofingiensis. According to the method, ammonium chloride with lower energy consumption in the process is used as a nitrogen source, the traditional fixed carbon nitrogen ratio feeding is abandoned, ammonia water is adaptively supplemented according to the condition that the pH value of the chlorella is reduced in the process of utilizing the nitrogen source, the heterotrophic environment of the microalgae is maintained to be proper and constant by the ammonia water in the process of supplementing the ammonia water, and the ammonia water is also used as the supplement of the nitrogen source to the growth and utilization of the microalgae cells, so that the nitrogen source provided by the ammonia water is practically and adaptively supplemented according to the nitrogen utilization condition and the requirement of the microalgae cells, and the limitation caused by the fixed carbon nitrogen ratio feeding to the growth of the microalgae is avoided, and the purposes of improving the growth speed and the biomass concentration of the cells are achieved.

In the specific culture process, wild type chlorella Chlorella zofingiensis is used as a reference, and the content of lutein, zeaxanthin and beta-carotene in cells of chlorella Chlorella zofingiensis mutant strain CZ-LZM3 and wild type chlorella Chlorella zofingiensis are compared under the same culture condition.

The heterotrophic culture process of the chlorella Chlorella zofingiensis mutant strain CZ-LZM3 comprises the following steps:

1) Activation of algae species

In a sterile environment, chlorella Chlorella zofingiensis single colonies are picked from a plate which is cultured (the strain CZ-LZM3 algae seeds are smeared on the plate until colonies grow), streaking is carried out on a sterilized plate (the composition of a culture medium is shown in an attached table 1), and the streaked plate is placed in a dark environment for culturing at a temperature of 26 ℃ for 15-20 days (obvious chlorella Chlorella zofingiensis algae single colonies are formed).

2) First-stage seed culture

A ring of mutant strain CZ-LZM3 (phi 2-3 mm) is selected from the activated fresh flat plate and is subjected to shaking culture in a 50mL triangular flask (15 mL liquid filling amount) at the temperature of 27 ℃ and the rotating speed of 180rpm for 120-144h (OD) ₇₅₀ ＝8)。

3) Two-stage seed culture

Inoculating the cultured primary seed solution into a 250mL secondary shaking flask with an inoculum size of 10% (v/v)Shaking culture (100 mL of the liquid loading amount) at 27deg.C at 180rpm for 72-84 hr (OD) ₇₅₀ ＝16-20)。

4) Three-stage seed culture

Inoculating the cultured secondary seed solution with 10% (v/v) inoculum size into 1000mL three-stage shake flask (liquid loading 300 mL), shake culturing at 27deg.C at 180rpm for 72-84 hr (OD) ₇₅₀ ＝20-22)。

The culture solutions of the first seed culture, the second seed culture and the third seed culture are shown in tables 4 and 6.

5) Fermentation tank culture

Seed solution of heterotrophically cultured Chlorella Chlorella zofingiensis mutant CZ-LZM3 with initial dry weight of 2.5g/L is inoculated into a 7.5L fermentation tank, the culture temperature is 26 ℃, the dissolved oxygen is set to 20%, and the stirring speed and the dissolved oxygen are coupled to control the dissolved oxygen. The composition of the medium in the fermenter is shown in tables 5 to 6.

The basic culture medium and the feed supplement culture medium both adopt ammonium chloride as nitrogen sources, the initial carbon nitrogen ratio is 5:1-80:1, and the glucose concentration is 20g/L. When the glucose concentration is lower than 5g/L, feeding a feeding culture medium (the feeding culture medium is a concentrated solution of a basic culture medium, the carbon-nitrogen ratio of which is 5-20 times of that of the basic culture medium) by a peristaltic pump with adjustable speed, controlling the glucose concentration in the culture process to be in the range of 5g/L-20g/L, monitoring the pH of a fermentation tank in the culture process, and controlling the pH to be 6.5+/-0.2 by ammonia water in time.

