CN114891822A

CN114891822A - Construction method of high-yield gamma-linolenic acid mucor circinelloides recombinant bacteria, recombinant bacteria constructed by method and application

Info

Publication number: CN114891822A
Application number: CN202210762108.9A
Authority: CN
Inventors: 宋元达; 王秀文; 杨武; 杨俊换
Original assignee: Shandong University of Technology
Current assignee: Shandong University of Technology
Priority date: 2022-06-29
Filing date: 2022-06-29
Publication date: 2022-08-12
Anticipated expiration: 2042-06-29
Also published as: CN114891822B

Abstract

The invention discloses a construction method of a high-yield gamma-linolenic acid mucor circinelloides recombinant strain, the recombinant strain constructed by the method and application, and belongs to the technical field of genetic engineering. The construction method of the high-yield gamma-linolenic acid mucor circinelloides recombinant strain comprises the steps of connecting nucleic acid sequences of delta 6, delta 12 and delta 9 fatty acid desaturase genes to an expression vector, transforming the obtained recombinant vector into a mucor circinelloides strain, screening positive clones, and allowing the delta 6, delta 12 and delta 9 fatty acid desaturase to be overexpressed in the mucor circinelloides strain, so as to obtain the high-yield gamma-linolenic acid mucor circinelloides recombinant strain. The recombinant strain Mc-d61d12d91 constructed by the method has the advantages that the GLA content is remarkably improved, the GLA content can reach 19.8% of total fatty acids, the oil yield is improved, the biomass can reach 38.2%, and the GLA yield can reach 1.22 g/L.

Description

Construction method of high-yield gamma-linolenic acid mucor circinelloides recombinant bacteria, recombinant bacteria constructed by method and application

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a construction method of a high-yield gamma-linolenic acid mucor circinelloides recombinant strain, the recombinant strain constructed by the method and application.

Background

The microorganisms capable of accumulating more than 20% of oil in cells are called oil-producing microorganisms and comprise bacteria, fungi, yeast, microalgae and the like, the produced oil is microbial oil or unicellular oil, and the microbial oil has the advantages of high oil content, short production period, rich raw material source, no occupation of too much cultivated land, no influence of seasons and climate and the like. Since the 80 s in the 20 th century, the first strain in the world for realizing industrial production of GLA was the oil-producing microorganism Mucor circinelloides, and due to the strong lipid production capacity and complete genome sequencing, gene operation systems are increasingly perfected and used as model organisms for researching the production of GLA by microbial fermentation.

Polyunsaturated fatty acids (PUFAs) are straight-chain fatty acids with a carbon chain length of 18 to 22 carbon atoms, which contain two or more double bonds. PUFAs can be classified into two broad classes of polyunsaturated fatty acids, the omega-3 series and the omega-6 series, depending on where the double bond is first introduced. Linoleic acid, linolenic acid, and the like are called essential fatty acids because of the lack of enzymes that catalyze the production of two or more unsaturated double bonds in the human body.

GLA, an essential fatty acid, is an omega-6 series polyunsaturated fatty acid, has important physiological functions for human body, and has anti-inflammatory, anti-cardiovascular disease, anti-tumor and anti-diabetic effects. Currently, the main sources of GLA are some plant seeds, most of which are evening primrose, grass-leaved sweetflag, blackcurrant and the like. Because plant growth is greatly influenced by environment and the production period is long, more and more eyes are projected to microorganisms to produce GLA, such as Mucor, Mortierella, Benninghamella, Rhizopus, Trichoderma and the like, but at present, the GLA of both microorganisms and plant sources does not reach the yield of commercial production.

Disclosure of Invention

Aiming at the problems in the prior art, the invention aims to provide a construction method of a high-yield gamma-linolenic acid mucor circinelloides recombinant bacterium, the recombinant bacterium constructed by the method and application.

In order to achieve the purpose, the invention adopts the following technical scheme:

the construction method of the high-yield gamma-linolenic acid mucor circinelloides recombinant strain comprises the steps of connecting nucleic acid sequences of delta 6, delta 12 and delta 9 fatty acid desaturase genes to an expression vector, transforming the obtained recombinant vector into a mucor circinelloides strain, screening positive clones, and allowing the delta 6, delta 12 and delta 9 fatty acid desaturase to be over-expressed in the mucor circinelloides strain to obtain the high-yield gamma-linolenic acid mucor circinelloides recombinant strain.

In a specific embodiment, the nucleic acid sequence of the Δ 6 fatty acid desaturase gene is set forth in SEQ ID NO 1; the nucleic acid sequence of the delta 12 fatty acid desaturase gene is shown as SEQ ID NO. 2; the nucleic acid sequence of the delta 9 fatty acid desaturase gene is shown in SEQ ID NO. 3.

In a specific embodiment, the mucor circinelloidal strain is mucor circinelloidal Mu 760.

In a specific embodiment, the expression vector is at least one of an integrative plasmid pMAT2075 and an integrative plasmid pMAT 2076.

In a specific example, the Δ 6 fatty acid desaturase gene is first ligated to the integrative plasmid pMAT2075, and the recombinant plasmid is then transformed into the protoplast of mucor circinelloids deficient strain Mu760 to yield the recombinant strain Mc-d 61;

then the delta 12 fatty acid desaturase gene and the delta 9 fatty acid desaturase gene are connected to an integration plasmid pMAT 2076;

and finally, transforming the recombinant plasmid containing the delta 12 fatty acid desaturase gene and the delta 9 fatty acid desaturase gene into a protoplast of Mucor circinelloides Mc-d61 to obtain a recombinant strain Mc-d61d12d91, namely the constructed high-yield gamma-linolenic acid Mucor circinelloides recombinant strain.

The recombinant strain of the Mucor circinelloides for high yield of the gamma-linolenic acid constructed by the method is Mucor circinelloides, is preserved in China general microbiological culture Collection center (CGMCC 40013) at20 days 12 months in 2021, and has a preservation number of CGMCC 40013.

The application of the high-yield gamma-linolenic acid mucor circinelloides recombinant strain in fermentation production of gamma-linolenic acid.

