CN114907982A

CN114907982A - Chlorella mutant strain and high-density heterotrophic culture method and application thereof

Info

Publication number: CN114907982A
Application number: CN202210257048.5A
Authority: CN
Inventors: 韩丹翔; 陈桥红
Original assignee: Demeter Biotechnology Zhuhai Co ltd
Current assignee: Demeter Biotechnology Zhuhai Co ltd
Priority date: 2022-03-16
Filing date: 2022-03-16
Publication date: 2022-08-16
Anticipated expiration: 2042-03-16
Also published as: CN114907982B

Abstract

The invention relates to a chlorella mutant strain with high yield of lutein, zeaxanthin and beta-carotene under heterotrophic culture conditions, which is named as chlorella CZ-LZM3 and is preserved in China center for type culture collection (CCTCC No): m20211675, the preservation address is Wuhan city Wuchang district No. 299, Hubei province. The chlorella mutant strain CZ-LZM3 inherits the excellent characteristics of chlorella suitable for quick and high-density heterotrophic culture, and has the characteristics of high yield of lutein, zeaxanthin and beta-carotene that WT chlorella does not have; when in culture, proper heterotrophic culture conditions are firstly provided for accumulating biomass in a large amount, and a special induction means is combined to promote the accumulation of lutein, zeaxanthin and beta-carotene with higher specific gravity in a single cell on the premise of obtaining a large amount of biomass. The technical scheme of the invention provides technical support for the commercial production of natural pigments such as lutein, zeaxanthin, beta-carotene and the like by utilizing chlorella.

Description

Chlorella mutant strain and high-density heterotrophic culture method and application thereof

Technical Field

The invention relates to the technical field of microalgae seed cultivation, and relates to a heterotrophic chlorella mutant strain for producing lutein, zeaxanthin and beta-carotene and application thereof.

Background

Lutein, zeaxanthin and beta-carotene belong to the carotenoids, all of which are fat-soluble pigments. The 3 pigments have the effects of resisting oxidation, preventing macular degeneration, treating cataract, preventing cardiovascular diseases, relieving atherosclerosis, enhancing immunity of organism, etc. In the global market, natural xanthophyll, zeaxanthin and beta-carotene are widely used and increasingly required in the fields of cosmetics, aquaculture, medicine, food, health products and the like. The natural lutein is mainly from marigold flowers, the lutein content of the marigold flowers is between 0.6 and 2.5 percent, the marigold is an annual herbaceous plant, the flowering phase is 8 to 9 months, and therefore annual production cannot be realized, and cultivated land is occupied. The natural zeaxanthin is mainly derived from corn, the corn belongs to coarse food grain, and excessive intake of the coarse food grain can cause cellulose to block intestinal tracts, affect the dyspepsia of gastrointestinal tracts and further cause lifelong diseases. Natural beta-carotene is currently mainly derived from 3 aspects, 1) dunaliella salina: the culture needs high illumination, high salinity and other conditions; 2) carrot: the content is low, and the production cost is high; 3) blakeslea trispora: there is a certain safety problem that the intestinal flora may be disturbed when taken.

Microalgae have attracted attention for their ability to produce high value carotenoids such as astaxanthin, lutein, zeaxanthin and beta-carotene. Chlorella zofingiensis is a unicellular green algae, which can accumulate a small amount of carotenoids such as astaxanthin, lutein, zeaxanthin and beta-carotene in cells when cultured under certain specific conditions, and can be cultured at high density under heterotrophic conditions. Although Chlorella zofingiensis has the potential to produce lutein, zeaxanthin and beta-carotene, the content of these pigments in the cells is still low. Experiments show that when wild Chlorella is cultured for 12 days under heterotrophic conditions, the content of lutein and zeaxanthin respectively accounts for 0.05% and 0.011% of the dry weight of cells, which results in the low economic benefit of the process for producing lutein, zeaxanthin and beta-carotene by the wild Chlorella zofingiensis, and the process is difficult to commercialize. If the mutation method is adopted, an algal strain which can inherit the advantage of high-density culture of the chlorella and can simultaneously improve the contents of lutein and zeaxanthin in algal cells is obtained, and the method has important promotion significance for the commercial application of producing the lutein, the zeaxanthin and the beta-carotene by utilizing the chlorella. Huang et al, which utilizes MNNG as a chemical mutagen to treat Chlorella angustifolia zofingiensis of wild type, obtained a stable high yield of lutein, zeaxanthin and beta-carotene algal strain, when cultured with glucose as a carbon source, the yield of lutein, zeaxanthin and beta-carotene was 0.034g/L, 0.035g/L and 0.024g/L, respectively, but the mutant strain was only cultured in a shake flask without large-scale heterotrophic culture, and under the condition of scale-up culture, the yield of lutein, zeaxanthin and beta-carotene tended to be greatly reduced, limiting the commercial application prospect.

Therefore, there is still a need for a chlorella mutant strain with high yield of lutein, zeaxanthin and beta-carotene under heterotrophic culture conditions, and simultaneously, the heterotrophic induction process of the chlorella mutant strain is optimized, so that technical support is provided for promoting the industrialization and commercialization of the chlorella mutant strain for producing lutein, zeaxanthin and beta-carotene with high efficiency.