Table 4 shows the culture medium for algae species (the first and second three-stage culture solution is the nutrient components contained in each L)

TABLE 5 composition of fermenter base and feed medium

Composition of components	Basic culture medium (g/L)	Feed supplement medium (g/L)
			Glucose	5～20	750
Ammonium chloride	0.25～1.0	2.71～37.5
			KH ₂ PO ₄	0.3～1.2	30
MgSO ₄ ·7H ₂ O	0.3～1.2	30
			Citric acid trisodium salt	0.05～0.2	5
CaCl ₂ Mother liquor	1mL	12.5mL
			FeSO ₄ With EDTA mother liquor	1mL	12.5mL
Microelement mother liquor	1mL	12.5mL
			Defoaming agent	0.08mL

TABLE 6 mother liquor composition in each Medium/liquid

In the experiment, the culture conditions of the specific fermentation tank culture in the step 5) are changed to obtain the following scheme:

a) The initial carbon-nitrogen ratio in the basal medium was set to 35:1, and the carbon-nitrogen ratio in the feed medium was set to 420:1. Other conditions are as set forth in step 5) above.

B) The culture medium adopts ammonium chloride as a nitrogen source, so that the initial carbon-nitrogen ratio in the basic culture medium is 30:1, and the carbon-nitrogen ratio of the feed culture medium is 30:1. Other conditions are as set forth in step 5) above.

C) The culture medium adopts ammonium chloride as a nitrogen source, so that the initial carbon-nitrogen ratio in the basic culture medium is 20:1, and the carbon-nitrogen ratio of the feed culture medium is 300:1. Other conditions were the same as in the above 5).

D) Urea is adopted as a nitrogen source of the culture medium, the initial carbon-nitrogen ratio is 34:1, and the carbon-nitrogen ratio of the feed culture medium is 34:1. Other conditions are as set forth in step 5) above.

E) Urea is adopted as a nitrogen source of the culture medium, the initial carbon-nitrogen ratio is 34:1, and the carbon-nitrogen ratio of the feed culture medium is 408:1. Other conditions were the same as in the above 5). Other conditions were the same as in the above 5).

F) The culture medium adopts sodium nitrate as a nitrogen source, the initial carbon-nitrogen ratio is 34:1, and the carbon-nitrogen ratio of the feed culture medium is 34:1. Other conditions are as set forth in step 5) above.

As a result of comparison, the cell dry weights of the Chlorella Chlorella zofingiensis mutant strain CZ-LZM3 cultured to day 10 were 185g/L, 136g/L, 180g/L, 89g/L, 128g/L and 44g/L, respectively. It follows that both protocols A and C allow to obtain a higher cell dry weight of the mutant strain CZ-LZM 3. Thus, in the biomass accumulation stage during the subsequent heterotrophic culture, the culture is carried out in a fermenter according to the conditions listed in step 5) above.

On day 16 of fermentation culture according to scheme A, the cell dry weight, lutein content, zeaxanthin content, and beta-carotene content of mutant strain CZ-LZM3 and wild type Chlorella were measured as shown in FIG. 2. In all of the figures a-d of FIG. 5, the lower curve corresponds to wild-type Chlorella. As can be seen from the graph, the cell dry weights of wild-type Chlorella and mutant strain CZ-LZM3 tended to increase with the increase in culture time. The maximum cell dry weight of the mutant strain CZ-LZM3 cultured for 16 days can reach 251.5 g/L. On day 16, the dry cell weight of the mutant strain CZ-LZM3 can reach 251.5g/L, the lutein content in the mutant strain CZ-LZM3 can account for 0.097% of the dry cell weight, the zeaxanthin content can account for 0.259% of the dry cell weight, and the beta-carotene content can account for 0.149% of the dry cell weight. On the 16 th day, the lutein yield can reach 0.2502g/L, the zeaxanthin yield can reach 0.6509 g/L, and the beta-carotene yield can reach 0.3775g/L. Furthermore, the inventors have surprisingly found that the ratio of the zeaxanthin content and lutein content of the mutant strain CZ-LZM3 under heterotrophic culture conditions is close to 2.4:1 on days 12, 13 and 16 of culture, which is the optimal ratio in the foveal region of the human eye.