A method for producing gamma-linolenic acid by fermenting the high-yield gamma-linolenic acid mucor circinelloides recombinant bacteria is to inoculate a strain with the preservation number of CGMCC 40013 on a fermentation medium for fermentation, wherein the fermentation condition is 28 ℃, 600rpm and the air input is 1v/v min ^-1 The pH was maintained at 6.0.

The technical scheme of the invention has the advantages that:

the invention provides a method for constructing a Mucor circinelloides strain with high GLA yield by coexpressing endogenous delta 6, delta 12 and delta 9 fatty acid desaturase genes; the GLA content of the recombinant strain Mc-d61d12d91 is remarkably improved to 19.8% of total fatty acid, the oil yield is also improved to 38.2% of biomass, and therefore the GLA yield can reach 1.22 g/L.

Drawings

FIG. 1 plasmid maps of pMAT2075, pCRC124, pMAT2076 and pCRC 150;

FIG. 2 is a diagram of the structure of the gene amplified by PCR of recombinant strain Mc-d61 and an electrophoretogram;

FIG. 3 shows a gene structure diagram and an electrophoretogram of PCR amplification of the recombinant strain Mc-d61d12d 91;

FIG. 4 Effect of isozymes of Δ 6 fatty acid desaturase on lipid content and GLA content;

FIG. 5 Effect of isozymes of Δ 9 fatty acid desaturase on lipid content and GLA content.

Detailed Description

Terms used in the present invention have generally meanings as commonly understood by one of ordinary skill in the art, unless otherwise specified.

The present invention will be described in further detail with reference to the following data in conjunction with specific examples. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

Example 1

Cloning of mucor circinelloides des61, des12 and des91 and construction of recombinant vector

The Mucor circinelloides WJ11 strain was inoculated into a 500 mL baffled Erlenmeyer flask containing 100 mL of K & R medium, cultured at 28 ℃ and 130 rpm for 48 h, filtered with a Buchner funnel, and washed with distilled water three times to obtain a mycelium. Freezing at-80 deg.C overnight, extracting RNA by Trizol method, and reverse transcribing according to the reverse transcription kit instruction to obtain cDNA.

The extracted cDNA of the Mucor circinelloides WJ11 strain is taken as a template, and the following primer pairs are adopted to clone des61, des12 and des91 gene sequences shown as SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 respectively.

SEQ ID NO:1

SEQ ID NO:2

SEQ ID NO:3

The primer sequences for clones des61, des12 and des91 are as follows:

D61-F：5’–ATGAGCAGCGACGTAGGAGCAACAGC–3’(SEQ ID NO:4)；

D61-R：5’–AGAAATTCAGCAAAAAAATGCTCTAA–3’(SEQ ID NO:5)；

D12-F：5’–ATGATGGCAACCAAGAGAAACGTT–3’(SEQ ID NO:6)；

D12-R：5’–TGTCTTCTTTAAGAACTAATCTATGA–3’(SEQ ID NO:7)；

D91-F：5’–ATGTCAACTACAACGACAACTA–3’(SEQ ID NO:8)；

D91-F：5’–AACCTGAGAAGAACAAGACCAAGTAA–3’(SEQ ID NO:9)；

and (3) PCR reaction system: 5 XPrimeSTAR buffer 10. mu.L, dNTP mix (2mM each) 5. mu.L, upstream and downstream primers each 1. mu.L, total cDNA 100-200 ng, PrimeSTAR HS DNApolymerase 1. mu.L, ddH ₂ Make up to 50. mu.L of O.

The reaction condition is that the cycle is started after the denaturation is carried out for 3min at 95 ℃, then the denaturation is carried out for 10min at 95 ℃, the annealing is carried out for 30sec at 55 ℃, the extension is carried out for 90sec at 72 ℃, the extension is continued for 10min at 72 ℃ after the cycle is carried out for 30 times, and finally the temperature is reduced to 4 ℃ for storage.

Recovering the amplified product, connecting the 1407bp des61 PCR fragment with pMAT2075 vector (vector diagram is shown as a in figure 1) to obtain pCRC124 (vector diagram is shown as b in figure 1), connecting the 1191bp des12 PCR fragment and the 1386bp des91 PCR fragment obtained by amplification with pMAT2076 vector (vector diagram is shown as c in figure 1) to obtain pCRC150 (vector diagram is shown as d in figure 1, pCRC150 is a plasmid containing des12 and des91 genes in the structural sequence of 1kb upstream of sodit-a, marker gene LeuA, promoter Pzrt1, target gene des12, terminator T1, promoter Pgpd1, des91 and 1kb downstream of sodit-a), then transferring the connected vector into competent cell E.coli Top10, coating the transformed product on a yeast strain containing 100mg/L penicillin (10g/L NaCl, 10g/L, 15 g/L) agar, placing the mixture in a constant temperature incubator at 37 ℃ for 14-16 h. And then selecting a single colony, inoculating the single colony into an LB liquid culture medium, culturing at 37 ℃ and 200rpm for 14-16 h, and extracting plasmids for sequencing verification.

Example 2

Obtaining of recombinant strain Mc-d61d12d91 of high-yield GLA mucor circinelloides