Disclosure of Invention

Technical problem to be solved

In view of the above disadvantages and shortcomings of the prior art, the present invention provides a chlorella mutant strain with high yield of lutein, zeaxanthin and beta-carotene under heterotrophic culture conditions, and then realizes the ultra-high density culture of chlorella by optimizing the heterotrophic culture method of chlorella, and further increases the content of lutein, zeaxanthin and beta-carotene in chlorella cells by adding induction factors during the heterotrophic culture, thereby laying a technical foundation for the commercial production of lutein, zeaxanthin and beta-carotene by chlorella.

(II) technical scheme

In order to achieve the purpose, the invention adopts the main technical scheme that:

in a first aspect, the present invention provides a chlorella mutant strain with high yields of lutein, zeaxanthin and β -carotene under heterotrophic culture conditions, named chlorella CZ-LZM3, named latin: chlorella zofingiensis CZ-LZM3, which has been deposited in China center for type culture Collection at 12 months and 24 days 2021, has a collection number of CCTCC No: m20211675, the preservation address is Wuhan city Wuchang district No. 299, Hubei province.

In a second aspect, the present invention provides a chlorella heterotrophic culture method for culturing chlorella CZ-LZM3, the method comprising: a basic culture medium and a supplementary culture medium are used in the heterotrophic culture process, the basic culture medium is a culture medium initially contained in a fermentation tank, the supplementary culture medium is a culture medium gradually supplemented into the fermentation tank along with the culture, and the chlorella CZ-LZM3 is inoculated into the basic culture medium during the culture;

the culture process is divided into a biomass accumulation process and a pigment induction process, wherein the culture of the biomass accumulation process meets the following conditions:

a. the nitrogen source in the basic culture medium and the supplemented culture medium is ammonium chloride;

b. the initial carbon-nitrogen ratio of the basic culture medium is 5:1-80: 1; the supplementary culture medium is a concentrated solution of a basic culture medium, and the carbon-nitrogen ratio of the supplementary culture medium is 5-20 times of that of the basic culture medium;

c. in the control culture process, the glucose concentration in the culture medium in the fermentation tank is kept within the range of 5g/L-20g/L by feeding the supplemented culture medium, and C/N in the culture medium in the fermentation tank is a non-constant value;

d. during the culture process, the pH value of the culture medium in the fermentation tank is reduced along with the utilization of nitrogen source in the fermentation tank by the chlorella, and ammonia water is supplemented adaptively to maintain the culture medium in the fermentation tank within a determined pH range.

Preferably, the culture temperature of the biomass accumulation process is 26-28 ℃, the dissolved oxygen is set to be 20% + -2, the stirring speed and the dissolved oxygen are coupled to control the dissolved oxygen, and the pH value is controlled to be 6.5 +/-0.2.

According to a preferred embodiment of the present invention, the pigment accumulation process is induced by a combination of three factors: i.e.adding gibberellin, sodium chloride to the fermentor and abruptly increasing the C/N ratio.

According to a preferred embodiment of the present invention, gibberellin is present in the fermenter at a concentration of 10mg/L and 200mM sodium chloride, and a carbon source is added to achieve a C/N ratio of 180: 1.

According to the preferred embodiment of the present invention, the end point of the biomass accumulation process is to culture for 10 days or to switch to the pigment induction process when the dry cell weight of the Chlorella vulgaris Perilla zofingiensis mutant strain CZ-LZM3 reaches 180g/L or more.

According to a preferred embodiment of the invention, the end points of the pigment induction process are: taking samples at the same time point for several days continuously to determine the contents of lutein, zeaxanthin and beta-carotene, and finishing the induction process when the contents of lutein, zeaxanthin and beta-carotene in the samples are unchanged or begin to decline.

According to the preferred embodiment of the invention, one or more of white light, blue light and yellow-green light is added for synergistic induction in the biomass accumulation process or the pigment induction process.

According to a preferred embodiment of the invention, the intensity of the added white or blue light is 500. mu. mol photon m ^-2 ·s ^-1 . The synergistic induction by adding different lights can be carried out in a biomass accumulation culture stage, a pigment induction culture stage or both stages.

In a third aspect, the present invention provides a method for efficiently producing lutein, zeaxanthin, and beta-carotene by heterotrophically culturing Chlorella vulgaris CZ-LZM 3.

In a fourth aspect, the present invention provides a method for efficiently producing lutein, zeaxanthin and beta-carotene, which comprises the method for heterotrophic culture of chlorella as described in the above examples.

(III) advantageous effects

(1) The invention adopts a chemical mutagenesis method to obtain a chlorella mutant strain with high lutein, zeaxanthin and beta-carotene yield by screening, which is named as chlorella CZ-LZM3, and the mutant strain is proved to accumulate higher lutein, zeaxanthin and beta-carotene content in cells under heterotrophic culture conditions, and the content of lutein, zeaxanthin and beta-carotene in the mutant strain is far higher than that of the mutant strain reported by Huang and the like, so the invention has better commercial application prospect.

The contents of lutein, zeaxanthin and beta-carotene in the chlorella CZ-LZM3 are obviously improved compared with wild type, and the growth of the chlorella CZ-LZM3 is not much different from that of the wild type. Under the conventional heterotrophic culture condition, compared with the wild type, the yield of lutein is improved by 1.2 times, the yield of zeaxanthin is improved by 6.4 times, and the yield of beta-carotene is improved by 3.9 times under the heterotrophic culture condition, so that the mutant strain CZ-LZM3 obtained in the invention has great application potential.