5. Induction culture and pigment accumulation of chlorella Chlorella zofingiensis mutant strain CZ-LZM3

When the cell dry weight of the mutant strain CZ-LZM3 reaches more than 180g/L or the cell is fermented and cultured for 10 days according to the method, the cell can be switched into a three-factor induction culture stage, and pigment accumulation in algae cells is promoted. Experiments were run with blank (no three-factor induction) as control. The three-factor induction culture method comprises the following steps: gibberellin, sodium chloride and a carbon source are added into the fermentation medium, so that the medium instantaneously meets the following conditions: gibberellin concentration is 10mg/L, initial carbon to nitrogen ratio is 180:1, and sodium chloride concentration is 200mM.

The culture shows that the variation trend of the biomass and pigment of the mutant strain CZ-LZM3 is the same as that of the wild type chlorella. As shown in FIG. 6, the biomass of mutant CZ-LZM3 still tended to increase after switching to three-factor induction, and the biomass reached 237g/L by day 16 (6 days of three-factor induction). Compared with the control group (without three-factor induction), the content of lutein, zeaxanthin and beta-carotene of the mutant strain CZ-LZM3 is obviously improved (p < 0.05). Compared with a control group under the three-factor induction condition, the lutein content is improved by 36%, the zeaxanthin content is improved by 44%, and the beta-carotene content is improved by 48%.

6. Heterotrophic culture in fermenter according to scheme A of the fourth section above and addition of different photonics to induce growth and accumulation of lutein, zeaxanthin and beta-carotene for Chlorella Chlorella zofingiensis mutant strain CZ-LZM3

The experiments were divided into white light group, blue light group and yellow-green light group. The LED lamp strips with different light quality conditions are wound on a transparent 7.5L fermentation tank body, and when a light quantum meter is arranged at the center of an empty fermentation tank, the measured light intensities are 500 mu mol photon m ^-2 ·s ^-1 . The cell dry weight of mutant CZ-LZM3 was measured daily during the culture. Lutein content, zeaxanthin content, beta-carotene content were measured daily from day 4. The measurement results are shown in fig. 7. Wherein, a diagram shows the biomass of mutant strain CZ-LZM3, b diagram shows the lutein content, c diagram shows the zeaxanthin content and d diagram shows the beta-carotene content.

As can be seen from the graph, different light quality inductions have no influence on biomass of wild chlorella and mutant strain CZ-LZM3, the biomass is in a trend of growing, and the biomass of the mutant strain CZ-LZM3 can reach 217g/L, 211g/L, 216.5g/L and 203g/L under dark, white light, blue light and yellow-green light conditions respectively after heterotrophic culture for 12 days. Compared with a control group, the lutein content is respectively improved by 75 percent and 30 percent under the white light and blue light conditions after 12 days of culture; the content of zeaxanthin is respectively improved by 30%, 59% and 46% under the conditions of white light, blue light and yellow-green light; the beta-carotene content is respectively improved by 73%, 100% and 82% under the conditions of white light, blue light and yellow-green light.

The method using different light quality induction can be overlapped with the three-factor induction culture stage or the whole culture process of two stages of the biomass accumulation stage and the pigment induction stage.

The main inventive contributions of the present invention are as follows:

(1) After 1.5% EMS treatment for 1h, a chlorella mutant with stable and high yield of lutein, zeaxanthin and beta-carotene can be obtained, and the chlorella mutant strain CZ-LZM3 is preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of M20211675. Sequencing and identification prove that 9 bases CAGACTTCC are inserted into the 502 bases of BKT1-CDS3 of the mutant strain CZ-LZM 3.

(2) Glucose and ammonium chloride are used as carbon nitrogen sources, the carbon nitrogen ratio in a basic culture medium is 5:1-80:1, the nitrogen carbon ratio in a feed supplement culture medium is 5-20 times of the carbon nitrogen ratio in the basic culture medium, the pH value of a culture system is regulated by ammonia water to be kept at 6.5+/-0.2 in the culture process, the culture temperature is 26-28 ℃, dissolved oxygen is set to 20% +/-2, stirring speed and dissolved oxygen are coupled to control the dissolved oxygen, the glucose concentration is monitored in the culture process, when the glucose concentration in the basic culture medium is reduced to 5g/L, the feed supplement culture medium is fed, the glucose concentration is constantly controlled to be in the range of 5-20g/L, and the cell dry weight of a mutant strain CZ-LZM3 can reach more than 180g/L in a 7.5L fermentation tank for 10 days. And according to the mode, on the premise of no external induction factor, the dry weight of the cells can reach 251.5g/L when the cells are cultured to 16 days, and the contents of lutein, zeaxanthin and beta-carotene respectively account for 0.097%, 0.259% and 0.149% of the dry weight of the cells. These are far above the levels described in the prior art.