Preparation of Mucor circinelloides Mu760 protoplast: spores of Mu760 Mu circinelloides were inoculated onto YPG plates (3g/L yeast extract, 10g/L peptone, 20g/L glucose, 20. mu.g/mL leucine, 200. mu.g/mL uracil, pH 4.5) and cultured in a 28 ℃ incubator. Picking single colony to YPG plate, culturing at 28 deg.C for 3-4 days, collecting spore suspension, placing in sterilized 50mL centrifuge tube, calculating concentration by hemacytometer method, and diluting to obtain spore with concentration of 12.5 × 10 ⁷ one/mL spore suspension, 1mL spore suspension was placed in a 250mL Erlenmeyer flask containing 20mL liquid YPG and left overnight at 4 ℃ to allow the spores to fully imbibe water and swell. The Erlenmeyer flask was then set to 28 ℃ and spores were cultured at 200rpm to germinate and observed microscopically for status. After centrifugation at 1500rpm for 5min, 5mL of PS Buffer pH6.5 (18.22g sorbitol and 20mL of SPB Buffer (10mM Na) ₂ HPO ₄ ，2mM KH ₂ PO ₄ ) Two washes) and YPG medium was washed off. Then, the cells were resuspended in 5mL of PS Buffer, and lyase was added to a final concentration of 4mg/mL and chitinase was added to a final concentration of 0.06. mu.L/mL, and the mixture was incubated at 30 ℃ for 90min in a shaker at 60rpm to remove cell walls. Then 20mL of 0.5M pre-cooled sorbitol is added, after centrifugation for 5min at 1500rpm, the mixture is washed twice by 0.5M pre-cooled sorbitol, 0.5M sorbitol is added to lightly blow and suck the heavy suspension precipitate to obtain protoplast, and the protoplast is subpackaged by 100 uL/tube for use.

Construction of recombinant strain Mc-d 61: 100 μ L of the above-prepared Mu760 protoplast of Mucor circinelloides was mixed with 1 μ g of plasmid pCRC124 and transformed by electric shock, 1mL of pre-cooled YPGS (0.5M sorbitol, 3g/L yeast extract, 10g/L peptone, 20g/L glucose) was added immediately after the electric shock was completed, incubated at 28 ℃ and 100rpm for 1h, centrifuged at 1500rpm to remove YPGS, and YNBS (91.1g/L sorbitol, 1.5g/L glutamic acid, 1.5g/L (NH) ₄ ) ₂ SO ₄ 0.5g/L yeast basic nitrogen source, 10g/L glucose, pH 4.5, adding thiamine and nicotinic acid to a final concentration of 1. mu.g/mL after sterilization, resuspending, uniformly coating on an MMC screening plate (10g/L casein hydrolysate, 0.5g/L yeast basic nitrogen source, 20g/L glucose, 15g/L agar, pH 3.2, adding thiamine and nicotinic acid to a final concentration of 1. mu.g/mL after sterilization), and avoiding temperature at 28 ℃ to avoidAnd (5) performing light culture for 3-4 days. Randomly picking single colony hypha on a new MMC plate, culturing for 2-3 days at 28 ℃, collecting spores, respectively inoculating about 200 spores into the MMC plate and the MMC plate containing uracil, culturing for 2-3 days at 28 ℃, counting, repeating the screening steps until the growth number of the spores in the two plates is basically the same, and indicating that a transformant with stable heredity is obtained. Stably inherited transformant is cultured on YPG medium plate at 28 ℃ for 5-7 days to collect spores, and the concentration of the spores is adjusted to be 1 multiplied by 10 ⁷ pieces/mL were stored in 30% glycerin tube at-80 ℃. The finally obtained recombinant strain Mc-d61 of Mucor circinelloides and the control strain Mc-2075 (pMAT 2075-unloaded strain) were verified by PCR using the following primer pairs.

CarRP-F:5’–GATAAGCATA AACCAGATCTGC–3’(SEQ ID NO:10)；

CarRP-R:5’–GTATCTGACA TAGTCGAGCTTC–3’(SEQ ID NO:11)；

The reaction system and the amplification condition are pre-denatured at 95 ℃ for 2min, denatured at 98 ℃ for 20sec, annealed at 51 ℃ for 20sec, extended at 72 ℃ for 3min and 30sec, extended at 72 ℃ for 7min after 30 cycles, and finally cooled to 4 ℃ for storage.

The PCR results are shown in FIG. 2, wherein a is the gene structure diagram of the different amplified strains, 1 is the CarRP gene segment of the original strain Mucor circinelloides Mu760, 2 is the genomic fragment obtained by transferring PyrF and Pztt 1 of the empty plasmid pMAT2075 into Mucor circinelloides Mu760 by using the principle of homologous recombination, and 3 is the genomic fragment obtained by transferring the plasmid fragment with over-expressed d61 into Mucor circinelloides Mu 760. Wherein, the fragment obtained by amplifying the recombinant strain Mc-d61 of the Mucor circinelloides is 5887bp, and the fragment of the corresponding position of the control strain Mc-2075 is 4476bp, which indicates that the recombinant plasmid is successfully transformed into the Mucor circinelloides. b is an electrophoresis result picture of amplification, wherein M is maker; lane 1 is control strain Mc-2075;

lanes

2 and 3 represent the recombinant strain Mc-d61 of Mucor circinelloides, which is consistent with the results in a.

Construction of recombinant strain Mc-d61d12d 91: preparing protoplast from recombinant strain Mc-d61 by the above method, mixing 100uL of Mc-d61 protoplast with 1 μ g of plasmid pCRC150, performing electric shock transformation, immediately adding 1mL of precooled YPGS, incubating at 28 deg.C and 100rpm, and culturingYPGS was removed by centrifugation at 1500rpm for 1h, resuspended in YNBS and plated onto YNB selection medium (1.5g/L glutamic acid, 1.5g/L (NH) ₄ ) ₂ SO ₄ 0.5g/L yeast basic nitrogen source, 10g/L glucose, 15g/L agar and pH 3.2, adding thiamine and nicotinic acid to a final concentration of 1 mu g/mL) after sterilization, and culturing for 3-4 days at 28 ℃ in the dark. Randomly picking single colony hyphae on a new YNB plate, culturing for 2-3 days at 28 ℃, collecting spores, respectively inoculating about 200 spores into the YNB plate and the YNB plate containing leucine, culturing for 2-3 days at 28 ℃, counting, and repeating the screening steps until the growth number of the spores in the two plates is basically the same, which indicates that genetically stable transformants are obtained. Stably inherited transformant is cultured on YPG medium plate at 28 ℃ for 5-7 days to collect spores, and the concentration of the spores is adjusted to be 1 multiplied by 10 ⁷ pieces/mL were stored in 30% glycerin tube at-80 ℃. Finally, the recombinant strain Mc-d61d12d91 of the mucor circinelloides is obtained. PCR validation was performed using the following primer pairs.

mt-F：5’–TTATTTTTATCGTTTGGTGGTACACAAACTGC–3’(SEQ ID NO:12)；

mt-R：5’–GTAACCCCACAGAAATAGAGCCATAAGG–3’(SEQ ID NO:13)；

The reaction system and the amplification condition are pre-denatured at 95 ℃ for 2min, denatured at 98 ℃ for 20sec, annealed at 50 ℃ for 20sec, extended at 72 ℃ for 5min, extended at 72 ℃ for 10min after 30 cycles, and finally cooled to 4 ℃ for storage.

