CN101400798A - Preparation of polyunsaturated fatty acids - Google Patents

Preparation of polyunsaturated fatty acids Download PDF

Info

Publication number
CN101400798A
CN101400798A CNA2007800078470A CN200780007847A CN101400798A CN 101400798 A CN101400798 A CN 101400798A CN A2007800078470 A CNA2007800078470 A CN A2007800078470A CN 200780007847 A CN200780007847 A CN 200780007847A CN 101400798 A CN101400798 A CN 101400798A
Authority
CN
China
Prior art keywords
acid
nucleotide sequence
xaa
variant
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CNA2007800078470A
Other languages
Chinese (zh)
Inventor
P·奇尔普斯
J·鲍尔
X·邱
G·吴
B·程
M·特鲁克萨
T·韦特耶恩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF Plant Science GmbH
Original Assignee
BASF Plant Science GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF Plant Science GmbH filed Critical BASF Plant Science GmbH
Publication of CN101400798A publication Critical patent/CN101400798A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/6445—Glycerides
    • C12P7/6472—Glycerides containing polyunsaturated fatty acid [PUFA] residues, i.e. having two or more double bonds in their backbone
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to a method for preparing eicosapentaenoic acid, docosapentaenoic acid and/or docosahexaenoic acid in a transgenic plant comprises providing, in the plant, at least one nucleic acid encoding each of delta 6-desaturase; delta 6-elongase; delta 5-desaturase, where the sequence encoding has been altered from that in the original source so as to match the codon utilization of one or more plant types. The independent claims are included for the following: oils, lipids, free fatty acids and their fractions produced by the new method; (2) the isolated nucleic acid Seq, recombinant nucleic acid that comprises one or more copies of a promoter active in plants, at least one NA for each of D6D, D6E, D5D and D5E the last modified as specified and one or more copies of a termination sequence; in order to produce the docosahexenoic acid, the invention also implants at least one c of the nucleic acid sequence encoded with delta 4-desaturase polypeptide.

Description

Produce the method for polyunsaturated fatty acid
The present invention relates to produce in transgenic plant the method for timnodonic acid, clupanodonic acid and/or docosahexenoic acid, this method is included at least a nucleotide sequence is provided in the described plant, and its coding has the active polypeptide of Δ 6-desaturase; At least a nucleotide sequence, its coding has the polypeptide of Δ 6-elongase activity; At least a nucleotide sequence, its coding have the active polypeptide of Δ 5-desaturase; With at least a nucleotide sequence, its coding has the polypeptide of Δ 5-elongase activity, wherein coding has nucleotide sequence in the source biology of nucleotide sequence and this sequence of polypeptide of Δ 5-elongase activity and compares and modified, because it is adapted to codons selection in one or more plantation species.In preferred embodiments, also provide other nucleotide sequence, it is coded in has ω 3-desaturase and/or the active polypeptide of Δ 4-desaturase in the plant.
In a further preferred embodiment; provide other nucleotide sequence, its ethylene reductase of in plant, encoding; acyl-acp (acyl carrier protein) desaturase; fatty acyl-acp thioesterase; the fatty acid acyl based transferase; acyl-CoA: lysophospholipid acyltransferase; Fatty acid synthetase; fatty acid hydroxylase; acetyl-CoA carboxylase; the acetyl-CoA oxydase; fatty acid desaturase; lipid acid acetylene series enzyme (acetylenase); lipoxygenase; triacylglycerol lipases; oxidation propadiene synthase (allene oxide synthases); hydroperoxide lyase or fatty acid elongase.
The present invention relates to recombinant nucleic acid molecules in addition, and described recombinant nucleic acid molecules comprises at least a nucleotide sequence, and its coding has the active polypeptide of Δ 6-desaturase; At least a nucleotide sequence, its coding have the active polypeptide of Δ 5-desaturase; At least a nucleotide sequence, its coding has the polypeptide of Δ 6-elongase activity; With at least a nucleotide sequence, its coding has the polypeptide of Δ 5-elongase activity, and it compares with the nucleotide sequence in the biology in this sequence source and modified, because codons that it is adapted in one or more plantation species are selected.
Another part of the present invention relates to by oil, lipid and/or the lipid acid of method generation of the present invention and their purposes.
At last, the present invention also relates to transgenic plant, it produces by method of the present invention or it comprises recombinant nucleic acid molecules of the present invention, and relates to its purposes as food or feed.
Lipid is synthetic can separated into two parts: the combining and the adding or the modification of polarity headgroup of lipid acid synthetic and they and sn-glycerol-3-phosphate.The useful lipid that is used for film comprises phosphatide, glycolipid, sphingolipid and phosphoglyceride.Lipid acid is synthetic to begin to the conversion of ethanoyl-ACP with the conversion or the catalytic acetyl-CoA of acetyl transacylase of the catalytic acetyl-CoA of acetyl coa carboxylase A to malonyl CoA.After the condensation reaction, these two kinds of product molecules form acetoacetyl-ACP together, and it transforms by a series of condensations, reduction and dehydration reaction, thus the saturated fatty acid molecule that obtains having needed chain length.It is (synthetic about lipid acid the microorganism that specific desaturase produces unsaturated fatty acids by molecular oxygen aerobic or anaerobic ground catalysis from these molecules, see people such as F.C.Neidhardt (1996) E.coli and Salmonella.ASM Press:Washington, D.C., p.612-636 and the reference of wherein quoting; People such as Lengeler (Ed.) (1999) Biologyof Procaryotes.Thieme:Stuttgart, New York and the reference of wherein quoting, and Magnuson, K., the reference that waits people (1993) Microbiological Reviews 57:522-542 and wherein quote).In order to experience further prolongation step, the lipid acid of gained phospholipids incorporate must turn back to lipid acid CoA ester storehouse.This passes through acyl-CoA: the lysophospholipid acyltransferase becomes possibility.And these endonuclease capables are got back to phosphatide with the lipid acid that prolongs from the coenzyme A transesterify.If suitable, this reaction sequence can repeat.
In addition, lipid acid must be transported to multiple decorating site subsequently and mix triacylglycerol storage lipid.Another important step for example was during lipid was synthetic, by the glycerine fatty acid acyltransferase with lipid acid transfer to the polarity headgroup (see Frentzen, 1998, Lipid, 100 (4-5): 161-166).
The storage of the modification of film transhipment, beta-oxidation, lipid acid and the cofactor of the biosynthesizing of lipid acid, desaturation, lipid metabolism and lipoid substance and triacylglycerol and the summary of assembling in the plant, comprise its reference, provide by following: Kinney, 1997, Genetic Engineering, Ed.:JK Setlow, 19:149-166; Ohlrogge and Browse, 1995, Plant Cell 7:957-970; Shanklin and Cahoon, 1998, Annu.Rev.Plant Physiol.Plant Mol.Biol.49:611-641; Voelker, 1996, Genetic Engineering, Ed.:JK Setlow, 18:111-13; Gerhardt, 1992, Prog.Lipid is R.31:397-417; G ü hnemann-
Figure A200780007847D0005143226QIETU
﹠amp; Kindl, 1995, Biochim.Biophys Acta 1256:181-186; People such as Kunau, 1995, Prog.Lipid Res.34:267-342; People such as Stymne, 1993, in:Biochemistry and Molecular Biology ofMembrane and Storage Lipids of Plants, Eds.:Murata and Somerville, Rockville, American Society of Plant Physiologists, 150-158, Murphy ﹠amp; Ross 1998, Plant Journal.13 (1): 1-16.
According to the type of desaturation, can be with two big classes of polyunsaturated fatty acid, ω 6 and omega-3 fatty acid differentiate, described ω 6 and omega-3 fatty acid they metabolism and their function on different.
In the text below, polyunsaturated fatty acid is called PUFA, PUFAs, LCPUFA or LCPUFAs (polyunsaturated fatty acid (poly unsaturated fatty acids), PUFA, long chain polyunsaturated fatty acids (long chain poly unsaturated fatty acids), LCPUFA).
Lipid acid linolic acid (18:2 Δ 9,12) serve as the raw material of ω 6 pathways metabolisms, and ω 3 approach are by linolenic acid (18:3 Δ 9,12,15) carry out.Linolenic acid forms (people (1998) Prog.Lipid Res.37:73-117 such as Tocher by linolic acid by ω 3-desaturase is active; People such as Domergue (2002) Eur.J.Biochem.269:4105-4113).
Mammals, thereby people do not have corresponding desaturase activity (Δ 12-and ω 3-desaturase) to be used to form described raw material and necessary by these lipid acid of food intake (indispensable fatty acid).Begin important polyunsaturated fatty acid arachidonic acid (=ARA, 20:4 on the physiology with these precursors Δ 5,8,11,14), a kind of ω 6-lipid acid and two kinds of omega 3-fatty acid timnodonic acids (=EPA, 20:5 Δ 5,8,11,14,17) and docosahexenoic acid (DHA, 22:6 Δ 4,7,10,13,17,19) synthetic in proper order by desaturase and extension enzyme reaction.
By extending 2 of enzyme lipid acid extensions or 4 carbon atoms respectively to C 20-and C 22The generation of-PUFAs plays crucial effects.This method is undertaken by 4 steps.The first step is that malonyl-list acyl coenzyme A is condensed on the fatty acid acyl coenzyme A by ketoacyl coenzyme A synthase (KCS hereinafter is called and extends enzyme).Then be reduction step (the ketoacyl coenzyme A reductase enzyme, KCR), dehydrating step (dehydratase) and last reduction step (enoyl CoA reductase enzyme).Supposed that elongase activity influences the specificity and the speed (Millar and Kunst (1997) PlantJournal 12:121-131) of whole process.
Lipid acid and triglyceride have a large amount of application at foodstuffs industry, Animal nutrition, makeup and pharmaceutical field.According to them are triglycerides that the saturated or unsaturated fatty acids of free or other have the saturated or unsaturated fatty acids of rising content, and they are suitable for very different application.Therefore, for example, preferably have unsaturated fatty acids in the human nutrition, especially have the lipid of polyunsaturated fatty acid.Many unsaturated omega 3-fatty acids should have active effect to the cholesterol levels in the blood, and therefore cardiopathic prevention are had active effect.Can significantly reduce heart trouble, apoplexy or hypertensive risk (Shimikawa (2001) World Rev.Nutr.Diet.88:100-108) by in food, adding these omega 3-fatty acids.
The omega 3-fatty acid pair inflammatory process relevant with amynologic disease, especially to the chronic inflammatory diseases process, (Calder 2002, Proc.Nutr.Soc.61,345-358 as rheumatoid arthritis being had active effect; Cleland and James 2000, J.Rheumatol.27,2305-2307).Therefore they are added food, add diet food especially, perhaps be used for medicine.ω 6-lipid acid tends to that as arachidonic acid these rheumatisms are had negative influence.
ω 3-and ω 6-lipid acid are the precursors of the tissue hormone (as prostaglandin(PG)) that is called eicosanoid, described tissue hormone is derived from dihomo-gamma-linolenic acid, arachidonic acid and timnodonic acid, ω 3-and ω 6-lipid acid also are the precursors of thromboxane and leukotriene, and thromboxane and leukotriene are derived from arachidonic acid and timnodonic acid.The eicosanoid (being called PG2 series) that forms from ω 6-lipid acid promotes inflammatory reaction usually, and from the eicosanoid (being called PG3 series) of omega 3-fatty acid very little or not short scorching effect is arranged.
Polyunsaturated long-chain omega 3-fatty acid such as timnodonic acid (=EPA, C20:5 Δ 5,8,11,14,17) or docosahexenoic acid (=DHA, C22:6 Δ 4,7,10,13,16,19) because their multiple effects aspect healthy but the important component of human nutrition, described effect comprises the synthetic of functional, the hormone of growth, eye of children's brain and other semiochemicalses, prevention (Poulos, A (1995) Lipids 30:1-14 with cardiovascular disorder, cancer and diabetes; Horrocks, LA and Yeo YK (1999) Pharmacol Res40:211-225).
Because the composition of current mankind food adds how unsaturated omega-3 fatty acid and is even more important in food, described how unsaturated omega-3 fatty acid is preferentially found in fish oil.Thereby, for example, with polyunsaturated fatty acid, as docosahexenoic acid (=DHA, C22:6 Δ 4,7,10,13,16,19) or timnodonic acid (=EPA, C20:5 Δ 5,8,11,14,17) add in the infant formulas to improve nutritive value.Therefore, need to produce polyunsaturated longer chain fatty acid.
Multiple lipid acid and triglyceride level are mainly from microorganism such as genus mortierella (Mortierella) or Schizochytrium or from oil-produced vegetable, as soybean, rape (oilseed rape), algae, belong to (Crypthecodinium) or brown algae as Crypthecodinium cohnii and belong in (Phaeodactylum) and other biology and obtaining, the form of common triglyceride (=triglyceride level=triglycerin) with them obtains.Yet they can also for example obtain from fish from animal.Advantageously prepare free fatty acids by hydrolyzing triglyceride.Yet, utmost point long chain polyunsaturated fatty acids such as DHA, EPA, arachidonic acid (ARA, C20:4 Δ 5,8,11,14), dihomo-gamma-linolenic acid (DHGL, C20:3 Δ 8,11,14) or clupanodonic acid (DPA, C22:5 Δ 7,10,13,16,19) not synthetic in oil crops such as rape, soybean, Sunflower Receptacle and Flos Carthami.The conventional natural origin of these lipid acid is a fish, as catfish, salmon, sardines, redfish, common eel, carp, trout, halibut, mackerel, zander or tuna or algae.
Because their positive feature, the past has attempted utilizing the synthetic gene that relates to these lipid acid or triglyceride level to produce the unsaturated fatty acids that changes content in multiple biology.Thereby WO 91/13972 and its U.S.'s patent families have been described Δ 9-desaturase.WO 93/11245 claimed Δ 15 desaturases, WO 94/11516 claimed Δ 12 desaturases.Other desaturases are described among people (1999) the Lipids 34:649-659 such as people such as 265:20144-20149, Wada (1990) Nature 347:200-203 or Huang at for example EP-A-0 550 162, WO 94/18337, WO 97/30582, WO 97/21340, WO 95/18222, people (1990) J.Biol.Chem. such as EP-A-0 794 250, Stukey.Yet, the biological chemistry of multiple desaturase characterizes also insufficient so far, because these enzymes are membrane-bound protein, separation and sign to them have caused great difficulty (people (1981) Methods in Enzymol.71:12141-12147 such as McKeon, people such as Wang (1988) Plant Physiol.Biochem., 26:777-792).
Usually, also the enzyme analysis activity is come characterization of membrane bonded desaturase by analyzing parent material and product subsequently by importing suitable biology.Δ 6-desaturase is described in WO 93/06712, US 5,614,393, WO 96/21022, WO 00/21557 and WO 99/27111.This enzyme is produced lipid acid in genetically modified organism application is described in WO 98/46763, WO 98/46764 and WO 98/46765.The expression of multiple desaturase and the formation of polyunsaturated fatty acid are also described in WO 99/64616 or WO 98/46776 and are claimed.Render a service and its influence about the expression of desaturase, it should be noted that the expression of a kind of desaturase of description so far only causes the unsaturated fatty acids/lipid of low levels, as gamma-linolenic acid and therapic acid to polyunsaturated fatty acid formation.
Many trials have been carried out in the past in the hope of obtaining elongase gene.Millar and Kunst, people such as 1997 (Plant Journal 12:121-131) and Millar, 1999 (Plant Cell11:825-838) have described the sign that plant is extended enzyme, and described extension enzyme is used at the synthetic monounsaturated longer chain fatty acid (C22:1) of plant and synthetic very-long-chain fatty acid with formation wax (C 28-C 32).Arachidonic acid and EPA synthetic for example is described among WO 01/59128, WO 00/12720, WO 02/077213 and the WO 02/08401.Many unsaturated C24-lipid acid synthetic is described in for example people 2000 such as Tvrdik, among J.CellBiol.149:707-718 or the WO 02/44320.
Being used to produce the suitable especially of PUFA is little algae, as Phaeodactylum tricornutum (Phaeodactylumtricornutum), some kind of Porphiridium, some kind of genus thraustochytrium (Thraustochytrium), Schizochytrium kind or Crypthecodinium cohnii belong to some kind, ciliate is sour jujube tail Eimeria (Stylonychia) or Colpidium (Colpidium) for example, fungi such as mortierella, entomophthora Pseudomonas (Entomophthora) or Mucor (Mucor) and/or mosses such as sword-like leave Rhodobryum (Physcomitrella), angle tooth Rhodobryum (Ceratodon) and hepatica (Marchantia) (R.Vazhappilly and F.Chen (1998) Botanica Marina 41:553-558; K.Totani and K.Oba (1987) Lipids 22:1060-1062; M.Akimoto etc., (1998) Appl.Biochemistry and Biotechnology 73:269-278).Bacterial strain is selected to have caused having developed many mutant strains of described microorganism, and they produce a series of desirable compounds, comprise PUFA.Yet sudden change and selection that improvement produces the strain system of specific molecular such as polyunsaturated fatty acid are time-consuming and difficult methods.In addition, by mentioned microorganism, only can produce limited amount desirable polyunsaturated fatty acid, as DPA, EPA or ARA; And they obtain as fatty acid mixt usually.This is why in a single day may be with regard to the reason of preferred recombination method.
Higher plant comprises polyunsaturated fatty acid such as linolic acid (C18:2) and linolenic acid (C18:3).ARA, EPA and DHA in the seed oil of higher plant basic do not find or with only with indivisible the existence (E.Ucciani:Nouveau Dictionnaire des Huiles V é g é tales[NewDictionary of the Vegetable Oils].Yet, higher plant, it will be favourable preferably producing LCPUFA oil crops in as rape (oilseed rape), Semen Lini, Sunflower Receptacle and soybean, because the required relatively large high quality LCPUFA of foodstuffs industry, Animal nutrition and pharmacy purpose can obtain economically.For this reason, advantageously in oil grain, import the gene of the biosynthetic enzyme of coding LCPUFA and express them therein by recombination method.These genes encodings for example, Δ 6 desaturases, Δ 6 extend enzyme, Δ 5 desaturases or Δ 4 desaturases.These genes can be advantageously from producing LCPUFA and the microorganism that they mix film or triglyceride being separated with lower plant.Thereby therefore, might open up from moss and separate Δ 6 delta 8 desaturase genes leaf sword-like leave moss (Physcomitrella patens) and from open up leaf sword-like leave moss and beautiful nematode (C.elegans), separate Δ 6 elongase genes.
For example described transgenic plant in DE-A-102 19 203 (producing the method for polyunsaturated fatty acid in plant), it comprises and expresses the gene and thereby the generation LCPUFAs of coding LCPUFA biosynthetic enzyme.Yet these plants give birth to LCPUFAs with the volume production that needs to be optimized, and described optimization is used for handling the oil that plant exists.Therefore, based on total lipid content of plant, the ARA content in the plant of describing among the DE-A-102 19 203 only has 0.4 to 2%, and EPA content only has 0.5 to 1% in each case.
Utilize polyunsaturated long-chain fatty acids fortified foodstuff and feed to become possibility in order to make, the method that therefore is starved of cheap and simple is used for especially producing polyunsaturated long-chain fatty acids at botanical system.
Therefore a target of the present invention provides method, utilizes described method can also produce long chain polyunsaturated fatty acids, especially timnodonic acid, clupanodonic acid and/or docosahexenoic acids in a large number at an easy rate in transgenic plant.
Now being surprised to find to increase long chain polyunsaturated fatty acids by express the Δ 5-extension enzyme sequence of optimizing in transgenic plant, especially the output of timnodonic acid, clupanodonic acid and/or docosahexenoic acid.
The PUFAs that produces by the inventive method comprise higher animal can not synthesize therefore must consume or higher animal can not produce q.s and therefore must consume component of its additional quantity, though they can synthesize as bacterium easily by other biology.
Therefore, in transgenic plant, produce timnodonic acid, clupanodonic acid and/or docosahexenoic acid by the inventive method and realize target of the present invention, be included at least a nucleotide sequence is provided in the plant, its coding has the active polypeptide of Δ 6-desaturase; At least a nucleotide sequence, its coding has the polypeptide of Δ 6-elongase activity; At least a nucleotide sequence, its coding have the active polypeptide of Δ 5-desaturase; With at least a nucleotide sequence, its coding has the polypeptide of Δ 5-elongase activity, wherein said coding has nucleotide sequence in the biology in nucleotide sequence and this sequence source of polypeptide of Δ 5-elongase activity compares and is modified, because the codon that it is adapted in one or more plant speciess is selected.In order to produce DHA, additionally need provide at least a nucleotide sequence, it is encoded in plant and has the active polypeptide of Δ 4-desaturase.
" provide in the plant " at the context of the invention middle finger take measures to make coding to have the active polypeptide of Δ 6-desaturase, have the polypeptide of Δ 6-elongase activity, the nucleotide sequence that has the active polypeptide of Δ 5-desaturase and have a polypeptide of Δ 5-elongase activity is present in the plant jointly." provide in the plant " and therefore comprise by carrying out Plant Transformation with one or more recombinant nucleic acid molecules that comprise described nucleotide sequence and hybridizing in the nucleotide sequence introduced plant by the suitable stock plant that comprises one or more described nucleotide sequences.
According to the present invention, coding has nucleotide sequence in the biology in nucleotide sequence and described sequence source of polypeptide of Δ 5-elongase activity compares and is modified, because it is adapted to the codon selection in one or more plant speciess.This expression has been carried out special optimization with described nucleotide sequence for the object of the invention, but does not change the aminoacid sequence of this nucleic acid sequence encoding thus.
Genetic code is redundant, because it uses 61 kinds of codons to define 20 seed amino acids.Therefore, most 20 kinds of protein generate amino acid so are encoded by a plurality of triplets (codon).Yet in particular organisms, do not use the synonym of definition single amino acids with same frequency; Be preferred codon that often uses and the codon that seldom uses on the contrary.These differences on codon is selected are owing to selective evolution pressure and especially translation efficiency.Therefore seldom the reason that the translation efficiency of the codon of Chu Xianing is lower may be that corresponding aminoacyl-tRNA storehouse has exhausted and no longer can be used to protein synthesis.
In addition, different biological preferred different codons.For this reason, for example, in the intestinal bacteria of being everlasting (E.coli) cell, carry out on suboptimum ground from the expression of the recombinant DNA of mammalian cell.Therefore it is possible that the codon of using the frequent codon replacement of using seldom to use in some cases improves expression.Do not wish by a kind of theory, suppose that codon optimized dna sequence dna makes more effective translation become possibility, and the mRNAs that forms thus may have the longer transformation period and therefore can be used for translation more frequently in cell.Narrated by top, can obtain having only the biochron that be different from the initial source of this nucleotide sequence when biological (wherein with the express nucleic acid sequence), codon optimized be only essential.
For the known many biologies of dna sequence dna of a large amount of relatively genes, can from table, obtain the frequency of utilization of specific cryptosystem in each biology.It is possible with high relatively accuracy the protein sequence retroversion being become dna sequence dna under the help of these tables, and described dna sequence dna is included in each biology for the preferred codon of proteinic multiple amino acids.Especially in following internet address, can find the codon option table: http://www.kazusa.or.ip/Kodon/E.html.In addition, a plurality of companies provide the software that is used for gene optimization, for example, and Entelechon (Software Leto) or Geneart (Software GeneOptimizer).
The adaptation that sequence is selected codon in the particular organisms can be carried out under the help of multiple standards.On the one hand, using in the selected biology to specific amino acids, the codon of frequent appearance is possible, but on the other hand, also consider the natural frequency of multiple codon, make all codons of specific amino acids natural frequency according to them is incorporated in the majorizing sequence.Use being chosen in this case of position of particular bases triplet to carry out at random.According to the present invention, consider that the natural frequency of each codon is adjusted dna sequence dna, it also is suitable using in selected biology the codon of the most frequent appearance.
From the nucleotide sequence (its coding has the polypeptide of Δ 5-elongase activity, for example the polypeptide of describing in SEQ ID No.110) of Ostreococcus tauri, the codon that especially preferably adapts at least in rape, soybean and/or flax is selected.The initial sequence of preferably in SEQ ID No.109, describing from the nucleotide sequence of Ostreococcus tauri.Coded delta 5-extends the dna sequence dna of enzyme at least 20% position, preferred at least 30% position, especially preferred at least 40% position and most preferably at least 50% the position codon that is adjusted to adapt in rape, soybean and/or flax select.
The nucleotide sequence that uses most preferably is the sequence of describing in SEQ ID No.64.
Also comprise those codon optimized dna sequence dnas with understanding the present invention, its coding have Δ 5-elongase activity polypeptide and by with wild-type sequence relatively, their aminoacid sequence is modified on one or more positions, but it still has the activity substantially the same with wild-type protein.
The nucleotide sequence that coding has the active polypeptide of Δ 6-desaturase is preferably selected from:
A) nucleotide sequence, it has the sequence of describing among the SEQ ID No.1,3,5,7,9,11,13,15,17,19,21,23,25,27,29,31,33,35,37,39 or 41, preferably has the sequence of describing among the SEQ ID No.1,
B) nucleotide sequence, among its coding SEQ ID No.2,4,6,8,10,12,14,16,18,20,22,24,26,28,30,32,34,36,38,40 or 42, the aminoacid sequence of pointing out among the preferred SEQ ID No.2,
C) nucleotide sequence, itself and top a) or b) the complementary strand hybridize under stringent condition of the nucleotide sequence pointed out among the nucleotide sequence, especially the SEQID No.1 that point out,
D) nucleotide sequence, itself and top a) or b) in the nucleotide sequence pointed out, especially with SEQ ID No.1 in the sequence pointed out have at least 60%, 65%, 70%, 75% or 80%, preferably at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90%, preferred especially at least 91%, 92%, 93%, 94% or 95% and especially at least 96%, 97%, 98% or 99% identity and
E) nucleotide sequence, its encoding amino acid sequence and this aminoacid sequence have point out among the SEQID No.43,44,45,46,47,48,49 or 50 at least a, and for example 2,3,4,5,6,7 or 8 kind, preferably all aminoacid patterns.
Aminoacid pattern is meant short amino acid sequence, and it preferably comprises and is less than 50, especially preferably is less than 40 and especially 10 to 40, and even more preferably 10 to 30 amino acid.
For the present invention, identity is preferred definite on Nucleotide of the present invention or aminoacid sequence total length, for example for the nucleotide sequence of pointing out among the SEQ ID NO:64, determines on 903 Nucleotide total lengths.
The nucleotide sequence that coding has the polypeptide of Δ 6-elongase activity is preferably selected from:
A) have the sequence of describing among the SEQ ID No.171,173,175,177,179,181 or 183, the nucleotide sequence that especially has the sequence of describing among the SEQ ID No.171,
B) nucleotide sequence, the aminoacid sequence of pointing out among its coding SEQ ID No.172,174,176,178,180,182 or 184, the aminoacid sequence of pointing out among the SEQ ID No.172 that especially encodes,
C) nucleotide sequence, itself and top a) or b) in the complementary strand hybridize under stringent condition of the nucleotide sequence pointed out among the nucleotide sequence, especially the SEQ IDNo.1 that point out,
D) nucleotide sequence, itself and top a) or b) in the nucleotide sequence pointed out, especially with SEQ IDNo.171 in the sequence pointed out have at least 60%, 65%, 70%, 75% or 80%, preferably at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90%, preferred especially at least 91%, 92%, 93%, 94% or 95% and especially at least 96%, 97%, 98% or 99% identity and
E) nucleotide sequence, its encoding amino acid sequence and this aminoacid sequence have point out among the SEQ ID No.185,186,187,188,189,190,191 or 192 at least a, for example 2,3,4,5,6,7 or 8 kind, preferably all aminoacid patterns.
The nucleotide sequence that coding has the polypeptide of Δ 6-elongase activity especially also is the codon optimized sequence of the present invention, preferably in the nucleotide sequence of describing in SEQ ID NO:122.
The nucleotide sequence that coding has the active polypeptide of Δ 5-desaturase is preferably selected from:
A) nucleotide sequence, it has the sequence of describing in SEQ ID No.51,53 or 55, preferably have the sequence of describing in SEQ ID No.51,
B) nucleotide sequence, the aminoacid sequence of pointing out among its coding SEQ ID No.52,54 or 56, the aminoacid sequence of pointing out among the optimized encoding SEQ ID No.52,
C) nucleotide sequence, itself and top a) or b) in the complementary strand hybridize under stringent condition of the nucleotide sequence pointed out among the nucleotide sequence, especially the SEQ IDNo.51 that point out,
D) nucleotide sequence, itself and top a) or b) in the nucleotide sequence pointed out, especially with SEQ IDNo.51 in the sequence pointed out have at least 60%, 65%, 70%, 75% or 80%, preferably at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90%, preferred especially at least 91%, 92%, 93%, 94% or 95% and especially at least 96%, 97%, 98% or 99% identity and
E) nucleotide sequence, its encoding amino acid sequence and this aminoacid sequence have point out among the SEQ ID No.57,58,59,60,61,62 or 63 at least a, and for example 2,3,4,5,6 or 7 kind, preferably all aminoacid patterns.
Other suitable nucleotide sequence can for example be found the http://www.ncbi.nlm.nih.gov from document or known gene library by the technician.
In present method further preferred embodiment, in addition coding is had in one or more nucleotide sequence introduced plants of ω-3-desaturase activity and/or the active polypeptide of Δ 4-desaturase.
The nucleotide sequence that coding has ω-active polypeptide of 3-desaturase is preferably selected from:
A) have the sequence of describing in SEQ ID No.193 or 195, the nucleotide sequence of the sequence of describing among the preferred SEQ ID No.193,
B) nucleotide sequence, the aminoacid sequence of pointing out among its coding SEQ ID No.194,
The complementary strand hybridize under stringent condition of the nucleotide sequence of describing in the c) nucleotide sequence, itself and SEQ ID No.193 or 195 and
D) nucleotide sequence, the sequence of pointing out in itself and SEQ ID No.193 or 195 has at least 60%, 65%, 70%, 75% or 80%, preferably at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90%, preferred at least 91%, 92%, 93%, 94% or 95% and especially at least 96%, 97%, 98% or 99% identity especially.
Being advantageously used in ω-3-desaturase in the inventive method makes ω-6 biosynthetic pathway be displaced to ω-3 biosynthetic pathway to become possibility, cause C 18:2To C 18:3The skew of lipid acid.ω-3-desaturase transforms the phosphatide of wide region, as phosphatidylcholine (=PC), phosphatidylinositols (=PIS) or phosphatidylethanolamine (=PE) be more useful.At last, also can neutral lipid (=NL), promptly find the desaturation product in the triglyceride level.
The nucleotide sequence that coding has the active polypeptide of Δ 4-desaturase is preferably selected from:
A) have the sequence of describing among the SEQ ID No.77,79,81,83,85,87,89,91 or 93, the nucleotide sequence that preferably has the sequence of describing among the SEQ ID No.77,
B) nucleotide sequence, the aminoacid sequence of pointing out among its coding SEQ ID No.78,80,82,84,86,88,90,92 or 94, the aminoacid sequence of pointing out among the optimized encoding SEQ ID No.78,
C) nucleotide sequence, itself and top a) or b) in the complementary strand hybridize under stringent condition of the nucleotide sequence pointed out among the nucleotide sequence, especially the SEQ IDNo.77 that point out,
D) nucleotide sequence, the sequence of pointing out among itself and the SEQ ID No.77 has at least 60%, 65%, 70%, 75% or 80%, preferably at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90%, preferred especially at least 91%, 92%, 93%, 94% or 95% and especially at least 96%, 97%, 98% or 99% identity and
E) nucleotide sequence, its encoding amino acid sequence, this aminoacid sequence has point out among the SEQ ID No.95,96,97,98,99,100,101,102,103,104,105,106,107 or 108 at least a, for example 2,3,4,5,6,7,8,9,10,11,12,13 or 14 kind, preferably all aminoacid patterns.
The two keys of Δ 4-desaturase catalysis that are advantageously used in the inventive method are introduced in the lipid acid clupanodonic acid, cause the formation of docosahexenoic acid.
The nucleotide sequence that has the polypeptide of Δ 6-desaturase activity, Δ 6-elongase activity, Δ 5-desaturase activity and Δ 5-elongase activity except coding, introduce when suitable and coding has outside the nucleotide sequence of ω-3-desaturase activity and/or the active polypeptide of Δ 4-desaturase, and it is useful that the method that the present invention describes will be encoded in other nucleic acid introduced plant of lipid acid or lipid metabolism enzyme extraly.
It is possible using the combination of the nucleotide sequence that uses in all genes of lipid acid or lipid metabolism and the inventive method in principle; The preferred use is selected from ethylene reductase; acyl-acp (acyl carrier protein) desaturase; fatty acyl-acp thioesterase; the fatty acid acyl based transferase; acyl-CoA: lysophospholipid acyltransferase; Fatty acid synthetase; fatty acid hydroxylase; acetyl-CoA carboxylase; the acetyl-CoA oxydase; fatty acid desaturase; lipid acid acetylene series enzyme; lipoxygenase; triacylglycerol lipases; oxidation propadiene synthase; the lipid acid of hydroperoxide lyase or fatty acid elongase or the gene of lipid metabolism and Δ-6-extends enzyme; Δ-6-desaturase; Δ-5-desaturase and Δ-5-extends enzyme; and with ω-3-desaturase and/or Δ-4-desaturase combination, the combination of use individual gene or several genes is possible in the time of suitably.