(2) In order to further improve the efficiency of the production of lutein, zeaxanthin and beta-carotene, the invention divides the culture process of chlorella CZ-LZM3 into two stages, one is a biomass mass accumulation stage which realizes the high-density culture of chlorella CZ-LZM3 to obtain more chlorella cells, the other is an induced pigment production stage, and the other stage is introduced with three-factor induction, namely phytohormone (specifically gibberellin) + NaCl + high C/N ratio to promote the production of more pigment in chlorella. Wherein, certain intensity of illumination is added in the biomass accumulation process or the pigment induction process to carry out synergistic induction on the algae cells so as to further improve the contents of lutein, zeaxanthin and beta-carotene. Among them, white light has the most obvious effect on increasing the lutein content, and blue light has the most obvious effect on increasing the zeaxanthin content and the beta-carotene content.

In some experiments, the mutant strain CZ-LZM3 screened by the invention is induced and cultured by adopting three factors, and compared with the common heterotrophic culture, the mutant strain CZ-LZM3 has the advantages that the lutein content is improved by 34%, the zeaxanthin content is improved by 42%, and the beta-carotene content is improved by 47%.

Further, compared with the common heterotrophic culture, white light and blue light are added under the induction condition for induction, so that the lutein content in the algae cells is respectively increased by 75% and 30%; the zeaxanthin content is respectively improved by 30 percent, 59 percent and 46 percent under the conditions of white light, blue light and yellow-green light; the beta-carotene content increased by 73%, 100% and 82% under white, blue and yellow-green light conditions, respectively.

In conclusion, the chlorella strain with high lutein, zeaxanthin and beta-carotene yield is obtained by mutation, and the chlorella strain inherits the excellent characteristics of the chlorella suitable for quick and high-density heterotrophic culture and has the characteristics of high lutein, zeaxanthin and beta-carotene yield which are not possessed by the WT chlorella; when in culture, proper heterotrophic culture conditions are firstly provided for accumulating biomass in a large amount, and a special induction means is combined to promote the accumulation of lutein, zeaxanthin and beta-carotene with higher specific gravity in a single cell on the premise of obtaining a large amount of biomass. The technical scheme of the invention provides technical support for the commercial production of natural pigments such as lutein, zeaxanthin, beta-carotene and the like by utilizing chlorella.

Drawings

FIG. 1 is a graph showing the biomass and cell number of Chlorella vulgaris wild type and mutant strain CZ-LZM3 when cultured in shake flasks under total nitrogen (a, c) and nitrogen deficiency (b, d).

FIG. 2 is a photomicrograph of the color and cell morphology changes of Chlorella species wild type and mutant strain CZ-LZM3 when cultured in shake flasks under total (+ N) and nitrogen deficiency (-N) conditions.

FIG. 3 is a graph showing the change of lutein content (a), zeaxanthin content (b) and beta-carotene content (c) in chlorella wild type and mutant strains CZ-LZM3 when cultured in shake flasks for total nitrogen and nitrogen deficiency.

FIG. 4 shows the alignment of the CDS3 region of BKT1 gene of Chlorella vulgaris wild type and mutant CZ-LZM 3.

FIG. 5 shows the change in the biomass (a), the lutein content (b), the zeaxanthin content (c) and the beta-carotene content (d) of chlorella wild type and mutant strain CZ-LZM3 when cultivated in a 7.5L fermenter.

FIG. 6 is a graph showing the effect of the induction of the three factors on the biomass (a), the xanthophyll content (b), the zeaxanthin content (c) and the beta-carotene content (d) of chlorella wild type and mutant LZM3 when cultured in a 7.5L fermenter

FIG. 7 shows the effect of the addition of different light-induced strains on the biomass (a), the lutein content (b), the zeaxanthin content (c) and the beta-carotene content (d) of the mutant CZ-LZM3 when cultivated in a 7.5L fermenter.

Detailed Description

For the purpose of better explaining the present invention and to facilitate understanding, the present invention will be described in detail by way of specific embodiments with reference to the accompanying drawings.

The invention mainly comprises the following contents of determining the mutagenesis condition of Chlorella zofingiensis, screening high-yield lutein, zeaxanthin and beta-carotene mutant strains, identifying the mutant strain CZ-LZM3 of the Chlorella zofingiensis and the wild type mutation site, optimizing heterotrophic culture conditions, inducing three factors and inducing light synergistically, and the like:

firstly, determining the condition of chemical mutagenesis of Chlorella zofingiensis

The culture method of Chlorella zofingiensis is as follows: monoclonal algae (purchased from American ATCC type culture Collection) grown on a solid modified Endo culture medium (the composition and the dosage of the modified Endo culture medium are shown in the attached table 1-2) are picked up to be cultured in a 50mL conical flask filled with 20mL of the modified Endo culture medium for 5 days, then transferred to a 250mL conical flask filled with 100mL of the modified Endo culture medium, and when the cells grow to the logarithmic growth phase, a certain volume of algae liquid is taken for mutagenesis, and the cell number is about 2X 10 ⁶ cells/ml。

The algal cells were collected by centrifugation, and the obtained algal cell pellet was treated with ethyl methylsulfonate (EMS, Sigma-Aldrich, St. Louis, Mo., USA) at various concentrations, and EMS solution was prepared by diluting with 0.2M phosphate buffer (phosphate buffer: NaH) ₂ PO ₄ ·2H ₂ O31.2g，Na ₂ HPO ₄ ·7H ₂ O53.6 g, pH 6.5), the final concentration of EMS is 0.5%, 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0% (W/V), the mixture is placed in a dark environment at 26 ℃ for mutagenesis for 1 hour, 10% sodium thiosulfate is added after the reaction is finished to stop the reaction, 3000g of the mixture is centrifuged for 5min to remove the sodium thiosulfate, and fresh improved Endo culture medium is added for washing twice. Adding a certain amount of fresh improved Endo culture medium, placing in an incubator at 26 ℃ for 24 hours in the dark, taking 400 cells/plate coating, culturing for 3 weeks, and observing the color change of the monoclone after the monoclone grows out.