The PCR verification result is shown in FIG. 3, a is the gene structure diagram of different amplified strains, 1 is the structure diagram of the amplified fragment of the recombinant strain Mucor circinelloides Mc-d61, and 2 is the structure diagram of the amplified fragment of the recombinant strain Mc-d61d12d 91; wherein, the fragment obtained by amplifying the recombinant strain Mc-d61d12d91 of the Mucor circinelloides is 9980bp, while the fragment of the corresponding position of the control strain Mc-d61 is 4217bp, which indicates that the plasmid is successfully transformed into the Mucor circinelloides. b is an electrophoresis result picture of amplification, wherein M is maker; lane 1 is control strain Mc-d 61;

lanes

2 and 3 represent the recombinant strain Mc-d61d12d91 of Mucor circinelloides, which is consistent with the results in a.

The successfully constructed recombinant strain Mc-d61d12d91 was deposited in the general microbiological center of the China Committee for culture Collection of microorganisms at 12 months and 20 days in 2021, and the address is No. 3 Hospital No. 1 of Xilu, North Chen, the sunward, Beijing, City. The preservation number given to the biological material by the collection center is CGMCC 40013, and the suggested classification name is Mucor circinelloides.

Example 3

Fermentation method of recombinant strain Mc-d61d12d91 of high-yield GLA mucor circinelloides

In a 1.5L fermenter with 1L K&And culturing the recombinant strain Mc-d62d12d91 of the mucor circinelloides in the culture medium R. The fermentation conditions were 28 ℃, 600rpm, and the air input was 1v/v min ^-1 The pH was maintained at about 6.0.

K&R medium: 30g/L glucose, 1.5g/L MgSO ₄ ·7H ₂ O, 3.3g/L ammonium tartrate, 7.0g/L KH ₂ PO ₄ ，2.0g/L Na ₂ HPO ₄ 1.5g/L yeast extract, 0.1g/L CaCl ₂ ·2H ₂ O，8mg/L FeCl ₃ ·6H ₂ O，1mg/L ZnSO ₄ ·7H ₂ O，0.1mg/L CuSO ₄ ·5H ₂ O，0.1mg/L Co(NO ₃ ) ₂ ·6H ₂ O，0.1mg/L MnSO ₄ ·5H ₂ O。

Collecting fermentation liquor samples of 6, 12, 24, 48, 36, 48, 60, 72, 84 and 96 hours according to the oil production rule of mucor circinelloides, separating the fermentation liquor and mycelium, storing the fermentation liquor at-20 ℃ for later use, washing the mycelium for 3 times by using distilled water, collecting the mycelium, storing at-80 ℃, and then freezing and drying for later use.

The method for extracting the grease in the sample comprises the following specific steps: weighing about 10mg of the freeze-dried thalli, and adding 2mL of 4M hydrochloric acid into a 5mL glass bottle; ② water bath is carried out for 3h at 80 ℃, and vortex oscillation is carried out once every 30 min; ③ cooling to room temperature, adding 1mL of methanol and 1mL of chloroform, and adding 100 μ L of pentadecanoic acid (C15: 0) with a certain concentration as an internal standard by using a microsyringe; fourthly, fully and uniformly mixing for 15min, centrifuging for 5min at 3000rpm, and collecting a chloroform layer in a new glass bottle; drying by nitrogen; sixthly, adding 1mL of 10% hydrochloric acid methanol solution, carrying out water bath at 60 ℃ for 3h, and carrying out vortex oscillation once every 30 min; seventhly, after cooling to room temperature, adding 2mL of n-hexane and 1mL of saturated saline solution, fully and uniformly mixing for 15min, centrifuging at 3000rpm for 5min, sucking 1mL of the upper n-hexane layer, and transferring to a gas phase bottle to obtain a fatty acid methyl ester solution.

Adopting gas chromatography analysis, wherein the gas chromatography is GC-689N of Agilent in America, and the measurement conditions are as follows: gas chromatography conditions, no split-flow sample injection, DB-Waxetr (30m × 0.32mm, 0.22 μm) chromatographic column, hydrogen ion flame monitor, nitrogen as carrier gas, 250 ℃ for both gasification chamber temperature and detector temperature, and 1 μ L sample injection. Temperature rising procedure: the initial temperature is 80 ℃, the temperature is increased to 200 ℃ at the heating rate of 8 ℃/min, then increased to 205 ℃ at the heating rate of 1 ℃/min, finally increased to 240 ℃ at the heating rate of 4 ℃/min, and the temperature is kept for 5 min. The position of each fatty acid and the size of the peak area of the composition are recorded, and the total fatty acid content is calculated. As a result, as shown in Table 1, the intracellular lipid content of the overexpression strain Mc-d61d12d91 was significantly increased as compared with the control strain Mc-2075.

TABLE 1 oil and fat content of control and overexpression strains Mc-d61d12d91

The results of the measurement of the intracellular fatty acid composition of the recombinant strain Mc-d61d12d91 are shown in Table 2, and it can be seen from Table 2 that the intracellular fatty acid composition of the recombinant strain Mc-d61d12d91 is greatly changed and the GLA content is increased to 19.8% of the total fatty acids compared with the control strain Mc-2075.