The nucleic acid that uses in the inventive method is advantageously expressed in nutritive issue (somatic tissue).Nutritive issue is at the tissue of the context of the invention middle finger by the mitotic division breeding.Organizing also of the type produces by monogony (apomixis) and breeding.Breeding is the term that uses when individual number increased with the successive generation.Substantially the same by these individualities that vegetative propagation produces with their parent.The example of this type of tissue be on leaf, flower, root, stem, the ground or under runner (side shoot, stolon), rhizome, bud, stem tuber such as piece root or stem tuber, bulb, propagulum, brood bud, bulb or turion.This type of is organized also can be by false vivipary, true vivipary or the vivipary generation that is caused by the mankind.Yet the seed (as typical aster section (Asteraceae), Gramineae (Poaceae) or the Rosaceae (Rosaceae)) that produces by agamospermy is also included within the nutritive issue that advantageously takes place to express.The nucleic acid that uses in the inventive method not half ground in germinal tissue (germ line tissue) is expressed or is not expressed.The example of this type of tissue is by syngenesis, i.e. the tissue that subtrahend cell fission produces, for example seed that produces by sexual process.
Not half refers to, compares with nutritive issue, and the expression of measuring on RNA and/or the protein level is lower than 5%, advantageously is lower than 3%, particularly advantageously is lower than 2%, most preferably is lower than 1,0.5,0.25 or 0.125%.
Nucleotide sequence is particularly preferably expressed in the leaf of transgenic plant.This LCPUFAs with generation according to the present invention can directly be absorbed by the digestion leaf by the animal or human, and does not need the advantage of the processing in early stage of vegetable material.
The expression of nucleotide sequence of the present invention in leaf can realize by using the special promotor of composing type or leaf.
" constitutive promoter " is that make may be in the root phase of development of plants, in the preferred whole plants growth course at multiple tissue, preferred institute in a organized way in expression promoter.The preferred use from plant or from the promotor of plant virus.The promotor of CaMV (cauliflower mosaic virus) 35S transcript (people (1980) Cell 21:285-294 such as Franck), 19S CaMV promotor (US5,352,605), actin promoter (people (1990) Plant Cell 2:163-171 such as McElroy) from rice, legumin B promotor (Gen Bank Acc.No.X03677), Agrobacterium nopaline synthase promoter, TR binary promotor, Agrobacterium octopine synthase promoter, ubiquitin promotor (people (1995) Plant Mol.Biol.29:637-649 such as Holtorf), the Smas promotor, (US 5 for the cinnamyl-alcohol dehydrogenase promotor, 683,439), the promotor of vacuole ATP enzyme subunit, pEMU promotor (people (1991) Theor.Appl.Genet.81:581-588 such as Last), (people (1984) EMBO such as Velten is (12) J.3: 2723-2730) for the MAS promotor, histone H 3 promotor (people (1992) Mol.Gen.Genet.231:276-285 such as Lepetit) from corn, nitrilase 1 gene promoter (Gen Bank Acc.No.U38846 from Arabidopis thaliana, Nucleotide 3862-5325) with from the proteinic promotor (WO 91/13991) of the proline rich of wheat, and other promotor of expressing of mediation constitutive gene.The promotor of preferred especially CaMV 35S transcript.
Using the constitutive promoter that their regulate sequence of having as above mentioned those all natural appearance in principle, to be used for novel method be possible.Yet it also is possible additionally or separately using the synthetic promotor.
" leaf specificity promoter " is to show high reactivity and do not have activity or SA promotor is only arranged in other tissue in leaf." low activity " is lower than in leaf active 20% in the context of the invention middle finger activity in other tissue, preferably be lower than 10%, especially preferably is lower than 5% and most preferably be lower than 3,2 or 1%.The example of suitable leaf specificity promoter is the promotor (people (1985) Nature 318:579-582 such as Timko) and the protein-bonded promotor of chlorophyll a/b (people (1985) EMBO such as Simpson J.4:2723-2729) of rubisco (rubisco) small subunit.
The technician knows other leaf specificity promoter, and perhaps he can separate other suitable promotor with known method.Therefore, in the molecular biology ordinary method, for example under the help of hybrid experiment or the research of DNA-protein bound, the technician can identify leaf specificity adjusting nucleic acid elements.This needs the first step for example to separate total poly (A) from the leaf texture of the biology wanted (will from described biology separation adjusting sequence) +RNA, and set up the cDNA library.Second step, use from non-leaf texture based on poly (A) +The cDNA clone of RNA molecule is by hybridizing those clones that identify from first library, the corresponding poly (A) of described clone +The RNA molecule only accumulates in leaf texture.Subsequently, these cDNA that identify in this mode are used to separate the promotor with leaf specificity regulatory element.The technician can use the method for other PCR-based of separating suitable leaf specificity promoter in addition.
Certainly, by using activated seed specific promoters in embryo and/or endosperm, it also is possible expressing nucleotide sequence of the present invention in the seed of transgenic plant.Seed specific promoters can separate from dicotyledonous and monocotyledons in principle.Preferred promotor is listed hereinafter: USP (unknown seed albumen) and vicilin (pea ((Vicia faba) (
Figure A200780007847D0018143453QIETU
Et al. (1991) Mol.Gen Genet.225 (3): 459-467), [US 5 for rapeseed protein (rape); 608; 152], conlinin (Semen Lini) [WO 02/102970], (US 5 for acyl carrier protein (rape); 315; 001 and WO 92/18634), oleosin (Arabidopis thaliana) [WO 98/45461 and WO 93/20216], [US 5 for Kidney bean albumen (Kidney bean); 504,200], Bce4[WO 91/13980], legumin B4 (LegB4 promotor) [
Figure A200780007847D0019143551QIETU
Deng, Plant J., 2,2,1992], Lpt2 and lpt1 (barley) [WO95/15389 and WO95/23230], from rice, the seed specific promoters of corn and wheat [WO99/16890], Amy32b, Amy 6-6 and aleurain[US 5,677,474], Bce4 (rape) [US 5,530,149], glycinin (soybean) [EP 571 741], Phosphoenolpyruvate carboxylase (soybean) [JP 06/62870], ADR12-2 (soybean) [WO 98/08962], [US 5 for isocitrate lyase (rape), 689,040] or αDian Fenmei (barley) [EP, 781,849].
In particularly preferred embodiment of the present invention, used nucleotide sequence, especially coded delta 5-extends enzyme and by being suitable for the nucleotide sequence that codon in one or more plant speciess selects the nucleotide sequence in the biology with its sequence source relatively to be modified, preferably the nucleotide sequence of describing in SEQ ID NO:64 is especially expressed in seed in germinal tissue.Specific expressed passing through in the seed used a kind of above mentioned seed specific promoters, especially uses the rapeseed protein promotor advantageously to carry out.In this particularly preferred embodiment, the content of the LCPUFAs that produces, especially the content of C22 lipid acid accounts at least 5% of seed oil content by weight in seed oil, advantageously account at least 6,7,8,9 or 10% by weight, preferably by weight at least 11,12,13,14 or 15%, particularly preferably by weight at least 16,17,18,19 or 20%, very particularly preferably by weight at least 25,30,35 or 40%.In the further particularly preferred embodiment of the nucleotide sequence of describing in SEQ ID NO:63 is arranged, the content of C22 lipid acid accounts at least 8% of seed oil content by weight in the seed oil.
In the further particularly preferred embodiment of the present invention, the nucleotide sequence that uses, especially coded delta 5-extends enzyme and by adapting to the nucleotide sequence that codon in one or more plant speciess selects the nucleotide sequence in the biology with its sequence source relatively to be modified, preferably the nucleotide sequence of describing in SEQ ID NO:64 is especially expressed in seed in germinal tissue.Specific expressed in the seed by using a kind of above mentioned seed specific promoters, especially use the rapeseed protein promotor advantageously to carry out.In this particularly preferred embodiment, the content of the docosahexenoic acid in the seed oil accounts at least 1% of seed oil content by weight, preferably by weight at least 1.1,1.2,1.3,1.4 or 1.5%, especially preferably by weight at least 1.6,1.7,1.8 or 1.9%, especially by weight at least 2,2.1,2.2,2.3,2.4,2.5,2.6,2.7,2.8 or 2.9%, further preferably by weight at least 3,3.5 or 4%.In the further particularly preferred embodiment of the nucleotide sequence that has SEQ ID NO:63 to describe, docosahexenoic acid content accounts at least 1.9% of seed oil content by weight in the seed oil.Known to the skilled in this respect is in order to produce docosahexenoic acid, needs extra one or more nucleotide sequences, and its coding has the active polypeptide of Δ 4-desaturase.The nucleotide sequence that coding has the active polypeptide of Δ 4-desaturase advantageously is selected from the sequence with description among the SEQ ID No.77,79,81,83,85,87,89,91 or 93, the nucleotide sequence that preferably has the sequence of describing among the SEQ ID No.77.
In the further particularly preferred embodiment of the present invention, the nucleotide sequence that uses, especially coded delta 5-extends enzyme and selects by the codon that is suitable in one or more plant speciess, the nucleotide sequence of relatively being modified with the nucleotide sequence in the biology in its sequence source, preferably the nucleotide sequence of describing in SEQ ID NO:64 is especially expressed in seed in germinal tissue.Specific expressed passing through in seed used a kind of above mentioned seed specific promoters, especially uses the rapeseed protein promotor advantageously to carry out.In this particularly preferred embodiment, the content of the docosahexenoic acid in the seed oil is at least 1% of seed oil content by weight, preferably by weight at least 1.1,1.2,1.3,1.4 or 1.5%, especially preferably by weight at least 1.6,1.7,1.8 or 1.9%, especially by weight at least 2,2.1,2.2,2.5,2.6,2.7,2.8 or 2.9%, further preferably by weight at least 3,3.5 or 4%.In this case, the LCPUFAs that produces, especially the content of C22 lipid acid is at least 5% of seed oil content by weight in seed oil, by weight advantageously at least 6,7,8,9 or 10%, by weight preferably at least 11,12,13,14 or 15%, by weight particularly preferably at least 16,17,18,19 or 20%, by weight very particularly preferably at least 25,30,35 or 40%.In the further particularly preferred embodiment of the nucleotide sequence of in having SEQ ID NO:63, describing, the content of docosahexenoic acid is at least 1.9% of seed oil content by weight in the seed oil, and the content of C22 lipid acid is at least 8% of seed oil content by weight in the seed oil.
Gene expression in plants also can be realized (seeing Gatz (1997) Annu.Rev.Plant Physiol.Plant Mol.Biol., the summary among the 48:89-108) by chemical inducible promoter.When expectation genetic expression when special mode takes place with the time, chemical inducible promoter is suitable especially.The example of this type of promotor be salicylic acid inducible promotor (WO 95/19443), tsiklomitsin inducible promoter (people (1992) Plant such as Gatz J.2,397-404) and alcohol induced type promotor.
The promotor of response biology or abiotic stress condition also is suitable, for example, the PRP1 gene promoter of pathogen-inducible (people such as Ward, Plant.Mol.Biol.22 (1993) 361-366), (US 5 for thermal induction type tomato hsp80 promotor, 187,267), cold induction type potato α-Dian Fenmei promotor (WO 96/12814) or wound-induced type pinII promotor (EP-A-0 375 091).
Also specially suitable other promotor is that those cause the promotor that plasmid is specific expressed, because plasmid has constituted compartment, and the synthetic therein biosynthetic precursor of lipid and some end products.Suitable promotor describe to some extent in WO 95/16783 and WO 97/06250 as the viral rna polymerase promotor, and Arabidopis thaliana clpP promotor has description in WO 99/46394.
Not only can in complete transgenic plant, produce understanding the polyunsaturated fatty acid that produces according to the present invention, also can produce in plant cell cultures or in callus culture thing (callous cultures).
The polyunsaturated fatty acid of Chan Shenging advantageously is combined in phosphatide and/or the triglyceride in the method, but also can be used as the form that other fatty acid ester appears maybe can also being combined in free fatty acids in biology.They exist can be used as " pure products " aspect this, or can also be advantageously exist with the form of the mixture of the form of multiple fatty acid mixt or different phosphatide such as phosphatidyl glycerol, phosphatidylcholine, phosphatidylethanolamine and/or phosphatidylserine and/or triglyceride, monoacylglycerol ester and/or DG ester.The LCPUFAs that produces in present method, EPA, DPA and DHA advantageously are present in phosphatidylcholine and/or phosphatidylethanolamine and/or the triglyceride.Triglyceride also can comprise other lipid acid in addition, as have 4 to 6 C atoms short chain fatty acid, have the medium chain fatty acid of 8 to 12 C atoms or have the longer chain fatty acid of 14 to 24 C atoms.They preferably comprise longer chain fatty acid, preferred especially C 20Or C 22Lipid acid.
Term " glyceryl ester " can be understood as and refers to one, the glycerine (glycerine list, two or three esters) of two or three carboxylic group esterifications." glyceryl ester " also can be understood as the mixture that refers to multiple glyceryl ester.Glyceryl ester is preferably triglyceride level.Glyceryl ester or glyceride mixture can comprise other additive, for example free fatty acids, antioxidant, protein, carbohydrate, VITAMIN and/or other material.
For the purpose according to the inventive method, " glyceryl ester " therefore is interpreted as the derivative of finger from glycerine.Except above-described glycerin fatty acid ester, also comprise glyceryl phosphatide and glyceroglycolipid.The preferred embodiment that can mention is a glyceryl phosphatide herein, as Yelkin TTS (phosphatidylcholine), Val, phosphatidyl glycerol, phosphatidylserine and alkylacylglycerol phosphatide.
For the object of the invention, phosphatide will be interpreted as and refer to phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidyl glycerol and/or phosphatidylinositols.
Has how unsaturated C 18-, C 20-and/or C 22The fatty acid ester of-fatty acid molecule can be with the isolated in form of oil or lipid, for example with compound, as sphingolipid, phosphoglyceride, lipid, glycolipid such as glycosphingolipid, phosphatide such as phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, phosphatidyl glycerol, phosphatidylinositols or diphosphatidylglycerol, the monoacylglycerol ester, the DG ester, (it comprises and has at least two for triglyceride or other fatty acid ester such as acetyl-CoA ester, three or four, preferred four, the polyunsaturated fatty acid of five or six two keys) isolated in form is from being used to prepare the plant separation of fatty acid ester; Advantageously, they are with the form of their DG ester, triglyceride and/or with the form of phosphatidyl ester, especially preferably with the isolated in form of triglyceride, phosphatidylcholine and/or phosphatidylethanolamine.Except these esters, polyunsaturated fatty acid also is present in the plant as free fatty acids or the form that is combined in other compound.Usually, multiple above-claimed cpd (fatty acid ester and free fatty acids) is present in the biology, it probably is distributed as with triglyceride level weight and counts 80 to 90%, count 2 to 5% with triglyceride weight, count 5 to 10% with monoglyceride weight, count 1 to 5% with free fatty acids weight, count 2 to 8% with phosphatide weight, total multiple compound amounts to 100% by weight.
The content of the LCPUFAs of Chan Shenging is based on lipid acid total in the transgenic plant by weight at least 4% in the methods of the invention, by weight advantageously at least 5,6,7,8,9 or 10%, by weight preferably at least 11,12,13,14 or 15%, by weight especially preferably at least 16,17,18,19 or 20%, by weight very especially preferably at least 25,30,35 or 40%.Lipid acid EPA, DPA that produces in the method for the present invention and/or DHA based on the content of lipid acid total in the transgenic plant under each situation by weight at least 5%, under each situation by weight preferably at least 6,7,8 or 9%, under each situation by weight especially preferably at least 10,11 or 12%, under each situation by weight most preferably at least 13,14,15,16,17,18,19 or 20%.
Lipid acid advantageously produces with combining form.Under the help of the used nucleic acid of the inventive method, it is possible placing these unsaturated fatty acidss on sn1, the sn2 of the triglyceride of favourable generation and/or the sn3 position.Advantageously, at least 11% triglyceride is by disubstituted (referring on sn1 and sn2 or sn2 and sn3 position).Trisubstituted triglyceride also is can be detected.Because a large amount of reactions steps takes place from precursor compound linolic acid (C18:2) and linolenic acid (C18:3), the end product of described method for example, arachidonic acid (ARA) or timnodonic acid (EPA) do not produce with pure fully product; Trace or relatively large precursor also always are present in the end product.For example, if linoleic acid plus linolenic acid all is present in the original plant, end product such as ARA or EPA and/or DPA and/or DHA also exist as mixture.Precursor is based on the amount of end product separately, should advantageously amount to by weight not to be higher than 20%, preferably is not higher than 15% by weight, especially preferably not as 10%, preferably is not higher than 5% very especially by weight by weight.Advantageously, have only ARA or EPA and/or DPA and/or DHA to produce in the methods of the invention, as the end product in the transgenic plant with the form of bonded or free acid.
Fatty acid ester that produces by the inventive method or fatty acid mixt are in each case based on 100% and based on the total fatty acid content of biology, advantageously comprise 6 to 15% palmitinic acid, 1 to 6% stearic acid, the oleic acid of 7-85%, 0.5 vaccenic acid to 8%, 0.1 the eicosanoic acid to 1%, 7 to 25% saturated fatty acid, 8 to 85% monounsaturated fatty acids and 60 to 85% polyunsaturated fatty acid.Preferred at least 0.1,0.2,0.3,0.4,0.5,0.6,0.7,0.8,0.9 or 1% arachidonic acid is present in fatty acid ester or the fatty acid mixt as useful polyunsaturated fatty acid in the total fatty acid content.The fatty acid ester or the fatty acid mixt that produce by the inventive method further advantageously comprise lipid acid, described lipid acid is selected from lipid acid erucic acid (13-Decosahedaenoic acid), sterculic acid (9,10-methylene radical Octadec-9-enoic Acid), malvalic acid (8,9-methylene radical 17 carbon-8-olefin(e) acid), hydnocarpylacetic acid (cyclopentenes dodecylic acid), furans lipid acid (9,12-epoxy Linolenic Acid, the 11-diolefinic acid), vernolic acid (9,10-epoxy 18 carbon-12-olefin(e) acid), tariric acid (6-octadecynoic acid), 6-19 carbyne acid, santalbic acid (anti-11-vaccenic acid-9-acetylenic acid), 6, the 9-santalbinic acid, pyrulic acid (anti-10-17 alkene-8-acetylenic acid), crepenyninic acid (9-octadecylene-12-acetylenic acid), 13,14-dihydro oropheic acid, 18 carbon-13-alkene-9, isomic acid, petroselenic acid (suitable-petroselinic acid), 9 is suitable, 12 anti--octadecadienoic acids, calendulin acid (calendulic acid) (8 anti-10 anti-12 suitable-punicic acid), Catalposide acid (catalpic acid) (9 anti-11 anti-13 suitable-punicic acid), eleostearic acid (9 along 11 anti-13 anti--punicic acids), jacaric acid (8 along 10 anti-12 suitable-punicic acids), Trichosanoic acid (9 along 11 anti-13 suitable-punicic acids), wheat cake tree acid (9 along 11 anti-13 anti-15 suitable-therapic acids), Pinolenic acid (pinolenic acid) (complete-suitable-5,9, the 12-punicic acid), laballenic acid (5,6-18 carbon diene allenolic acids), the lipid acid of ricinolic acid (12-hydroxyoleic acid) and/or coriolin acid (coriolicacid) (13-hydroxyl-9 is suitable, 11 anti--octadecadienoic acids).Usually, above-mentioned lipid acid only is present in the fatty acid ester or fatty acid mixt that produces by the inventive method so that trace is favourable, the meaning is based on total fatty acid content, their appearance is lower than 30%, preferably be lower than 25%, 24%, 23%, 22% or 21%, especially preferably be lower than 20%, 15%, 10%, 9%, 8%, 7%, 6% or 5%, very especially preferably be lower than 4%, 3%, 2% or 1%.In the further preferred form of the present invention, based on total fatty acid content, the appearance of these above-mentioned lipid acid is lower than 0.9%, 0.8%, 0.7%, 0.6% or 0.5%, especially preferably is lower than 0.4%, 0.3%, 0.2%, 0.1%.Based on total fatty acids, fatty acid ester that is produced by the inventive method or fatty acid mixt advantageously comprise and are lower than 0.1% and/or do not have butyric acid, cholesterol and nisinic acid (nisioic acid, a C23:6 Δ 3,8,12,15,18,21).
Realize comparing by nucleotide sequence used in the inventive method with non-transgenic plant, LCPUFAs output increase at least 50% in the transgenic plant, advantageously at least 80%, particularly advantageously at least 100%, very particularly advantageously at least 150% is possible.
Also can be by above-described method synthetic chemistry pure polyunsaturated fatty acid or fatty acid composition.For this reason, in a known way for example the combination by extraction, distillation, crystallization, chromatogram or these methods come separation of fatty acids or fatty acid composition.These chemical pure lipid acid or fatty acid composition are useful for the application in foodstuffs industry department, makeup department and especially the pharmacology industrial sector.
In principle, all dicotyledonous or monocotyledonous useful plants are suitable to the inventive method.Useful plant refers to can be humans and animals and produces food, produces the plant of other running stores, fiber and medicine, as cereal, and for example corn, paddy rice, wheat, barley, millet, oat, rye, buckwheat; As stem tuber, for example potato, cassava, sweet potato, Chinese yam or the like; As sugar plant, for example sugarcane or beet; As beans, for example Kidney bean, pea, broad bean or the like; As the grease crop, for example soybean, rape, Sunflower Receptacle, safflower, flax, camolina or the like.Favourable plant is selected from following plant section: Aceraceae (Aceraceae), Actinidiaceae (Actinidiaceae), Anacardiaceae (Anacardiaceae), umbelliferae (Apiaceae), Arecaceae (Arecaceae), composite family (Asteraceae), Betulaceae (Betulaceae), Boraginaceae (Boraginaceae), Cruciferae (Brassicaceae), Bromelia family (Bromeliaceae), Cannabaceae (Cannabaceae), Cannaceae (Cannaceae), Caprifoliaceae (Caprifoliaceae), Chenopodiaceae (Chenopodiaceae), convolvulaceae (Convolvulaceae), Curcurbitaceae (Cucurbitaceae), Dioscoreaceae (Dioscoreaceae), Elaeangnaceae (Elaeagnaceae), Ericaceae (Ericaceae), Euphorbiaceae (Euphorbiaceae), pulse family (Fabaceae), Fagaceae (Fagaceae), gooseberry section (Grossulariaceae), Juglandaceae (Juglandaceae), Lauraceae (Lauraceae), Liliaceae (Liliaceae), flax family (Linaceae) (Linaceae), Malvaceae (Malvaceae), Moraceae (Moraceae), Musaceae (Musaceae), Oleaceae (Oleaceae), Oxalidaceae (Oxalidaceae), papaveracease (Papaveraceae), Gramineae (Poaceae), polygonaceae (Polygonaceae), Punicaceae (Punicaceae), the Rosaceae (Rosaceae), Rubiaceae (Rubiaceae), Rutaceae (Rutaceae), scrophulariaceae (Scrophulariaceae), Solanaceae (Solanaceae), Sterculiaceae (Sterculiaceae) and Valerianaceae (Valerianaceae).
Examples which may be mentioned are the following plants selected from the group: Anacardiaceae such as Pistacia genus (Pistacia), Mango genus (Mangifera), cashew (Anacardium) eg A month Hunzi (Pistacia vera (A May Hunzi real)), mango (Mangifer indica (mango)) or cashews (Anacardium occidentale (Cashews)) genus and species, genus Asteraceae such as Calendula (Calendula), red and blue flower genus (Carthamus), Knapweed (Centaurea), chicory genus (Cichorium), an artichoke (Cynara), Helianthus (Helianthus), Lactuca (Lactuca), Locusta, Tagetes, Valeriana (Valeriana) Such as marigold (Calendula officinalis (Marigold general)), safflower (Carthamus tinctorius (safflower)), cornflower (Centaurea cyanus (Cornflower)), chicory (Cichorium intybus (chicory)), artichokes (Cynara scolymus (artichoke)), sunflower (Helianthus annus (Sunflower)), lettuce (Lactuca sativa), wrinkled leaf lettuce (Lactuca crispa), taro (Lactuca esculenta), some kind of poison lettuce (Lactuca scariola L.ssp.Sativa), Lactus scariola L.var.integrata, Lactuca scariola L.var.integrifolia, lettuce Lettuce romana subspecies (Lactuca sativa subsp.Romana), Locusta communis, lettuce Lettuce valerian (Valeriana locusta (salad vegetables)), bay leaves marigold (Tagetes lucida), Longevity Daisy (Tagetes erecta) or Egeria marigold (Tagetes tenuifolia) (French marigold) of the genus and Species, genus Umbelliferae such as carrots (Daucus) such as carrot (Daucus carota (carrot)) genus And species, such as Betulaceae Corylus (Corylus) such as the European hazel (Corylus avellana) or filberts (Corylus colurna (hazelnut)) genus and species, comfrey such as Borago, for example, the following genera and Kind: Borago officinalis (borage), cruciferous such as Brassica (Brassica), genus Camelina (Camelina), Melanosinapis, Sinapis alba (Sinapis), Arabidopsis (Arabadopsis) cases Such as the European rapeseed (Brassica napus), turnip is some kind (Brassica rapa ssp. (Rapeseed)), Wild Europe white mustard (Sinapis arvensis), mustard (Brassica juncea), Brassica juncea var.juncea, wrinkled leaf mustard (Brassica juncea var.crispifolia), big-leaf mustard (Brassica juncea var.foliosa), black mustard (Brassica nigra), Brassica sinapioides, Camelina (Camelina sativa), mustard (Melanosinapis communis (mustard Dish)), cabbage (Brassica oleracea (fodder beet)) or Arabidopsis (Arabidopsis thaliana) Genus and species, bromeliads such as pineapple genus (Anana), Bromelia (pineapple) such as pineapple (Anana comosus), Ananas ananas or Bromelia comosa (Pineapple) genus and species, papaya Subjects such as papaya genus (Carica) such as papaya (Carica papaya (papaya)) genus and species, a large Subjects such as cannabis hemp genus (Cannabis) such as marijuana (Cannabis sativa (marijuana)) genus and species, spin Flower Branch as Ipomoea (Ipomea), bindweed genus (Convolvulus) such as sweet potatoes (Ipomoea batatus), violin leaf morning glory (Ipomoea pandurata), Convolvulus batatas, Convolvulus tiliaceus, Ipomoea fastigiata, Ipomoea tiliacea, three lobed potato (Ipomoea triloba) or Convolvulus panduratus (sweet potatoes, sweet potatoes) genus and species, Chenopodiaceae Such as the case of sugar beet (Beta vulgaris) such as sugar beet (Beta vulgaris), Beta vulgaris var. altissima, common variants beet (Beta vulgaris var.vulgaris), Beta maritima, sweet Perennial vegetable varieties Beta vulgaris var.perennis, Beta vulgaris var.Conditiva or Beta vulgaris var.esculenta (beet) genus and species, such as the Cucurbitaceae Cucurbita (Cucurbita) For example Cucurbita (Cucurbita maxima), ash sub pumpkin (Cucurbita mixta), zucchini (Cucurbita pepo) or pumpkin (Cucurbita moschata (zucchini)) genus and species, Elaeagnus Subjects such as Elaeagnus (Elaeagnus) such as olive (Olea europaea (olive)) genus and species, DU Azalea Branch as Kalmia (Kalmia) such as broad-leaved mountain laurel (Kalmia latifolia), narrow-leaf mountain Month Gui (Kalmia angustifolia), lobular mountain laurel (Kalmia microphylla), marsh mountain laurel (Kalmia polifolia), Western Mountain laurel (Kalmia occidentalis), Cistus chamaerhodendros or mountain laurel (Kalmia lucida (mountain laurel)) genus and species, such as the Euphorbiaceae Manioc (Manihot), Janipha, Jatropha (Jatropha), genus Castor (Ricinus) such as Cassava (Manihot utilissima), Janipha manihot, Jatropha manihot, Manihot aipil, sweet cassava (Manihot dulcis), Manihot manihot, Manihot melanobasis, cassava (Manihot esculenta (cassava)) or castor bean (Ricinus communis (Castor)) of the genus and species, legumes such as peas case (Pisum), genus Acacia (Albizia), Cathormion, Feuillea, Inga, Pithecolobium, acacia (Acacia), shy Genus (Mimosa), Medicajo, Glycine (Glycine), lentils genus (Dolichos), Phaseolus Phaseolus, Glycine (Soybean) such as pea (Pisum sativum), forage peas (Pisum arvense), Pisum humile (peas), Albizia berteriana, Albizia (Albizia julibrissin), wide pod acacia (Albizia lebbeck), Acacia berteriana, Acacia littoralis, Albizia berteriana, Albizzia berteriana, Cathormion berteriana, Feuillea berteriana, Inga fragrans, Pithecellobium berterianum, Pithecellobium fragrans, Pithecolobium berterianum, Pseudalbizzia berteriana, Acacia julibrissin, Acacia nemu, Albizia nemu, Feuilleea julibrissin, Mimosa julibrissin, Mimosa speciosa, Sericanrda julibrissin, wide pod acacia (Acacia lebbeck), Acacia macrophylla, lebbeck (Albizia lebbeck), Feuilleea lebbeck, big-leaf mimosa (Mimosa lebbeck), Mimosa speciosa (acacia), alfalfa (Medicago sativa), wild alfalfa (Medicago falcata), hybrid alfalfa (Medicago varia) (Alfalfa Alfalfa), soybean (Glycine max), sickle lentils (Dolichos soja), broad leaf vine beans (Glycine gracilis), soybean (Glycine hispida), large bean (Phaseolus max), Soja hispida or Soja max (soybean) genus and species, Geraniales Branch (Geraniaceae) as Pelargoniums (Pelargonium), coconut genus (Cocos), Oleum such as coconut (Cocos nucifera), Cha Mi Sub geranium (Pelargonium grossularioides) or coconut oil (Oleum cocois (coconut)) of Genus and species, genus grasses such as sugar cane (Saccharum) such as sugar cane (Saccharum officinarum) Genus and species, such as Juglandaceae Juglans (Juglans), Wallia such as walnut (Juglans regia), Juglans ailanthifolia, pecan (Juglans sieboldiana), ash walnut (Juglans cinerea), Wallia cinerea, Juglans bixbyi, California black walnut (Juglans californica), Indian black walnut (Juglans hindsii), Juglans intermedia, Juglans jamaicensis, Big Walnut (Juglans major), Juglans microcarpa, black walnut (Juglans nigra) or walnut (Wallia nigra) (walnut) genus and species, such as avocado Lauraceae genus (Persea), Laurus (Laurus) such as laurel (Laurus nobilis (bay)), avocado (Persea americana), Avocado Oil (Persea gratissima) or Persea persea (avocado) genera and Species of legumes such as groundnuts genus (Arachis) such as groundnuts (Arachis hypogaea (Peanut)) genus And seed, flax subjects such as flax genus (Linum), Adenolinum metals such as flax (Linum usitatissimum), Linum humile, Austria flax (Linum austriacum), Linum bienne, narrow-leaved flax (Linum angustifolium), diarrhea flax (Linum catharticum), Golden flax (Linum flavum), large flower flax (Linum grandiflorum), Adenolinum grandiflorum, Lewis flax (Linum lewisii), that side flax (Linum narbonense), perennial flax (Linum perenne), perennial flax Lewis variants (Linum perenne var.lewisii), Linum pratense or linseed (Linum trigynum (flax Sub)) genus and species, Lythrarieae genus as pomegranate (Punica) such as pomegranate (Punica granatum (Pomegranate)) genus and species, Malvaceae (Malvaceae) such as cotton genus (Gossypium) such as Lu Cotton (Gossypium hirsutum), tree cotton (Gossypium arboreum), Sea Island cotton (Gossypium barbadense), cotton (Gossypium herbaceum) or cotton Thurber (Gossypium thurberi (cotton)) genus and species, Musa (Musaceae), such as Musa (Musa) Such as bananas (Musa nana), small fruit wild banana (Musa acuminata), plantains (Musa paradisiaca), certain species of the genus Musa (Musa spp. (banana)) of the genus and species, Onagraceae (Onagraceae) as Camissonia genus Oenothera (Oenothera) such as evening primrose (Oenothera biennis) or evening primrose (Camissonia brevipes (evening primrose)) genus and species, brown Palmetto Branch (Palmae) as an oil palm (Elaeis), for example, the following genera and species: oil palm (Elaeis guineensis (oil palm)), poppy (Papaveraceae), such as poppy (Papaver), for example The genus and species: Oriental poppy (Papaver orientale), poppy (Papaver rhoeas), long Pod poppy (Papaver dubium (poppy)), flax Branch (Pedaliaceae) such as flax genus (Sesamum) such as sesame (Sesamum indicum (sesame)) genus and species, Piperaceae (Piperaceae) as Piper (Piper), Artanthe, pepper grass genus (Peperomia), Steffensia such as a tree pepper (Piper aduncum), Piper amalago, narrow leaf pepper (Piper angustifolium), large pepper (Piper auritum), betel leaf (Piper betel), cubeb (Piper cubeba), Piper Smilax (Piper longum), pepper (Piper nigrum), false Piper Stubbs (Piper retrofractum), Artanthe adunca, Artanthe elongata, long pepper (Peperomia elongata), Piper elongatum, Steffensia elongata (cayenne pepper) genus And species of grasses (Poaceae) such as barley genus (Hordeum), Secale (Secale), Avena (Avena), genus Sorghum (Sorghum), Andropogon genus (Andropogon), fluff genus (Holcus), Panicum (Panicum), rice genus (Oryza), Zea (Zea (maize)), Triticum (Triticum) such as barley (Hordeum vulgare), Mount Ying barley (Hordeum jubatum), mouse barley (Hordeum murinum), short awn barley (Hordeum secalinum), cultivated two-rowed barley (Hordeum distichon), Hordeum aegiceras, six Row barley (Hordeum hexastichon), six-rowed barley (Hordeum hexastichum), irregular The barley (Hordeum irregulare), barley (Hordeum sativum), short awn barley (Hordeum secalinum) (barley), rye (Secale cereale (rye)), oats (Avena sativa), wild oat (Avena fatua), Mediterranean red oat (Avena byzantina), Avena fatua var.sativa, hybrid oat (Avena hybrida (oats)), two-color sorghum (Sorghum bicolor), johnsongrass (Sorghum halepense), sweet sorghum (Sorghum saccharatum), sorghum (Sorghum vulgare), Andropogon drummondii, two-color Fluff grass (Holcus bicolor), Holcus sorghum, Sorghum aethiopicum, Sorghum arundinaceum, Sorghum caffrorum, nutans sorghum grass (Sorghum cernuum), craft sorghum (Sorghum dochna), Sorghum drummondii, hard sorghum Grass (Sorghum durra), Sorghum guineense, Sorghum lanceolatum, multi-pulse Sorghum grass (Sorghum nervosum), sweet sorghum (Sorghum saccharatum), Sorghum subglabrescens, hanging Yegao Liang grass (Sorghum verticilliflorum), sorghum (Sorghum vulgare), johnsongrass (Holcus halepensis), Sorghum miliaceum, Panicum millet (Panicum militaceum (millet)), rice (Oryza sativa), Oryza latifolia (rice), corn M (Zea mays (maize)), wheat (Triticum aestivum), durum wheat (Triticum durum), cylindrical wheat (Triticum turgidum), Triticum hybernum, Maca wheat (Triticum macha), common wheat (Triticum sativum or Triticum vulgare) (Small Wheat), cruentum Branch (Porphyridiaceae) if Chroothece case, Flintiella genus, Petrovanella genus cruentum genus (Porphyridium), Rhodella, Rhodosorus, Vanhoeffenia example cruentum (Porphyridium cruentum) genus and species, Proteaceae (Proteaceae) such as macadamia nut case (Macadamia) such as entire leaves macadamia nut (Macadamia intergrifolia (macadamia)) genus and species, Rubiaceae (Rubiaceae) such as coffee case (Coffea) Such as coffee genus (Coffea) some kind of small fruit coffee (Coffea arabica), the fruit of coffee (Coffea canephora) or large fruit coffee (Coffea liberica (coffee)), Scrophulariaceae (Scrophulariaceae) such as genus mullein (Verbascum) genus and species such as the following: gross flap mullein Flowers (Verbascum blattaria), Oriental mullein (Verbascum chaixii), mullein leaves and (Verbascum densiflorum), Verbascum lagurus, long-leaf mullein (Verbascum longifolium), Verbascum lychnitis, Verbascum nigrum, Olympic mullein Flowers (Verbascum olympicum), Verbascum phlomoides, purple mullein (Verbascum phoenicum), Verbascum pulverulentum or mullein (Verbascum thapsus (mullein)), nightshade (Solanaceae), such as the genus Capsicum (Capsicum), Nicotiana (Nicotiana), nightshade (Solanum), tomato genus (Lycopersicon) such as the following genera And kinds: pepper (Capsicum annuum), Capsicum annuum var. glabriusculum, colored pepper (Capsicum frutescens (pepper)), red pepper (Capsicum annuum (paprika)), tobacco (Nicotiana tabacum), spend tobacco (Nicotiana alata), Long head of tobacco (Nicotiana attenuata), light tobacco (Nicotiana glauca), Nicotiana langsdorffii, Nicotiana obtusifolia, Nicotiana quadrivalvis, Nicotiana repanda, yellow tobacco (Nicotiana rustica), Nicotiana sylvestris (tobacco), potatoes Potato (Solanum tuberosum (tomato)), eggplant (Solanum melongena (eggplant)), tomato (Lycopersicon esculentum), Lycopersicon lycopersicum, plum tomatoes (Lycopersicon pyriforme), red eggplant (Solanum integrifolium) or tomato (Solanum lycopersicum) (tomato), Sterculiaceae (Sterculiaceae) such as cocoa tree is (Theobroma) such as Cocoa tree (Theobroma cacao (cocoa)) genus and species or Theaceae (Theaceae) as Camellia (Camellia) such as big-leaf tea (Camellia sinensis (tea)) genus and species. ...