TABLE 1 formulation of modified Endo Medium

Note: (1) CaCl ₂ ·2H ₂ O mother liquor: 210g of CaCl ₂ ·2H ₂ O in 1L ddH ₂ O

(2)FeSO ₄ ·7H ₂ O&EDTA mixed mother liquor: 32g FeSO ₄ ·7H ₂ O and 4.2g EDTA in 1L ddH ₂ O

TABLE 2 microelement mother liquor formula

It was observed that only 1.5% (W/V) EMS-treated plates developed golden yellow colonies, while EMS-treated plates of other concentrations did not develop colonies or developed white colonies. Therefore, subsequent selection made a pool of mutants producing lutein, zeaxanthin, and β -carotene with 1.5% (W/V) EMS.

Screening, culturing and content determination of mutant strains with high yield of lutein, zeaxanthin and beta-carotene

And (3) coating a certain amount of chlorella algae solution treated by 1.5% (W/V) EMS for 1 hour on an improved Endo solid culture medium, wherein the inoculation amount is 400 cells/plate, observing color change after culturing for 3 weeks, and picking out golden yellow monoclonal and placing in the improved Endo culture medium for culturing. In the case of shake flask culture, the culture was carried out at 2X 10 ⁶ After inoculating cells per ml, placing the cells in a dark shaking table at 26 ℃ and the rotating speed of 180rpm for total nitrogen culture, and then inoculating the cells in 6g/L of the same dry weight to a nitrogen-deficient culture medium for culture under the same culture condition as the total nitrogen culture. In the case of shake flask culture, the dry cell weight, cell number and image of the mutant strain were measured every dayMicrographs. The lutein content, zeaxanthin content, beta-carotene content were measured daily from day 4 onwards. The lutein content, zeaxanthin content and beta-carotene content are mainly determined by High Performance Liquid Chromatography (HPLC), and the specific method for extracting and determining the pigment is as follows:

(1) scooping a small scoop of glass beads into the glass bead breaking tube.

(2) About 20mg of the lyophilized algal powder was weighed into a glass bead breaking tube.

(3) 0.5mL of ice-precooled extract (methanol: dichloromethane ═ 3:1, V/V) was added, and the mixture was shaken 3 times on a glass bead crusher at 3000rpm for 20 seconds each, and cooled at intervals for 1 min.

(4) After being taken out and placed in an ice box to be cooled, 16000g of the mixture was centrifuged for 5min, and the supernatant was transferred to a 5mL glass bottle using a Pasteur pipette.

(5) Adding the extract, and repeating the steps 3-4 for two to three times until the algae residue is colorless.

(6) And drying the collected supernatant by using nitrogen, re-dissolving the supernatant by using 0.5mL of extracting solution, shaking and uniformly mixing the mixture, filtering the mixture by using a disposable syringe and a 0.22 mu m organic filter membrane into a brown sample injection bottle inserted with an inner cannula, and performing on-machine detection.

(7) The HPLC measurement conditions were as follows:

lutein, zeaxanthin and beta-carotene standards (Sigma Biochemical Co., Ltd., USA) were weighed out separately and dissolved in 1.75mL of dichloromethane to give a mother solution concentration of 2mg/mL, and the mixture was diluted with the extract solutions in the order of 0.1mg/mL, 0.05mg/mL, 0.02mg/mL, 0.01mg/mL, 0.005mg/mL, 0.002mg/mL and 0.001mg/mL and transferred to HPLC brown sample bottles equipped with cannulae from low to high concentrations.

Lutein, zeaxanthin and beta-carotene were determined as follows: the chromatographic column is as follows: YMC Carotenoid (250X 4.6mm,5 μm) and the separation temperature was 30 ℃. A sample of 10. mu.L was injected into a Waters e2695 high performance liquid chromatograph (Water Associates, Milford, MA, USA) equipped with a 2998 photodiode. Mobile phase a was (methanol: methyl tert-butyl ether: water 81:15:4, v/v) and mobile phase B was (methanol: methyl tert-butyl ether: water 43.5:52.5:4, v/v). The linear gradient program was: 100% A was run for 45min, then switched to 100% B for 2min, and finally switched to 100% A for 8min at a flow rate of 1.0 mL/min.

Table 3: the dry weight, cell number and pigment content at day 4 of the nitrogen deficiency culture are shown in the following table

Through comparison, the mutant strain with the CZ-LZM3 number has the largest cell number, the largest dry weight and the highest zeaxanthin and beta-carotene content, and finally the monoclonal with the CZ-LZM3 number is used as a target mutant strain through comprehensive calculation.