TABLE 2 fatty acid composition and amount of Mc-d62d12d91 for control and over-expressed strains

Effect of isoenzymes on oil and fat content and GLA content

Both Δ 6 and Δ 9 fatty acid desaturases have two isoenzymes. Δ 61 was more effective than Δ 62 for both isozymes of Δ 6 fatty acid desaturase. Delta 61 and delta 62 genes were ligated into the pMAT2075 vector, respectively, to transform the Mucor circinelloides strain Mu760 to obtain over-expressed strains (Mc-d61 and Mc-d62) containing delta 61 and delta 62, and to transform a pMAT 2075-unloaded strain as a control (Mc-2075); after fermentation for 96h in a 1L fermentation tank, the contents of lipid and various fatty acids were measured by oil extraction, and the results are shown in FIG. 4, wherein the GLA content of the Mc-d61 strain is 21% in total fatty acid content, which is 61.5% higher than that of the control strain (13%), while the GLA content of the Mc-d62 strain is only 15.7% in total fatty acid content, which is not significantly changed compared with the control strain.

Δ 91 is more effective than Δ 92 for both isozymes of Δ 9 fatty acid desaturase. Respectively connecting delta 12, delta 91, delta 12 and delta 92 into a pMAT2076 vector, transforming the Mc-d61 strain to obtain two recombinant strains of Mc-d61d12d91 and Mc-d61d12d 92; the transformed pMAT 2075-unloaded strain was used as a control (Mc-2075); after fermentation for 96h in a 1L fermentation tank, the contents of lipid and various fatty acids are measured by extracting oil, and the results are shown in FIG. 5, the total fatty acid content of the fermentation recombinant strain Mc-d61d12d91 reaches 38.2%, the content of GLA in the total fatty acids reaches 19.8%, the yield of GLA is remarkably improved to 1.22g/L, the total fatty acid content of the fermentation recombinant strain Mc-d61d12d92 reaches 36%, the content of GLA in the total fatty acids is 13.2%, and the yield of GLA is 0.72g/L (see FIG. 5).

Taken together, a single overexpression of Δ 61 and Δ 62, Δ 61 resulted in a 21% GLA proportion of total fatty acids higher than Δ 62, but the total fatty acid content and biomass did not change significantly compared to the control, so that GLA production was not as high for the Δ 61 overexpressing strain (Mc-d 61). Later, three genes (Mc-d61d12d91) of delta 61 delta 12 delta 91 were co-expressed, and the proportion of GLA in the total fat was slightly reduced (19.8%) but the GLA yield was significantly increased (high total fatty acid content) due to the significant increase in the total fatty acid content. The co-expression of a plurality of desaturase genes increases the total fatty acid content, the proportion of single fatty acid is reduced, but the yield combines the three factors of the proportion of GLA, the total fatty acid content and biomass, so that the co-expression of the three genes remarkably increases the GLA yield.

In the above embodiment:

the pMAT2075 is constructed as described in the Improved SDA production in high lipid accumulating strain of Mucor circinelloides WJ11by genetic modification;

pMAT2076 is the upstream and downstream 1kb of sodit-a which replaces CarRP homologous arm of pMAT2075, and the replacement marker gene pyrF is LeuA, namely, pMAT2076 is constructed; the specific method comprises the following steps:

using genome DNA of WJ11 as a template, designing an upstream primer F1/R1 containing SphI and SnaBI enzyme cutting sites, obtaining a sodit-a gene fragment through PCR, using SphI and SmaI to cut a pUC18 vector, then using T4DNA ligase to connect the sodit-a gene fragment with the enzyme cutting fragment of a pUC18 vector to obtain pUC 18-sodata-up-down, using the pUC18 vector as the template, designing an upstream primer F2/R2 containing XbaI and NheI enzyme cutting sites, using PCR to obtain linearized pUC18 and sodata-pUC up/down fragments, using Suzhou Jinzhi Biotech limited to synthesize a LeuA and Pztt 1 connected fragment (SEQ ID NO:18), also using NheI and XbaI to cut a LeuA and Pzsort 1, and then using T4DNA ligase to connect the LeuA and Pzsortit 1 with linearized DNA 18 and Pzta plasmid 2076/up.

The Mucor circinelloides WJ11 strain is Mucor circinelloides with the preservation number of CCTCC NO: M2014424;

the strain Mucor circinelloides Mu760 is a strain existing in the laboratory, and Deletion of plasmid Membrane Transporters introduced Lipid Accumulation in the filed of literature has been reported as Deletion of microorganism circulating microorganisms WJ11 and Improved SDA production in high Lipid Accumulation strain of microorganism circulating microorganisms WJ11by genetic modification.

F1：5’–CGATGGCATGCCCGGGGCGTATGGGCCCTTATGATATCACAC–3’(SEQ ID NO:14)；

R1：5’–CTGCATACGTACCCGGGGTTACATTAGCAGGTATTTTTGC–3’(SEQ ID NO:15)；

F2：5’–CCCGAGCTAGCCTCGAGCCAGATACTGTACTTCCACTTTTTAC–3’(SEQ ID NO:16)；

R2：5’–CGTACTCTAGATTTGTATACAAAGTGAAAGAAAGATG–3’(SEQ ID NO:17)；

SEQ ID NO:18

The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.

Sequence listing

<110> university of Shandong's science

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1407

<212> DNA

<213> Mucor circinelloides (Mucor circinelloides)