In the advantageous embodiment aspect this; the useful plant of using is the oilseed plant that comprises a large amount of lipoid substances, as peanut; rape; the canola oil dish; Sunflower Receptacle; safflower (Carthamustinctoria); opium poppy; leaf mustard; hemp; castor-oil plant; olive; sesame; mary bush; pomegranate; root of Redsepal Eveningprimrose; Verbascum; setose thistle; wild rose; fibert; almond; Queensland nut; avocado; bay; summer squash/pumpkin; Semen Lini; soybean; the A Yue charlatan; the Borrago officinalis; tree (oil palm; coconut palm or walnut tree) or crop corn for example; wheat; rye; oat; triticale; rice; barley; cotton; cassava (cassava); pepper; Flower of Aztec Marigold; plant of Solanaceae is potato for example; tobacco; eggplant and tomato; the kind of Vicia; pea; alfalfa or shrub plant (coffee; cocoa; tea); the kind of Salix and perennial grass and fodder crop.Favourable plant is oilseed plant such as peanut, rape, rape, Sunflower Receptacle, safflower, opium poppy, leaf mustard, hemp, castor-oil plant, olive, mary bush, pomegranate, root of Redsepal Eveningprimrose, summer squash/pumpkin, Semen Lini, soybean, Borrago officinalis, tree (oil palm, cocoa tree) according to the present invention.Especially preferably be rich in the plant of C18:2 and/or C18:3 lipid acid, as Sunflower Receptacle, safflower, tobacco, Verbascum, sesame, cotton, summer squash/pumpkin, opium poppy, root of Redsepal Eveningprimrose, English walnut, Semen Lini, hemp or setose thistle.Very especially preferred safflower, Sunflower Receptacle, opium poppy, root of Redsepal Eveningprimrose, English walnut, Semen Lini or hemp.
The content of expressing nucleotide sequence of the present invention and therefore increasing timnodonic acid in the leaf, clupanodonic acid and/or docosahexenoic acid in feed or food plant also is favourable.Preferred forage plant is, for example, trifolium kind such as red clover (Trifolium pratense), butch clover (Trifolium repens), alsike clover (Trifolium hybridum), donkey food grass (Onobrychis viccifolia), Egyptian clovet (Trifolium alexandrinium) and Persian trifolium (Trifolium resupinatum).Preferred food plant is a lettuce kind for example, as some kind (Lactuca scariola L.ssp.Sativa), Lactuca scariola L.var.integrata, Lactuca scariola L.var.integrifolia, lettuce romana subspecies, Locustacommunis and the lettuce valerian (Valeriana locusta) of lettuce (Lactuca sativa), curled lettuce (Lactuca crispa), taro (Lactuca esculenta), malicious lettuce.
It is possible that enzymic activity by nucleotide sequence produces multiple polyunsaturated fatty acid in the methods of the invention, described nucleotide sequence is that the used and coding of the inventive method has Δ-6-and extends enzyme, Δ-6-desaturase, the nucleotide sequence of the polypeptide of Δ-5-desaturase and/or Δ-5-elongase activity, the nucleotide sequence that advantageously has ω-3-desaturase and/or Δ-active polypeptide of 4-desaturase with coding, and the polypeptide of coding lipid acid or lipid metabolism (as has Δ-5-, Δ-6-, Δ-8-, Δ-12-desaturase or Δ-5-, other polypeptide of Δ-6-or Δ-9-elongase activity) other nucleotide sequence combination.According to the selected useful plant that is used for the inventive method, the mixture of multiple polyunsaturated fatty acid or single polyunsaturated fatty acid such as EPA, DPA or DHA can produce with free or combining form.Form (C18:2 or C18:3 lipid acid) according to the advantage lipid acid in the original plant, the lipid acid that obtains is from C18:2 lipid acid, as GLA, DGLA or ARA or from C18:3 lipid acid, as EPA, DPA or DHA.If be present in the unique unsaturated fatty acids that is used for present method in the plant is linolic acid (LA, C18:2 Δ 9,12), the unique of so described method may product be GLA, DGLA and ARA, it can exist with free fatty acids or conjugated fatty acid.If the unique unsaturated fatty acids that exists in the plant of using in present method is alpha-linolenic acid (ALA, C18:3 Δ 9,12,15) (for example in flax), the unique of so described method may product be SDA, ETA, EPA, DPA and/or DHA, it can exist with free fatty acids or conjugated fatty acid as above-mentioned.Used and participate in Δ-6-and extend the activity that enzyme, Δ-6-desaturase, Δ-5-desaturase and/or Δ-6-extends the enzyme of enzymic synthesis by changing in present method, it is possible advantageously producing unique indivedual product with the combination of other gene of lipid or fatty acid metabolism with oriented approach in plant.Advantageously, only synthesize EPA, DPA or DHA or its mixture.Because lipid acid is synthetic in the biosynthesizing chain, end product separately is not present in the biology as pure material.A spot of precursor compound always also is present in the end product.These based on end product EPA, DPA or DHA or its mixture, are lower than 20% on a small quantity by weight, advantageously are lower than 15% by weight, particularly advantageously are lower than 10% by weight, very particularly advantageously are lower than 5,4,3,2 or 1% by weight.
Have the oil of polyunsaturated fatty acid (its content has advantageously increased) and/or the output of triglyceride level in order to increase to produce in the inventive method, the amount that increases the initial product that is used for synthetic fatty acid is useful.This for example can be by coding being had Δ 12-desaturase the nucleic acid of polypeptide introduce in the biology and realize.This is useful especially in useful plant, as the plant of oil-produced vegetable such as Cruciferae (Brassicaceae), as Btassica (Brassica), for example rape; Elaeangnaceae such as Elaeagnus, for example the genus of Fructus oleae europaeae and kind or pulse family such as Glycine for example have genus and the kind of high oleic soybean.Because these biologies have only low linoleic acid content people (1961) Journal of the American Oil Chemical Society 38:678-681 such as () Mikoklajczak, it is useful using described Δ 12-desaturase to produce the raw material linolenic acid from oleic acid.It also is possible that initial lipid acid is provided from the external world in addition, but because more not preferred this method of the reason of expense.
Mosses and algae are unique botanical systems of a large amount of polyunsaturated fatty acids of known generation such as arachidonic acid (ARA) and/or timnodonic acid (EPA) and/or docosahexenoic acid (DHA).Mosses comprise PUFAs in film fat, however algae, and the biology relevant with algae and some fungies also accumulate a large amount of PUFAs in the triacylglycerol part.Isolated nucleic acid molecule is therefore useful especially to the inventive method from the bacterial strain that also accumulates PUFAs the triacylglycerol part; and it is therefore useful especially to lipid and the PUFA generation system that changes in the plant; described plant such as useful plant such as oil crops plant, for example rape, canola oil dish, flax, hemp, soybean, Sunflower Receptacle, Borrago officinalis.Therefore they can be advantageously used in the inventive method.
Nucleic acid used in the inventive method is advantageously from plant such as algae, the algae such as the different hair Trentepohlia (Heteromastix) of for example grass green algae section, Mammella, Mantoniella, little single Trentepohlia (Micromonas), Nephroselmis, Ostreococcus, green branch Trentepohlia (Prasinocladus), Prasinococcus, Pseudoscourfielda, Pycnococcus, tower born of the same parents Trentepohlia (Pyramimonas), Scherffelia, flat algae belongs to for example Heteromastix longifillis, Mamiella gilva, Mantoniella squamata, Micromonas pusilla, green kidney algae (Nephroselmisolivacea), Nephroselmis pyriformis, circular kidney algae (Nephroselmis rotunda), Ostreococcus tauri, Ostreococcus sp., Prasinocladus ascus, Prasinocladuslubricus, Pycnococcus provasolii, Pyramimonas amylifera, Pyramimonasdisomata, Pyramimonas obovata, Pyramimonas orientalis, Pyramimonasparkeae, Pyramimonas spinifera, Pyramimonas sp., Tetraselmis apiculata, Tetraselmis carteriaformis, Zhou Shi flat algae (Tetraselmis chui), wrinkle leaf flat algae (Tetraselmis convolutae), Tetraselmis desikacharyi, very thin flat algae (Tetraselmisgracilis), Tetraselmis hazeni, Tetraselmis impellucida, Tetraselmisinconspicua, Tetraselmis levis, spot flat algae (Tetraselmis maculata) is arranged, Tetraselmis marina, Tetraselmis striata, Tetraselmis subcordiformis, Tetraselmis suecica, Tetraselmis tetrabrachia, Tetraselmis tetrathele, Tetraselmis verrucosa, the genus of Tetraselmis verrucosa fo.Rubens or Tetraselmis sp. and kind or be selected from the algae such as the cyst Trentepohlia (Ascoglena) of division euglenophyta, become born of the same parents' Trentepohlias (Astasia), glue handle Trentepohlia, Cyclidiopsis, Euglena, intend Euglena (Euglenopsis), Hyalophacus, Ke Shi Trentepohlia (Khawkinea), Lepocinclis, Phacus, gyro Trentepohlia (Strombomonas) or Trachelomonas be fusiformis Euglena (Euglena acus) for example, the bent Euglena (Euglena geniculata) of knee, tiny Euglena, Euglena mixocylindracea, beak shape Euglena (Euglena rostrifera), green Euglena (Euglena viridis), Colacium stentorium, genus and the kind of cylinder capsule Euglena (Trachelomonascylindrica) or rotation capsule Euglena (Trachelomonas volvocina).
Other favourable plants are that algae such as Isochrysis galbana belong to (Isochrysis) or Crypthecodinium cohnii belongs to, algae/diatom such as Thalassiosira or brown algae belong to, mosses such as sword-like leave Rhodobryum or angle tooth Rhodobryum, perhaps higher plant such as Primulaceae (Primulaceae) Aleuritia for example, Calendula stellata, thorn-like bone seed chrysanthemum (Osteospermum spinescens) or Osteospermum hyoseroides, microorganism such as fungi be Aspergillus (Aspergillus) for example, genus thraustochytrium, phytophthora, entomophthora belongs to, Mucor or genus mortierella, the for example latent rhabditida of bacterium such as Shiva Salmonella, yeast or animal such as nematode, insect, the frog, sea cucumber or fish.The separated nucleotide sequence of the present invention advantageously is derived from vertebrates purpose animal.Described nucleotide sequence preferably is derived from following guiding principle: the vertebrates guiding principle; Euteleostomi, spoke fin net-rope (Actinopterygii); New Actinopterygii (Neopterygii); Teleostei (Teleostei); Euteleostei, archipterygium fish catalogue (Protacanthopterygii), salmon shape order (Salmoniformes); Salmon section (Salmonidae) or Oncorhynchi belong to (Oncorhynchus) or vertebrates (Vertebrata), amphibia (Amphibia), the amphibious order of anury (Anura), Pipidae (Pipidae), xenopus or invertebrates (Evertebrata) be Protochordata (Protochordata) for example, Tunicata (Tunicata), Holothuroidea (Holothuroidea), Ascidian section (Cionidae) is Amarouciumconstellatum for example, Botryllus schlosseri, Ciona, Molgula citrina, Molgulamanhattensis, Perophora viridis or Styela partita.Described nucleic acid especially advantageously is derived from fungi, animal or plant-derived as algae or mosses, preferably be derived from salmon shape order such as salmon section, belong to as salmon, for example from genus and the kind of rainbow trout, Trutta trutta or Yadong salmon (Salmo trutta fario), be derived from algae such as Mantoniella or Ostreococcus, or be derived from diatom such as Thalassiosira or brown algae and belong to or be derived from algae such as Crypthecodinium cohnii belongs to.
In preferred embodiments, this method also comprises the step that obtains cell or whole plant, described cell or whole plant comprise the nucleotide sequence that is used for described method, its coded delta 6-desaturase, Δ 6-extend the nucleotide sequence that enzyme, Δ 5-desaturase and/or Δ-5-extends enzyme, with the nucleotide sequence of suitable time coding ω-3-desaturase and/or Δ-4-desaturase, wherein said cell and/or useful plant can also comprise other nucleotide sequences of lipid or fatty acid metabolism.These nucleotide sequences that are preferred for this method advantageously are incorporated into separately or with coding lipid acid or proteinic other nucleotide sequences combinations of lipid metabolism and are used at least a gene construct and/or the carrier expressing, and are transformed at last in cell or the plant.In another preferred embodiment, described method also comprises the step that obtains oil, lipid or free fatty acids from useful plant.The advantageously cell of oil-produced vegetable, vegetable plant, lettuce plant or ornamental plant, perhaps plant self, explanation as mentioned of the useful plant of cell of Chan Shenging or generation by this way by this way.
Growth refers to vegetable cell, tissue or organ in the cultivation on the substratum or in substratum, and perhaps whole strain plant is in matrix or on matrix, for example in nutrient solution, flowerpot soil or the cultivation on ploughing.
For the object of the invention, " genetically modified " or " reorganization " refers to about the nucleotide sequence that for example contains the nucleotide sequence that uses in the inventive method, expression cassette (=gene construct) or carrier, or with the nucleotide sequence that uses in the inventive method, expression cassette or carrier plant transformed, all that makes up by recombination method and produces, wherein
A) described nucleotide sequence, or
B) the Genetic Control sequence that effectively is connected with described nucleotide sequence, for example promotor, or c) (a) and (b)
In any one all no fix is in their natural genotypic environments or be changed by recombination method, change may be for example the substituting of one or more nucleotide residues, interpolation, disappearance, inversion or insertion.The nature genotypic environment refers to natural gene group in the original organism or the existence in chromosomal foci or the genomic library.Under the situation of genomic library, preferably keep the natural genotypic environment of nucleotide sequence to small part.Described environment is flaning nucleotide sequence and is having 50bp at least in one side at least, preferred 500bp at least, especially preferred 1000bp at least, the preferred very especially sequence length of 5000bp at least.When following expression cassette passes through non-natural, synthetic (" artificial ") method, when for example mutagenic treatment is changed, the naturally occurring combination of the nucleotide sequence of the natural promoter of the nucleotide sequence that uses in the inventive method of naturally occurring expression cassette-for example and coded protein (described protein has corresponding Δ 6-desaturase, Δ 6-extends enzyme, Δ 5-desaturase and Δ 5-elongase activity), advantageously have ω 3-desaturase and/or the active nucleic acid sequences to proteins combination of Δ 4-desaturase, become transgene expression cassette with coding.For example at US 5,565,350 or WO 00/15815 in suitable method has been described.
As above-mentioned, the transgenic plant that are used for the object of the invention mean the used nucleic acid of method and are not in their natural site in the genome of described plant, but this class nucleic acid homology or heterology ground are expressed.Yet as above-mentioned, even if transgenosis also means on the natural place that nucleic acid of the present invention is in the Plant Genome them, this sequence has been passed through modification with respect to native sequences, and/or the adjusting sequence of native sequences has been passed through modification.Transgenosis preferably refers to the expression of nucleic acid non-natural site in genome of using in the inventive method, and the homology that this nucleic acid has promptly taken place is expressed, or heterogenous expression preferably.
Preferred genetically modified organism is useful plant, as oil-produced vegetable, vegetable plant, romaine lettuce plant or ornamental plant, they all advantageously are selected from plant section, and it is selected from following section: Aceraceae (Aceraceae), Actinidiaceae (Actinidiaceae), Anacardiaceae (Anacardiaceae), umbelliferae (Apiaceae), Arecaceae (Arecaceae), composite family (Asteraceae), Arecaceae, Betulaceae (Betulaceae), Boraginaceae (Boraginaceae), Cruciferae (Brassicaceae), Bromelia family (Bromeliaceae), Cannabaceae (Cannabaceae), Cannaceae (Cannaceae), Caprifoliaceae (Caprifoliaceae), Chenopodiaceae (Chenopodiaceae), convolvulaceae (Convolvulaceae), Curcurbitaceae (Cucurbitaceae), Dioscoreaceae (Dioscoreaceae), Elaeangnaceae (Elaeagnaceae), Ericaceae (Ericaceae), Euphorbiaceae (Euphorbiaceae), pulse family (Fabaceae), Fagaceae (Fagaceae), gooseberry section (Grossulariaceae), Juglandaceae (Juglandaceae), Lauraceae (Lauraceae), Liliaceae (Liliaceae), flax family (Linaceae) (Linaceae), Malvaceae (Malvaceae), Moraceae (Moraceae), Musaceae (Musaceae), Oleaceae (Oleaceae), Oxalidaceae (Oxalidaceae), papaveracease (Papaveraceae), Gramineae (Poaceae), polygonaceae (Polygonaceae), Punicaceae (Punicaceae), the Rosaceae (Rosaceae), Rubiaceae (Rubiaceae), Rutaceae (Rutaceae), scrophulariaceae (Scrophulariaceae), Solanaceae (Solanaceae), Sterculiaceae (Sterculiaceae) and Valerianaceae (Valerianaceae).
The appropriate host plant that is used for nucleic acid, expression cassette or the carrier of the inventive method in principle and advantageously can synthetic fatty acid, particularly unsaturated fatty acids, perhaps is suitable for any useful plant of express recombinant gene.The example that can mention is plant such as Arabidopsis, composite family, as calendulin, and perhaps useful plant such as soybean, peanut, castor-oil plant, Sunflower Receptacle, corn, cotton, flax, oilseed rape, coconut, oil palm, safflower or cocoa beans.Other favourable plants are listed in the application's other places.
Microorganism is usually as the intermediate host who produces the transgenosis useful plant.This type of available intermediate host is at Goeddel, Gene Expression Technology:Methods in Enzymology185, and Academic Press, San Diego, CA is described in detail in (1990).
The expression strain that can be advantageously used in this purpose is that for example those have the bacterial strain than low protease activity.For example at Gottesman, S., Gene Expression Technology:Methods inEnzymology 185, Academic Press, San Diego has described them among California (1990) 119-128.
Comprise how unsaturated the inventive method synthetic is, the transgenic plant of longer chain fatty acid can advantageously be sold, do not need to separate synthetic oil, lipid or lipid acid.The sale particularly advantageous of this form.
For the object of the invention, " plant " is the material, plant tissue, germinal tissue of complete plant and all plant parts, plant organ or plant part such as leaf, stem, seed, root, stem tuber, flower pesticide, fiber, root hair, stem, embryo, callus, cotyledon, petiole, results and from actual transgenic plant and/or can be used for producing the cell cultures of transgenic plant.In this context, described seed comprises all parts of seed, as kind of a skin, epidermic cell, seed cell, endosperm or embryo tissue.
Yet the compound that produces in the inventive method also can separate from plant with the form of their oil, fat, lipid and/or free fatty acids.Can obtain the polyunsaturated fatty acid that the inventive method produces by results plant or vegetable cell from the culture of their growths or field.This can or extract plant part by squeezing, and the preferred plant seed carries out.In this article by so-called cold-drawn or cold pressing that to obtain oil, fat, lipid and/or free fatty acids under the situation of not having the heat input be possible.Open plant part in order to make, especially seed is easier, earlier with their crushing, steam treatment or baking.Can squeeze or extract with the pretreated seed of this mode with the hexane of solvent then as heating.And then remove described solvent.Separate in this mode that to be higher than the compound that the inventive method of 96% produces be possible.Further handle the product that obtains in this mode, i.e. refining then.This makes removes for example plant mucus and suspended substance at the very start.So-called desliming can take place or for example through enzymatic, by adding acid as phosphoric acid chemistry/physically generation.By using alkali, for example sodium hydroxide solution is handled and is removed free fatty acids then.Water thoroughly cleans the product that obtains and removes the alkali that remains in the product, and is dried.In order to remove the coloring material that still is present in the product, can bleach product with for example Fuller's earth or gac.At last, also for example with steam with the product deodorizing.
The PUFAs or the LCPUFAs that produce by this method are preferably C 20And/or C 22Fatty acid molecule, described molecule have at least 4 two keys in fatty acid molecule, preferred 5 or 6 two keys.These C 20And/or C 22Fatty acid molecule can separate from plant with the form of oil, lipid or free fatty acids.Suitable transgenic plant for example be above mentioned those.
Based on 100% and the plant total fatty acid content, these oil of the present invention, lipid or lipid acid advantageously comprise as above-mentioned, 6 to 15% palmitinic acid, 1 to 6% stearic acid in each case; 7 to 85% oleic acid; 0.5 the vaccenic acid to 8%, 0.1 to 1% eicosanoic acid, 7 to 25% saturated fatty acid, 8 to 85% monounsaturated fatty acids and 60 to 85% polyunsaturated fatty acid.
The useful polyunsaturated long-chain fatty acids that is present in fatty acid ester or fatty acid mixt such as phosphatidyl fatty acid ester or the triglyceride is preferably at least 10,11,12,13,14,15,16,17,18,19 or 20% timnodonic acid by weight based on total fatty acid content, and/or based on total fatty acid content, at least 1,2,3,4,5 or 6% clupanodonic acid by weight, and/or based on total fatty acid content, by weight at least 1,2,3; Preferably at least 4,5,6; Preferred especially at least 7 or 8 and at least 9 or 10% docosahexenoic acid most preferably.
Fatty acid ester or the fatty acid mixt that produces by the inventive method also comprises lipid acid, described lipid acid is selected from erucic acid (two dodecylenes-13 acid), sterculic acid (9,10-methylene radical Octadec-9-enoic Acid), malvalic acid (8,9-methylene radical 17 carbon-8-olefin(e) acid), hydnocarpylacetic acid (cyclopentenes dodecylic acid), furans lipid acid (9,12-epoxy Linolenic Acid, the 11-diolefinic acid), vernolic acid (9,10-epoxy 18 carbon-12-olefin(e) acid), tariric acid (6-octadecynoic acid), 6-19 carbyne acid, santalbic acid (anti-11-vaccenic acid-9-acetylenic acid), 6, the 9-santalbinic acid, pyrulic acid (anti-10-17 alkene-8-acetylenic acid), crepenyninic acid (9-octadecylene-12-acetylenic acid), 13,14-dihydro oropheic acid, 18 carbon-13-alkene-9, isomic acid, petroselenic acid (suitable-petroselinic acid), 9 is suitable, 12 anti--octadecadienoic acids, calendulin acid (8 anti-10 anti-12 suitable-punicic acid), Catalposide acid (9 anti-11 anti-13 suitable-punicic acid), Trichosanoic acid (9 along 11 anti-13 suitable-punicic acids), jacaric acid (8 along 10 anti-12 suitable-punicic acids), Trichosanoic acid (9 along 11 anti-13 suitable-punicic acids), wheat cake tree acid (9 along 11 anti-13 anti-15 suitable-therapic acids), Pinolenic acid (complete-suitable-5,9, the 12-punicic acid), laballenic acid (5,6-18 carbon diene allenolic acids), ricinolic acid (12-hydroxyoleic acid) and/or coriolin acid (13-hydroxyl-9 is suitable, 11 anti--octadecadienoic acids).Usually, above-mentioned lipid acid only advantageously is present in the fatty acid ester or fatty acid mixt of the inventive method generation with trace, the meaning is, based on total fatty acid content, their existence is lower than 30%, preferably be lower than 25%, 24%, 23%, 22% or 21%, especially preferably be lower than 20%, 15%, 10%, 9%, 8%, 7%, 6% or 5%, very especially preferably be lower than 4%, 3%, 2% or 1%.In the further preferred form of the present invention, the existence of these above-mentioned lipid acid based on total fatty acids be lower than 0.9%, 0.8%0.7%, 0.6% or 0.5%, especially preferably be lower than 0.4%, 0.3%, 0.2%, 0.1%.Based on total fatty acids, fatty acid ester that the inventive method produces or fatty acid mixt advantageously comprise and are lower than 0.1% and/or do not have butyric acid, cholesterol and nisinic acid (nisioic acid, a C23:6 Δ 3,8,12,15,18,21).
Other embodiment of the present invention is oil, lipid, lipid acid and/or the fatty acid composition purposes in feed, food, makeup or medicine that the inventive method produces.In the methods of the invention the oil of Huo Deing, lipid, lipid acid or fatty acid mixt can be used for other oil, lipid, lipid acid or the fatty acid mixt of animal-origin for example fish oil mix in the mode that the technician is familiar with.Produce and also can be used for the preparation of feed, food, makeup or medicine by these oil, lipid, lipid acid or fatty acid mixt that the plant and animal component is formed in this mode.
It is unsaturated and/or saturated that term " oil ", " lipid " or " fat " are interpreted as that finger comprises, the fatty acid mixt of preferred esterified fatty acid.Preferably, how unsaturated free or advantageously in the esterified fatty acid, content is very high in linolic acid, gamma-linolenic acid, dihomo-gamma-linolenic acid, arachidonic acid, alpha-linolenic acid, therapic acid, eicosatetraenoic acid, timnodonic acid, clupanodonic acid or docosahexenoic acid especially described oil, fat or lipid.Preferably, the amount of unsaturated esterification lipid acid is about 30%, especially preferably has 50% amount, and most preferably has 60%, 70%, 80% or higher amount.Can after being converted into methyl esters by transesterification, lipid acid measure the amount of lipid acid by gas-chromatography.Oil, lipid or fat can comprise multiple other saturated or unsaturated fatty acids, for example calendulin acid, palmitinic acid, Zoomeric acid, stearic acid, oleic acid etc.Particularly, the amount of multiple lipid acid can change according to original plant.
As above describe, advantageously have 3,4,5 or 6, the esters of polyunsaturated fatty acids that particularly advantageously has 5 or 6 two keys and preparation is in the method advantageously taked the form of fatty acid ester, for example, sphingolipid, phosphoglyceride, lipid ester, glycolipid, phosphatide ester, monoacylglycerol ester, diacylglycerol (DGDG), triglyceride or other fatty acid ester, preferred phosphatide ester and/or triglyceride.
From esters of polyunsaturated fatty acids (described esters of polyunsaturated fatty acids produce in the methods of the invention and advantageously have at least 3,4,5 or 6 two keys), existing polyunsaturated fatty acid is through for example KOH or the processing of the NaOH aqueous solution of alkali, perhaps advantageously in exist alcohol for example when methyl alcohol or ethanol through acid hydrolysis, perhaps discharge and by for example being separated and H for example subsequently through the enzyme cutting 2SO 4Acidification and separate.This class lipid acid also can need not treatment step described above and directly discharge.
Used nucleotide sequence in present method (described nucleic acid sequence encoding has the polypeptide of Δ 6-desaturase, Δ 6-extension enzyme, Δ 5-desaturase and/or Δ 5-elongase activity), randomly coding has the nucleotide sequence of ω 3-desaturase and/or the active polypeptide of Δ 4-desaturase, and/or the substrate of other used nucleotide sequence (as the nucleotide sequence of the polypeptide of coding lipid acid or lipid metabolism) is C 16-, C 18-or C 20-lipid acid, the polypeptide of described lipid acid or lipid metabolism is selected from: acyl group-coa dehydrogenase, acyl group ACP[=acyl carrier protein] desaturase, acyl group ACP thioesterase, fatty acid acyl based transferase, acyl group-coenzyme A: lysophospholipid acyltransferase, Fatty acid synthetase, fatty acid hydroxylase, ethanoyl coenzyme A carboxylase, ACOD, fatty acid desaturase, lipid acid acetylene series enzyme, lipoxygenase, triacylglycerol lipases, oxidation propadiene synthase, hydroperoxide lyase or fatty acid elongase.。Preferably, the lipid acid that transforms in present method is transformed with the form of their acyl-CoA esters and/or with their form of phosphatide ester as substrate.