The culture of chlorella wild type and CZ-LZM3 was continued in a shake flask with total and nitrogen deficiency, and the results of comparing the biomass and cell number are shown in FIG. 1 (a, c correspond to total nitrogen, b, d correspond to nitrogen deficiency): the biomass and cell number of wild type chlorella and mutant strain CZ-LZM3 both showed an increasing trend. Comparing the biomass and cell number of the wild type Chlorella vulgaris and the mutant strain CZ-LZM3 under total nitrogen and nitrogen deficiency culture conditions, it can be seen that the biomass and cell number of the mutant strain CZ-LZM3 are significantly higher than the biomass and cell number (p) of the wild type<0.05). The biomass and cell count of the mutant strain CZ-LZM3 on day 4 of total nitrogen culture were 11.35g/L and 67.7X 10, respectively ⁶ cells/mL, 26.4% and 83% higher than wild type. The biomass and cell count of the mutant strain CZ-LZM3 on day 4 of nitrogen deficiency culture were 13.7g/L and 76.75X 10, respectively ⁶ cells/mL, 17% and 12% higher than wild type.

Constantly observing and taking micrographs, as shown in FIG. 2, the colors of the wild type chlorella and the mutant strain CZ-LZM3 both changed from light yellow to dark yellow upon total nitrogen culture (+ N). From the observation of cell morphology, it was found that the cells began to divide, and many small cells appeared. The color of wild chlorella gradually changes from yellow to orange and the color of mutant gradually changes from yellow to golden yellow during nitrogen deficiency culture (-N). From the observation of cell morphology, it was found that the cells still divided in the nitrogen-deficient culture, and some small cells appeared, and the cell size of the mutant strain CZ-LZM3 decreased from large to small, as with the wild type chlorella.

Comparing the change in lutein content (a), zeaxanthin content (b) and beta-carotene content (c) of chlorella wild type and mutant CZ-LZM3 when shake flasks were subjected to total nitrogen and nitrogen deficiency culture. The results are shown in FIG. 3: after the nitrogen deficiency culture was changed from the total nitrogen culture, the contents of zeaxanthin and beta-carotene tended to decrease in the wild type chlorella and the mutant strain CZ-LZM3, and to increase in the wild type chlorella. On day 5 of the nitrogen deficiency culture (day 9 of FIG. 3), the lutein content was 0.124% of the dry weight of the cells, which is 0.97 times that of wild type Chlorella vulgaris; the zeaxanthin content accounts for 0.216% of the dry weight of the cells, and is 3.4 times of that of wild chlorella; the content of beta-carotene is 0.093% of the dry weight of the cell, which is 3 times of that of wild chlorella.

Third, identification of Chlorella zofingiensis mutant strain CZ-LZM3 and wild type mutation site

The base sequence of the target gene is obtained by designing a specific primer to amplify the appointed gene segment. And comparing the base sequences of different samples, and analyzing the potential snp sites of the target gene. The BKT1 gene of wild type chlorella and chlorella mutant CZ-LZM3 was determined, and 4 pairs of forward and reverse primers were designed since the CDS region of BKT1 gene was divided into four regions (see list below). PCR amplification (pre-denaturation at 95 ℃ for 5min, annealing at 60 ℃ for 30sec, extension at 72 ℃ for 45sec, final extension at 72 ℃ for 5min, and 16 ℃ for 1min, for a total of 35 cycles.) was performed followed by sequencing using Sanger sequencing (3730 xl DNA Analyzer sequencer available from ABI). The original data in the format of ab1 is exported from an ABI 3730xl instrument, and is imported into Chromas analysis software for quality control of sequencing peak maps and exporting corresponding sequence files in the format of seq. And finally, carrying out multi-sequence alignment on the well sequenced full-length sequence in SeqMan software.

The 4 pairs of positive and negative primers are as follows:

BKT1-CDS1-F:5 'TAACTAGAAACCACATCCGC 3' and BKT1-CDS1-R:5 'CAACAAGGTGTACTCAGCG 3';

BKT1-CDS2-F:5 'CATGAAGGTTGTTGCAAAG 3' and BKT1-CDS2-R:5 'ACAGTTTCCCATTGTGATTC 3';

BKT1-CDS3-F:5 'GCACCGTTCATTGCTTAG 3' and BKT1-CDS3-R:5 'GGTGGTAATAGAGAAGCAGC 3' respectively;

BKT1-CDS4-F:5 'CATGTGTGCAGCAATGAC 3' and BKT1-CDS4-R:5 'AAACAAGCGAATTGTGAATC 3'.

The alignment is shown in FIG. 4, where the increased base of the mutant compared to WT type is boxed. The 502-bit insertion CAGACTTCC of CDS3 sequence of ketolase gene BKT1 gene which catalyzes zeaxanthin to astaxanthin leads to the insertion mutation of mutant CZ-LZM 3.

Heterotrophic culture of Chlorella strain Zofinigiensis mutant strain CZ-LZM3

The method aims to solve the problems of slow cell proliferation speed and low biomass when nitrate nitrogen and fixed carbon nitrogen are used in the high-density culture process of the existing Chlorella zofingiensis. According to the invention, ammonium chloride with lower energy consumption in the process is used as a nitrogen source, and meanwhile, the traditional fixed carbon-nitrogen ratio feeding is abandoned, ammonia water is supplemented adaptively according to the condition that the pH of chlorella is reduced in the process of using the nitrogen source, on one hand, the heterotrophic environment of the microalgae is maintained at proper and relatively constant pH by the ammonia water in the ammonia water supplementing process, and on the other hand, the ammonia water is also used as the supplement of the nitrogen source and is provided for the growth and utilization of the microalgae cells, so that the nitrogen source provided by the ammonia water is supplemented adaptively according to the nitrogen utilization condition and the requirement of the microalgae cells, and the limitation on the growth of the microalgae caused by the fixed carbon-nitrogen ratio feeding is avoided, thereby achieving the purpose of improving the growth speed and the biomass concentration of the cells.