<400> 1

atgagcagcg acgtaggagc aacagcagta ccccattttt atactcgtgc tgaattggct 60

gatatccatc aagatgttct ggacaagaaa cctgaagcta gaaaactaat tgtcgtcgag 120

aataaggtat acgatatcac agatttcgta tttgatcacc ctggcggtga gcgagtactt 180

ttgactcaag agggcagaga cgctacagat gtctttcatg aaatgcatcc tccctctgct 240

tacgaattgc tggcgaattg ctatgttggc gattgtgagc ccaagctgcc tatcgattca 300

accgataaga aggcattgaa ttctgctgct tttgctcaag aaattcgtga tctccgagat 360

aaattagaaa aacaaggcta tttcgacgct agtactggtt tctacatcta taaagtttcc 420

actaccctac ttgtctgtat tgtaggttta gctatcctca aagcttgggg tagagagtct 480

actttggctg tgtttattgc tgcttcttta gttggtcttt tttggcagca gtgcggttgg 540

cttgcccatg attatgctca ctatcaagtc atcaaagacc ccaatgtcaa taatctcttt 600

ttagttactt ttggcaacct ggttcaaggt ttctctcttt catggtggaa aaacaagcac 660

aatacccacc acgctagcac caatgtctct ggcgaagatc ccgatatcga tactgccccc 720

attttgctat gggacgagtt tgcagccgct aatttctatg gatccttgaa ggacaatgcc 780

agtggatttg acagattcat tgctgaacac attttgccct atcaaactcg ttactacttc 840

ttcattcttg gtttcgctcg tacctcttgg gctatccaat ctattatcta ttccttcaag 900

aacgaaacat tgaataaatc aaagctcttg tcctggtgtg agcgcatctt tttgattgtt 960

cattgggtct ttttcactta ctgcactatt gcctggatca gctctatcag aaacatcgcc 1020

atgttctttg ttgttagcca aatcactact ggttacttgc tcgccatcgt ctttgctatg 1080

aaccataatg gcatgcctgt ttacagcccc gaagaagcaa accataccga gttttatgaa 1140

ttgcaatgta tcactggtcg cgatgtcaac tgcactgtat ttggcgattg gctcatgggt 1200

ggattgaatt atcaaattga gcaccatctt ttccccgaaa tgcctcgaca tcatttatcc 1260

aaggtgaaat ccatggtcaa acccattgct caaaagtata atatccctta ccatgatacc 1320

acagtcattg gtggtaccat tgaagtcttg caaaccttgg attttgttca aaagatttcg 1380

cagaaattca gcaaaaaaat gctctaa 1407

<210> 2

<211> 1191

<212> DNA

<213> Mucor circinelloides (Mucor circinelloides)

<400> 2

atggcaacca agagaaacgt tacctccaat gctcctgctg cagaagacat cagcatcagc 60

aacaaggctg tgattgatga agccattgaa agaaactggg agatccccaa tttcaccatc 120

aaggagatcc gtgatgctat cccagctcac tgtttccgtc gtgatacctt tagatccttt 180

acacatgttc ttcatgatat tatcatcatg tccatcttgg ccattggtgc ttcttacatt 240

gattccatcc ctaataccta tgctcgcatt gctctctggc ccttgtactg gatcgctcaa 300

ggtattgttg gcactggtgt ctgggtcatt ggtcatgaat gtggccatca agcattcagc 360

ccttcaaaga ctatcaataa tagcgttggt tacgttctcc acactgcttt attagtacct 420

tatcactcat ggagattctc tcactctaag catcataaag ccactggaca catgtcaaaa 480

gatcaggtct ttgtcccctc tactcgtaag gaatacggtt tgcctcctcg tgagcaagat 540

cctgaagttg atggacctca tgatgctctt gatgaagctc ccatcgttgt cttgtatcgc 600

atgttccttc aatttacctt tggctggcct ctttatctct tcaccaatgt ctctggtcaa 660

gattaccccg gttgggcttc tcatttcaac cccaagtgtg ctatctacga tgaaaaccaa 720

ttctgggatg ttatgagctc caccgctggt gtccttggca tgattggttt cttggcttac 780

tgtggtcaag tctttggctc tcttgctgtc atcaagtact atgttattcc ctatttgaat 840

gttaactttt ggttggttct aatcacttac ttgcaacaca ctgatcccaa gttgcctcat 900

taccgtgaaa atgtttggaa cttccaacgc ggtgctgctt taactgttga tcgttcttat 960

ggtttcctcc tcgactactt ccatcatcac atttctgaca ctcatgttgc tcaccatttc 1020

ttctccacca tgcctcacta ccacgctgaa gaagctactg ttcatatcaa gaaggctctt 1080

ggtaagcact accactgcga caacactcct gtccctatcg ccttgtggaa ggtctggaag 1140

agttgccgtt ttgttgaaga tgagggcgat gttgtcttct ttaagaacta a 1191

<210> 3

<211> 1386

<212> DNA

<213> Mucor circinelloides (Mucor circinelloides)

<400> 3

atgtcaacta caacgacaac tacaacacaa gtaaacgctg acggaaagta tcctccttat 60

gcttacacac agactgagga tcgtcaactt cctttggcca atcctaagat gccccctttg 120

tttgatgaac ctactacact ccagaatttt gtcagccatg tcaactggtt ccaatccatt 180

ctcttgattt caacacctct tttgggtatc tatcttgcct ccaagactga attgcaaaca 240

aagacattgt actgggcaat cacctattac ttgatcactg gtttaggtat cactgctggt 300

taccatcgct actggtccca tagatcctat gattgtacct tacctactcg cattgctctt 360

tgcttggctg gttctggtgc cttccaaggc tctattcatt ggtggtcccg tggacatcgt 420

gctcatcatc gttggactga ttctgacaaa gatccttatg ctgctcctcg tggtttcttc 480

ttttctcata ttggttggat gttgattaac agacccaaga acagaattgg atatgctgat 540

actgctgatc ttaaggctga cccacttgtc cgtttccaac acaagaatta catttatttc 600

gctgtattta tggcttttgc tttccctacc ttagttgctg gcctcttgtg gggtgactgg 660

aagggtggtt tcgtttttgc tggcctctgt cgtcttgttg ccattcatca tgctactttc 720

tgtgtcaata gtcttgctca ttacattggc gacactcctt atgatgatta tcacactccc 780

aaagattctt ggatcactgc cattgttacc tgcggtgaag gttaccacaa tttccaccat 840

gaattccctc aagattatcg taacgctatt ctttggcacc aatacgatcc tacaaaatgg 900

ctcattagag gtttaagttt cattggtcaa acatacaact taaagacttt ctctgccaac 960

gagattcaaa agggcaaggt tcaaatgatg gaaaagaagg ctgacgagat caagaaaaca 1020

cttagttttg gtaagacact tgctgaattg cctgtctata ctatggaaga attccatgcc 1080

aaggtgaaca atgaggataa gaagtgggtt cttttggacg gcatcatgta cgacgttgag 1140

aactttgacc atcctggtgg agccaagtat ctcaatgctg gtattggcaa agatatgacc 1200

aagtcgttca atggcggtat ctacaatcat tcaaacggtg ctcgtaactt gctctctagt 1260

atgcgtgtcg gtgtgctcaa aggtgctatt gacatgaacc gtaatttctc aaagactgaa 1320

gcctctcaag aaaagtgtgc tgaatatgat ggtactctgg aacctgagaa gaacaagacc 1380

aagtaa 1386

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgagcagcg acgtaggagc aacagc 26