In order to produce long-chain PUFAs of the present invention, according to substrate, at first must be with saturated, single unsaturated C 16-lipid acid and/or how unsaturated C 18-lipid acid is by the enzymatic activity desaturation and/or the extension of desaturase and/or extension enzyme, or only desaturation also extends at least 2 carbon atoms by extending enzyme subsequently.After the extension circulation, this enzymic activity causes from C 16-lipid acid begins to C 18-lipid acid or from C 18-lipid acid begins to C 20-lipid acid, and back two extension circulations from C 16-lipid acid begins to cause C 20-lipid acid.The activity of desaturase that uses in the inventive method or extension enzyme preferably causes C 20-and/or C 22-lipid acid advantageously has at least 2 or 3 two keys in fatty acid molecule, preferably have 4,5 or 6 two keys, especially preferably causes having in the fatty acid molecule C of at least 5 two keys 22-lipid acid.The special preferred product of the inventive method is timnodonic acid, clupanodonic acid and/or docosahexenoic acid.The C that has at least 2 two keys in the lipid acid 18-lipid acid can extend as the form of phosphatide, glycolipid, sphingolipid, phosphoglyceride, monoacylglycerol, DG or triacylglycerol by enzymatic activity of the present invention with the form of free fatty acids or with ester.
Lipid acid, oil, lipid or fat is the preferred biosynthesizing position cellular layer of seed or seed normally for example in the plant of favourable use, and it is significant therefore nucleic acid used in the method being carried out seed-specific expression.Yet obviously the biosynthesizing of lipid acid, oil or lipid needn't be defined in seed tissue, but also can for example carry out in the tissue specificity mode at epidermic cell or in stem tuber in all other parts of plant.Advantageously, take place by synthesizing in nutrition (somatocyte) tissue of the inventive method.
Because method of the present invention, the polyunsaturated fatty acid of generation can increase in the used plant of present method in principle in two ways.Advantageously, can increase the storehouse of the free polyunsaturated fatty acid that produces by present method and/or the amount of esterification polyunsaturated fatty acid.Advantageously, advantageously increase the storehouse of esterification polyunsaturated fatty acid in the transgenic plant with the form of phosphatidyl ester and/or three acyl esters by method of the present invention.
Sequence used in the inventive method is cloned in the expression construct individually or is provided to it on recombinant nucleic acid molecules of connection and is used for introducing and expressing at biology.These expression construct make the polyunsaturated fatty acid that produces in synthetic best the inventive method become possibility.
Nucleic acid used in present method can be positioned on the independent plasmid or advantageously is incorporated in the genome of host cell behind introduced plant or vegetable cell.Under the situation in being incorporated into genome, integration can be at random or take place by recombinating, the copy that makes natural gene be introduced into replaces, therefore regulate the generation of the compound of wanting by cell, or the use by cdna reverse, make described gene be connected on the function in the functional expression unit, described functional expression unit comprises at least a sequence that guarantees genetic expression and at least a sequence of assurance function open gene polyadenylation.By many expression cassettes or construct nucleotide sequence advantageously is incorporated into and is used for how parallel expression in the plant, promptly nucleotide sequence is present in the ceneme of connection.
The nucleotide sequence construct can comprise more than a kind of nucleotide sequence, and its coding has the polypeptide of Δ-12-desaturase, Δ-4-desaturase, Δ-5-desaturase, Δ-6-desaturase, Δ-5-extension enzyme, Δ-6-extension enzyme and/or ω-3-desaturase enzymatic activity.The nucleotide sequence that has a plurality of copies also is possible, and described nucleic acid sequence encoding has the polypeptide of Δ-12-desaturase, Δ-4-desaturase, Δ-5-desaturase, Δ-6-desaturase, Δ-5-extension enzyme, Δ-6-extension enzyme and/or ω-3-desaturase enzymatic activity.
For introducing, advantageously increase in known manner and connect nucleic acid used in present method.Preferably, then be the method for following Pfu archaeal dna polymerase or Pfu/Taq archaeal dna polymerase mixture scheme.Select primer according to sequence to be amplified.Primer should be selected easily by this way: amplicon comprises the entire coded sequence from the initiator codon to the terminator codon.After the amplification, analyze described amplicon easily.For example, can separate the analysis of carrying out quality and quantity by gel electrophoresis.After this, can come the purifying amplicon according to standard scheme (for example Qiagen).The aliquots containig of the amplicon of purifying can be used for clone's step subsequently then.Suitable cloning vector is normally known to the skilled.These specifically comprise the carrier that can duplicate in microflora, that is to say it mainly is to guarantee effective carrier of cloning and making possibility stable conversion plant in yeast or fungi.The carrier that must mention is the carrier system multiple double base and that integrate altogether that is suitable for the conversion of T-DNA-mediation.The examples of such carriers system is common to be characterised in that they comprise the required vir gene of agriculture bacillus mediated conversion at least and T-DNA-delimits sequence (T-DNA border).This class carrier system also advantageously comprises other cis regulation domain, and as promotor and terminator sequence and/or selective marker, by these cis regulation domains, the biology of suitable conversion can be identified by selective marker.Under the situation that is total to the integrative vector system, vir gene and T-DNA sequence are arranged in same vehicle, and double element system is at least based on two kinds of carriers, and wherein a kind of carrier has carried the vir gene but do not had T-DNA, and second kind of carrier carried T-DNA and do not had the vir gene simultaneously.Therefore mentioned back a kind of carrier is less relatively, operates easily and duplicates in intestinal bacteria (E.coli) He in the Agrobacterium.This class binary vector comprises the carrier from pBIB-HYG, pPZP, pBecks, pGreen series.According to the present invention, Bin19, pBI101, pBinAR, pGPTV and pCAMBIA preferably use.The summary of the purposes of binary vector and they can be at Hellens etc., finds among Trends in Plant Science (2000) 5, the 446-451.
In order to prepare carrier, carrier is at first with the restriction endonuclease linearizing and carry out enzyme modification according to suitable manner then.After this cmy vector and the carrier of a purifying is used to clone step.In clone's step, use the ligase enzyme enzyme cutting and the carrier segments clone of the amplified material of purifying and preparation in a similar manner as required.In the present context, concrete nucleic acid construct or carrier or plasmid construction body can have one or the coding gene fragment above.Coding property gene fragment preferably effectively is connected with the modulability sequence in these constructs.The modulability sequence especially comprises the plant sequence, as promotor and terminator.This class construct can be in microorganism, especially in intestinal bacteria and agrobacterium tumefaciens in stable propagation under the selective conditions and might in plant or microorganism, shift allogeneic dna sequence DNA.
Can advantageously use cloning vector that the nucleotide sequence that uses in the inventive method and nucleic acid construct are introduced in the microorganism then in the introduced plant, therefore and be used for Plant Transformation, as at PlantMolecular Biology and Biotechnology (CRC Press, Boca Raton, Florida), chapter 6/7, page or leaf 71-119 (1993); F.F.White, Vectors for Gene Transfer inHigher Plants; In Transgenic Plants, volume 1, Engineering and Utilization, editor: Kung and R.Wu, Academic Press, 1993,15-38; People Techniquesfor Gene Transfer such as B.Jenes, in:Transgenic Plants, volume 1, Engineering andUtilization, editor: Kung and R.Wu, Academic Press (1993), 128-143; Potrykus, those that announce among Annu.Rev.Plant Physiol.Plant Molec.Biol. (1991) 42:205-225 and quote therein.Therefore, the nucleic acid that uses in present method, nucleic acid construct and/or carrier can be used for the recombinant modified of wide range of types plant, make the latter become better and/or become more effective LCPUFA to produce the survivor.
Because Δ 6-desaturase, Δ 6-are extended enzyme, Δ 5-desaturase and Δ 5-elongase gene to be incorporated in the plant separately or with other assortment of genes; not only may increase biosynthesizing flow to end product, also may increase or from the beginning (de novo) produce corresponding triacylglycerol and/or phosphatidyl ester composition.Equally, can increase the quantity or the activity of other gene that participates in the nutrition input, described nutrition is that the biosynthesizing of one or more lipid acid, oil, polarity and/or neutral lipid is required, make in the cell or in the storage area concentration of these precursors, cofactor or intermediate raise, following thus description, the ability that cell produces PUFAs further strengthens.Participate in the active of biosynthetic one or more the Δ 6-desaturases of these compounds, Δ 6-extension enzyme, Δ 5-desaturase and/or Δ 5-elongase gene or increase its quantity by optimizing, perhaps improving from biology by the activity of destroying one or more genes that participate in these compounds of degraded is possible from lipid acid and the output in the lipid molecule, production and/or the production efficiency of plant advantageously also.
The nucleic acid molecule encoding protein that uses in the inventive method or its part, yet described protein or single protein or its part comprise aminoacid sequence, its with at sequence SEQ ID NO.65, SEQID NO.2, SEQ ID NO.172 or SEQ ID NO.52 and the aminoacid sequence of describing among SEQ ID NO.194 or the SEQ ID NO.78 suitably the time have enough homologys, make protein or its part still have Δ 6-desaturase, Δ 6-extends enzyme, Δ 5-desaturase and/or Δ 5-elongase activity and have Δ-4-desaturase and/or ω-3-desaturase activity suitably the time.By the protein of nucleic acid molecule/a plurality of nucleic acid molecule encodings or its part preferably still have its/they basic enzymatic activity and participate in the biology, advantageously stride the ability that these films carry out molecule transport to making up cytolemma or essential compound metabolism or the participation of liposome in the plant.Have at least about 60% and preferably at least about 70%, 80% or 90% by the protein of described nucleic acid molecule encoding and the aminoacid sequence of in SEQ ID NO.65, SEQ ID NO.2, SEQ ID NO.172, SEQ ID NO.52, SEQ ID NO.194 or SEQ ID NO.78, describing, and especially preferably at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity.Homology or homologous refer to identity or same in the context of the present invention.
In whole amino acid or nucleotide sequence district, calculate homology.For more different sequences, utilize a series of programs based on multiple algorithm.In this context, the algorithm of Needleman and Wunsch or Smith and Waterman provides result especially reliably.In order to carry out sequence alignment, service routine PileUp (J.Mol.Evolution., 25,351-360,1987, people such as Higgins, CABIOS, 5 1989:151-153) or program Gap and BestFit[Needleman and Wunsch (J.Mol.Biol.48; 443-453 (1970) and Smith and Waterman (Adv.Appl.Math.2; 482-489 (1981)], it is the part of GCG software package [Madison, Wisconsin, USA 53711 (1991) for Genetics ComputerGroup, 575 Science Drive].Being arranged on below service routine GAP uses determined the sequence homology data (representing with %) that provide above in the whole sequence district: the breach weight: 50, and the length weight: 3, average coupling: 10.000 and average mispairing: 0.000.Unless otherwise noted, these always are provided with and also are provided with as the sequence comparative standard.
The ω that uses in the method for the present invention-3-desaturase, Δ-6-desaturase, Δ-6-extends enzyme, Δ-5-extends enzyme, the basic enzymatic activity of Δ-4-desaturase and/or Δ-5-desaturase refers to, with by having SEQ ID NO.64, SEQ ID NO.1, SEQ ID NO.171, SEQ ID NO.51, the protein/enzyme of the sequence encoding of SEQ ID NO.193 or SEQ ID NO.77 is compared, they still have at least 10%, preferably at least 20%, especially preferably at least 30% and most preferably at least 40,50 or 60% enzymatic activity, and therefore can involved in plant or vegetable cell in synthetic fatty acid, the advantageously necessary compound metabolism of fatty acid ester such as phosphatidyl ester and/or triglyceride or participate in molecule and stride the film transportation.
The nucleic acid that is advantageously used in method can be derived from bacterium, fungi, diatom, animal belongs to or plant as latent rhabditida or Oncorhynchi, as algae or mosses, as Shiva Bordetella (Shewanella), the sword-like leave Rhodobryum, genus thraustochytrium, fusarium (Fusarium), phytophthora, angle tooth Rhodobryum, abnormal female corruption mould (Pytium irregulare), Mantoniella, Ostreococcus, Isochrysis galbana belongs to, Aleurita, Muscarioides, genus mortierella, the Borrago officinalis belongs to, brown algae belongs to, Crypthecodinium cohnii belongs to, and is especially mould from abnormal female corruption, rainbow trout, Africa xenopus, Ciona, false short hailian seaweed, Mantoniella squamata, Ostreococcus sp., Ostreococcus tauri, tiny Euglena, exhibition leaf sword-like leave moss, phytophthora infestans, Fusarium graminaeum, the Kou Shi Crypthecodinium cohnii, angle tooth moss (Ceratodon purpureus), Isochrysis galbana (Isocrydid galbana), Aleuritafarinosa, the kind of genus thraustochytrium, Muscarioides viallii, Mortierella alpina, the glass lettuce, Phaeodactylum tricornutum, genus of beautiful nematode and kind or especially advantageously mould from abnormal female corruption, thraustochytriale (Thraustochytrium sp.) and/or Ostreococcus tauri.
The nucleotide sequence that uses coded delta-12-desaturase, Δ-9-to extend enzyme or Δ-8-desaturase in addition in the methods of the invention is possible.The nucleotide sequence that uses in present method is advantageously introduced in the expression cassette, and described expression cassette makes the expression of nucleic acid in plant become possibility.
Coded delta-12-desaturase, ω-3-desaturase, Δ-9-is extended enzyme, Δ-6-desaturase, Δ-8-desaturase, Δ-6-to be extended nucleotide sequence that enzyme, Δ-5-desaturase, Δ-5-extend enzyme or Δ-4-desaturase and effectively is connected in one or more conditioning signals and improves genetic expression.These are regulated sequence and are intended to make the orientation expression of gene to become possibility.This for example can refer to that according to the difference of plant, gene is only expressed and/or crossed and express after inducing, or expresses and/or cross expression immediately.The sequence that is advantageously used in expression makes constitutive expression become possibility, as CaMV35S, CaMV36S, CaMV35Smas, no, mas, ubi, stpt, lea or Super promotor.Express and preferably to occur in as described above in the nutritive issue.In another preferred embodiment, described expression occurs in the seed.
These regulate sequences is for example inductor or repressor bonded sequence and therefore regulate expression of nucleic acids.Except not being connected to adjusting sequence on the nucleotide sequence at their natural gene seats, or replace these sequences, the natural adjusting of these sequences also can exist before the practical structures gene, and suitably the time by genetic modification, make natural adjusting be closed and improve genetic expression.Gene construct can additionally advantageously also comprise one or more functions and be connected to what is called " enhancer sequence " on the promotor, and it expresses the enhancing of nucleotide sequence becomes possibility.Extra favourable sequence also can be inserted into 3 ' end of dna sequence dna, as other regulatory element or terminator.Favourable terminator is for example viral terminator, as 35S terminator or other.The nucleotide sequence that uses in the inventive method may reside in the expression cassette (=gene construct) of one or more copies.Preferably, have only the gene of a copy to be present in each expression cassette.This gene construct or a plurality of gene construct can together be expressed simultaneously or in the continuous introduced plant and in host living beings.In this context, gene construct can be inserted in the one or more carriers and in cell and exist with free form, or also can be inserted in the genome.When gene to be expressed was present in the gene construct jointly, it was useful inserting other gene in plant.Yet the gene construct that will contain nucleotide sequence in each case is incorporated in the plant and also is possible with the plant phase mutual cross that obtains with the offspring who obtains to contain jointly all gene constructs.
In this context, regulate the sequence or the factor can, as above describe preferably the genetic expression of introducing gene had active effect, therefore strengthen its expression.Therefore, regulatory element advantageously the enhancing on transcriptional level can transcribe signal such as promotor and/or enhanser by force and take place by using.In addition, yet, also be possible for example by the stability enhancing translation that improves mRNA.
For guarantee biosynthesis gene at stable integration between number generation in transgenic plant, coded delta 6-desaturase, Δ 6-extend that enzyme, Δ 5-desaturase or Δ 5-extend enzyme and suitably the time ω 3-desaturase or Δ 4-desaturase and every kind of nucleotide sequence using in the method should under the control of promotor separately, express.This can be identical or different for every kind of sequence.In this context, construction expression box by this way advantageously: then be that suitable shearing site is used to nucleic acid to be expressed and inserts after the promotor, described shearing site is advantageously located in the polylinker.In the time of suitably, terminator can be positioned at the back of polylinker.This sequence repeats repeatedly, and preferred 3,4,5 or 6 times, therefore feasible can being combined in the construct up to 6 genes also be incorporated in the transgenic plant so that express.For the express nucleic acid sequence, nucleotide sequence inserts in the promotor back by the suitable cleavage site in the polylinker for example.Every kind of nucleotide sequence advantageously has the promotor of self and has the terminator of self as required.Yet still can be and before terminator, insert a plurality of nucleotide sequences as required in the promotor back.Here the insertion site of the nucleic acid that inserts or its sequence particularly important not in the expression cassette, that is to say nucleotide sequence can be in expression cassette at first position or the most last position insert and this position influences the expression of this nucleotide sequence indistinctively.In advantageous embodiment, different promotor for example USP, LegB4 or DC3 promotor can advantageously be used in expression cassette with different terminators.In further advantageous embodiment, also can use identical promotor such as CaMV35S promotor.
As previously discussed, transcribing of quiding gene should advantageously stop (after terminator codon) by the suitable terminator that is positioned at the biosynthesis gene 3 ' end that has imported.In the present context, can use the example of sequence is OCS1 or 35SCaMV terminator.As the situation of promotor, should use different terminator sequences to every kind of gene.
As previously discussed, gene construct also can comprise other gene in the desire importing biology.Importing in host plant and therefore expressing regulatory gene therein is possible and favourable as inductor, repressor or enzyme gene, and wherein these inductors, repressor or enzyme have participated in the adjusting of one or more genes in the biosynthetic pathway because of its activity.This class regulatory gene can be allos or homology.And other biosynthesis gene in lipid acid or the lipid metabolism can advantageously exist in nucleic acid construct or gene construct; Alternatively, these genes can also be present in one or more other nucleic acid constructs.Preferred lipid acid or the biosynthesis gene of selecting in the lipid metabolism is to be selected from ethylene reductase; acyl group ACP[=acyl carrier protein] desaturase; acyl group ACP thioesterase; the fatty acid acyl based transferase; acyl-CoA: lysophospholipid acyltransferase; fatty acid synthetase; fatty acid hydroxylase; ethanoyl coenzyme A carboxylase; ACOD; fatty acid desaturase; lipid acid acetylene series enzyme; lipoxygenase; triacylglycerol lipases; oxidation propadiene synthase; one or more genes of hydroperoxide lyase or fatty acid elongase or their combinations.Especially favourable nucleotide sequence is the biosynthesis gene in lipid acid or the lipid metabolism, and these biosynthesis genes are selected from acyl-CoA: lysophospholipid acyltransferase, Δ 8-desaturase, Δ 9-desaturase, Δ 12-desaturase and/or Δ 9-extend enzyme.
In the present context, above-mentioned nucleic acid or gene can extend enzyme and desaturase with other and be combined in the above-mentioned expression cassette clone and transform plant under Agrobacterium is assisted.
The term that uses in this specification sheets " carrier " refers to such nucleic acid molecule, and it can transport other nucleic acid of bonded with this nucleic acid molecule institute.A type of carrier is " plasmid ", can connect the circular double stranded DNA ring of extra dna fragmentation.Another type of carrier is a virus vector, might connect in the genome of this virus extra dna fragmentation.Some carrier can be in the host cell that imports these carriers self-replicating (bacteria carrier that for example has the bacterium replication origin).Other carrier is when advantageously integrating and therefore duplicate with host genome in the genome at host cell when host cell importing.And some carrier can be controlled the expression of gene that effectively is connected with these carriers.These carriers are called " expression vector " in the present context.Usually the expression vector that is applicable to the DNA recombinant technology has adopted the form of plasmid.In this manual because plasmid is the most frequently used carrier format, so " plasmid " and " carrier " commutative use.Yet the present invention also has covering the expression vector such as the virus vector of other form of similar functions.And term " carrier " also will comprise other carrier such as phage, viral as SV40, CMV, TMV, transposon, IS element, phasmid, phagemid, clay, linear or annular DNA that the technician knows.
The recombinant expression vector that advantageously uses in method comprises nucleotide sequence or the described gene construct according to present method use with the form that is suitable for used expression of nucleic acid in the host cell, be that described recombinant expression vector comprises based on selected one or more adjusting sequences of the host cell that is used to express, wherein this (class) regulated sequence and effectively is connected with the nucleotide sequence that will express.In recombinant expression vector, " effectively connect " to mean the purpose nucleotide sequence is connected in such a manner with the adjusting sequence, this nucleotide sequence is expressed and they are connected to each other and make this two classes sequence (for example in in-vitro transcription/translation system, if or carrier imported host cell, in host cell) all carried out the expectation function that belongs to this sequence.Term " adjusting sequence " is intended to comprise promotor, enhanser and other expression controlling elements (for example polyadenylation signal).These regulate sequence description in for example Goeddel:Gene Expression Technology:Methods in Enzymology 185, Academic Press, San Diego is in CA (1990) one books or referring to Gruber and Crosby, Methods in Plant Molecular Biology and Biotechnolgy, CRC Press, BocaRaton, Florida, Glick and Thompson write, Chapter 7, and 89-108 comprises the reference of wherein quoting.The adjusting sequence comprises those adjusting sequences of controlling the nucleotide sequence constitutive expression in polytype host cell and those control the adjusting sequence that nucleotide sequences are only directly expressed under specified conditions in specific host cell.The technician knows the responsible multiple factor of the design of expression vector, expresses degree and other factor as the selection of host cell to be transformed, proteinic purpose.
The recombinant expression vector used of designing institute is used for expressing the used nucleotide sequence of present method by this way: they can be transformed among the protokaryon intermediate host and behind the last introduced plant and make gene expression therein become possibility.Because simple, this is favourable, and the intermediate steps in the vector construction is carried out in the microorganism of being everlasting.For example, Δ-6-desaturase, Δ-6-extend enzyme, Δ-5-desaturase and/or Δ-5-elongase gene and can (see Romanos bacterial cell, insect cell (use rhabdovirus expression vector), yeast cell and other fungal cell, M.A., wait people (1992) Yeast 8:423-488; Van den Hondel, C.A.M.J.J. waits people (1991) " Heterologous gene expression infilamentous fungi ", in:More Gene Manipulations in Fungi, J.W.Bennet ﹠amp; L.L.Lasure, editor, page or leaf 396-428:Academic Press:San Diego; With van denHondel, C.A.M.J.J. ， ﹠amp; Punt, P.J. (1992) " Gene transfer systems and vectordevelopment for filamentous fungi; in:Applied Molecular Genetics ofFungi; Peberdy; J.F.; wait the people; editor, page or leaf 1-28, Cambridge University Press:Cambridge), algae (people (1999) Marine Biotechnology.1:(3 such as Falciatore): 239-251), use carrier to express in the ciliate according to the method for transformation of describing among the WO 98/01572, and preferably in the cell of metaphyte, express and (see Schmidt, R. and Willmitzer, L. (1988) " High efficiency Agrobacterium tumefaciens-mediatedtransformation of Arabidopsis thaliana leaf and cotyledon explants " PlantCell Rep.:538-586; Plant Molecular Biology and Biotechnology, C Press, Boca Raton, Florida, chapter 6/7, page or leaf 71-119 (1993); F.F.White, people such as B.Jenes, Techniques for Gene Transfer in Transgenic Plants, volume 1, Engineering andUtilization, editor: Kung and R.Wu, Academic Press (1993), 128-43; Potrykus (1991) Annu.Rev.Plant Physiol.Plant Molec.Biol.42:205-225 (with the reference of wherein quoting)).Appropriate host is at Goeddel, Gene ExpressionTechnology:Methods in Enzymology 185, Academic Press, San Diego, the host who further discusses among the CA (1990).Recombinant expression vector can or for example use the T7 promotor to regulate sequence and the T7 polysaccharase is transcribed and translated external.
Protein expression utilizes carrier to carry out usually in the prokaryotic organism, and described carrier comprises composing type or the inducible promoter that control is merged or non-fused protein is expressed.Typical fusion expression vector is pGEX (Pharmacia Biotech Inc especially; Smith, D.B. and Johnson, K.S. pMAL (New England Biolabs (1988) Gene67:31-40),, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ), wherein glutathione S-transferase (GST), maltose E-is conjugated protein and A albumen is fused to respectively on the target recombinant protein matter.
The example of the non-fusion coli expression carrier of suitable induction type especially is pTrc (Amann etc. (1988) Gene 69:301-315) and pET 11d (" GeneExpression Technology " 60-89 pages or leaves such as Studier of nineteen ninety California San Diego Academic Press press " Methods in Enzymology " 185).Target gene is based on host RNA polysaccharase transcribing from heterozygosis trp-lac promoter, fusion from the expression of pTrc carrier.Target gene is based on transcribing of T7-gn10-lac promoter, fusion that the viral rna polymerase (T7-gn1) through coexpression mediated from the expression of pET11d carrier.This viral rna polymerase is provided by the λ-prophage of settling down of host strain BL21 (DE3) or HMS174 (DE3), and the wherein said λ of settling down-prophage has been carried the T7 gn1 gene that is subjected to the control of lacUV 5 promoter transcriptions.
It is known for the technician to be suitable for procaryotic other carrier, these carriers are for example pLG338, pACYC184 in intestinal bacteria, pBR series is serial as pUC18 or pUC19, M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III113-B1, λ gt11 or pBdCI as pBR322, pUC, pIJ101, pIJ364, pIJ702 or pIJ361 in streptomyces, being among pUB110, pC194 or the pBD214 in genus bacillus, is pSA77 or pAJ667 in coryneform bacteria.
In another embodiment, expression vector is a Yeast expression carrier.The example that is used for the carrier that yeast saccharomyces cerevisiae expresses comprise pYeDesaturasec1 (Baldari etc. (1987) Embo J.6:229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz etc. (1987) Gene 54:113-123) and pYES2 (InvitrogenCorporation, San Diego, CA).Be used to make up " Applied Molecular Genetics of fungi " 1-28 page or leaf of the editors such as Cambridge University Press J.F.Peberdy that the carrier that is applicable to other fungi such as filamentous fungus and construction process be included in Cambridge University in 1991, van den Hondel, C.A.M.J.J; And Pun, P.J. those carriers described in detail and method in " Gene transfer systems and vector developmentfor filamentous fungi " or in " More Gene Manipulations in Fungi " [San Diego Academic Press J.W.Bennet of press and L.L.Lasure edit the 396-428 page or leaf].Other suitable yeast vector is for example pAG-1, YEp6, YEp13 and pEMBLYe23.
Perhaps, the nucleotide sequence that uses in the inventive method can use the rhabdovirus expression vector in expressed in insect cells.The rhabdovirus carrier that is used in marking protein in the insect cell (for example Sf9 cell) of cultivation comprises pAc series people (1983) Mol.Cell Biol.3:2156-2165 such as () Smith and pVL series (Lucklow and Summers (1989) Virology170:31-39).
Above-mentioned carrier only summary has been looked back the carrier that may be fit to.Other plasmid is to describe known to the technician and in for example " Cloning vector " (editors such as P.H., ISBN 0 444 904018 for Amster dawn-New York-Oxford Elsevier press in 1985, Pouwels).For other suitable protokaryon and eukaryotic expression system of being used for, see cold spring port, New York in 1989 ColdSpring Harbor Laboratory press, Sambrook, J., Fritsch, E.F. and Maniatis, " the Molecular Cloning:A Laboratory Manual " second edition the 16th of T. and the description in the 17th chapter.
The gene that uses in present method also can be expressed in one-celled plants cell (as algae), see people such as Falciatore (1999) Marine Biotechnology 1 (3): 239-251 and the reference of wherein quoting and in vegetable cell, express from higher plant (for example spermatophyte is as cultivating crop).The example of plant expression vector is included in Becker, D., Kemper, E., Schell, J. and Masterson, R. (1992) Plant Mol.Biol.20:1195-1197; And Bevan, M.W. (1984) Nucl.Acids Res.12:8711-8721; Vectors for Gene Transfer in HigherPlants; In:Transgenic Plants, volume 1, Engineering and Utilization, editor: Kung and R.Wu, Academic Press, 1993, those carriers of describing in detail among the page or leaf 15-38.
The expression of plants box preferably comprises the adjusting sequence, its in can the controlling plant cell genetic expression and effectively connect and make every kind of sequence can realize its function such as Transcription Termination, for example polyadenylation signal.Preferred polyadenylation signal is from those of agrobacterium tumefaciens T-DNA, gene 3 (people such as Gielen as Ti-plasmids pTiACH5, (1984) EMBO 835 et seq. J.3), it is known as the octopine synthetic enzyme, or its function equivalent, but all other terminators of functionally active also are fit in plant.
Because regulating, gene expression in plants is not limited to transcriptional level frequently, expression of plants box preferred package contains other sequence such as the translational enhancer of effective connection, for example super drive sequences, it strengthens tobacco mosaic virus (TMV) 5 '-untranslated leader, and it increases protein/RNA ratio people (1987) Nucl.Acids Research 15:8693-8711 such as () Gallie.
As above describe, gene expression in plants must effectively be connected with the suitable promotor that controlling gene is expressed.Advantageously available promotor is constitutive promoter (people such as Benfey, EMBOJ. (1989) 8:2195-2202), as from those of plant virus, as 35S CaMV (people (1980) Cell 21:285-294 such as Franck), 19S CaMV (also seeing US 5352605 and WO 84/02913), perhaps plant promoter, as US 4,962, the promotor of rubisco (Rubisco) small subunit of describing in 028.
Other preferred sequence that is used for functional cohesion in the gene expression in plants box is target sequencing row, it enters its suitable cellular compartment to the guiding gene product, and other compartment that for example enters vacuole, nucleus, all types of plastid such as amyloplast, chloroplast(id), chromoplast, ECS, plastosome, endoplasmic reticulum, oil body, peroxysome or vegetable cell is necessary; (see Kermode (1996) Crit.Rev.Plant Sci.15 (4): summary among the 284-423 and the reference of wherein quoting).
Carrier DNA can import in protokaryon and eukaryotic cell by the conversion or the rotaring dyeing technology of routine.Term " conversion " and " transfection ", joint and transduction as used in the present context, be intended to comprise the several different methods that is used in host cell, importing heterologous nucleic acids (as DNA) that this area crowd knows, comprise transfer, electroporation or particle bombardment that calcium phosphate or calcium chloride co-precipitation, the transfection of deae dextran mediation, lipofection, natural competence, chemistry mediate. is applicable to transform or transfection comprises that the method for the host cell of plant cell can find in " Methods in Molecular Biology " the 44th volume Gartland of Humana Press publishing house of (cold spring port, New York in 1989 Cold SpringHarbor Laboratory publishing house " Molecular Cloning:A Laboratory Manual " second editions) such as Sambrook and other laboratory manual such as the nineteen ninety-five Totowa of New Jersey and " Agrobacterium protocols " that Davey edits.
Term " nucleic acid (molecule) " additionally comprises the non-translated sequence that is positioned at encoding gene district 3 ' end and 5 ' end in advantageous embodiment as used herein: the sequence upstream at least 500 of coding region 5 ' end, preferred 200, the sequence downstream at least 100 of preferred especially 100 Nucleotide and encoding gene district 3 ' end, preferred 50, preferred especially 20 Nucleotide.Other nucleic acid molecule that exists in " isolating " nucleic acid molecule and this nucleic acid natural origin is separated." isolating " nucleic acid does not preferably have in the genomic dna of the biology in this nucleic acid source the sequence (for example being positioned the sequence of nucleic acid 5 ' and 3 ' end) at the natural flank of described nucleic acid.In multiple embodiments, isolating Δ-6-the desaturase that uses in present method, Δ-6-extend enzyme or Δ-5-desaturase and, ω-3-desaturase or Δ-4-desaturase molecule can for example comprise the nucleotide sequence that is less than about 5kb, 4kb, 3kb, 2kb, 1kb, 0.5kb or 0.1kb in the time of suitably, and it is at the natural flank of nucleic acid molecule described in the cell genomic dna in nucleic acid source.
The nucleic acid molecule that uses in present method can separate with sequence information provided herein by using molecular biological standard technique.For example identifying on DNA or amino acid levels under the help of comparison algorithm that homologous sequence or homology, conserved sequence district also are possible.These can be used as hybridization probe (for example people such as Sambrook in the standard hybridization technique, Molecular Cloning:ALaboratory Manual, second edition, Cold Spring Harbor Laboratory, ColdSpring Harbor Laboratory Press, Cold Spring Harbor, NY describes in 1989) be used for separating other nucleotide sequence that can be used for present method.The nucleic acid molecule that uses in present method or its part can be separated by the polymerase chain reaction in addition, use Oligonucleolide primers (nucleic acid molecule that for example comprises full sequence or its part can use Oligonucleolide primers to separate by the polymerase chain reaction, has made up described primer based on this identical sequence) in this case based on this sequence or its part.For example, can be from cell separating mRNA (for example by people such as Chirgwin (1979) Biochemistry 18:5294-5299 guanidine thiocyanate extraction method) and can be in ThermoScript II (for example from Gibco/BRL, the Moloney MLV ThermoScript II that Bethesda obtains, from SeikagakuAmerica, Inc., MD or AMV ThermoScript II that St.Petersburg, FL obtain) help preparation cDNA down.Make up the synthetic Oligonucleolide primers on the basis of one of sequence that can in SEQ ID NO.64, SEQ ID NO.1, SEQ ID NO.171, SEQ ID NO.51, SEQ ID NO.193 or SEQ ID NO.77, show or under the help of the aminoacid sequence that SEQ ID NO.65, SEQ ID NO.2, SEQ ID NO.172, SEQ ID NO.52, SEQ ID NO.194 or SEQ ID NO.78 describe and be used to pass through polymerase chain reaction (PCR) amplification.Can use cDNA or genomic dna as template and the suitable Oligonucleolide primers pcr amplification technology by the standard nucleic acid of the present invention that increases.The nucleic acid clone that increases in this mode can be characterized it in suitable carrier and by dna sequence analysis.Can for example use automatic dna synthesizer to prepare oligonucleotide by the synthetic method of standard.