(3) Under heterotrophic conditions, high C/N, gibberellin and NaCl induce the Chlorella mutant CZ-LZM3 to produce lutein, zeaxanthin and beta-carotene under heterotrophic conditions. In the prior art, naCl and gibberellin are commonly applied to chlorella under autotrophic conditions to increase the accumulation of pigments in the algae, and the inventor finds that sodium chloride and gibberellin can also stimulate the chlorella under heterotrophic conditions to accumulate pigments.

(4) Different light quality inductions have no effect on the biomass of wild type chlorella and mutant strain CZ-LZM 3. Under heterotrophic conditions, different light quality is cooperatively added for induction, and compared with a control group (darkness), the white light has the most obvious effect of improving the lutein content after being cultured for 12 days, and the lutein content is improved by 75%; the blue light has the most obvious effect on improving the content of zeaxanthin and beta-carotene, and is respectively improved by 59 percent and 100 percent.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.

Claims

1. A chlorella mutant strain which can produce lutein, zeaxanthin and beta-carotene under heterotrophic culture conditions is named as chlorella Chlorella zofingiensis CZ-LZM3 and is preserved in China center for type culture collection (CCTCC No) in 12 months of 2021: m20211675, the preservation address is No. 299 of Wuchang district of Wuhan, hubei province.

2. A heterotrophic culture method of chlorella, the method comprising: the heterotrophic culture process uses a basal medium and a feed medium, wherein the basal medium is a medium initially contained in a fermentation tank, the feed medium is a medium gradually supplemented into the fermentation tank along with the culture, and the chlorella CZ-LZM3 of claim 1 is inoculated into the basal medium during the culture;

the culture process is divided into a biomass accumulation process and a pigment induction process; wherein, the culture of the biomass accumulation process meets the following conditions:

d. in the culture process, the pH of a culture medium in the fermentation tank is reduced along with the utilization of a nitrogen source in the fermentation tank by the chlorella, and ammonia water is adaptively supplemented to maintain the culture medium in the fermentation tank within a determined pH range; the culture temperature of the biomass accumulation process is 26-28 ℃, the dissolved oxygen is set to 20% +/-2, the stirring speed and the dissolved oxygen are coupled to control the dissolved oxygen, and the pH is controlled to 6.5+/-0.2;

the pigment induction process adopts three factors to jointly induce: i.e., adding gibberellin, sodium chloride, and suddenly increasing the C/N ratio to the fermentor.

3. The heterotrophic culture method of chlorella according to claim 2, wherein the concentration of gibberellin in the fermenter is 10mg/L, the concentration of sodium chloride is 200mM, and the C/N ratio is 180:1 by adding a carbon source.

4. The method according to claim 2, wherein the biomass accumulation process is switched to a pigment induction process when the end point of the biomass accumulation process is 10 days of culture or when the cell dry weight of chlorella CZ-LZM3 reaches 180g/L or more.

5. The heterotrophic culture method of chlorella according to claim 2, wherein the end point of the pigment induction process is: the lutein, zeaxanthin and beta-carotene content is measured by taking samples at the same time point for several continuous days, and the induction process is ended when the lutein, zeaxanthin and beta-carotene content in the samples is unchanged or begins to decrease.

6. The heterotrophic culture method of chlorella according to claim 2 or 5, wherein one or more of white light, blue light and yellow-green light is added for synergistic induction during biomass accumulation or pigment induction.

7. The heterotrophic culture method of Chlorella according to claim 6, wherein the intensity of the added white light or blue light is 500. Mu. Mol photo nm ^-2 ·s ^-1 。

8. A process for the efficient production of lutein, zeaxanthin and β -carotene, characterized in that it is obtained by heterotrophic culture of the chlorella CZ-LZM3 of claim 1; or the method comprises the chlorella heterotrophic culture method of any one of claims 2-7.