<210> 5

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agaaattcag caaaaaaatg ctctaa 26

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgatggcaa ccaagagaaa cgtt 24

<210> 7

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgtcttcttt aagaactaat ctatga 26

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atgtcaacta caacgacaac ta 22

<210> 9

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aacctgagaa gaacaagacc aagtaa 26

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gataagcata aaccagatct gc 22

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gtatctgaca tagtcgagct tc 22

<210> 12

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ttatttttat cgtttggtgg tacacaaact gc 32

<210> 13

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gtaaccccac agaaatagag ccataagg 28

<210> 14

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cgatggcatg cccggggcgt atgggccctt atgatatcac ac 42

<210> 15

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ctgcatacgt acccggggtt acattagcag gtatttttgc 40

<210> 16

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cccgagctag cctcgagcca gatactgtac ttccactttt tac 43

<210> 17

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

cgtactctag atttgtatac aaagtgaaag aaagatg 37

<210> 18

<211> 4330

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gtacgtctag aaaattcagt gagatgcttt ttctacagta tcaatagttt atttccataa 60

cccattcaac tccatgtatc caggcaagaa atcaaaaacg aacaattaca gctgtctgat 120

ctaggtaatg tgcatggatc caagtgacca tgtatgtaaa agtttctatg gtggaaaatg 180

atcaatgcat atttctctac ggaatatctg cgaatgaaat gtgcaaagtc attaatcgtt 240

ctacatttga tgctttatga ctgaaccctc aattgaaatt cacccagaaa aagctcatga 300

tcttcatgtt cctctttact ttgcagattt gttttgaatg gtgatttgaa aggagtggga 360

aaaagaatct ccagcgttta cgttacatgg aaaaaagaga gttaggccaa taggagcaca 420

acgcctcatt gagtcactgc cagttcaagc agtttgtggt cggatctgta aattgacagg 480

caatcaagac gcctgagtca ctatactact tgtgccaagt tggtgagatt gaccaatgat 540

ttcatcaatc tcattgagtc aggataaatg caaatattta ctttataata acctgctaac 600

aaacgaggat tttcttattt ctttaacttg tttcttacat ttttaaaaaa taaataaccc 660

cctccaatta tatacaaatg tctcgcactc tctatgataa agtctgggat gatcatgtca 720

ttgatcaaca agaagatggt acttgtttga tctatatcga tagacatctt gtgcatgaag 780

tcactagtcc tcaagctttc gaaggccttc gcaatgccaa ccgtccagta cgtcgtcctg 840

actgtactct tgctactgtc gatcacaaca ttcctactac aaccagaaag aatttcaaaa 900

atatcaccac tttcatcaaa gaagctgatt caagaactca atgtgagact cttgaacaaa 960

acatagaagc ctttggtctt acctatttcg gtatggagga tagtcgtcaa ggtattgtac 1020

atgttattgg tcctgagcaa ggttttactc tccccgcaac tactgttgta tgcggtgatt 1080

cacatacatc tacacacggt gcttttggtg cccttgcttt tggtattggt acatccgaag 1140

tagagcatgt acttgctacc caaactctct tacaaaagaa gtcaaagaac atgcgcattc 1200

gcgttcaagg taaagccctt cccggcgtca catccaagga tattgttctt cacattattg 1260

gtgttattgg tactgctggt ggtaccggtt gtgttattga attctgtggt gatactattg 1320

ctgctctctc catggagtca agaatgtcca tctgtaacat gtcaattgaa gcgggtgctc 1380

gtgctggtat ggttgctccc gatgaggtta cctttgaata ccttcgtgat aaacctctcg 1440

ctcccaaggg cgctgattgg gatcgtgctg tcaaatattg gaagtctctc agctctgatg 1500

ccgacgccaa gtacgatatt aacgtagaaa ttaacgctgc tgacattgct cctactctta 1560

cctggggtac tagtcctcaa gatgtcgttc ctattactgg ttcaactcct gatcctgcaa 1620

agattgagga tcccattcgt cgttctgctg ttcaacgtgc tcttgactat attggtattg 1680

ctcccaacac tcctatggaa ggtgtcaagg tggacaaggt atttatcggt agttgtacca 1740

actctcgtat cgaggatctt cgtgctgctg ctgctgtagt caagggtaag cgtgctgctg 1800

aatgggttga tgccatggtg gttcctggtt caggtttggt taaacgtcaa gctgagcgtg 1860

aaggtttaga caagatcttc actgatgctg gttttgattg gagagaggct ggttgttcca 1920

tgtgtctcgg catgaaccct gatcaattga agcctggaga acgttgtgca tctacatcta 1980

atcgtaattt tgagggtcgt caaggtgctg gtggacgtac tcatcttgta agccctgcca 2040

tggctgctgc tgctggtatc aagggttgtc ttactgatgt ccgtaacatg gaagtctctg 2100

aaattcctgg tactcccaag caaagtcctc gtcaagaagt tgttgccgaa ttcgagtctg 2160

aagatgaagt cgattccagc tctgttgatt ctgctactgt tgctacacct cctagcactg 2220

gcgagtctgc tggtatgccc aagttcacta ctctcaaggg ctatgctgct cctcttgata 2280

tctctaatgt cgatactgat atgattattc ccaagcaatt cctcaagacc atcaaacgca 2340

ctggccttgg tagtgctctt ttctatgctc tccgtttcga ccctactact ggcgctgaga 2400

accctgactt tgtcctcaac caagaaccct atcgtcaagc ccgtaccttg gtttgtactg 2460

gtcccaactt tggctgtggt agttctcgtg aacatgctcc ttgggccttt aacgactttg 2520

gtatccgttg tatccttgca cctagttttg cagatatttt ctataacaac tgcttcaaga 2580

atggtatgct ccccattgtc cttcctcaag atcaattaga agctattgct gctgaagcta 2640

agaagggatc cgaagttgaa gtggacctta tcaatcaagt tgttcgtttt gccggcaatg 2700

aagttccttt tgaagtggag gctttccgta agcactgcct tgtcaatggc tttgatgaca 2760

ttggattgac tatgcaaaag gctgacaaga ttgctgattt cgaggtcaag cgcactgaaa 2820