Used have a sequence SEQ ID NO.64, SEQ ID NO.1, SEQ ID NO.171, SEQ ID NO.51, the Δ of SEQ ID NO.193 or SEQ ID NO.77-5-extends enzyme, ω-3-desaturase, Δ-6-desaturase, Δ-6-extends enzyme, the homologue of Δ-4-desaturase or Δ-5-desaturase nucleotide sequence is meant for example allelic variant, itself and SEQ ID NO.64,66, one of nucleotide sequence that shows in 68 or 70, with SEQ ID NO.1,3,5,7,9,11,13,15,17,19,21,23,25,27,29,31,33,35,37, one of nucleotide sequence that shows in 39 or 41, with SEQ ID NO.171,173,175,177,179, one of nucleotide sequence that shows in 181 or 183, with SEQ ID NO.51, one of nucleotide sequence that shows in 53 or 55, with one of nucleotide sequence that shows in SEQ ID NO.193 or 195 or with SEQ ID NO.77,79,81,83,85,87,89, one of nucleotide sequence that shows in 91 or 93, especially SEQID NO.64, SEQ ID NO.1, SEQ ID NO.171, SEQ ID NO.51, nucleotide sequence that shows among SEQ ID NO.193 or the SEQ ID NO.77 or their homologue, derivative or analogue or its part have at least about 40,50 or 60%, preferably at least about 60 or 70%, more preferably at least about 70 or 80%, 90% or 95% and even more preferably at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity or homology.What comprise equally is the isolated nucleic acid molecule of nucleotide sequence, described nucleic acid molecule for example under stringent condition with SEQ ID NO.64, SEQ ID NO.1, SEQ ID NO.171, SEQ ID NO.51, SEQ ID NO.193 or SEQ ID NO.77 in one of the nucleotide sequence that shows or its part hybridization.Part the present invention refer to aspect this at least 25 base pairs (=bp), 50bp, 75bp, 100bp, 125bp or 150bp, preferably 175bp, 200bp, 225bp, 250bp, 275bp or 300bp at least, preferred especially 350bp, 400bp, 450bp, 500bp or more base pairs are used for hybridization.It also may be useful using complete sequence.Allelic variant comprises in the specific function variant, its can be by the sequence described among SEQ ID NO.64, SEQ ID NO.1, SEQ ID NO.171, SEQ ID NO.51, SEQ ID NO.193 or the SEQ ID NO.77 disappearance, the insertion or substitute of Nucleotide obtain, but, kept the enzymic activity of encoded protein matter thus basically for insertion.
Can extend the homology that enzyme, Δ-4-desaturase and/or Δ-6-extends the enzymatic nucleic acid sequence with disclosed ω-3-desaturase herein, Δ-6-desaturase, Δ-5-desaturase, Δ-5-based on them, under the hybridization conditions of strictness separate the nucleic acid molecule that help the inventive method as hybridization probe with the standard hybridization technique with its part by using sequence.For example using the long isolated nucleic acid molecule of at least 15 Nucleotide aspect this and under stringent condition, be possible with the making nucleic acid molecular hybridization that comprises SEQ ID NO.64, SEQ ID NO.1, SEQ ID NO.171, SEQ ID NO.51, SEQ ID NO.193 or SEQ ID NO.77 nucleotide sequence.Use have at least 25,50,100,250 or more the nucleic acid molecule of polynucleotide also be possible.
Be intended to describe hybridization and wash conditions as the term " hybridize under stringent condition " that uses herein, at least 60% mutual homologous nucleotide sequence keeps hybridization together usually under the described conditions.Described condition optimization is for making at least about 65%, preferably at least about 70% and especially preferably at least about 75% or higher mutual homologous sequence keep hybridizing together condition usually.These stringent conditions are that the technician is known and can be at Current Protocols in Molecular Biology, John Wiley ﹠amp; Sons, N.Y. (1989) finds among the 6.3.1-6.3.6.The preferred limiting examples of stringent hybridization condition be the 6x sodium chloride/sodium citrate (=about 45 ℃ condition hybridization in SSC), then at 0.2 x SSC, one of 50 to 65 ℃ and more a plurality of washing step among 0.1% SDS.The technician knows that these hybridization conditions are different with for example there being organic solvent according to the type of nucleic acid, and is relevant with the concentration of temperature and damping fluid.Be to be between 42 ℃ to 58 ℃ in the aqueous buffer solution of 0.1 to 5 x SSC (pH7.2) according to the type of nucleic acid in concentration for example in the temperature under " standard hybridization conditions ".If organic solvent, for example 50% methane amide is present in the above-mentioned damping fluid, and the temperature under the standard conditions is about 42 ℃ so.The hybridization conditions of DNA:DNA hybrid molecule for example is preferably 0.1 x SSC and 20 ℃ to 45 ℃, preferred 30 ℃ to 45 ℃.The hybridization conditions of DNA:RNA hybrid molecule for example is preferably 0.1 x SSC and 30 ℃ to 55 ℃, preferred 45 ℃ to 55 ℃.For example, do not having to determine above-mentioned hybridization temperature under the condition of methane amide for the nucleic acid of G+C content with about 100bp (=base pair) length and 50%.The technician knows can be based on textbook such as above-mentioned textbook or from following textbook: people such as Sambrook, " Molecular Cloning ", Cold Spring Harbor Laboratory, 1989; Hames and Higgins (editor) 1985, " Nucleic Acids Hybridization:APractical Approach ", IRL Press at Oxford University Press, Oxford; Brown (editor) 1991, " Essential Molecular Biology:A Practical Approach ", how IRL Press at Oxford University Press determines necessary hybridization conditions among the Oxford.
In order to determine two seed amino acid sequences (SEQ ID NO.65 for example, SEQ ID NO.2, SEQID NO.172, SEQ ID NO.52, one of sequence of SEQ ID NO.194 or SEQ ID NO.78) or two kinds of nucleic acid (SEQ ID NO.64 for example, SEQ ID NO.1, SEQ ID NO.171, SEQ ID NO.51, SEQ ID NO.193 or SEQ ID NO.77) homology (=identity) per-cent, with described sequence write on another sequence following can compare their (for example, the room can be introduced in the sequence of protein or nucleic acid) best to produce the best comparison with another protein or nucleic acid.Then, amino acid group or the Nucleotide on more corresponding amino acid position or the nucleotide position.Occupied by identical amino acid group or identical Nucleotide as the correspondence position in the position in the infructescence and another sequence, so molecule on this position be homologous (promptly as amino acid used in this context or nucleic acid " homology " corresponding amino acid or nucleic acid " identity ").The per-cent of two kinds of homology between sequences is functions (being the total x100 of the number/position of homology=same position) of the total same position number of sequence.The program and the algorithm that are used for determining homology have been described in the above.
Can pass through to SEQ ID NO.64, SEQ ID NO.1, SEQ ID NO.171, SEQ IDNO.51, introduce one or more nucleotide substitutions in the nucleotide sequence of SEQ ID NO.193 or SEQ ID NO.77, add or disappearance generation coding ω-3-desaturase, Δ-6-desaturase, Δ-5-desaturase, Δ-5-extends enzyme, Δ-4-desaturase and/or Δ-6-extends the isolated nucleic acid molecule of enzyme, described ω-3-desaturase, Δ-6-desaturase, Δ-5-desaturase, Δ-5-extends enzyme, Δ-4-desaturase and/or Δ-6-extend enzyme be used for present method and with SEQ ID NO.65, SEQ ID NO.2, SEQ ID NO.172, SEQ ID NO.52, the protein sequence homology of SEQ ID NO.194 or SEQ ID NO.78 makes one or more amino acid replacements, add or lack and be introduced in the encoded protein matter.Sudden change can be introduced in one of SEQ ID NO.64, SEQ ID NO.1, SEQ ID NO.171, SEQ ID NO.51, SEQ ID NO.193 or SEQ ID NO.77 sequence by standard technique such as site-specific mutagenesis and PCR mediated mutagenesis.Conservative amino acid replacement preferably produces at the non-essential amino acid residue place of one or more predictions.In " conservative amino acid replacement ", the amino-acid residue that amino-acid residue is had similar side chain replaces.Defined amino-acid residue family in the art with similar side chain.These families comprise amino acid with basic side chain (Methionin for example, arginine, Histidine), the amino acid of acid side-chain (aspartic acid for example, L-glutamic acid), the amino acid of uncharged polar side chain (glycine for example, l-asparagine, glutamine, Serine, Threonine, tyrosine, halfcystine), the amino acid of non-polar sidechain (L-Ala for example, Xie Ansuan, leucine, Isoleucine, proline(Pro), phenylalanine, methionine(Met), tryptophane), β-branch side chain amino acid (Threonine for example, Xie Ansuan, Isoleucine) and the amino acid of aromatic series side chain (tyrosine for example, phenylalanine, tryptophane, Histidine).Extending the prediction non-essential amino acid residue that enzyme, Δ-4-desaturase and/or Δ-6-extends in the enzyme at ω-3-desaturase, Δ-6-desaturase, Δ-5-desaturase, Δ-5-is therefore preferably replaced by another amino-acid residue from identical side chain family.Another may be at ω-3-desaturase whole or part in another embodiment, Δ-6-desaturase, Δ-5-desaturase, Δ-5-extends enzyme, for example introduce sudden change at random in Δ-4-desaturase and/or Δ-6-extension enzyme encoding sequence scope by saturation mutagenesis, and can be to gained screening mutant ω described herein-3-desaturase, Δ-6-desaturase, Δ-5-desaturase, Δ-5-extends enzyme, Δ-4-desaturase or Δ-6-elongase activity is to identify mutant, and this mutant has kept ω-3-desaturase, Δ-6-desaturase, Δ-5-desaturase, Δ-5-extends enzyme, Δ-4-desaturase or Δ-6-elongase activity.Encoded protein matter can be recombinant expressed after mutagenesis, and activity of proteins can be for example by using assay method described herein to determine.
The present invention is more at large set forth by following examples, and it is not understood that to limit.With the content quotation of the patent application of all reference, patent application, patent and the announcement of quoting in the patent application as a reference.
Below table shown as the sequence identifier of use in the priority application in February 21 in 2006 (have German application number 102006008030.0) and the corresponding sequence identifier in this subsequent application.By the nucleotide sequence correspondence of the SEQ ID NO:1 of priority application sign for example by the nucleotide sequence of the SEQ ID NO:64 sign of subsequent application.
Sequence identifier concordance list in the sequence identifier of priority application and the subsequent application:
SEQ ID NO: priority application German application numbers 102006008030.0 SEQIDNO: this subsequent application Biological
1 64 Ostreococcus?tauri
2 65 Ostreococcus?tauri
3 1 Phytium?irregulare
4 2 Phytium?irregulare
5 171 Traustochytrium?sp.
6 172 Traustochytrium?sp.
7 51 Thraustochytriumssp.
8 52 Thraustochytriumssp.
9 193 Phytophthora infestans (Phytophthorainfestans)
10 194 Phytophthora infestans
11 77 Traustochytrium?sp.
12 78 Traustochytrium?sp.
13 109 Ostreococcus?tauri
n.a. 110 Ostreococcus?tauri
14 122 Ostreococcus?tauri
n.a. 123 Ostreococcus?tauri
15 143 Ostreococcus?tauri
16 144 Ostreococcus?tauri
17 161 Cauliflower mosaic virus
18 162 Cauliflower mosaic virus
19 163 False short hailian seaweed (Thalassiosirapseudonana)
20 164 False short hailian seaweed
Embodiment
Embodiment 1: general cloning process
The for example restricted cutting of cloning process, agarose gel electrophoresis, purifying DNA fragment, nucleic acid be transferred to nitrocellulose filter with nylon membrane, be connected the sequential analysis of dna fragmentation, transformed into escherichia coli cell, microbial culture and recombinant DNA according to (1989) such as Sambrook (Cold SpringHarbor Laboratory Press:ISBN 0-87969-309-6) enforcement of describing.
Embodiment 2: the sequential analysis of recombinant DNA
(Sanger etc. (1977) Proc.Natl.Acad.Sci.USA74, method 5463-5467) checks order recombinant DNA molecules according to Sanger with ABI laser fluorescence dna sequencing instrument.The fragment that obtains by polymerase chain reaction through order-checking and checking to avoid the polysaccharase deviation in the construct to be expressed.
Embodiment 3: clone gene from Ostreococcus tauri
Sequence conserved regions in Ostreococcus tauri sequence library (genome sequence) under every kind of situation of search is possible, and described sequence encoding has the protein of Δ-5-elongase activity or Δ-6-elongase activity.These are following sequences:
The gene title SEQ?ID Amino acid
OtELO1.1, (Δ-6-extends enzyme) SEQ?ID?NO.143 292
OtELO2.1, (Δ-5-extends enzyme) SEQ?ID?NO.109 300
OtElo2.1 with from extension enzyme (the GenBank AAN77156 of zebra fish (Danio rerio); About 26% identity) have the highest similarity, and OtElo1.1 with have the highest similarity (with tBLASTn algorithm compare people (1990) J.Mol.Biol.215:403-410 such as () Altschul) from sword-like leave Rhodobryum (Physcomitrella) extension enzyme (about 36% identity) (PSE).
Extend following the carrying out of clone of enzyme:
With 40ml be in the Ostreococcus tauri culture of stationary phase centrifugal and in 100 μ l distilled waters resuspension and be stored in-20 ℃.With the PCR method corresponding genomic dna that increases.Select corresponding primer to making them have the yeast consensus sequence (Kozak (1986) Cell 44:283-292) that is used for efficient translation on the initiator codon side.In each case, in the 50 μ l cumulative volumes that contain cell, 200 μ M dNTPs, 2.5U Taq polysaccharase and every kind of primer of 100pmol that 1 μ l thaws, carry out the amplification of OtElo DNA.The condition that is used for PCR is as follows: 95 ℃ of sex change for the first time 5 minutes, be that 94 ℃ 30 seconds, 55 ℃ 1 minute and 72 ℃ carried out 30 circulations and 72 ℃ of last extension steps of 10 minutes in 2 minutes subsequently.
Embodiment 4: from the optimization of Ostreococcus tauri elongase gene
As the separation described among the embodiment 3 extension enzyme from biological Ostreococcus tauri.For realizing the increase of C22 fatty acid content, the codon that sequence SEQ ID No.143 (Δ 6-extends enzyme) and SEQID No.109 (protein that coding is identified by SEQ ID No.110) (Δ 5-extends enzyme) are adapted in rape, flax and the soybean is selected.For this purpose, (it is SEQ ID NO.144 that Δ 6-extends enzyme Δ 6-to be extended the aminoacid sequence that enzyme and Δ 5-extend enzyme; It is SEQ ID NO.65 that Δ 5-extends enzyme) reverse translation to be to obtain the degeneracy dna sequence dna.Consider the natural frequency of single codon, (from Geneart, Regensburg) codon that these dna sequence dnas are adapted in rape, soybean and flax is selected by the GeneOptimizer program.In the external synthetic majorizing sequence that obtains with this method, it is pointed out in SEQ ID NO.64 (Δ 5-extends enzyme) and SEQ ID NO.122 (protein that coding SEQ IDNO.123 identifies) (Δ 6-extends enzyme).
Embodiment 5: the clonal expression plasmid is used for carrying out heterogenous expression at yeast
For characterizing through optimizing the function of nucleotide sequence, the open reading-frame (ORF) of each DNA is cloned into the semi-lactosi induction type GAL1 promotor downstream of pYES2.1/V5-His-TOPO (Invitrogen), obtains plasmid pOTE1.2 (comprise Δ 6-and extend enzyme sequence) and pOTE2.2 (comprising Δ 5-extension enzyme sequence).
Be cloned into the extension enzyme sequence general introduction among the yeast vector pYES2.1/V5-His-TOPO:
The gene title SEQ?ID Amino acid
POTE1.1, (Δ-6-extends enzyme) SEQ?ID?NO.143 292
POTE1.2, (Δ-6-extends enzyme) SEQ?ID?NO.122 292, the codon of optimization
POTE2.1, (Δ-5-extends enzyme) SEQ?ID?NO.109 300
POTE2.2, (Δ-5-extends enzyme) SEQ?ID?NO.64 300, the codon of optimization
By electroporation (1500V) with carrier pOTE1.2 and pOTE2.2 and comprise coded delta 6-respectively and extend comparison construct pOTE1.1 and the pOTE2.1 that enzyme and Δ 5-extend the natural acid sequence of enzyme Wine brewing yeast strain (Saccharomyces cerevisiae) 334 is transformed.The yeast that has transformed empty carrier pYES2 is with comparing.Containing 2% glucose but do not have and select the yeast that transforms on complete minimum medium (CMdum) agar plate of uridylic.After the selection, select three transformant in each case and be used for further functional expression.
Be to express Ot and extend enzyme, at first, contain 2% (w/v) raffinose with the transformant inoculation of screening in each case but do not have pre-culture that the 5ml CMdum liquid nutrient medium of uridylic forms and, 200rpm cultivation 2 days down at 30 ℃.Contain the 5mlCMdum liquid nutrient medium (no uridylic) of 2% raffinose to OD with pre-culture inoculation then 600Be 0.05.In addition, in each case, in the yeast culture of pOTE1.1 and pOTE1.2 conversion, add 0.2mM gamma-linolenic acid (GLA).Based on the activity of OtELO1.1, the expectation gamma-linolenic acid extends to 20:3 lipid acid.In the yeast culture of pOTE2.1 and pOTE2.2 conversion, add 0.2mM arachidonic acid and timnodonic acid respectively in each case.The activity of corresponding OtELO2.1, expectation lipid acid ARA and EPA extend to 22:4 and 22:5 lipid acid respectively.By adding 2% (w/v) semi-lactosi abduction delivering.Culture continues to cultivate 96 hours at 20 ℃.
Embodiment 6: the expression of OtELO2.2 in the yeast (as describing among the SEQ ID NO:64) and OtELO1.2 (in SEQ ID NO:122)
The yeast of analyzing as follows as in embodiment 5, transforming with plasmid pYES2, pOTE1.2 and pOTE2.1:
For removing residual substratum and lipid acid, from main culture, collect yeast cell and use 100mM NaHCO by centrifugal (100xg, 5 minutes, 20 ℃) 3, pH8.0 washs.From the yeast cell precipitation, prepare Fatty acid methyl ester (FAMEs) by the acidic methanol decomposition.For this purpose, with 2ml 1N vitriolic methanol solution (methanolic sulfuric acid) and 2% (v/v) Propanal dimethyl acetal 80 ℃ of incubation cell precipitations 1 hour.By extracting FAMEs with sherwood oil (PE) extracting twice.For removing not derived fatty acid, with 2ml 100mM NaHCO 3, pH8.0 and 2ml distilled water wash organic phase are respectively once.Use Na then 2SO 4Dry PE phase, evaporation and in 100 μ l PE, absorbing under argon gas.DB-23 capillary column (30m, 0.25mm, 0.25 μ m, Agilent) last sample separation at Hewlett-Packard 6850 gas chromatographs that have flame ionization detector.The GLC analysis condition is as follows: furnace temperature is set at 5 ℃ of/minute clock rate from 50 ℃ to 250 ℃ and finally 250 ℃ (maintenances) 10 minutes.
By utilizing relatively residence time identification signal of suitable lipid acid standard substance (Sigma).For example at Napier and Michaelson (2001) Lipids 36 (8): 761-766; People such as Sayanova (2001) Journal of Experimental Botany 52 (360): 1581-1585, people such as Sperling (2001) Arch.Biochem.Biophys.388 (2): people such as 293-298 and Michaelson (1998) FEBS Letters 439 (3): described this method among the 215-218.Analytical results has been described in table 1.
The suitable active of determining pOTE1.1/pOTE1.2 and pOTE2.1/2.2 is possible.Majorizing sequence (pOTE1.2 and pOTE2.2 respectively) all shows active in both cases.Than wild-type sequence, pOTE1.2 can only improve the synthetic of gamma-linolenic acid slightly.On the contrary, may observe active increase and specific change (table 1) surprisingly for pOTE2.2.Aspect this, the activity that EPA extends almost doubles, and the extension of ARA is above four times.Therefore under the situation of yeast moderate substrate, it is possible for 6 times that the optimization of using Δ 5-from Ostreococcus tauri to extend the sequence of enzyme increases DHA precursor output.
Embodiment 7: the clonal expression plasmid is used for the seed-specific expression of plant
Except as otherwise noted, general condition described below is applied to all subsequent experimental.
According to the present invention, pBin19, pBI101, pBinAR, pGPTV, pCAMBIA or pSUN are preferred for the following examples.The summary of binary vector and their purposes can be people such as Hellens, finds among Trends in Plant Science (2000) 5:446-451.Use pGPTV derivative as describing among the DE10205607.The difference of this carrier and pGPTV is extra AscI restriction enzyme cutting site of inserting.
The starting point of cloning process is cloning vector pUC19 (people such as Maniatis).In the first step, with following primer amplification conlinin promoter fragment:
Cnl1?C5’：
gaattcggcgcgccgagctcctcgagcaacggttccggcggtatagagttgggtaattcga
Cnl1?C3’：cccgggatcgatgccggcagatctccaccattttttggtggtgat
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
The PCR product earlier with restriction enzyme EcoRI 37 ℃ of incubations 2 hours, and then with Restriction enzyme Sma I 25 ℃ of incubations 12 hours.With the same manner incubation cloning vector pUC19.Subsequently, the carrier and the corresponding dna fragmentation of excision that separate PCR product and 2668bp cutting with agarose gel electrophoresis.With the specification sheets purify DNA of Qiagen gel-purified test kit (Qiagen Gel Purification Kit) by manufacturers.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche (Rapid Ligation Kit) is used for this purpose.Plasmid pUC19-Cnl1-C by the sequence verification acquisition.
In next step, use following primer from carrier pGPVT-USP/OCS (DE 102 05 607) amplification OCS terminator (Genbank Accession V00088; De Greve, H., wait people (1982) J.Mol.Appl.Genet.1 (6): 499-511):
OCS_C5’：aggcctccatggcctgctttaatgagatatgcgagacgcc
OCS_C3’：cccgggccggacaatcagtaaattgaacggag
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
The PCR product earlier with restriction enzyme StuI 37 ℃ of incubations 2 hours then with Restriction enzyme Sma I 25 ℃ of incubations 12 hours.Carrier pUC19-Cn11-C and Restriction enzyme Sma I were 25 ℃ of incubations 12 hours.Subsequently, also excise the dna fragmentation of correspondence with the carrier after agarose gel electrophoresis separation PCR product and the cutting.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1-C_OCS by the sequence verification acquisition.
In next step, pass through pcr amplification Cnl1-B promotor with following primer:
Cnl1-B5’：aggcctcaacggttccggcggtatag
Cnl1-B3’：cccggggttaacgctagcgggcccgatatcggatcccattttttggtggtgattggttct
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
The PCR product earlier with restriction enzyme StuI 37 ℃ of incubations 2 hours then with Restriction enzyme Sma I 25 ℃ of incubations 12 hours.Carrier pUC19-Cn11-C and Restriction enzyme Sma I were 25 ℃ of incubations 12 hours.Subsequently, also excise the dna fragmentation of correspondence with the carrier after agarose gel electrophoresis separation PCR product and the cutting.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1-C_Cn11B_OCS by the sequence verification acquisition.
In next step, insert the OCS terminator of Cnl1B.For this reason, carry out PCR with following primer:
OCS2?5’：aggcctcctgctttaatgagatatgcgagac
OCS2?3’：cccgggcggacaatcagtaaattgaacggag
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
The PCR product earlier with restriction enzyme StuI 37 ℃ of incubations 2 hours then with Restriction enzyme Sma I 25 ℃ of incubations 12 hours.Carrier pUC19-Cnl1C_Cnl1B_OCS and Restriction enzyme Sma I were 25 ℃ of incubations 12 hours.Subsequently, separate PCR product and cutting back carrier and the corresponding dna fragmentation of excision with agarose gel electrophoresis.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1-C_Cnl1B_OCS2 by the sequence verification acquisition.
In next step, pass through pcr amplification Cnl1-A promotor with following primer:
Cnl1-B5’：aggcctcaacggttccggcggtatagag
Cnl1-B3’：aggccttctagactgcaggcggccgcccgcattttttggtggtgattggt
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
PCR product and restriction enzyme StuI were 37 ℃ of incubations 2 hours.Carrier pUC19-Cnl1-C and Restriction enzyme Sma I were 25 ℃ of incubations 12 hours.Subsequently, separate PCR product and cutting back carrier and the corresponding dna fragmentation of excision with agarose gel electrophoresis.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1C_Cnl1B_Cnl1A_OCS2 by the sequence verification acquisition.
In next step, insert the OCS terminator of Cnl1A.For this reason, carry out PCR with following primer:
OCS2?5’：ggcctcctgctttaatgagatatgcga
OCS2?3’：aagcttggcgcgccgagctcgtcgacggacaatcagtaaattgaacggaga
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
The PCR product earlier with restriction enzyme StuI 37 ℃ of incubations 2 hours then with restriction enzyme HindIII 37 ℃ of incubations 2 hours.Carrier pUC19-Cnl1C_Cnl1B_Cnl1A_OCS2 and restriction enzyme StuI 37 ℃ of incubations 2 hours and with restriction enzyme HindIII 37 ℃ of incubations 2 hours.Subsequently, also excise the dna fragmentation of correspondence with the carrier after agarose gel electrophoresis separation PCR product and the cutting.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1-C_Cnl1B_Cnl1A_OCS3 by the sequence verification acquisition.
In next step, plasmid pUC19-Cnl1C_Cnl1B_Cnl1A_OCS3 is used to clone Δ 6-, Δ 5-desaturase and Δ 6-and extends enzyme.For this reason, with following PCR primer amplification Phytium irregulare
Δ 6-desaturase (WO02/26946):
D6Des(Pir)5’：agatctatggtggacctcaagcctggagtg
D6Des(Pir)3’：ccatggcccgggttacatcgctgggaactcggtgat
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
The PCR product earlier with restriction enzyme BglII 37 ℃ of incubations 2 hours then with restriction enzyme NcoI 37 ℃ of incubations 2 hours.Carrier pUC19-Cnl1C_Cnl1B_Cnl1A_OCS3 and restriction enzyme BglII 37 ℃ of incubations 2 hours and with restriction enzyme NcoI 37 ℃ of incubations 2 hours.Subsequently, separate PCR product and cutting back carrier and the corresponding dna fragmentation of excision with agarose gel electrophoresis.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1_d6Des (Pir) by the sequence verification acquisition.
In next step, plasmid pUC19-Cnl1_d6Des (Pir) is used to clone Thraustochytrium ssp. Δ 5-desaturase (WO02/26946).For this reason, with following PCR primer amplification thraustochytriale (Thraustochytrium ssp.) Δ 5-desaturase:
D5Des(Tc)5’：gggatccatgggcaagggcagcgagggccg
D5Des(Tc)3’：ggcgccgacaccaagaagcaggactgagatatc
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
The PCR product earlier with restriction enzyme BamHI 37 ℃ of incubations 2 hours then with restriction enzyme EcoRV 37 ℃ of incubations 2 hours.Carrier pUC19-Cnl1_d6Des (Pir) and restriction enzyme BamHI 37 ℃ of incubations 2 hours and with restriction enzyme EcoRV 37 ℃ of incubations 2 hours.Subsequently, separate PCR product and cutting back carrier and the corresponding dna fragmentation of excision with agarose gel electrophoresis.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) by the sequence verification acquisition.
In next step, plasmid pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) is used for clone exhibition leaf sword-like leave moss (Physcomitrella patens) Δ 6-and extends enzyme (WO01/59128), for this purpose, and with the following PCR primer amplification latter:
D6Elo(Pp)5’：gcggccgcatggaggtcgtggagagattctacggtg
D6Elo(Pp)3’：gcaaaagggagctaaaactgagtgatctaga
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
The PCR product earlier with restriction enzyme NotI 37 ℃ of incubations 2 hours then with restriction enzyme XbaI 37 ℃ of incubations 2 hours.Carrier pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) and restriction enzyme NotI 37 ℃ of incubations 2 hours and with restriction enzyme XbaI 37 ℃ of incubations 2 hours.Subsequently, separate PCR product and cutting back carrier and the corresponding dna fragmentation of excision with agarose gel electrophoresis.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) by the sequence verification acquisition.
Begin to prepare the binary vector that is used for Plant Transformation by pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp).For this reason, pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) and restriction enzyme A scI were 37 ℃ of incubations 2 hours.Handle carrier pGPTV with the same manner.Subsequently, separate and excise the dna fragmentation of correspondence with agarose gel electrophoresis from the pGPTV carrier after the fragment of pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) and the cutting.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pGPTV-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) by the sequence verification acquisition.
Use further construct pGPTV-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) _ D12Des (Co).For this reason, begin to increase by pUC19-Cnl1C_OCS with following primer:
Cnl1_OCS?5’：gtcgatcaacggttccggcggtatagagttg
Cnl1_OCS?3’：gtcgatcggacaatcagtaaattgaacggaga
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
PCR product and restriction enzyme SalI were 37 ℃ of incubations 2 hours.Carrier pUC19 and restriction enzyme SalI were 37 ℃ of incubations 2 hours.Subsequently, the PCR product separates and excises the dna fragmentation of correspondence with cutting back carrier with agarose gel electrophoresis.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1_OCS by the sequence verification acquisition.
In next step, mary bush (Calendula officinalis) Δ 12-delta 8 desaturase genes (WO01/85968) is cloned among the pUC19-Cnl1_OCS.For this reason, with following primer amplification d12Des (Co):
D12Des(Co)5’：agatctatgggtgcaggcggtcgaatgc
D12Des(Co)3’：ccatggttaaatcttattacgatacc
The composition of PCR mixture (50 μ l):
5.00 μ l template cDNA
5.00 μ l 10x damping fluid (Advantage polysaccharase)+25mM MgCl 2
5.00μl?2mM?dNTP
1.25 every kind of primer of μ l (10pmol/ μ l)
0.50 μ l Advantage polysaccharase (Clontech)
The PCR reaction conditions:
Annealing temperature: 1 minute 55 ℃
Denaturation temperature: 1 minute 94 ℃
Elongating temperature: 2 minutes 72 ℃
Cycle number: 35
PCR product and restriction enzyme BglII 37 ℃ of incubations 2 hours then with restriction enzyme NcoI 37 ℃ of incubations 2 hours.With the same manner incubation carrier pUC19-Cnl1_OCS.Subsequently, separate PCR fragment and cutting back carrier and the corresponding dna fragmentation of excision with agarose gel electrophoresis.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1_D12Des (Co) by the sequence verification acquisition.
Plasmid pUC19-Cnl1_D12Des (Co) and plasmid pUC19Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) and restriction enzyme SalI were 37 ℃ of incubations 2 hours.Subsequently, with agarose gel electrophoresis carrier of separating fragment and cutting back carrier and the corresponding dna fragmentation of excision.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and and carrier segments.The quick connection test kit of Roche is used for this purpose.Plasmid pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) _ D12Des (Co) by the sequence verification acquisition.
Begin to prepare the binary vector that is used for Plant Transformation by pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) _ D12Des (Co).For this reason, pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) _ D12Des (Co) and restriction enzyme A scI were 37 ℃ of incubations 2 hours.Handle carrier pGPTV with the same manner.Subsequently, fragment and the pGPTV carrier after the cutting that separates from pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) _ D12Des (Co) with agarose gel electrophoresis also excises corresponding dna fragmentation.Press the manufacturer specification purify DNA with Qiagen gel-purified test kit.Subsequently, connection carrier and PCR product.The quick connection test kit of Roche is used for this purpose.Plasmid pGPTV-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) _ D12Des (Co) by the sequence verification acquisition.
Other embodiment of seed-specific expression construct purposes is the Napin promotor.In people such as Wu (2005) Nat.Biotech.23:1013-1017, described and prepared these expression construct with carrier pGPTV or pSUN.
Another carrier that is fit to Plant Transformation is pSUN2.For the expression cassette number that exists in the carrier is increased to more than four, (Invitrogen Karlsruhe) is used in combination for this carrier and Gateway system.For this reason, following description is inserted carrier pSUN2 according to the specification sheets of manufacturers with Gateway A box:
PSUN2 carrier (1 μ g) and restriction enzyme EcoRV were 37 ℃ of incubations 1 hour.Use then from Roche, (Invitrogen Karlsruhe) is connected in the carrier after the cutting the quick connection test kit of Mannheim with Gateway A box.To obtain plasmid is transformed in the intestinal bacteria DB3.1 cell (Invitrogen).Then by the isolating plasmid pSUN-GW of sequence verification.