In the specific culture process, the content of lutein, zeaxanthin and beta-carotene in the cells of the Chlorella vulgaris zofingiensis mutant strain CZ-LZM3 and the Chlorella vulgaris zofingiensis wild under the same culture conditions are compared by taking the Chlorella vulgaris zofingiensis wild as a reference.

The heterotrophic culture process of Chlorella strain zofingiensis mutant strain CZ-LZM3 comprises the following steps:

1) activation of algal species

A single colony of Chlorella zofingiensis is picked from a well-cultured plate (the algae strain of the mutant strain CZ-LZM3 is smeared on the plate until the colony grows) by using an inoculating loop under a sterile environment, streaking is carried out on a sterilized plate (the composition of a culture medium is shown in an attached table 1), the streaked plate is placed in a dark environment for culturing, and the culture temperature is 26 ℃, and the Chlorella is cultured for 15-20 days (the obvious single colony of Chlorella zofingiensis algae is formed).

2) First order seed culture

From the activated fresh plate, a ring mutant strain CZ-LZM3 (phi 2-3 mm) was picked up and cultured in a 50mL triangular flask (liquid volume of 15mL) with shaking at 27 ℃ and 180rpm for 120-144h (OD) ₇₅₀ ＝8)。

3) Second stage seed culture

Inoculating the cultured primary seed solution into 250mL secondary shake flask (containing 100mL) at 10% (v/v) for shake culture at 27 deg.C and 180rpm for 72-84h (OD) ₇₅₀ ＝16-20)。

4) Three stage seed culture

Inoculating the cultured secondary seed solution into 1000mL of three-stage shake flask (liquid loading amount of 300mL) at an inoculation amount of 10% (v/v), performing shake culture at 27 deg.C and rotation speed of 180rpm for 72-84h (OD) ₇₅₀ ＝20-22)。

The culture solutions for the first seed culture, the second seed culture and the third seed culture are shown in tables 4 and 6.

5) Cultivation in fermenter

The heterotrophically cultured seed solution of Chlorella vulgaris Chlorella zofingiensis mutant strain CZ-LZM3 was inoculated at an initial dry weight of 2.5g/L into a 7.5L fermentor at a culture temperature of 26 deg.C with dissolved oxygen set at 20%, and the dissolved oxygen was controlled by stirring speed and dissolved oxygen coupling. See tables 5-6 for media composition in the fermentors.

The basic culture medium and the supplementary culture medium both adopt ammonium chloride as a nitrogen source, the initial carbon-nitrogen ratio is 5:1-80:1, and the glucose concentration is 20 g/L. When the glucose concentration is lower than 5g/L, a peristaltic pump with adjustable speed is used for feeding a supplemented medium (the supplemented medium is a concentrated solution of a basic medium, the carbon-nitrogen ratio of the supplemented medium is 5-20 times of that of the basic medium), the glucose concentration in the culture process is controlled within the range of 5g/L-20g/L, the pH of a fermentation tank is monitored in the culture process, and the pH is controlled within 6.5 +/-0.2 by using ammonia water in time.

Table 4 shows the culture media for algal species (nutrient components contained in each L as the first, second and third culture liquids)

TABLE 5 fermenter base and feed Medium composition

Composition of matter	Basic culture medium (g/L)	Feed medium (g/L)
			Glucose	5～20	750
Ammonium chloride	0.25～1.0	2.71～37.5
			KH ₂ PO ₄	0.3～1.2	30
MgSO ₄ ·7H ₂ O	0.3～1.2	30
			Citric acid trisodium salt	0.05～0.2	5
CaCl ₂ Mother liquor	1mL	12.5mL
			FeSO ₄ With EDTA mother liquor	1mL	12.5mL
Mother liquor of trace elements	1mL	12.5mL
			Defoaming agent	0.08mL

TABLE 6 stock solution composition in each medium/solution

In the experiment, the culture conditions of the specific fermentation tank culture in the step 5) are changed to obtain the following scheme:

A) and the initial carbon-nitrogen ratio in the basic culture medium is 35:1, and the carbon-nitrogen ratio in the feed culture medium is 420: 1. Other conditions are as listed above with reference to step 5).

B) And the culture medium adopts ammonium chloride as a nitrogen source, so that the initial carbon-nitrogen ratio in the basic culture medium is 30:1, and the carbon-nitrogen ratio of the feed medium is 30: 1. Other conditions are as listed above with reference to step 5).

C) And the culture medium adopts ammonium chloride as a nitrogen source, so that the initial carbon-nitrogen ratio in the basic culture medium is 20:1, and the carbon-nitrogen ratio of the feed medium is 300: 1. The other conditions are the same as in the above 5).

D) The culture medium adopts urea as a nitrogen source, the initial carbon-nitrogen ratio is 34:1, and the carbon-nitrogen ratio of the feed supplement culture medium is 34: 1. Other conditions are as listed above with reference to step 5).