catggccttg gttaaatgga aagggttata agggaaaggc taccaaaatc tctatcaacg 2880

gtgaaggtca aaagaagaag accaagctcg attggtaatt attgtaataa aacacttatt 2940

ttattgtaac tctattattt cctgtttcat atttcgatct attcattctc ttatcatatt 3000

ttaattttat taatcacatt ttaaataaat tgcattccct ctctttatat acaattcact 3060

gcttgtctag taatgcttga tattgttttg tgcctgatac gttgggcgtg tgacagacaa 3120

acaccaaaat gcccaaattt ctcgactgtt taaaagttta gcttctttct tcaacacgat 3180

gctgttcaac actagtgttg ttgctggata ctttagcctt cttccgttaa tcatactgta 3240

cactgatggc tatatagaaa agactctaat atacttgcat gctcttggca tcacttgtat 3300

tttgtatatt ctggtaaatt cgacaagtga tgagacaacg acgacgacag atgcatacaa 3360

gtctaattta cactgatgaa ccatcaatac attgtactat gatacagaaa aggattcctg 3420

atatcatata agcagcttta gttacgacct atttttgaga cactgctatg agtactaaca 3480

atcatcgctc taatgggtag cacgttgcac ttgcaagcgg ctgccaaaat atataaaagc 3540

gtagaatgtc ttcactaatc caatgtgcaa tcattagata tgtactacac aagatgtaga 3600

aatcaagatt acagaaattc attgctcatc acatcagcaa accacggcat ttagagcgct 3660

aggccatcaa cctaaactca aaaatttctg cgggatcaca atgctcgttt catatagaaa 3720

attttgccct gataggaaca ttctgtatga gctgtaacct caaaaatttt tagtcttgcg 3780

cactatgtat agcccatggc gtatcattgc ctcatacaat acatgtctag cagcttcccg 3840

cctaaccacc actgaaactc tacacattag tgctctttta attagacagg ctgccatagc 3900

aacgtcctaa actgtgatgt aatatgtaat tcataagaaa tttttgatat ttttaaacat 3960

catctcactc aaatggtgct actttcaatt gcttgaaatg gaagtatttc aggtctgaaa 4020

ccttctcatc aactgaaaat cctcggcgtc atgatgtttt tgtgtacctt gagggtgata 4080

ttttgacctt gtcgtgacta aatattagaa atttttggca ttgattggct gtatgtcacc 4140

ttgaaggtac taaaactatg tgtaccttat ccgttacctg atctttggga ggagatgtgc 4200

cttgatgata tgctctacgt tggtttcaag tcattatttg tataaataga ccaagagaag 4260

gctttactgt tcctatcatt ctttgctttc tattactttt atatacaaaa taactaaata 4320

gatctcatgc 4330

Claims

1. The construction method of the high-yield gamma-linolenic acid mucor circinelloides recombinant strain is characterized in that nucleic acid sequences of delta 6, delta 12 and delta 9 fatty acid desaturase genes are connected to an expression vector, the obtained recombinant vector is transformed into a mucor circinelloides double-defect strain, positive clones are screened, delta 6, delta 12 and delta 9 fatty acid desaturase is overexpressed in the mucor circinelloides double-defect strain, and the high-yield gamma-linolenic acid mucor circinelloides recombinant strain is obtained.

2. The construction method of the recombinant bacteria of the Mucor circinelloides for high yield of gamma-linolenic acid according to claim 1, characterized in that the nucleic acid sequence of the delta 6 fatty acid desaturase gene is shown as SEQ ID NO. 1; the nucleic acid sequence of the delta 12 fatty acid desaturase gene is shown as SEQ ID NO. 2; the nucleic acid sequence of the delta 9 fatty acid desaturase gene is shown in SEQ ID NO. 3.

3. The method for constructing the recombinant strain of the Mucor circinelloides for high yield of gamma-linolenic acid according to claim 1, wherein the strain with double-defect type of Mucor circinelloides is Mu 760.

4. The method for constructing the recombinant bacteria of the mucor circinelloides with high yield of gamma-linolenic acid according to claim 1, wherein the expression vector is at least one of an integrative plasmid pMAT2075 and an integrative plasmid pMAT 2076.

5. The construction method of the high-yield gamma-linolenic acid Mucor circinelloides recombinant strain according to any one of claims 1 to 4, characterized in that,

connecting the delta 6 fatty acid desaturase gene to an integrative plasmid pMAT2075, and then transforming the recombinant plasmid into a protoplast of a mucor circinelloides defective strain Mu760 to obtain a recombinant strain Mc-d 61;

6. The high-yield gamma-linolenic acid Mucor circinelloides recombinant strain constructed by the method of claim 4 is characterized in that the recombinant strain is Mucor circinelloides (Mucor circinelloides), and the strain is preserved in the China general microbiological culture Collection center (CGMCC 40013) at 12-20 months in 2021 with the preservation number of CGMCC 40013.

7. The use of the recombinant bacteria of mucor circinelloides for producing gamma-linolenic acid with high yield according to claim 6 in the fermentation production of gamma-linolenic acid.

8. A method for producing gamma-linolenic acid by fermenting the high-yield gamma-linolenic acid mucor circinelloides recombinant strain as claimed in claim 6 is characterized in that a strain with the preservation number of CGMCC 40013 is inoculated on a fermentation medium for fermentation, the fermentation condition is 28 ℃, the rpm is 600, and the air input is 1v/v min ^-1 The pH was maintained at 6.0.