In second step, downcut expression cassette and be connected to the carrier pSUN-GW of same processing from pUC19-Cnl1_d6Des (Pir) _ d5Des (Tc) _ D6Elo (Pp) _ D12Des (Co) with AscI.The plasmid pSUN-4G that obtains in this mode is used for other gene construct.
For this purpose, at first modify the pENTR clone according to manufacturer specification (Invitrogen).Plasmid pENTR1A (Invitrogen) and restriction enzyme EcoRI used Klenow enzyme and 1 μ M dNTP mixture process in 1 hour 30 minutes then at 37 ℃ of incubations, and subsequently with AscI joint (5 '-ggcgcgcc; 5 ' end phosphorylation, two strands) be connected in the pENTR1A carrier.Describe that as above gene progressively is inserted in the Cnl box of these modifications and enters the pENTR carrier by the AscI transfer, obtain the pENTR-Cnl carrier.
In next step, preparation pSUN-8G construct.For this purpose, generation has 5 ' and the 3 ' primer (it contains preceding 20 and last in each case 20 Nucleotide of restricted as described above cleavage site and open reading-frame (ORF)) of SEQ ID NOs:1,3,5 and 7 gene, and increase and be connected in the pENTR-Cnl carrier with standard conditions (on seeing), it carries out recombining reaction according to manufacturer specification and pSUN-4G carrier subsequently.
With this mode prepare construct pSUN-8G and be transformed into leaf mustard (Brassica juncea) and colea (Brassica napus) in.Seed by the gas chromatographic analysis transgenic plant.
Another construct that is used for the conversion of leaf mustard and colea is construct pSUN-9G.Prepare this construct with rapeseed protein (napin) promotor according to people such as Wu (2005) Nat.Biotech.23:1013-1017.In people such as Wu 2005 amending method, the encoding sequence that inserts OtELO2.2 with described mode replaces gene OmELO.Then the construct pSUN-9G that obtains is transformed in leaf mustard and the colea.
Embodiment 8: extract lipid from vegetable material
By conditions suitable (describing for example) down the modified plant of growth and the analyzing substratum and/or the cellular constituent that are used for improving purpose product (being lipid or lipid acid) output can determine of the influence of plant genetic modification to purpose compound (as lipid acid) output.These analytical technologies for the technician known and comprise spectroscopy, thin layer chromatography, polytype dyeing process, zymetology and micro-biological process and analytical chromatography for example high performance liquid chromatography (see, for example, Ullman, Encyclopedia of Industrial Chemistry, volume A2, page or leaf 89-90 and page or leaf 443-613, VCH:Weinheim (1985); FallonA. wait people (1987) " Applications of HPLC inBiochemistry " in:Laboratory Techniques in Biochemistry and MolecularBiology, volume 17; People such as Rehm (1993) Biotechnology, volume 3, chapter III: " Productrecovery and purification ", page or leaf 469-714, VCH:Weinheim; Belter, people such as P.A. (1988) Bioseparations:downstream processing for Biotechnology, JohnWiley and Sons; Kennedy, J.F. and Cabral, J.M.S. (1992) Recovery processesfor biological Materials, John Wiley and Sons; Shaeiwitz, J.A. and Henry, J.D. (1988) Biochemical Separations, in:Ullmann ' s Encyclopedia of IndustrialChemistry, volume B3; Chapter 11, page or leaf 1-27, VCH:Weinheim; And Dechow, F.J. (1989) Separation and purification techniques in biotechnology, NoyesPublications)
Except above mentioned method, as people such as Cahoon (1999) Proc.Natl.Acad.Sci.USA 96 (22): people such as 12935-12940 and Browse (1986) Analytic Biochemistry152:141-145 describes extracts plant lipid from vegetable material.Christie, William W., Advances in Lipid Methodology, Ayr/Scotland:Oily Press (Oily PressLipid Library; 2); Christie, William W., Gas Chromatography and Lipids.A Practical Guide-Ayr, Scotland:Oily Press, 1989, Repr.1992, IX, 307pp. (Oily Press Lipid Library; 1); " Progress in Lipid Research; Oxford:Pergamon Press, 1 (1952)-16 (1977) under the title:Progress in theChemistry of Fats and Other Lipids CODEN has described the qualitative and quantitative analysis of lipid or lipid acid.
Except the end product of measuring fermentation, other composition that also can analyze the pathways metabolism that is used for producing the purpose compound for example intermediate and by product to measure the gross production efficiency of this compound.Analytical procedure comprises the amount of measuring nutrition (for example sugar, carbohydrate, nitrogenous source, phosphoric acid salt and other ion) in the substratum, measure the composition and the growth of biomass, analyze the generation of the conventional metabolite in the biosynthetic pathway and measure the gas that is produced between yeast phase." the Applied MicrobialPhysiology that the standard method that is used for these measurements is edited at the IRL Press P.M.Rhodes of press and P.F.Stanbury; A Practical Approach " describe in 103-129 page or leaf, 131-163 page or leaf and 165-192 page or leaf (ISBN:0199635773) and the reference of wherein being quoted.
The example of an analysis is analysis (shortenings: FAME, the fatty acid methyl ester of lipid acid; GC-MS, gas-liquid chromatograph/mass spectrum; TAG, triacylglycerol; TLC, thin-layer chromatography).
Can be as Christie and wherein reference (119-169 page or leaf among " the Advances on Lipid Methodology " of the Oily Press Christie of press of Dundee in 1997 the 4th edition; Gaschromatographie-Massenspektrometrie-Verfahren[GasChro matography/mass spectrometric methods in 1998], Lipide 33:343-353) for several times as described in operational analysis standard method: GC, GC-MS or TLC by analyzing the biological clear existence that inerrably detects fatty acids products of reorganization.
The material that desire is analyzed can pass through grinding in supersound process, the glass mill, liquid nitrogen and grinding or by the in addition fragmentation of other available method.This material must be centrifugal after fragmentation.Resuspended precipitation in distilled water, 100 ℃ of heating 10 minutes, cooled on ice and recentrifuge, then in the methanol solution that contains 0.5M sulfuric acid and 2% Propanal dimethyl acetal 90 ℃ extracted 1 hour, produce the oil and the lipoid substance of hydrolysis thus, produced the lipid of transmethylaseization.These fatty acid methyl esters extract in sherwood oil and are last by using capillary column (Chrompack, WCOT Fused Silica, CP-Wax-52 CB, 25 μ m 0.32mm) keep through the thermograde between 20 minutes 170 ℃ to 240 ℃ and at 240 ℃ and carried out GC in 5 minutes and analyze.The identity of the fatty acid methyl ester that obtains must be used and can determine from the standard substance (being Sigma) that commercial source obtains.
At first by travelling to and fro between mechanically homogenate vegetable material extraction between pestle and the mortar so that it is more convenient for.
100 ℃ were heated 10 minutes and recentrifuge after cooled on ice subsequently.Cell precipitation is with 1M vitriolic methanol solution (methanolic sulfuric acid) and 90 ℃ of hydrolysis of 2% Propanal dimethyl acetal one hour and with the lipid transmethylaseization.The fatty acid methyl ester that obtains (FAME) extracting in sherwood oil.The FAME that is extracted by use capillary column (Chrompack, WCOT FusedSilica, CP-Wax-52 CB, 25 μ m, gas-liquid chromatograph 0.32mm) is kept through the thermograde between 20 minutes 170 ℃ to 240 ℃ and at 240 ℃ and was analyzed in 5 minutes.The identity of fatty acid methyl ester by with the relatively affirmation of corresponding FAME standard substance (Sigma).The identity of two keys and position are by making the FAME mixture suitably chemically derived for example to produce 4, and 4-Er Jia Yang oxazoline derivative (Christie, 1998) is further analyzed through GC-MS.
Embodiment 9: the Δ 5-from the optimization of Ostreococcus tauri extends the purposes that enzyme (as describing among the SEQ ID NO:64) is used for the constitutive expression construct
Generation is used for Plant Transformation based on the conversion carrier of pGPTV-35S with based on the plasmid of pBIN19-35S (Bevan M. (1984) Nucl.Acids Res.18:203).For this purpose, at first will be by promoter element CaMV35S (SEQ ID No.161) and 35S terminator (SEQ ID NO.162; Franck, people such as A. (1980) Cell 21 (1): 285-294) expression cassette of Zu Chenging is assembled in the pUC carrier.This need be through the promotor of the restricted cleavage site insertion of SalI/XbaI and the terminator that inserts through the restricted cleavage site of BamHI/SmaI.In addition, the polylinker that has an XhoI cleavage site is connected to (three reconnect) on the terminator.The plasmid pUC19-35S that obtains is used to clone the PUFA gene then.Abreast, the open reading-frame (ORF) of Δ 6-desaturase (SEQ ID NO.1), Δ 5-desaturase (SEQ ID NO.51) and Δ 6-extension enzyme (SEQ ID NO.171) sequence is inserted into the pUC19-35S carrier through the EcoRV cleavage site.Plasmid pUC-D6, the pUC-D5 that obtains, pUC-E6 (Tc) are used to make up binary vector pGPTV-35S_D6D5E6 (Tc).For this purpose, with enzyme SalI digested vector pGPTV,, and connect correct fragment with SalI/XhoI digested plasmid pUC-D6.The plasmid pGPTV-D6 that obtains with SalI digestion with SalI/XhoI digested plasmid pUC-D5, and connects correct fragment subsequently.And then obtain plasmid pGPTV-D6-D5 once with SalI digestion institute, with SalI/XhoI digested plasmid pUC-E6 (Tc), and connect correct fragment.These successive clone step generates binary vector pGPTV-D6D5E6 (Tc), and it is used for transforming.
In next step, the sequence of d6Elo (Tp) (SEQ ID NO.163) replaces d6Elo (Tc) sequence to be inserted among the carrier pUC19-35S.The plasmid pUC-E6 that obtains of institute (Tp) is used to prepare binary vector pGPTV-35S_D6D5E6 (Tp).
In next step, the open reading-frame (ORF) of ω 3Des (SEQ ID NO.193) is cloned among the pUC19-35S.The plasmid pUC-ω 3Pi that obtains is transferred to binary vector pGPTV-D6D5E6 (Tc) and pGPTV-D6D5E6 (Tp) through SalI/XhoI.The carrier pGPTV-D6D5E6 that obtains (Tc) ω 3Pi of institute and pGPTV-D6D5E6 (Tp) ω 3Pi are used for Plant Transformation.
In next step, will extend the open reading-frame (ORF) (SEQ ID No.64) of enzyme and be cloned among the pUC19-35S from the optimization Δ 5-of Ostreococcus tauri from the open reading-frame (ORF) (SEQ ID No.77) of the Δ 4-desaturase of thraustochytriale.Obtaining plasmid pUC-E5 and pUC-D4 are transferred among carrier pGPTV-D6D5E6 (Tp) the ω 3Pi by SalI/XhoI according to top narration.The carrier pGPTV-D6D5E6 that obtains (Tp) the ω 3PiE5D4 of institute is used for Plant Transformation.
According to manufacturer's specification sheets all binary vectors are transformed in the e.colidh5 (Invitrogen).Identify positive colony and isolated plasmid dna (QiagenDneasy) by PCR.
Embodiment 10: the composing type binary vector is to the conversion of plant
A) generation of transgenic plant colea and leaf mustard.Use rape Plant Transformation scheme people (1992) Plant Cell Reports 8:238-242 such as (improve one's methods) Moloney.
Binary vector pGPTV-D6D5E6 (Tp) ω 3PiE5D4 is transformed into (people (1984) Nucl.Acids.Res.13:4777-4788 such as Deblaere) among the agrobacterium tumefaciens C58C1:pGV2260.The overnight culture of the positive Agrobacterium bacterium colony that transforms is used to transform Orychophragmus violaceus (Orychophragmusviolaceus) after the 1:50 dilution in being added with the Murashige-Skoog substratum of 3% sucrose (Murashige and Skoog (1962) Physiol.Plant.15:473) (3MS substratum).Petiole or hypocotyl (about in each case 1cm of the new germ-free plant of sprouting 2) in culture dish with the Agrobacterium dilution incubation of 1:50 5-10 minute.In 25 ℃ of dark, cultivated altogether 3 days being added with on the 3MS substratum of 0.8%Bacto agar subsequently.Subsequently, on the MS substratum that is added with 500mg/l cefotaxime (cefotaxime sodium), 50mg/l kantlex, 20 μ M benzylaminopurines (BAP) and 1.6g/l glucose, continue to cultivate with 16 hours illumination/8 hour dark rhythm and pace of moving things that reach weekly.The seedling that transfer grows is to the MS substratum that is added with 2% sucrose, 250mg/l cefotaxime and 0.8%Bacto agar.If three Zhou Hougen do not grow, add the 2-indolebutyric acid to substratum so and use tethelin as taking root.
Obtain regrowth containing on the 2MS substratum of kantlex and cefotaxime, then after taking root, be transferred to soil also, after the cultivation, two weeks of growth in controlled environment case or greenhouse, allow to bloom, the results mature seed is also analyzed expression such as Δ 6-elongase activity or the Δ 5-or the Δ 6-desaturase activity of extending enzyme by lipid analysis.In this mode, identify the strain system that how unsaturated C20-and C22-fatty acid content raise.
B) generation of transgenosis Orychophragmus violaceus plant
Use as a) in rape Plant Transformation scheme people (1992) Plant CellReports 8:238-242 such as (modification) Moloney of description.
Be to produce transgenic plant, binary vector pGPTV-D6D5E6 (Tp) ω 3PiE5D4 is transformed among the agrobacterium tumefaciens C58C1:pGV2260 people (1984) Nucl.Acids.Res.13:4777-4788 such as () Deblaere.The overnight culture of the positive Agrobacterium bacterium colony that transforms is used to transform Orychophragmus violaceus after the 1:50 dilution in containing the Murashige-Skoog substratum of 3% sucrose (Murashige and Skoog (1962) Physiol.Plant.15:473) (3MS substratum).Petiole or hypocotyl (every kind of about 1cm of the new germ-free plant of sprouting 2) in culture dish with the Agrobacterium dilution incubation of 1:50 5-10 minute.On the 3MS substratum that is added with 0.8% Bacto agar, be total to incubation 3 days subsequently at 25 ℃ in the dark.On the MS substratum that contains 500mg/l cefotaxime (cefotaxime sodium), 15mg/l kantlex, 20 μ M benzylaminopurines (BAP) and 1.6g/l glucose, continue to cultivate subsequently with 16 hours illumination/8 hour dark rhythm and pace of moving things that reach weekly.The seedling that transfer grows is to the MS substratum that is added with 2% sucrose, 250mg/l cefotaxime and 0.8% Bacto agar.If three Zhou Hougen do not grow, add the 2-indolebutyric acid to substratum so and use tethelin as taking root.
Obtain regrowth also containing on the 2MS substratum of kantlex and cefotaxime, and after taking root, be transferred to soil, and after the cultivation, two weeks of growth in controlled environment case or greenhouse, allow to bloom, the results mature seed is also checked expression such as Δ-6-elongase activity or the Δ-5-or the Δ-6-desaturase activity of extending enzyme by lipid analysis.Identify the strain system that how unsaturated C20-and C22-fatty acid content raise in this mode.
C) conversion of arabidopsis thaliana
Use the scheme of people (1993) C.R.Acad.Sci.Ser.III Sci.Vie.316:1194-1199 such as Bechthold.
For producing transgenic plant, binary vector pGPTV-D6D5E6 (Tp) the ω 3PiE5D4 that produces is transformed among the agrobacterium tumefaciens C58C1:pMP90 people (1984) Nucl.Acids.Res.13:4777-4788 such as () Deblaere, and, the flower of Arabidopis thaliana cv.Columbia 0 is immersed in the Agrobacterium solution of OD600=1.0 according to the scheme of people such as Bechthold (1993).Repeat this step two days later once more.Seed with these flowers is positioned on the agar plate that contains 1/2MS, 2% sucrose and 50mg/l kantlex then.Then green seedling is transferred to soil.
Embodiment 11: the analysis of plant material of transgenosis Zhuge's Lepidium (Orychophragmus) or arabidopsis thaliana
Carry out the extraction and the gas chromatographic analysis of pGPTV-D6D5E6 (Tp) ω 3PiE5D4 transgenic plant transformed Orychophragmus violaceus and Arabidopsis leaf material as describing among the embodiment 8.Table 2 display analysis result.Multiple lipid acid is pointed out with weight percent.May show that long chain polyunsaturated fatty acids is synthetic by two kinds of different plant species.With the obtaining 1.5% DHA with Arabidopis thaliana and compare of people (2005) Functional Plant Biology 32:473-479 such as for example Robert report, be used to obtain significantly higher DHA output from the majorizing sequence (describing in as SEQ ID NO:64) of the Δ 5-of Ostreococcustauri extension enzyme, this is surprising.For the first time realize that the synthetic of long chain polyunsaturated fatty acids is possible in the Orychophragmus violaceus.
Embodiment 12: the strain of transgenosis leaf mustard is the analysis of seed
As describing the extraction and the gas chromatographic analysis of the transgenosis leaf mustard seed that carries out the pSUN-9G conversion among the embodiment 8.Table 6 display analysis result.Multiple lipid acid is pointed out with percentage area.As in people such as Wu 2005, may show the synthetic of long chain polyunsaturated fatty acids (PUFA).Astoundingly, the use of the nucleotide sequence of the extension enzyme sequence OtELO2.2 of modification such as SEQ ID NO:64 description causes the C22 fatty acid content to significantly improve.In a word, in weight %, seed oil contains about 8% how unsaturated C22 lipid acid.Especially, be 1.9% in the content of lipid acid docosahexenoic acid (DHA) in the weight % seed oil, people 2005 such as expression and Wu compare and raise 10 times.
Embodiment 13: from Orychophragmus violaceus leaf material the lipid classification and the detailed analysis of position analysis
The leaf texture of about 1g is 95 ℃ of down heating 10 minutes in the 4ml Virahol, carry out homogenate and vibrate after adding the 1.5ml chloroform by Polytron.Sample is centrifugal, and collect supernatant liquor, and use Virahol: chloroform 1:1 (v/v) is the extracting precipitation once more.Two kinds of extracts are merged, and drying is also dissolved in chloroform.At silicon-dioxide prepsep post (Fisher Scientific, Nepean, Canada) upward the fat extract is presorted level and be separated into neutral lipid, glycolipid and phosphatide, use chloroform respectively: acetate 100:1 (v/v), acetone: acetate 100:1 (v/v) and methyl alcohol: chloroform: water 100:50:40 (v/v/v) wash-out.These fractions are at silicon-dioxide G-25 thin layer chromatography board (TLC; Macherey-Nagel, D ü ren, Germany) last further fractional separation.Neutral lipid hexane: diethyl ether: acetate (70:30:1) colour developing, glycolipid chloroform: methyl alcohol: ammonia (65:25:4v/v/v) colour developing, and phosphatide chloroform: methyl alcohol: ammonia: water (70:30:4: 1v/v/v/v) colour developing.Under the UV lamp, identify each lipid, by striking off its removal from flat board and being used for direct transmethylation or being used for further analysis by suitable solvent extraction with primulin(e) spraying back.
It is possible also analyzing respectively by the multiple lipid of disclosed method fractional separation (neutral lipid, phosphatide and galactolipid).Glycolipid is used for the position of each lipid acid of additional detections.
A) the regiospecificity analysis of triglyceride (TAG)
The TAG of 3 to 5 milligrams of TLC purifying is dry under the nitrogen in Glass tubing, in aqueous buffer solution by of short duration supersound process (1M Tris pH8; 2.2% CaCl 2(w/v); 0.05% biliary salts (w/v)) resuspension and 40 ℃ of incubations 4 minutes.After adding 0.1ml steapsase (10mg/ml in the water) solution,, and stop digestion by adding 1ml ethanol and 1.5ml4M HCl with the violent vortex of sample 3 minutes.TAG with twice extraction of diethyl ether partly digests washes with water, and drying is also dissolved in the chloroform of small volume.As above described for neutral lipid, on the TLC plate, from free fatty acids and indigested TAG, separate monoacylglycerol (MAG).Analyze and represent the sn-2 position of TAG by GC corresponding to the point of MAG.Calculate the distribution of lipid acid with respect to residue sn-1 and sn-3 position: sn-1+sn-3=(TAG * 3-MAG)/2 by following formula.
This position analysis of triglyceride discloses in this case that EPA is present in sn-2 and the sn-1/3 position with similar concentration with DHA, and finds ARA fully only being present on a small quantity in the triglyceride, and herein mainly in the sn-2 position (table 3).
B) the stereospecificity analysis of phosphatide
Phosphatidyl glycerol (PG), phosphatidylethanolamine (PE) and the phosphatidylcholine (PC) of fractional separation and extraction are at N 2Following dry and at the 0.5ml borate buffer solution (0.5M, pH7.5 contain 0.4mM CaCl 2) middle resuspension.After the of short duration supersound process, add from the 5U Phospholipase A2 (Sigma P-7778) of Mozambique Naja (Naja mossambica) venom and 2ml diethyl ether also at room temperature with sample vortex 2 hours.Ether is dry mutually, stop described digestion with the 1M HCl of 0.3ml, and use chlorine: methyl alcohol (2:1v/v) extractive reaction mixture.At chloroform: methyl alcohol: ammonia: the phosphatide by the TLC separating digesting in the water (70:30:4:2v/v/v/v) and remove corresponding to the point of free fatty acids that discharges and lysophospholipid and directly carry out transmethylation by striking off.
The position analysis of phosphatide shows that EPA and DHA accumulate in the sn-2 position of phosphatidylcholine (PC), and DHA is similarly respectively in the sn-1 and sn-2 position of phosphatidylethanolamine (PE).In two kinds of phosphatide, find the ARA of trace only or do not have ARA (table 4).EPA and the DHA concentration in phosphatidyl glycerol is lower than the concentration in the phosphatide of other research, in this lipid classification, also observe accumulation in the sn-2 position (table 4, PG).
C) the stereospecificity analysis of glycolipid
The research galactolipid is as other polarity lipid.Main component is found and formed there to galactolipid in the film of plastid.
Single semi-lactosi DG (MGDG) of TLC purifying and digalactosyl DG (DGDG) are dry and dissolve in the 0.5ml diethyl ether under nitrogen.((50mM, pH7.5 contain 2mM CaCl to this lipase at the 2ml borate buffer solution to add lipase (Sigma 62305) from 25 units of rhizopus arrhizus (Rhizopus arrhizus) then 2) in resuspension), and at room temperature with sample vortex 2 hours.Described ether is dry mutually also by adding 0.3ml 1M HCl termination digestion, and use the 4ml chloroform: methyl alcohol (2:1v/v) extracts described lipid.After the drying, the galactolipid of digestion is present in the chloroform of small volume: in the methyl alcohol (2:1v/v) and at first use chloroform: methyl alcohol: ammonia: water (70:30:4:1v/v/v/v) develop the color on the silicon-dioxide TLC of precoating plate and arrives the about 2/3 of plate height for twice, then is at hexane: diethyl ether: develop the color fully in the acetate (70:30:1).With having identified after the primulin(e) spraying, it is wiped off and directly carry out transmethylase and be used for GC and analyze corresponding to the free fatty acids that discharges and the point of haemolysis galactolipid.
Find that in these lipids VLCPUFA also is possible, observes the accumulation of EPA in the sn-2 position.Only in digalactosyl DG (DGDG), found DHA, and in single semi-lactosi DG (MGDG), do not detected (table 5).The distribution of VLCPUFA in galactolipid shown the kinetics of synthetic and subsequent transformation, and described galactolipid is not have expection to contain the compartment of these lipid acid.VLCPUFA in the polarity lipid has special nutritive value, because than neutral lipid, they can be absorbed in mammal intestine better.Table 1: the detection of pOTE1.1 and pOTE2.1 majorizing sequence in the yeast.Determine transformation efficiency according to substrate conversion.Can realize active significantly improving with the majorizing sequence among the plasmid pOTE2.2.
Figure A200780007847D00831
Table 2: the gas chromatographic analysis of Orychophragmus violaceus and Arabidopis thaliana leaf material.Each lipid acid is pointed out with percentage area.
Figure A200780007847D00842
Figure A200780007847D00851
Figure A200780007847D00861
Table 6: gas-chromatography is determined the lipid acid (by weight percentage) with the transgenosis leaf mustard plant seed of construct pSUN-9G conversion.WT has described the wild-type contrast of unmodified.
Figure A200780007847D00881
18∶4 20∶0 20∶3(8，11，14) 20∶3(11，14，17) 20∶4(ARA)(5，8，11，14) 20∶4(ETeA)(8，11，14，17) 20∶5(EPA)(5，8，11，14，17) 22∶1 22∶4
3.2 0.6 1.1 0.5 3.1 0.6 4.6 0.0 1.5
4.0 0.9 2.0 0.9 4.2 1.0 4.1 0.0 3.1
3.2 0.7 1.3 0.7 4.1 0.5 4.5 0.0 2.7
3.3 0.8 1.4 0.6 3.6 0.6 4.4 0.0 2.4
22∶5 22∶6
2.0 1.5
3.5 1.9
2.8 1.6
2.5 1.6
Sequence table
＜110〉BASF Plant Science AG
＜120〉method of generation polyunsaturated fatty acid
<130>B?8172
<150>DE?10?2006?008?030.0
<151>2006?02?21
<150>EP?06120309.7
<151>2006?09?07
<160>199
＜170〉according to the Biomax PatentTool of PatentIN 3.1 editions
<210>1
<211>1380
<212>DNA
<213>Phytium?irregulare
<220>
<221>CDS
<222>(1)..(1380)
<400>1
Figure A200780007847Q00891
Figure A200780007847Q00901
Figure A200780007847Q00911
<210>2
<211>459
<212>PRT
<213>Phytium?irregulare
<400>2
Figure A200780007847Q00921
<210>3
<211>1380
<212>DNA
＜213〉rhizopus stolonifer (Rhizopus stolonifer)
<220>
<221>CDS
<222>(1)..(1380)
<400>3
Figure A200780007847Q00932
Figure A200780007847Q00941
Figure A200780007847Q00951
<210>4
<211>459
<212>PRT
＜213〉rhizopus stolonifer
<400>4
Figure A200780007847Q00961
<210>5
<211>1380
<212>DNA
＜213〉rhizopus stolonifer
<220>
<221>CDS
<222>(1)..(1380)
<400>5
Figure A200780007847Q00971
Figure A200780007847Q00981
Figure A200780007847Q00991
<210>6
<211>459
<212>PRT
＜213〉rhizopus stolonifer
<400>6
Figure A200780007847Q00992
<210>7
<211>1401
<212>DNA
＜213〉cunninghamella echinulata (Cunninghamella echinulata)
<220>
<221>CDS
<222>(1)..(1401)
<400>7
Figure A200780007847Q01002
Figure A200780007847Q01011
Figure A200780007847Q01021
<210>8
<211>466
<212>PRT
＜213〉cunninghamella echinulata
<400>8
Figure A200780007847Q01022
Figure A200780007847Q01041
<210>9
<211>1398
<212>DNA
<213>Glossomastix?chrysoplasta
<220>
<221>CDS
<222>(1)..(1398)
<400>9
Figure A200780007847Q01042
Figure A200780007847Q01051
Figure A200780007847Q01061
<210>10
<211>465
<212>PRT
<213>Glossomastix?chrysoplasta
<400>10
Figure A200780007847Q01071
Figure A200780007847Q01081
<210>11
<211>1455
<212>DNA
＜213〉false short hailian seaweed (Thalassiosira pseudonana)
<220>
<221>CDS
<222>(1)..(1455)
<400>11
Figure A200780007847Q01082
Figure A200780007847Q01091
Figure A200780007847Q01101
<210>12
<211>484
<212>PRT
＜213〉false short hailian seaweed
<400>12
Figure A200780007847Q01102
Figure A200780007847Q01111
Figure A200780007847Q01121
<210>13
<211>1446
<212>DNA
＜213〉marchantia (Marchantia poiymorpha)
<220>
<221>CDS
<222>(1)..(1446)
<400>13
Figure A200780007847Q01131
Figure A200780007847Q01141
<210>14
<211>481
<212>PRT
＜213〉marchantia
<400>14
Figure A200780007847Q01142
Figure A200780007847Q01151
<210>15
<211>1377
<212>DNA
＜213〉Rhizopus oryzae (Rhizopus oryzae)
<220>
<221>CDS
<222>(1)..(1377)
<400>15
Figure A200780007847Q01161
Figure A200780007847Q01171
Figure A200780007847Q01181
<210>16
<211>458
<212>PRT
＜213〉Rhizopus oryzae
<400>16
Figure A200780007847Q01182
Figure A200780007847Q01191
<210>17
<211>1404
<212>DNA
＜213〉chinese yeast (Mucor rouxii)
<220>
<221>CDS
<222>(1)..(1404)
<400>17
Figure A200780007847Q01192
Figure A200780007847Q01201
Figure A200780007847Q01211
Figure A200780007847Q01221
<210>18
<211>467
<212>PRT
＜213〉chinese yeast
<400>18
Figure A200780007847Q01222
<210>19
<211>1374
<212>DNA
＜213〉Mortierella alpina (Mortierella alpina)
<220>
<221>CDS
<222>(1)..(1374)
<400>19
Figure A200780007847Q01232
Figure A200780007847Q01241
Figure A200780007847Q01251
<210>20
<211>457
<212>PRT
＜213〉Mortierella alpina
<400>20
Figure A200780007847Q01252
Figure A200780007847Q01261
Figure A200780007847Q01271
<210>21
<211>1377
<212>DNA
＜213〉Mortierella alpina
<220>
<221>CDS
<222>(1)..(1377)
<400>21
Figure A200780007847Q01272
Figure A200780007847Q01291
<210>22
<211>458
<212>PRT
＜213〉Mortierella alpina
<400>22
Figure A200780007847Q01292
<210>23
<211>1434
<212>DNA
＜213〉Phaeodactylum tricornutum (Phaeodactylum tricornutum)
<220>
<221>CDS
<222>(1)..(1434)
<400>23
Figure A200780007847Q01321
Figure A200780007847Q01331
<210>24
<211>477
<212>PRT
＜213〉Phaeodactylum tricornutum
<400>24
Figure A200780007847Q01341
<210>25
<211>1374
<212>DNA
＜213〉Mortierella isabellina (Mortierella isabellina)
<220>
<221>CDS
<222>(1)..(1374)
<400>25
Figure A200780007847Q01351
Figure A200780007847Q01361
<210>26
<211>457
<212>PRT
＜213〉Mortierella isabellina
<400>26
Figure A200780007847Q01371
<210>27
<211>1374
<212>DNA
＜213〉Mortierella alpina
<220>
<221>CDS
<222>(1)..(1374)
<400>27
Figure A200780007847Q01382
Figure A200780007847Q01391
Figure A200780007847Q01401
<210>28
<211>457
<212>PRT
＜213〉Mortierella alpina
<400>28
Figure A200780007847Q01402
Figure A200780007847Q01411
Figure A200780007847Q01421
<210>29
<211>1380
<212>DNA
<213>Pythium?irregulare
<220>
<221>CDS
<222>(1)..(1380)
<400>29
Figure A200780007847Q01422
Figure A200780007847Q01431
Figure A200780007847Q01441
<210>30
<211>459
<212>PRT
<213>Pythium?irregulare
<400>30
Figure A200780007847Q01442
Figure A200780007847Q01451
<210>31
<211>1374
<212>DNA
＜213〉Mortierella alpina
<220>
<221>CDS
<222>(1)..(1374)
<400>31
Figure A200780007847Q01461
Figure A200780007847Q01481
<210>32
<211>457
<212>PRT
＜213〉Mortierella alpina
<400>32
Figure A200780007847Q01482
Figure A200780007847Q01491
<210>33
<211>1374
<212>DNA
＜213〉Mortierella isabellina
<220>
<221>CDS
<222>(1)..(1374)
<400>33
Figure A200780007847Q01511
<210>34
<211>457
<212>PRT
＜213〉Mortierella isabellina
<400>34
Figure A200780007847Q01512
Figure A200780007847Q01521
Figure A200780007847Q01531
<210>35
<211>1563
<212>DNA
＜213〉angle tooth moss (Ceratodon purpureus)
<220>
<221>CDS
<222>(1)..(1563)
<400>35
Figure A200780007847Q01532
Figure A200780007847Q01541
Figure A200780007847Q01551
<210>36
<211>520
<212>PRT
＜213〉angle tooth moss
<400>36
Figure A200780007847Q01552
Figure A200780007847Q01571
<210>37
<211>1452
<212>DNA
＜213〉angle tooth moss
<220>
<221>CDS
<222>(1)..(1452)
<400>37
Figure A200780007847Q01572
Figure A200780007847Q01581
Figure A200780007847Q01591
<210>38
<211>483
<212>PRT
＜213〉angle tooth moss
<400>38
Figure A200780007847Q01592
Figure A200780007847Q01611
<210>39
<211>1374
<212>DNA
＜213〉Mortierella alpina
<220>
<221>CDS
<222>(1)..(1374)
<400>39
Figure A200780007847Q01612
Figure A200780007847Q01621
Figure A200780007847Q01631
<210>40
<211>457
<212>PRT
＜213〉Mortierella alpina
<400>40
Figure A200780007847Q01632
Figure A200780007847Q01651
<210>41
<211>1374
<212>DNA
＜213〉Mortierella alpina
<220>
<221>CDS
<222>(1)..(1374)
<400>41
Figure A200780007847Q01652
Figure A200780007847Q01661
Figure A200780007847Q01671
<210>42
<211>457
<212>PRT
＜213〉Mortierella alpina
<400>42
Figure A200780007847Q01672
Figure A200780007847Q01681
<210>43
<211>444
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(5)..(10)
＜223〉5 to 10 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 Xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 Xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(19)..(20)
＜223〉19 to 20 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(22)..(23)
＜223〉22 to 23 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(25)..(25)
＜223〉25 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(32)..(34)
＜223〉32 to 34 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(37)..(38)
＜223〉37 to 38 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(40)..(42)
＜223〉40 to 42 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(44)..(46)
＜223〉44 to 46 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(48)..(48)
＜223〉48 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(51)..(59)
＜223〉51 to 59 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(60)..(77)
＜223〉60 to 77 Xaa is arbitrary amino acid or does not have amino acid is any or no amino acid
<220>
＜221〉variant
<222>(79)..(82)
＜223〉79 to 82 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(84)..(84)
＜223〉84 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(87)..(92)
＜223〉87 to 92 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(94)..(97)
＜223〉94 to 97
<220>
＜221〉variant
<222>(99)..(101)
＜223〉99 to 101 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(103)..(104)
＜223〉103 to 104 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(106)..(132)
＜223〉106 to 132 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(133)..(134)
＜223〉133 to 134 Xaa is that arbitrary amino acid or the xaa that does not have the amino acid position are any or no amino acid
<220>
＜221〉variant
<222>(136)..(138)
＜223〉136 to 138 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(140)..(140)
＜223〉140 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(142)..(142)
＜223〉142 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(145)..(145)
＜223〉145 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(153)..(153)
＜223〉153 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(159)..(160)
＜223〉159 to 160 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(162)..(171)
＜223〉162 to 171 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(172)..(172)
＜223〉172 Xaa is that arbitrary amino acid or the xaa that does not have the amino acid position are any or no amino acid
<220>
＜221〉variant
<222>(174)..(176)
＜223〉174 to 176 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(181)..(182)
＜223〉181 to 182 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(186)..(186)
＜223〉186 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(190)..(190)
＜223〉190 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(194)..(195)
＜223〉194 to 195 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(197)..(200)
＜223〉197 to 200 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(201)..(207)
＜223〉201 to 207 Xaa is that the xaa of arbitrary amino acid position is any or no amino acid
<220>
＜221〉variant
<222>(214)..(214)
<223>214
<220>
＜221〉variant
<222>(216)..(216)
＜223〉216 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(218)..(218)
＜223〉218 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(220)..(238)
＜223〉220 to 238 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(239)..(250)
＜223〉239 to 250 Xaa is that arbitrary amino acid or the xaa that does not have the amino acid position are any or no amino acid
<220>
＜221〉variant
<222>(252)..(255)
＜223〉252 to 255 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(257)..(258)
＜223〉257 to 258 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(260)..(261)
＜223〉260 to 261 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(264)..(264)
＜223〉264 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(267)..(269)
＜223〉267 to 269 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(271)..(284)
＜223〉271 to 284 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(285)..(296)
＜223〉285 to 296 Xaa is that arbitrary amino acid or the xaa that does not have the amino acid position are any or no amino acid
<220>
＜221〉variant
<222>(298)..(298)
＜223〉298 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(300)..(305)
＜223〉300 to 305 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(307)..(326)
＜223〉307 to 326 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(327)..(328)
＜223〉327 to 328 Xaa is that the xaa of arbitrary amino acid position is any or no amino acid
<220>
＜221〉variant
<222>(330)..(336)
＜223〉330 to 336 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(338)..(339)
＜223〉338 to 339 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(342)..(342)
＜223〉342 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(345)..(347)
＜223〉345 to 347 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(352)..(352)
＜223〉352 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(354)..(359)
＜223〉354 to 359 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(360)..(363)
＜223〉360 to 363 xaa is arbitrary amino acid is any or no amino acid
<220>
＜221〉variant
<222>(365)..(367)
＜223〉365 to 367 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(369)..(370)
＜223〉369 to 370 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(372)..(372)
＜223〉372 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(374)..(379)
＜223〉374 to 379 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(380)..(384)
＜223〉380 to 384 xaa is arbitrary amino acid is any or no amino acid
<220>
＜221〉variant
<222>(386)..(387)
＜223〉386 to 387 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(390)..(390)
＜223〉390 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(404)..(405)
＜223〉404 to 405 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(410)..(411)
＜223〉410 to 411 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(413)..(416)
＜223〉413 to 416 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(418)..(419)
＜223〉418 to 419 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(423)..(427)
＜223〉423 to 427 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(430)..(435)
＜223〉430 to 435 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(438)..(438)
＜223〉438 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(441)..(443)
＜223〉441 to 443 xaa is an arbitrary amino acid
<400>43
Figure A200780007847Q01761
Figure A200780007847Q01771
<210>44
<211>31
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(3)
＜223〉2 to 3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Asp or Glu
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Leu or Val
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Leu, Met or Val
<220>
＜221〉variant
<222>(17)..(18)
＜223〉17 to 18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Ala, Asn, Pro or Ser
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Ile or Val
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Pro or Val
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(25)..(25)
＜223〉25 xaa is Ile or Val
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is Glu or Lys
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 xaa is Ala, Ser or Thr
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 xaa is arbitrary amino acid or does not have amino acid
<400>44
Figure A200780007847Q01781
Figure A200780007847Q01791
<210>45
<211>27
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Asp, Gly or Asn
<220>
＜221〉variant
<222>(3)..(4)
＜223〉3 to 4 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is Ala, Gln or Ser
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Asp or Asn
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Ala or Ser
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Ala, Ser or Val
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Pro or Thr
<220>
＜221〉variant
<222>(25)..(25)
＜223〉25 xaa is Leu or Val
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 xaa is Glu, Gly, Asn or Ser
<400>45
Figure A200780007847Q01801
<210>46
<211>31
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(3)
＜223〉2 to 3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Glu, Lys or Arg
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Ala or Gly
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is Ser or Thr
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is Ala, Ser or Val
<220>
＜221〉variant
<222>(12)..(13)
＜223〉12 to 13 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Phe or Met
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Pro or Ser
<220>
＜221〉variant
<222>(17)..(18)
＜223〉17 to 18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(20)..(22)
＜223〉20 to 22 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(24)..(25)
＜223〉24 to 25 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(29)..(29)
＜223〉29 xaa is arbitrary amino acid or does not have amino acid
<400>46
Figure A200780007847Q01811
<210>47
<211>26
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Phe, Leu or Val
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is Ala, Gly or Ser
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Gln or Thr
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Ala, Cys or Pro
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Ser, Thr or Val
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is Cys, Ser or Thr
<220>
＜221〉variant
<222>(10)..(11)
＜223〉10 to 11 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Ile or Leu
<220>
＜221〉variant
<222>(17)..(18)
＜223〉17 to 18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(20)
＜223〉19 to 20 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(22)..(23)
＜223〉22 to 23 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is Ala, Pro or Ser
<400>47
Figure A200780007847Q01831
<210>48
<211>13
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 Xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Asp or Ser
<400>48
Figure A200780007847Q01841
<210>49
<211>17
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(3)
＜223〉2 to 3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(7)..(8)
＜223〉7 to 8 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is Phe or Leu
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Ile or Leu
<400>49
Figure A200780007847Q01842
<210>50
<211>20
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Asp, Glu or Thr
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is Ala or Thr
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is Asp, Gly, Ser or Thr
<220>
＜221〉variant
<222>(5)..(7)
＜223〉5 to 7 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(9)..(10)
＜223〉9 to 10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Phe, Leu or Val
<220>
＜221〉variant
<222>(14)..(15)
＜223〉14 to 15 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Ala, Asp, Gly, Asn or Ser
<220>
＜221〉variant
<222>(18)..(19)
＜223〉18 to 19 xaa is
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Ala, Gln or Ser
<400>50
<210>51
<211>1320
<212>DNA
＜213〉thraustochytriale (Thraustochytrium ssp.)