E) The culture medium adopts urea as a nitrogen source, the initial carbon-nitrogen ratio is 34:1, and the carbon-nitrogen ratio of the feed supplement culture medium is 408: 1. The other conditions are the same as in the above 5). The other conditions are the same as in the above 5).

F) Sodium nitrate is used as a nitrogen source in the culture medium, the initial carbon-nitrogen ratio is 34:1, and the carbon-nitrogen ratio of the feed supplement culture medium is 34: 1. Other conditions are as listed above with reference to step 5).

The cell dry weight of the Chlorella vulgaris zofingiensis mutant strain CZ-LZM3 cultured to the 10 th day is 185g/L, 136g/L, 180g/L, 89g/L, 128g/L and 44g/L respectively. Thus, both protocols A and C gave higher dry cell weight of the mutant strain CZ-LZM 3. Thus in the biomass accumulation phase during the subsequent heterotrophic cultivation, the cultivation takes place in a fermenter according to the conditions listed above for step 5).

The cell dry weight, the lutein content, the zeaxanthin content, and the beta-carotene content of the mutant strain CZ-LZM3 and Chlorella wildtype were measured on day 16 of fermentation culture according to protocol A and are shown in FIG. 2. In all figures a-d of fig. 5, the lower curve corresponds to wild-type chlorella. As can be seen from the graph, the dry cell weight of Chlorella wildtype and the mutant strain CZ-LZM3 tended to increase with the culture time. The maximum dry cell weight of the mutant strain CZ-LZM3 cultured for 16 days can reach 251.5 g/L. When the mutant strain CZ-LZM3 is cultured to 16 days, the dry weight of the cell can reach 251.5g/L, the lutein content in the mutant strain CZ-LZM3 can account for 0.097%, the zeaxanthin content can account for 0.259% and the beta-carotene content can account for 0.149%. When the culture is carried out till the 16 th day, the yield of the lutein can reach 0.2502g/L, the yield of the zeaxanthin can reach 0.6509 g/L, and the yield of the beta-carotene can reach 0.3775 g/L. Furthermore, the inventors have surprisingly found that the ratio of zeaxanthin content and lutein content of the mutant strain CZ-LZM3 under heterotrophic culture conditions is close to 2.4:1 on

days

12, 13 and 16 of culture, which is the optimal ratio for the foveal region of the macula of a human eye.

Fifthly, induced culture and pigment accumulation of Chlorella zofingiensis mutant strain CZ-LZM3

When the dry cell weight of the mutant strain CZ-LZM3 reaches 180g/L or more after fermentation culture for 10 days, the strain can be switched into a three-factor induction culture stage to promote pigment accumulation in algae cells. The experiment was controlled against a blank (no three-factor induction). The three-factor induction culture method comprises the following steps: adding gibberellin, sodium chloride and a carbon source into the fermentation medium to ensure that the culture medium instantaneously meets the following conditions: gibberellin concentration was 10mg/L, initial carbon to nitrogen ratio 180:1 and sodium chloride concentration 200 mM.

The mutant strain CZ-LZM3 is cultured to show the same biomass and pigment change tendency as wild chlorella. As shown in FIG. 6, the biomass of mutant strain CZ-LZM3 still increased after switching to three-factor induction, and the biomass reached 237g/L by culturing until day 16 (6 days after three-factor induction). Compared with a control group (without three-factor induction), the content of lutein, zeaxanthin and beta-carotene of the mutant strain CZ-LZM3 is obviously improved (p is less than 0.05). Compared with a control group, the lutein content is improved by 36%, the zeaxanthin content is improved by 44%, and the beta-carotene content is improved by 48% under the three-factor induction condition.

Sixthly, performing heterotrophic culture in a fermentation tank according to the scheme A of the fourth part and adding different light quality for inducing the growth and accumulation of lutein, zeaxanthin and beta-carotene on the Chlorella zofingiensis mutant strain CZ-LZM3

The experiments were divided into white, blue and yellow-green light groups. Winding LED lamp strips with different light quality conditions on a transparent 7.5L fermentation tank body, and placing a photon meter at the center of an empty fermentation tank to obtain light intensity of 500 mu mol photon m ^-2 ·s ^-1 . The dry cell weight of the mutant strain CZ-LZM3 was determined daily during the cultivation. The lutein content, zeaxanthin content, beta-carotene content were measured daily from day 4 onwards. The measurement results are shown in fig. 7. Wherein, a is the mutant strain CZ-LZM3 biomass, b is the lutein content, c is the zeaxanthin content and d is the beta-carotene content.

As can be seen from the figure, the biomass of wild chlorella and the mutant strain CZ-LZM3 is not affected by different light induction, the biomass is increased, and the biomass of the mutant strain CZ-LZM3 can reach 217g/L, 211g/L, 216.5g/L and 203g/L under dark, white light, blue light and yellow green light conditions when the strain is cultured heterotrophically for 12 days. Compared with a control group, the lutein content is respectively increased by 75 percent and 30 percent under the white light and blue light conditions after the culture for 12 days; the zeaxanthin content is respectively improved by 30%, 59% and 46% under the conditions of white light, blue light and yellow green light; the beta-carotene content increased by 73%, 100% and 82% under white, blue and yellow-green light conditions, respectively.

Different light induction methods can also be used to superpose the three-factor induction culture phase or throughout the two-phase culture of the biomass accumulation phase and the pigment induction phase.