<220>
<221>CDS
<222>(1)..(1320)
<400>51
Figure A200780007847Q01871
Figure A200780007847Q01881
<210>52
<211>439
<212>PRT
＜213〉thraustochytriale
<400>52
Figure A200780007847Q01882
Figure A200780007847Q01891
<210>53
<211>1371
<212>DNA
<213>Ostreococcus?tauri
<220>
<221>CDS
<222>(1)..(1371)
<400>53
Figure A200780007847Q01921
<210>54
<211>456
<212>PRT
<213>Ostreococcus?tauri
<400>54
Figure A200780007847Q01931
<210>55
<211>1254
<212>DNA
＜213〉leishmania major (Leishmania major)
<220>
<221>CDS
<222>(1)..(1254)
<400>55
Figure A200780007847Q01932
Figure A200780007847Q01941
Figure A200780007847Q01951
<210>56
<211>417
<212>PRT
＜213〉leishmania major
<400>56
Figure A200780007847Q01952
Figure A200780007847Q01961
<210>57
<211>401
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(17)..(26)
＜223〉17 to 26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(27)..(29)
＜223〉27 to 29 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(33)..(37)
＜223〉33 to 37 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(40)..(44)
＜223〉40 to 44 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(46)..(46)
＜223〉46 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(48)..(48)
＜223〉48 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(50)..(51)
＜223〉50 to 51 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(54)..(56)
＜223〉54 to 56 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(58)..(69)
＜223〉58 to 69 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(70)..(77)
＜223〉70 to 77 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(79)..(89)
＜223〉79 to 89 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(91)..(91)
＜223〉91 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(93)..(94)
＜223〉93 to 94 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(96)..(97)
＜223〉96 to 97 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(99)..(100)
＜223〉99 to 100 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(1D3)..(104)
＜223〉103 to 104 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(106)..(110)
＜223〉106 to 110 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(112)..(127)
＜223〉112 to 127 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(128)..(129)
＜223〉128 to 129 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(131)..(137)
＜223〉131 to 137 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(142)..(143)
＜223〉142 to 143 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(146)..(146)
＜223〉146 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(149)..(149)
＜223〉149 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(151)..(151)
＜223〉151 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(154)..(155)
＜223〉154 to 155 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(157)..(157)
＜223〉157 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(159)..(166)
＜223〉159 to 166 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(168)..(168)
＜223〉168 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(170)..(172)
＜223〉170 to 172 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(174)..(176)
＜223〉174 to 176 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(178)..(180)
＜223〉178 to 180 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(182)..(182)
＜223〉182 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(187)..(187)
＜223〉187 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(189)..(192)
＜223〉189 to 192 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(195)..(195)
＜223〉195 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(198)..(198)
＜223〉198 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(200)..(200)
＜223〉200 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(202)..(202)
＜223〉202 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(206)..(221)
＜223〉206 to 221 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(223)..(225)
＜223〉223 to 225 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(227)..(229)
＜223〉227 to 229 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(231)..(231)
＜223〉231 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(234)..(236)
＜223〉234 to 236 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(238)..(239)
＜223〉238 to 239 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(241)..(241)
＜223〉241 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(243)..(245)
＜223〉243 to 245 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(248)..(258)
＜223〉248 to 258 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(260)..(285)
＜223〉260 to 285 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(286)..(286)
＜223〉286 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(288)..(289)
＜223〉288 to 289 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(291)..(298)
＜223〉291 to 298 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(300)..(300)
＜223〉300 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(302)..(303)
＜223〉302 to 303 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(305)..(307)
＜223〉305 to 307 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(309)..(309)
＜223〉309 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(312)..(324)
＜223〉312 to 324 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(327)..(329)
＜223〉327 to 329 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(331)..(338)
＜223〉331 to 338 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(339)..(339)
＜223〉339 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(341)..(341)
＜223〉341 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(343)..(343)
＜223〉343 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(345)..(346)
＜223〉345 to 346 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(349)..(349)
＜223〉349 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(351)..(352)
＜223〉351 to 352 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(358)..(359)
＜223〉358 to 359 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(364)..(369)
＜223〉364 to 369 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(371)..(379)
＜223〉371 to 379 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(381)..(381)
＜223〉381 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(383)..(386)
＜223〉383 to 386 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(388)..(393)
＜223〉388 to 393 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(395)..(396)
＜223〉395 to 396 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(399)..(400)
＜223〉399 to 400 xaa is an arbitrary amino acid
<400>57
Figure A200780007847Q02051
<210>58
<211>59
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(4)
＜223〉3 to 4 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is Phe, Leu or Val
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 Xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Lys or Arg
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Ile or Met
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(25)..(25)
＜223〉25 xaa is Ala or Glu
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is Phe or Val
<220>
＜221〉variant
<222>(27)..(28)
＜223〉27 to 28 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 xaa is Phe, Leu or Val
<220>
＜221〉variant
<222>(32)..(32)
＜223〉32 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is Ala or Gly
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(36)..(36)
＜223〉36 xaa is Ala or Gly
<220>
＜221〉variant
<222>(37)..(38)
＜223〉37 to 38 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(40)..(40)
＜223〉40 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(41)..(41)
＜223〉41 xaa is Asn or Ser
<220>
＜221〉variant
<222>(42)..(42)
＜223〉42 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(44)..(44)
＜223〉44 xaa is Asn or Ser
<220>
＜221〉variant
<222>(49)..(49)
＜223〉49 xaa is Ala or Thr
<220>
＜221〉variant
<222>(51)..(51)
＜223〉51 xaa is Asn or Gln
<220>
＜221〉variant
<222>(52)..(52)
＜223〉52 xaa is Lys or Arg
<220>
＜221〉variant
<222>(53)..(53)
＜223〉53 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(54)..(54)
＜223〉54 xaa is Glu or Arg
<220>
＜221〉variant
<222>(57)..(57)
＜223〉57 xaa is Met or Val
<400>58
Figure A200780007847Q02081
<210>59
<211>50
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Asn or Thr
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(7)..(8)
＜223〉7 to 8 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(11)..(12)
＜223〉11 to 12 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Ile or Val
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Ser or Thr
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(27)..(28)
＜223〉27 to 28 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(29)..(29)
＜223〉29 xaa is Glu or Gln
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 xaa is Ile, Leu or Val
<220>
＜221〉variant
<222>(31)..(31)
＜223〉31 xaa is Ala or Ser
<220>
＜221〉variant
<222>(32)..(32)
＜223〉32 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is Phe or Val
<220>
＜221〉variant
<222>(35)..(36)
＜223〉35 to 36 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Phe or Leu
<220>
＜221〉variant
<222>(38)..(38)
＜223〉38 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(39)..(39)
＜223〉39 xaa is Glu or Lys
<220>
＜221〉variant
<222>(40)..(40)
＜223〉40 xaa is Glu, Lys or Arg
<220>
＜221〉variant
<222>(41)..(41)
＜223〉41 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(42)..(42)
＜223〉42 xaa is Gly or Asn
<220>
＜221〉variant
<222>(44)..(44)
＜223〉44 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(46)..(46)
＜223〉46 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(47)..(47)
＜223〉47 xaa is Asp, Ser or Val
<220>
＜221〉variant
<222>(48)..(48)
＜223〉48 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(49)..(49)
＜223〉49 xaa is Pro or Thr
<400>59
Figure A200780007847Q02111
<210>60
<211>20
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Asp or Glu
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is Ala, Cys or Val
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is Asp or Asn
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is Lys or Arg
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Phe, Ile or Leu
<400>60
Figure A200780007847Q02121
<210>61
<211>61
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is Ala or Leu
<220>
＜221〉variant
<222>(8)..(10)
＜223〉8 to 10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 xaa is Ala, Ile or Val
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is Ala or Val
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Glu or Arg
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Asp, Lys or Arg
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Gly, Asn or Val
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Lys or Arg
<220>
＜221〉variant
<222>(17)..(18)
＜223〉17 to 18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Ala, Gly or Ser
<220>
＜221〉variant
<222>(20)..(23)
＜223〉20 to 23 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(25)..(26)
＜223〉25 to 26 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(28)..(29)
＜223〉28 to 29 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(31)..(31)
＜223〉31 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(32)..(32)
＜223〉32 xaa is Phe, Trp or Tyr
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(35)..(35)
＜223〉35 xaa is Ala, Gly or Ile
<220>
＜221〉variant
<222>(38)..(38)
＜223〉38 xaa is Ser or Thr
<220>
＜221〉variant
<222>(39)..(39)
＜223〉39 xaa is Cys or Ser
<220>
＜221〉variant
<222>(40)..(40)
＜223〉40 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(42)..(42)
＜223〉42 xaa is Ile or Val
<220>
＜221〉variant
<222>(43)..(43)
＜223〉43 xaa is Ala, Gly or Leu
<220>
＜221〉variant
<222>(45)..(45)
＜223〉45 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(47)..(47)
＜223〉47 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(48)..(48)
＜223〉48 xaa is Phe or Leu
<220>
＜221〉variant
<222>(49)..(49)
＜223〉49 xaa is Phe or Tyr
<220>
＜221〉variant
<222>(52)..(52)
＜223〉52 xaa is Pro or Val
<220>
＜221〉variant
<222>(53)..(53)
＜223〉53 xaa is Arg or Ser
<220>
＜221〉variant
<222>(54)..(55)
＜223〉54 to 55 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(56)..(56)
＜223〉56 xaa is Leu or Met
<220>
＜221〉variant
<222>(57)..(57)
＜223〉57 xaa is Lys or Arg
<220>
＜221〉variant
<222>(58)..(58)
＜223〉58 xaa is Gly or Thr
<220>
＜221〉variant
<222>(59)..(59)
＜223〉59 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(60)..(60)
＜223〉60 xaa is Lys or Arg
<220>
＜221〉variant
<222>(61)..(61)
＜223〉61 xaa is His or Tyr
<400>61
Figure A200780007847Q02161
<210>62
<211>34
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(5)
＜223〉2 to 5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(8)..(9)
＜223〉8 to 9 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 xaa is Asp or Pro
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is Met or Val
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Asn or Pro
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(16)..(17)
＜223〉16 to 17 xaa is Asp or Glu
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Ala or Leu
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Phe or Trp
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Leu or Val
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Glu or Arg
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is Ala or Val
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is His or Tyr
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 xaa is Ile, Met or Val
<220>
＜221〉variant
<222>(31)..(31)
＜223〉31 xaa is Asp or Asn
<220>
＜221〉variant
<222>(32)..(32)
＜223〉32 xaa is Ile or Val
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is Asp, Ser or Thr
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is Pro or Thr
<400>62
<210>63
<211>28
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is 6lu or Gln
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Ala or Thr
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Phe or Tyr
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is Glu or Gln
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is Lys or Arg
<220>
＜221〉variant
<222>(13)..(14)
＜223〉13 to 14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Lys or Arg
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Asp or Arg
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(22)
＜223〉21 to 22 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(25)..(26)
＜223〉25 to 26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 xaa is Asp or Pro
<400>63
Figure A200780007847Q02201
<210>64
<211>903
<212>DNA
<213>Ostreococcus?tauri
<220>
<221>CDS
<222>(1)..(903)
<400>64
Figure A200780007847Q02211
<210>65
<211>300
<212>PRT
<213>Ostreococcus?tauri
<400>65
Figure A200780007847Q02212
Figure A200780007847Q02221
<210>66
<211>834
<212>DNA
<213>Pavlova?sp
<220>
<221>CDS
<222>(1)..(834)
<400>66
Figure A200780007847Q02222
<210>67
<211>277
<212>PRT
<213>Pavlova?sp
<400>67
Figure A200780007847Q02242
Figure A200780007847Q02251
<210>68
<211>1077
<212>DNA
＜213〉false short hailian seaweed
<220>
<221>CDS
<222>(1)..(1077)
<400>68
Figure A200780007847Q02252
Figure A200780007847Q02261
<210>69
<211>358
<212>PRT
＜213〉false short hailian seaweed
<400>69
Figure A200780007847Q02271
Figure A200780007847Q02281
<210>70
<211>903
<212>DNA
<213>Ostreococcus?tauri
<220>
<221>CDS
<222>(1)..(903)
<400>70
Figure A200780007847Q02291
<210>71
<211>300
<212>PRT
<213>Ostreococcus?tauri
<400>71
Figure A200780007847Q02292
Figure A200780007847Q02301
<210>72
<211>339
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(29)
＜223〉3 to 29 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(30)..(43)
＜223〉30 to 43 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(45)..(50)
＜223〉45 to 50 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(53)..(73)
＜223〉53 to 73 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(74)..(79)
＜223〉74 to 79 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(81)..(82)
＜223〉81 to 82 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(85)..(86)
＜223〉85 to 86 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(88)..(90)
＜223〉88 to 90 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(92)..(110)
＜223〉92 to 110 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(112)..(127)
＜223〉112 to 127 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(128)..(128)
＜223〉128 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(130)..(130)
＜223〉130 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(133)..(134)
＜223〉133 to 134 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(137)..(137)
＜223〉137 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(139)..(140)
＜223〉139 to 140 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(143)..(144)
＜223〉143 to 144 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(147)..(147)
＜223〉147 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(149)..(149)
＜223〉149 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(151)..(152)
＜223〉151 to 152 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(154)..(154)
＜223〉154 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(159)..(159)
＜223〉159 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(163)..(166)
＜223〉163 to 166 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(170)..(179)
＜223〉170 to 179 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(180)..(182)
＜223〉180 to 182 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(184)..(184)
＜223〉184 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(188)..(190)
＜223〉188 to 190 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(193)..(193)
＜223〉193 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(196)..(197)
＜223〉196 to 197 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(203)..(206)
＜223〉203 to 206 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(208)..(210)
＜223〉208 to 210 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(217)..(217)
＜223〉217 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(222)..(223)
＜223〉222 to 223 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(226)..(252)
＜223〉226 to 252 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(253)..(267)
＜223〉253 to 267 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(269)..(272)
＜223〉269 to 272 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(276)..(277)
＜223〉276 to 277 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(280)..(282)
＜223〉280 to 282 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(284)..(291)
＜223〉284 to 291 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(292)..(324)
＜223〉292 to 324 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(326)..(337)
＜223〉326 to 337 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(338)..(338)
＜223〉338 xaa is arbitrary amino acid or does not have amino acid
<400>72
Figure A200780007847Q02341
Figure A200780007847Q02351
<210>73
<211>45
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is Ala or Gly
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Ala or Leu
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Phe or Ile
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Leu or Met
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Ala or Ser
<220>
＜221〉variant
<222<(23)..(23)
＜223〉23 xaa is Ala or Leu
<220>
＜221〉variant
<222>(25)..(26)
＜223〉25 to 26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 xaa is Arg or Ser
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is Ile or Leu
<220>
＜221〉variant
<222>(39)..(39)
＜223〉39 xaa is Leu or Met
<220>
＜221〉variant
<222>(40)..(40)
＜223〉40 xaa is Leu or Val
<220>
＜221〉variant
<222>(43)..(43)
＜223〉43 xaa is Cys, Thr or Val
<220>
＜221〉variant
<222>(44)..(44)
＜223〉44 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(45)..(45)
＜223〉45 xaa is Cys or Val
<400>73
Figure A200780007847Q02371
<210>74
<211>43
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Leu or Val
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Cys or Asn
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Asp or Asn
<220>
＜221〉variant
<222>(9)..(10)
＜223〉9 to 10 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(14)
＜223〉13 to 14 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is Phe or Trp
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Ala or Leu
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(25)..(26)
＜223〉25 to 26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is Leu or Val
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is Ile or Val
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Ala, Thr or Val
<220>
＜221〉variant
<222>(38)..(38)
＜223〉38 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(39)..(39)
＜223〉39 xaa is Ile or Leu
<220>
＜221〉variant
<222>(40)..(40)
＜223〉40 xaa is an arbitrary amino acid
<400>74
Figure A200780007847Q02391
<210>75
<211>37
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(3)
＜223〉2 to 3 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Gly, Ser or Thr
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(14)
＜223〉13 to 14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Ala or Ser
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Ala or Ser
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Glu or Lys
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Ala, Asn or Ser
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Lys or Arg
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Ala, Gly or Ser
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is Glu or Gly
<220>
＜221〉variant
<222>(25)..(29)
＜223〉25 to 29 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 xaa is Asn, Pro or Gln
<220>
＜221〉variant
<222>(31)..(32)
＜223〉31 to 32 xaa is Ala, Asp or Glu
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is Gly, Ser or Thr
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is Asn, Gln or Thr
<220>
＜221〉variant
<222>(35)..(36)
＜223〉35 to 36 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Ala, Asp or Pro
<400>75
Figure A200780007847Q02411
<210>76
<211>19
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(3)
＜223〉2 to 3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(4)..(7)
＜223〉4 to 7 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Phe, Leu or Val
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Ala, Leu or Val
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Thr or Val
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Ala, Ile or Leu
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is Phe, Ile or Leu
<400>76
Figure A200780007847Q02421
<210>77
<211>1560
<212>DNA
<213>Traustochytrium?sp.
<220>
<221>CDS
<222>(1)..(1560)
<400>77
Figure A200780007847Q02441
<210>78
<211>519
<212>PRT
<213>Traustochytrium?sp.