The main inventive contributions of the present invention are as follows:

(1) after 1.5 percent EMS treatment for 1 hour, a chlorella mutant with high lutein, zeaxanthin and beta-carotene yield can be obtained, and the chlorella mutant CZ-LZM3 is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M20211675. Sequencing proves that 9 bases CAGACTTCC are inserted into 502 bases of BKT1-CDS3 of the mutant strain CZ-LZM 3.

(2) Glucose and ammonium chloride are used as carbon-nitrogen sources, the carbon-nitrogen ratio in a basic culture medium is 5:1-80:1, the nitrogen-carbon ratio in a supplemented culture medium is 5-20 times of the carbon-nitrogen ratio in the basic culture medium, the pH value of a culture system is adjusted by ammonia water to be kept at 6.5 +/-0.2 in the culture process, the culture temperature is 26-28 ℃, the dissolved oxygen is set to be 20 +/-2, the stirring speed and the dissolved oxygen are coupled to control the dissolved oxygen, the glucose concentration is monitored in the culture process, the supplemented culture medium is fed when the glucose concentration in the basic culture medium is reduced to 5g/L, the glucose concentration is constantly controlled to be within the range of 5-20g/L, the mutant strain CZ-LZM3 can realize ultrahigh cell density in a 7.5L fermentation tank, and the dry cell weight can reach more than 180g/L when the culture is carried out for 10 days. And according to the mode, on the premise of no external induction factor, the dry weight of the cells can reach 251.5g/L when the cells are cultured to the 16 th day, and the contents of lutein, zeaxanthin and beta-carotene respectively account for 0.097%, 0.259% and 0.149% of the dry weight of the cells. These are well above the levels reported in the prior art.

(3) Under heterotrophic conditions, high C/N, gibberellin and NaCl induce the chlorella mutant strain CZ-LZM3 to produce lutein, zeaxanthin and beta-carotene under heterotrophic conditions. NaCl and gibberellin are generally applied to chlorella under autotrophic conditions in the prior art to increase the accumulation of pigments in the chlorella, while the inventor finds that sodium chloride and gibberellin can also stimulate chlorella under heterotrophic conditions to accumulate pigments.

(4) Different photoplasmic inductions had no effect on the biomass of wild type chlorella and mutant CZ-LZM 3. The method is characterized in that different light substances are synergistically added under the heterotrophic condition for induction, and the effect of white light on the improvement of the lutein content is most obvious and is improved by 75 percent compared with a control group (dark) when the culture is carried out for 12 days; the blue light has the most obvious effect of improving the zeaxanthin content and the beta-carotene content, and the content is respectively improved by 59 percent and 100 percent.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A chlorella mutant strain with high yield of lutein, zeaxanthin and beta-carotene under heterotrophic culture conditions is named as chlorella CZ-LZM3, which is preserved in China Center for Type Culture Collection (CCTCC) at 12 months and 24 days in 2021, and the preservation number is CCTCC No: m20211675, the preservation address is Wuhan city Wuchang district No. 299, Hubei province.

2. A method for heterotrophic culture of chlorella, the method comprising: a basic culture medium and a supplementary culture medium are used in the heterotrophic culture process, the basic culture medium is a culture medium initially contained in a fermentation tank, the supplementary culture medium is a culture medium gradually supplemented into the fermentation tank along with the culture, and the chlorella CZ-LZM3 is inoculated into the basic culture medium during the culture;

a. the nitrogen sources in the basic culture medium and the supplemented culture medium are both ammonium chloride;

3. The method for heterotrophic culture of chlorella according to claim 2, wherein the culture temperature during the biomass accumulation is 26-28 ℃, the dissolved oxygen is set to 20% ± 2, the stirring speed and the dissolved oxygen coupling control dissolved oxygen, the ph is controlled to 6.5 ± 0.2.

4. The chlorella heterotrophic culture method according to claim 2, wherein the pigment accumulation process is induced by a combination of three factors: i.e.adding gibberellin, sodium chloride to the fermentor and abruptly increasing the C/N ratio.

5. The method for heterotrophic culture of chlorella according to claim 4, wherein the concentration of gibberellin in the fermenter is 10mg/L, the concentration of sodium chloride is 200mM, and a carbon source is added so that the C/N ratio is 180: 1.

6. The method for heterotrophic culture of Chlorella vulgaris according to claim 2 wherein the end point of the biomass accumulation process is to culture for 10 days or to switch to pigment induction when the dry cell weight of Chlorella vulgaris zofingiensis mutant strain CZ-LZM3 is more than 180 g/L.

7. The method for heterotrophic culture of chlorella according to claim 2, wherein the end point of the pigment induction process is: taking samples at the same time point for several days continuously to determine the content of lutein, zeaxanthin and beta-carotene, and finishing the induction process when the content of lutein, zeaxanthin and beta-carotene in the samples is unchanged or begins to decline.

8. The method for heterotrophic culture of chlorella according to claim 2 or 7, wherein one or more of white light, blue light and yellowish green light is added for synergistic induction during the biomass accumulation process or pigment induction process.

9. The method for heterotrophic culture of Chlorella as claimed in claim 8, wherein the added white or blue light has an intensity of 500 μmol photonm ^-2 ·s ^-1 。

10. A method for efficiently producing xanthophyll, zeaxanthin and β -carotene, which is characterized by comprising the steps of heterotrophically culturing the chlorella vulgaris CZ-LZM3 according to claim 1; or the method comprises the chlorella heterotrophic culture method of any one of claims 2 to 9.