<400>78
Figure A200780007847Q02452
Figure A200780007847Q02461
Figure A200780007847Q02471
<210>79
<211>1560
<212>DNA
<213>Thraustochytrium?sp
<220>
<221>CDS
<222>(1)..(1560)
<400>79
Figure A200780007847Q02472
Figure A200780007847Q02481
Figure A200780007847Q02491
<210>80
<211>519
<212>PRT
<213>Thraustochytrium?sp
<400>80
Figure A200780007847Q02492
<210>81
<211>1653
<212>DNA
＜213〉false short hailian seaweed
<220>
<221>CDS
<222>(1)..(1653)
<400>81
Figure A200780007847Q02512
Figure A200780007847Q02521
Figure A200780007847Q02531
<210>82
<211>550
<212>PRT
＜213〉false short hailian seaweed
<400>82
Figure A200780007847Q02541
Figure A200780007847Q02551
<210>83
<211>1626
<212>DNA
＜213〉tiny Euglena (Euglena gracilis)
<220>
<221>CDS
<222>(1)..(1626)
<400>83
Figure A200780007847Q02552
Figure A200780007847Q02561
Figure A200780007847Q02571
Figure A200780007847Q02581
<210>84
<211>541
<212>PRT
＜213〉tiny Euglena
<400>84
Figure A200780007847Q02582
Figure A200780007847Q02591
<210>85
<211>1548
<212>DNA
<213>Thraustochytrium?aureum
<220>
<221>CDS
<222>(1)..(1548)
<400>85
Figure A200780007847Q02601
Figure A200780007847Q02611
Figure A200780007847Q02621
<210>86
<211>515
<212>PRT
<213>Thraustochytrium?aureum
<400>86
Figure A200780007847Q02631
<210>87
<211>1548
<212>DNA
<213>Thraustochytrium?aureum
<220>
<221>CDS
<222>(1)..(1548)
<400>87
Figure A200780007847Q02651
Figure A200780007847Q02661
<210>88
<211>515
<212>PRT
<213>Thraustochytrium?aureum
<400>88
Figure A200780007847Q02662
Figure A200780007847Q02671
<210>89
<211>1548
<212>DNA
<213>Thraustochytrium?aureum
<220>
<221>CDS
<222>(1)..(1548)
<400>89
Figure A200780007847Q02682
Figure A200780007847Q02691
Figure A200780007847Q02701
<210>90
<211>515
<212>PRT
<213>Thraustochytrium?aureum
<400>90
Figure A200780007847Q02702
Figure A200780007847Q02711
Figure A200780007847Q02721
<210>91
<211>1548
<212>DNA
<213>Thraustochytrium?aureum
<220>
<221>CDS
<222>(1)..(1548)
<400>91
Figure A200780007847Q02722
Figure A200780007847Q02731
Figure A200780007847Q02741
<210>92
<211>515
<212>PRT
<213>Thraustochytrium?aureum
<400>92
Figure A200780007847Q02742
Figure A200780007847Q02751
Figure A200780007847Q02761
<210>93
<211>1560
<212>DNA
<213>Thraustochytrium?sp
<220>
<221>CDS
<222>(1)..(1560)
<400>93
Figure A200780007847Q02762
Figure A200780007847Q02771
Figure A200780007847Q02781
<210>94
<211>519
<212>PRT
<213>Thraustochytrium?sp
<400>94
Figure A200780007847Q02791
Figure A200780007847Q02801
<210>95
<211>575
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(3)
＜223〉2 to 3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(5)..(13)
＜223〉5 to 13 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(48)
＜223〉14 to 48 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(51)..(51)
＜223〉51 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(54)..(54)
＜223〉54 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(56)..(56)
＜223〉56 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(62)..(62)
＜223〉62 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(64)..(65)
＜223〉64 to 65 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(66)..(81)
＜223〉66 to 81 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(85)..(85)
＜223〉85 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(87)..(87)
＜223〉87 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(89)..(91)
＜223〉89 to 91 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(97)..(97)
＜223〉97 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(99)..(99)
＜223〉99 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(102)..(102)
＜223〉102 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(105)..(105)
＜223〉105 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(108)..(108)
＜223〉108 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(110)..(110)
＜223〉110 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(115)..(116)
＜223〉115 to 116 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(119)..(119)
＜223〉119 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(121)..(121)
＜223〉121 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(123)..(124)
＜223〉123 to 124 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(127)..(128)
＜223〉127 to 128 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(130)..(130)
＜223〉130 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(132)..(137)
＜223〉132 to 137 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(138)..(154)
＜223〉138 to 154 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(156)..(156)
＜223〉156 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(158)..(158)
＜223〉158 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(159)..(159)
＜223〉159 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(161)..(161)
＜223〉161 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(164)..(164)
＜223〉164 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(166)..(168)
＜223〉166 to 168 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(171)..(173)
＜223〉171 to 173 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(175)..(175)
＜223〉175 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(177)..(177)
＜223〉177 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(179)..(181)
＜223〉179 to 181 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(183)..(184)
＜223〉183 to 184 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(185)..(185)
＜223〉185 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(189)..(189)
＜223〉189 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(192)..(193)
＜223〉192 to 193 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(196)..(196)
＜223〉196 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(200)..(200)
＜223〉200 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(204)..(204)
＜223〉204 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(206)..(207)
＜223〉206 to 207 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(208)..(211)
＜223〉208 to 211 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(213)..(214)
＜223〉213 to 214 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(215)..(216)
＜223〉215 to 216 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(218)..(220)
＜223〉218 to 220 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(222)..(224)
＜223〉222 to 224 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(226)..(226)
＜223〉226 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(240)..(240)
＜223〉240 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(245)..(250)
＜223〉245 to 250 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(253)..(253)
＜223〉253 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(265)..(266)
＜223〉265 to 266 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(270)..(270)
＜223〉270 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(273)..(273)
＜223〉273 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(283)..(284)
＜223〉283 to 284 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(285)..(290)
＜223〉285 to 290 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(292)..(293)
＜223〉292 to 293 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(295)..(297)
＜223〉295 to 297 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(299)..(302)
＜223〉299 to 302 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(313)..(313)
＜223〉313 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(316)..(317)
＜223〉316 to 317 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(319)..(319)
＜223〉319 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(322)..(322)
＜223〉322 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(324)..(327)
＜223〉324 to 327 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(330)..(330)
＜223〉330 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(334)..(334)
＜223〉334 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(336)..(336)
＜223〉336 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(338)..(339)
＜223〉338 to 339 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(341)..(342)
＜223〉341 to 342 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(346)..(346)
＜223〉346 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(349)..(350)
＜223〉349 to 350 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(353)..(354)
＜223〉353 to 354 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(356)..(359)
＜223〉356 to 359 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(362)..(363)
＜223〉362 to 363 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(367)..(368)
＜223〉367 to 368 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(371)..(371)
＜223〉371 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(373)..(375)
＜223〉373 to 375 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(377)..(377)
＜223〉377 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(381)..(381)
＜223〉381 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(384)..(385)
＜223〉384 to 385 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(387)..(387)
＜223〉387 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(390)..(392)
＜223〉390 to 392 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(395)..(395)
＜223〉395 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(397)..(398)
＜223〉397 to 398 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(400)..(402)
＜223〉400 to 402 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(405)..(405)
＜223〉405 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(408)..(409)
＜223〉408 to 409 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(412)..(413)
＜223〉412 to 413 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(417)..(417)
＜223〉417 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(427)..(427)
＜223〉427 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(434)..(435)
＜223〉434 to 435 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(438)..(438)
＜223〉438 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(440)..(440)
＜223〉440 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(442)..(443)
＜223〉442 to 443 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(444)..(452)
＜223〉444 to 452 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(454)..(454)
＜223〉454 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(456)..(457)
＜223〉456 to 457 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(459)..(459)
＜223〉459 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(463)..(464)
＜223〉463 to 464 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(466)..(466)
＜223〉466 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(468)..(472)
＜223〉468 to 472 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(473)..(473)
＜223〉473 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(475)..(483)
＜223〉475 to 483 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(484)..(489)
＜223〉484 to 489 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(491)..(492)
＜223〉491 to 492 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(496)..(496)
＜223〉496 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(506)..(507)
＜223〉506 to 507 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(527)..(527)
＜223〉527 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(530)..(532)
＜223〉530 to 532 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(534)..(538)
＜223〉534 to 538 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(540)..(542)
＜223〉540 to 542 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(544)..(545)
＜223〉544 to 545 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(548)..(548)
＜223〉548 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(556)..(556)
＜223〉556 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(558)..(559)
＜223〉558 to 559 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(561)..(562)
＜223〉561 to 562 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(565)..(565)
＜223〉565 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(568)..(569)
＜223〉568 to 569 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(573)..(573)
＜223〉573 xaa is an arbitrary amino acid
<400>95
Figure A200780007847Q02911
Figure A200780007847Q02921
Figure A200780007847Q02931
<210>96
<211>58
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(4)
＜223〉2 to 4 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is Ala or Val
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Ala or Ser
<220>
＜221〉variant
<222>(14).，(14)
＜223〉14 xaa is Pro or Val
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 xaa is Asn or Ser
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Gly, Gln or Ser
<220>
＜221〉variant
<222>(38)..(39)
＜223〉38 to 39 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(41)..(41)
＜223〉41 xaa is Glu or Thr
<220>
＜221〉variant
<222>(42)..(42)
＜223〉42 xaa is Asn, Thr or Val
<220>
＜221〉variant
<222>(43)..(44)
＜223〉43 to 44 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(45)..(45)
＜223〉45 xaa is His or Tyr
<220>
＜221〉variant
<222>(47)..(47)
＜223〉47 xaa is Gln or Ser
<220>
＜221〉variant
<222>(48)..(48)
＜223〉48 xaa is Asp or Gly
<220>
＜221〉variant
<222>(49)..(49)
＜223〉49 xaa is Ile or Val
<220>
＜221〉variant
<222>(50)..(50)
＜223〉50 xaa is Phe or Val
<220>
＜221〉variant
<222>(51)..(51)
＜223〉51 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(52)..(52)
＜223〉52 xaa is Glu or Ser
<220>
＜221〉variant
<222>(55)..(55)
＜223〉55 xaa is Ala or Glu
<400>96
<210>97
<211>61
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Ile or Val
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Asn or Ser
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Ala or Ser
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Asn or Ser
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is Lys or Arg
<220>
＜221〉variant
<222>(25)..(25)
＜223〉25 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is Leu, Met or Val
<220>
＜221〉variant
<222>(29)..(29)
＜223〉29 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(31)..(31)
＜223〉31 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(42)..(42)
＜223〉42 xaa is Ala or Gly
<220>
＜221〉variant
<222>(43)..(43)
＜223〉43 xaa is Phe or Met
<220>
＜221〉variant
<222>(47)..(47)
＜223〉47 xaa is Phe, Leu or Met
<220>
＜221〉variant
<222>(50)..(50)
＜223〉50 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(59)..(59)
＜223〉59 xaa is Leu or Val
<220>
＜221〉variant
<222>(60)..(60)
＜223〉60 xaa is Ile or Leu
<220>
＜221〉variant
<222>(61)..(61)
＜223〉61 xaa is Asp or Glu
<400>97
Figure A200780007847Q02971
<210>98
<211>40
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is Lys or Arg
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is Phe or Tyr
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Ile or Leu
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Ala or Gly
<220>
＜221〉variant
<222>(11)..(12)
＜223〉11 to 12 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(14)..(15)
＜223〉14 to 15 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(16)..(17)
＜223〉16 to 17 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Ile or Leu
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Ala or Asn
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is Phe, Ile or Val
<220>
＜221〉variant
<222>(25)..(25)
＜223〉25 xaa is Gln, Ser or Thr
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is Phe or Val
<220>
＜221〉variant
<222>(29)..(29)
＜223〉29 xaa is Glu or Gly
<220>
＜221〉variant
<222>(31)..(31)
＜223〉31 xaa is Ala or Val
<220>
＜221〉variant
<222>(32)..(32)
＜223〉32 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is Arg or Ser
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Phe or Tyr
<220>
＜221〉variant
<222>(38)..(38)
＜223〉38 xaa is an arbitrary amino acid
<400>98
Figure A200780007847Q02991
<210>99
<211>59
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is Ala or Ile
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Ala, Leu or Val
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Ile or Leu
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is Gly or Leu
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Met or Val
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Ala or Gly
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Phe or Met
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Pro or Val
<220>
＜221〉variant
<222>(23)..(24)
＜223〉23 to 24 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is Leu or Val
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(31)..(31)
＜223〉31 xaa is Ile or Met
<220>
＜221〉variant
<222>(32)..(32)
＜223〉32 xaa is Ala or Gly
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is Phe or Leu
<220>
＜221〉variant
<222>(35)..(35)
＜223〉35 xaa is Ala or Thr
<220>
＜221〉variant
<222>(39)..(39)
＜223〉39 xaa is Leu or Val
<220>
＜221〉variant
<222>(49)..(49)
＜223〉49 xaa is Ile or Val
<220>
＜221〉variant
<222>(56)..(56)
＜223〉56 xaa is Ala or Gly
<220>
＜221〉variant
<222>(57)..(57)
＜223〉57 xaa is Ser or Thr
<400>99
Figure A200780007847Q03021
<210>100
<211>45
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is Ile or Val
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Asp or Lys
<220>
＜221〉variant
<222>(7)..(9)
＜223〉7 to 9 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Asp or Gly
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Ile or Val
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Ala or Gly
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Ala or Leu
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Lys or Arg
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Asp or Glu
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is Ala or Cys
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is Ile or Val
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 xaa is Ser or Thr
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is Ile, Pro or Val
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(36)..(36)
＜223〉36 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Pro or Ser
<220>
＜221〉variant
<222>(39)..(39)
＜223〉39 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(41)..(41)
＜223〉41 xaa is Leu or Met
<220>
＜221〉variant
<222>(42)..(42)
＜223〉42 xaa is Glu or Arg
<220>
＜221〉variant
<222>(45)..(45)
＜223〉45 xaa is Lys or Arg
<400>100
Figure A200780007847Q03041
<210>101
<211>24
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(6)
＜223〉2 to 6 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Ser or Thr
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Phe or Tyr
<220>
＜221〉variant
<222>(19)..(20)
＜223〉19 to 20 xaa is Leu or Met
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Leu or Met
<400>101
<210>102
<211>27
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Asp or Glu
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Leu or Met
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is Lys or Arg
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Glu or Arg
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is Ala or Val
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Lys or Arg
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(20)..(21)
＜223〉20 to 21 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Gln or Arg
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is Ala or Gly
<220>
＜221〉variant
<222>(25)..(26)
＜223〉25 to 26 xaa is an arbitrary amino acid
<400>102
Figure A200780007847Q03061
<210>103
<211>28
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(3)
＜223〉2 to 3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(6)..(10)
＜223〉6 to 10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(11)..(12)
＜223〉11 to 12 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(17)..(18)
＜223〉17 to 18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Asp or Thr
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Ala or Gly
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(25)..(25)
＜223〉25 xaa is Ala or Thr
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is Glu or Gly
<400>103
Figure A200780007847Q03081
<210>104
<211>28
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 xaa is Phe or Trp
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is Ser, Thr or Val
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is Ile or Leu
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Glu or Ser
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Lys or Arg
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 xaa is Ala or Glu
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is Asp, Glu or Lys
<400>104
Figure A200780007847Q03091
<210>105
<211>15
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Cys or Ser
<220>
＜221〉variant
<222>(7)..(8)
＜223〉7 to 8 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(10)..(12)
＜223〉10 to 12 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Ile or Pro
<400>105
Figure A200780007847Q03101
<210>106
<211>29
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(7)
＜223〉2 to 7 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(8)..(12)
＜223〉8 to 12 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Asp or Val
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is Glu, Asn or Gln
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Gln or Arg
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Glu or Lys
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Ala or Glu
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is Ala, Leu or Val
<220>
＜221〉variant
<222>(25)..(26)
＜223〉25 to 26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 xaa is Ala, Glu or Ser
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is Ala, Glu or Asn
<400>106
Figure A200780007847Q03111
<210>107
<211>11
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Glu or Asn
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is Cys or Val
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Ala or Gly
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is Pro or Val
<220>
＜221〉variant
<222>(9)..(10)
＜223〉9 to 10 xaa is an arbitrary amino acid
<400>107
Figure A200780007847Q03121
<210>108
<211>8
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Ala or Ile
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Phe, Ile or Leu
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Phe or Leu
<400>108
Figure A200780007847Q03131
<210>109
<211>903
<212>DNA
<213>Ostreococcus?tauri
<220>
<221>CDS
<222>(1)..(903)
<400>109
Figure A200780007847Q03132
Figure A200780007847Q03141
<210>110
<211>300
<212>PRT
<213>Ostreococcus?tauri
<400>110
Figure A200780007847Q03142
Figure A200780007847Q03151
<210>111
<211>834
<212>DNA
<213>Pavlova?sp
<220>
<221>CDS
<222>(1)..(834)
<400>111
Figure A200780007847Q03161
<210>112
<211>277
<212>PRT
<213>Pavlova?sp
<400>112
Figure A200780007847Q03172
<210>113
<211>1077
<212>DNA
＜213〉false short hailian seaweed
<220>
<221>CDS
<222>(1)..(1077)
<400>113
Figure A200780007847Q03182
Figure A200780007847Q03191
Figure A200780007847Q03201
<210>114
<211>358
<212>PRT
＜213〉false short hailian seaweed
<400>114
Figure A200780007847Q03211
<210>115
<211>903
<212>DNA
<213>Ostreococcus?tauri
<220>
<221>CDS
<222>(1)..(903)
<400>115
Figure A200780007847Q03212
Figure A200780007847Q03221
<210>116
<211>300
<212>PRT
<213>Ostreococcus?tauri
<400>116
Figure A200780007847Q03222
Figure A200780007847Q03231
<210>117
<211>339
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(29)
＜223〉3 to 29 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(30)..(43)
＜223〉30 to 43 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(45)..(50)
＜223〉45 to 50 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(53)..(73)
＜223〉53 to 73 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(74)..(79)
＜223〉74 to 79 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(81)..(82)
＜223〉81 to 82 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(85)..(86)
＜223〉85 to 86 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(88)..(90)
＜223〉88 to 90 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(92)..(110)
＜223〉92 to 110 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(112)..(127)
＜223〉112 to 127 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(128)..(128)
＜223〉128 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(130)..(130)
＜223〉130 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(133)..(134)
＜223〉133 to 134 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(137)..(137)
＜223〉137 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(139)..(140)
＜223〉139 to 140 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(143)..(144)
＜223〉143 to 144 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(147)..(147)
＜223〉147 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(149)..(149)
＜223〉149 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(151)..(152)
＜223〉151 to 152 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(154)..(154)
＜223〉154 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(159)..(159)
＜223〉159 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(163)..(166)
＜223〉163 to 166 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(170)..(179)
＜223〉170 to 179 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(180)..(182)
＜223〉180 to 182 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(184)..(184)
＜223〉184 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(188)..(190)
＜223〉188 to 190 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(193)..(193)
＜223〉193 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(196)..(197)
＜223〉196 to 197 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(203)..(206)
＜223〉203 to 206 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(208)..(210)
＜223〉208 to 210 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(217)..(217)
＜223〉217 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(222)..(223)
＜223〉222 to 223 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(226)..(252)
＜223〉226 to 252 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(253)..(267)
＜223〉253 to 267 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(269)..(272)
＜223〉269 to 272 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(276)..(277)
＜223〉276 to 277 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(280)..(282)
＜223〉280 to 282 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(284)..(291)
＜223〉284 to 291 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(292)..(324)
＜223〉292 to 324 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(326)..(337)
＜223〉326 to 337 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(338)..(338)
＜223〉338 xaa is arbitrary amino acid or does not have amino acid
<400>117
Figure A200780007847Q03271
<210>118
<211>45
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is Ala or Gly
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Ala or Leu
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Phe or Ile
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Leu or Met
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Ala or Ser
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Ala or Leu
<220>
＜221〉variant
<222>(25)..(26)
＜223〉25 to 26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 xaa is Arg or Ser
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is Ile or Leu
<220>
＜221〉variant
<222>(39)..(39)
＜223〉39 xaa is Leu or Met
<220>
＜221〉variant
<222>(40)..(40)
＜223〉40 xaa is Leu or Val
<220>
＜221〉variant
<222>(43)..(43)
＜223〉43 xaa is Cys, Thr or Val
<220>
＜221〉variant
<222>(44)..(44)
＜223〉44 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(45)..(45)
＜223〉45 xaa is Cys or Val
<400>118
Figure A200780007847Q03301
<210>119
<211>43
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Leu or Val
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Cys or Asn
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Asp or Asn
<220>
＜221〉variant
<222>(9)..(10)
＜223〉9 to 10 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(14)
＜223〉13 to 14 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is Phe or Trp
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Ala or Leu
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(25)..(26)
＜223〉25 to 26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is Leu or Val
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is Ile or Val
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Ala, Thr or Val
<220>
＜221〉variant
<222>(38)..(38)
＜223〉38 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(39)..(39)
＜223〉39 xaa is Ile or Leu
<220>
＜221〉variant
<222>(40)..(40)
＜223〉40 xaa is an arbitrary amino acid
<400>119
Figure A200780007847Q03321
<210>120
<211>37
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(3)
＜223〉2 to 3 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Gly, Ser or Thr
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(14)
＜223〉13 to 14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Ala or Ser
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Ala or Ser
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Glu or Lys
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Ala, Asn or Ser
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Lys or Arg
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Ala, Gly or Ser
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is Glu or Gly
<220>
＜221〉variant
<222>(25)..(29)
＜223〉25 to 29 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 xaa is Asn, Pro or Gln
<220>
＜221〉variant
<222>(31)..(32)
＜223〉31 to 32 xaa is Ala, Asp or Glu
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is Gly, Ser or Thr
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is Asn, Gln or Thr
<220>
＜221〉variant
<222>(35)..(36)
＜223〉35 to 36 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Ala, Asp or Pro
<400>120
Figure A200780007847Q03341
<210>121
<211>19
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(3)
＜223〉2 to 3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(4)..(7)
＜223〉4 to 7 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Phe, Leu or Val
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Ala, Leu or Val
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Thr or Val
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Ala, Ile or Leu
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is Phe, Ile or Leu
<400>121
Figure A200780007847Q03351
<210>122
<211>879
<212>DNA
<213>Ostreococcus?tauri
<220>
<221>CDS
<222>(1)..(879)
<400>122
Figure A200780007847Q03361
Figure A200780007847Q03371
<210>123
<211>292
<212>PRT
<213>Ostreococcus?tauri
<400>123
Figure A200780007847Q03372
<210>124
<211>1047
<212>DNA
＜213〉marchantia
<220>
<221>CDS
<222>(1)..(1047)
<400>124
Figure A200780007847Q03382
Figure A200780007847Q03401
<210>125
<211>348
<212>PRT
＜213〉marchantia
<400>125
Figure A200780007847Q03411
<210>126
<211>831
<212>DNA
<213>Thraustochytrium?sp
<220>
<221>CDS
<222>(1)..(831)
<400>126
Figure A200780007847Q03412
Figure A200780007847Q03421
<210>127
<211>276
<212>PRT
<213>Thraustochytrium?sp
<400>127
Figure A200780007847Q03431
<210>128
<211>1146
<212>DNA
＜213〉leishmania major
<220>
<221>CDS
<222>(1)..(1146)
<400>128
Figure A200780007847Q03441
Figure A200780007847Q03451
<210>129
<211>381
<212>PRT
＜213〉leishmania major
<400>129
Figure A200780007847Q03452
Figure A200780007847Q03461
Figure A200780007847Q03471
<210>130
<211>879
<212>DNA
<213>Ostreococcus?tauri
<220>
<221>CDS
<222>(1)..(879)
<400>130
Figure A200780007847Q03481
<210>131
<211>292
<212>PRT
<213>Ostreococcus?tauri
<400>131
Figure A200780007847Q03482
Figure A200780007847Q03491
<210>132
<211>873
<212>DNA
＜213〉marchantia
<220>
<221>CDS
<222>(1)..(873)
<400>132
Figure A200780007847Q03492
Figure A200780007847Q03501
<210>133
<211>290
<212>PRT
＜213〉marchantia
<400>133
Figure A200780007847Q03512
Figure A200780007847Q03521
<210>134
<211>873
<212>DNA
＜213〉exhibition leaf sword-like leave moss (Physcomitrella patens)
<220>
<221>CDS
<222>(1)..(873)
<400>134
Figure A200780007847Q03522
Figure A200780007847Q03531
<210>135
<211>290
<212>PRT
＜213〉exhibition leaf sword-like leave moss
<400>135
Figure A200780007847Q03532
Figure A200780007847Q03541
<210>136
<211>957
<212>DNA
＜213〉Mortierella alpina
<220>
<221>CDS
<222>(1)..(957)
<400>136
Figure A200780007847Q03551
Figure A200780007847Q03561
<210>137
<211>318
<212>PRT
＜213〉Mortierella alpina
<400>137
Figure A200780007847Q03562
Figure A200780007847Q03571
<210>138
<211>242
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(5)
＜223〉3 to 5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(8)..(16)
＜223〉8 to 16 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(20)
＜223〉19 to 20 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(22)..(42)
＜223〉22 to 42 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(43)..(49)
＜223〉43 to 49 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(52)..(56)
＜223〉52 to 56 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(59)..(59)
＜223〉59 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(62)..(63)
＜223〉62 to 63 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(65)..(68)
＜223〉65 to 68 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(70)..(73)
＜223〉70 to 73 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(75)..(75)
＜223〉75 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(77)..(78)
＜223〉77 to 78 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(80)..(94)
＜223〉80 to 94 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(95)..(98)
＜223〉95 to 98 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(101)..(101)
＜223〉101 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(104)..(105)
＜223〉104 to 105 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(108)..(108)
＜223〉108 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(111)..(111)
＜223〉111 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(114)..(114)
＜223〉114 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(116)..(120)
＜223〉116 to 120 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(122)..(124)
＜223〉122 to 124 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(127)..(127)
＜223〉127 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(131)..(132)
＜223〉131 to 132 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(134)..(135)
＜223〉134 to 135 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(139)..(143)
＜223〉139 to 143 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(148)..(149)
＜223〉148 to 149 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(151)..(151)
＜223〉151 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(154)..(155)
＜223〉154 to 155 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(158)..(159)
＜223〉158 to 159 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(162)..(162)
＜223〉162 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(165)..(165)
＜223〉165 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(168)..(168)
＜223〉168 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(170)..(184)
＜223〉170 to 184 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(185)..(190)
＜223〉185 to 190 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(192)..(193)
＜223〉192 to 193 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(196)..(196)
＜223〉196 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(199)..(203)
＜223〉199 to 203 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(205)..(206)
＜223〉205 to 206 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(208)..(213)
＜223〉208 to 213 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(214)..(219)
＜223〉214 to 219 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(222)..(227)
＜223〉222 to 227 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(229)..(230)
＜223〉229 to 230 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(233)..(235)
＜223〉233 to 235 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(237)..(237)
＜223〉237 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(241)..(241)
＜223〉241 xaa is an arbitrary amino acid
<400>138
Figure A200780007847Q03611
Figure A200780007847Q03621
<210>139
<211>60
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Phe or Trp
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is Leu, Met or Val
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Phe or Ile
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 Xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(13)..(15)
＜223〉13 to 15 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is Ile, Leu or Val
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Ser or Thr
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Phe or Val
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Ile or Val
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 xaa is Ala, Ser or Thr
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is Ser or Thr
<220>
＜221〉variant
<222>(29)..(29)
＜223〉29 xaa is Ile or Val
<220>
＜221〉variant
<222>(30)..(31)
＜223〉30 to 31 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(32)..(32)
＜223〉32 xaa is Ile or Leu
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(35)..(35)
＜223〉35 xaa is Ala, Ile or Leu
<220>
＜221〉variant
<222>(36)..(36)
＜223〉36 xaa is Ala, Ile or Val
<220>
＜221〉variant
<222>(37)..(39)
＜223〉37 to 39 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(42)..(42)
＜223〉42 xaa is Gly or Asn
<220>
＜221〉variant
<222>(44)..(44)
＜223〉44 xaa is Asp or Glu
<220>
＜221〉variant
<222>(45)..(45)
＜223〉45 xaa is Ala or Ser
<220>
＜221〉variant
<222>(47)..(47)
＜223〉47 xaa is Phe, Trp or Tyr
<220>
＜221〉variant
<222>(49)..(49)
＜223〉49 xaa is Ala or Thr
<220>
＜221〉variant
<222>(50)..(50)
＜223〉50 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(51)..(51)
＜223〉51 xaa is Leu or Val
<220>
＜221〉variant
<222>(54)..(54)
＜223〉54 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(55)..(55)
＜223〉55 xaa is Ile or Val
<220>
＜221〉variant
<222>(58)..(58)
＜223〉58 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(59)..(59)
＜223〉59 xaa is Leu or Met
<400>139
<210>140
<211>22
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Ala or Leu
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is Phe or Tyr
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Cys or Ser
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Gly, Leu or Val
<220>
＜221〉variant
<222>(8)..(9)
＜223〉8 to 9 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(10)..(11)
＜223〉10 to 11 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(13)..(14)
＜223〉13 to 14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(15)..(16)
＜223〉15 to 16 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is Gly, Ser or Thr
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Leu or Val
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Phe or Trp
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Glu, Gly or Asn
<400>140
Figure A200780007847Q03671
<210>141
<211>18
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(3)
＜223〉2 to 3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(9)..(12)
＜223〉9 to 12 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Gly, Ile, Leu or Val
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Ala or Ser
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Trp or Tyr
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is Ala, Cys or Asp
<400>141
Figure A200780007847Q03681
<210>142
<211>25
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(4)..(5)
＜223〉4 to 5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Phe, Ile or Leu
<220>
＜221〉variant
<222>(7)..(8)
＜223〉7 to 8 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Ile, Leu or Met
<220>
＜221〉variant
<222>(11)..(12)
＜223〉11 to 12 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(15)
＜223〉14 to 15 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Ser or Thr
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Leu or Met
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Phe or Leu
<220>
＜221〉variant
<222>(22)..(23)
＜223〉22 to 23 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(25)..(25)
＜223〉25 xaa is Phe or Tyr
<400>142
Figure A200780007847Q03691
<210>143
<211>879
<212>DNA
<213>Ostreococcus?tauri
<220>
<221>CDS
<222>(1)..(879)
<400>143
Figure A200780007847Q03692
Figure A200780007847Q03701
<210>144
<211>292
<212>PRT
<213>Ostreococcus?tauri
<400>144
Figure A200780007847Q03712
Figure A200780007847Q03721
<210>145
<211>831
<212>DNA
<213>Thraustochytrium?sp
<220>
<221>CDS
<222>(1)..(831)
<400>145
Figure A200780007847Q03722
Figure A200780007847Q03731
<210>146
<211>276
<212>PRT
<213>Thraustochytrium?sp
<400>146
Figure A200780007847Q03732
Figure A200780007847Q03741
<210>147
<211>1146
<212>DNA
＜213〉leishmania major
<220>
<221>CDS
<222>(1)..(1146)
<400>147
Figure A200780007847Q03742
Figure A200780007847Q03751
Figure A200780007847Q03761
<210>148
<211>381
<212>PRT
＜213〉leishmania major
<400>148
Figure A200780007847Q03762
<210>149
<211>879
<212>DNA
<213>Ostreococcus?tauri
<220>
<221>CDS
<222>(1)..(879)
<400>149
Figure A200780007847Q03781
Figure A200780007847Q03791
<210>150
<211>292
<212>PRT
<213>Ostreococcus?tauri
<400>150
Figure A200780007847Q03792
Figure A200780007847Q03801
<210>151
<211>873
<212>DNA
＜213〉exhibition leaf sword-like leave moss
<220>
<221>CDS
<222>(1)..(873)
<400>151
Figure A200780007847Q03811
<210>152
<211>290
<212>PRT
＜213〉exhibition leaf sword-like leave moss
<400>152
Figure A200780007847Q03821
<210>153
<211>957
<212>DNA
＜213〉Mortierella alpina
<220>
<221>CDS
<222>(1)..(957)
<400>153
Figure A200780007847Q03841
<210>154
<211>318
<212>PRT
＜213〉Mortierella alpina
<400>154
Figure A200780007847Q03842
<210>155
<211>236
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(8)
＜223〉2 to 8 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(14)
＜223〉13 to 14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(16)..(36)
＜223〉16 to 36 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(37)..(43)
＜223〉37 to 43 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(46)..(47)
＜223〉46 to 47 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(49)..(50)
＜223〉49 to 50 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(53)..(53)
＜223〉53 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(56)..(57)
＜223〉56 to 57 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(59)..(62)
＜223〉59 to 62 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(64)..(67)
＜223〉64 to 67 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(69)..(69)
＜223〉69 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(71)..(72)
＜223〉71 to 72 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(74)..(82)
＜223〉74 to 82 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(83)..(86)
＜223〉83 to 86 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(88)..(89)
＜223〉88 to 89 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(91)..(92)
＜223〉91 to 92 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(95)..(95)
＜223〉95 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(98)..(99)
＜223〉98 to 99 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(102)..(102)
＜223〉102 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(105)..(105)
＜223〉105 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(108)..(108)
＜223〉108 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(111)..(114)
＜223〉111 to 114 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(116)..(116)
＜223〉116 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(121)..(121)
＜223〉121 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(125)..(126)
＜223〉125 to 126 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(128)..(129)
＜223〉128 to 129 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(133)..(137)
＜223〉133 to 137 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(142)..(142)
＜223〉142 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(145)..(145)
＜223〉145 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(148)..(148)
＜223〉148 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(152)..(152)
＜223〉152 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(156)..(156)
＜223〉156 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(159)..(159)
＜223〉159 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(162)..(162)
＜223〉162 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(164)..(165)
＜223〉164 to 165 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(167)..(178)
＜223〉167 to 178 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(179)..(184)
＜223〉179 to 184 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(186)..(187)
＜223〉186 to 187 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(190)..(190)
＜223〉190 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(193)..(197)
＜223〉193 to 197 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(199)..(200)
＜223〉199 to 200 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(202)..(207)
＜223〉202 to 207 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(208)..(213)
＜223〉208 to 213 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(216)..(217)
＜223〉216 to 217 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(219)..(221)
＜223〉219 to 221 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(223)..(224)
＜223〉223 to 224 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(227)..(229)
＜223〉227 to 229 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(231)..(231)
＜223〉231 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(235)..(235)
＜223〉235 xaa is an arbitrary amino acid
<400>155
Figure A200780007847Q03901
Figure A200780007847Q03911
<210>156
<211>59
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Phe or Ile
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is Ile, Leu or Val
<220>
＜221〉variant
<222>(10)..(13)
＜223〉10 to 13 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Lys or Arg
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Ile, Leu or Val
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Ile or Val
<220>
＜221〉variant
<222>(25)..(25)
＜223〉25 xaa is Ala or Ser
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is Ser or Thr
<220>
＜221〉variant
<222>(28)..(29)
＜223〉28 to 29 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(32)..(32)
＜223〉32 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is Ala, Ile or Leu
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is Ile or Val
<220>
＜221〉variant
<222>(35)..(35)
＜223〉35 xaa is Ala or Thr
<220>
＜221〉variant
<222>(36)..(37)
＜223〉36 to 37 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(40)..(40)
＜223〉40 xaa is Gly or Asn
<220>
＜221〉variant
<222>(42)..(42)
＜223〉42 xaa is Asp or Glu
<220>
＜221〉variant
<222>(45)..(45)
＜223〉45 xaa is Phe or Trp
<220>
＜221〉variant
<222>(47)..(47)
＜223〉47 xaa is Ala or Thr
<220>
＜221〉variant
<222>(48)..(48)
＜223〉48 xaa is Ala or Ile
<220>
＜221〉variant
<222>(52)..(52)
＜223〉52 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(53)..(53)
＜223〉53 xaa is Ile or Val
<220>
＜221〉variant
<222>(56)..(56)
＜223〉56 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(57)..(57)
＜223〉57 xaa is Leu or Met
<220>
＜221〉variant
<222>(59)..(59)
＜223〉59 xaa is Ala, Gly or Thr
<400>156
Figure A200780007847Q03931
<210>157
<211>22
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Leu or Met
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Ala, Cys or Ser
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Glu or Gly
<220>
＜221〉variant
<222>(8)..(10)
＜223〉8 to 10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 xaa is Gln or Ser
<220>
＜221〉variant
<222>(13)..(16)
＜223〉13 to 16 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Phe or Trp
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Gly or Asn
<400>157
Figure A200780007847Q03951
<210>158
<211>16
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Leu or Met
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(6)..(8)
＜223〉6 to 8 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 Xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Ala or Ser
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Trp or Tyr
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Cys or Asp
<400>158
Figure A200780007847Q03961
<210>159
<211>24
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(4)
＜223〉3 to 4 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Ile or Leu
<220>
＜221〉variant
<222>(6)..(7)
＜223〉6 to 7 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is Ile or Leu
<220>
＜221〉variant
<222>(10)..(11)
＜223〉10 to 11 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Ser or Thr
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Leu or Met
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(22)
＜223〉21 to 22 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is Phe or Tyr
<400>159
Figure A200780007847Q03971
<210>160
<211>8
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Trp or Tyr
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is Ile or Leu
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Phe or Val
<400>160
<210>161
<211>755
<212>DNA
＜213〉tobacco mosaic virus (TMV)
<400>161
Figure A200780007847Q03981
<210>162
<211>211
<212>DNA
＜213〉tobacco mosaic virus (TMV)
<400>162
Figure A200780007847Q03982
<210>163
<211>819
<212>DNA
＜213〉false short hailian seaweed
<220>
<221>CDS
<222>(1)..(819)
<400>163
Figure A200780007847Q03983
Figure A200780007847Q04001
<210>164
<211>272
<212>PRT
＜213〉false short hailian seaweed
<400>164
Figure A200780007847Q04002
Figure A200780007847Q04011
<210>165
<211>837
<212>DNA
＜213〉Phaeodactylum tricornutum
<220>
<221>CDS
<222>(1)..(837)
<400>165
Figure A200780007847Q04012
Figure A200780007847Q04021
<210>166
<211>278
<212>PRT
＜213〉Phaeodactylum tricornutum
<400>166
Figure A200780007847Q04022
Figure A200780007847Q04031
<210>167
<211>272
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(4)..(10)
＜223〉4 to 10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(12)..(13)
＜223〉12 to 13 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(15)..(16)
＜223〉15 to 16 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(22)..(23)
＜223〉22 to 23 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(26)..(28)
＜223〉26 to 28 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(32)..(34)
＜223〉32 to 34 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(37)..(38)
＜223〉37 to 38 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(40)..(41)
＜223〉40 to 41 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(44)..(45)
＜223〉44 to 45 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(47)..(48)
＜223〉47 to 48 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(51)..(52)
＜223〉51 to 52 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(55)..(56)
＜223〉55 to 56 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(58)..(60)
＜223〉58 to 60 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(61)..(61)
＜223〉61 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(64)..(64)
＜223〉64 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(69)..(69)
＜223〉69 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(72)..(72)
＜223〉72 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(79)..(79)
＜223〉79 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(86)..(86)
＜223〉86 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(89)..(90)
＜223〉89 to 90 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(99)..(100)
＜223〉99 to 100 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(104)..(109)
＜223〉104 to 109 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(112)..(112)
＜223〉112 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(114)..(114)
＜223〉114 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(121)..(121)
＜223〉121 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(124)..(124)
＜223〉124 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(162)..(162)
＜223〉162 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(164)..(165)
＜223〉164 to 165 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(174)..(174)
＜223〉174 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(195)..(197)
＜223〉195 to 197 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(212)..(213)
＜223〉212 to 213 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(216)..(216)
＜223〉216 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(219)..(220)
＜223〉219 to 220 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(223)..(223)
＜223〉223 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(226)..(231)
＜223〉226 to 231 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(234)..(238)
＜223〉234 to 238 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(240)..(243)
＜223〉240 to 243 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(245)..(245)
＜223〉245 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(247)..(248)
＜223〉247 to 248 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(253)..(253)
＜223〉253 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(261)..(261)
＜223〉261 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(264)..(265)
＜223〉264 to 265 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(271)..(271)
＜223〉271 xaa is an arbitrary amino acid
<400>167
Figure A200780007847Q04081
<210>168
<211>59
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(27)..(27)
＜223〉27 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(29)..(29)
＜223〉29 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(30)..(34)
＜223〉30 to 34 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(39)..(39)
＜223〉39 xaa is Leu or Val
<400>168
Figure A200780007847Q04091
<210>169
<211>60
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Phe or Met
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is Ile or Val
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is Phe or Val
<220>
＜221〉variant
<222>(29)..(29)
＜223〉29 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is Asp or His
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is Phe or Trp
<220>
＜221〉variant
<222>(35)..(35)
＜223〉35 xaa is Asp or Asn
<220>
＜221〉variant
<222>(36)..(36)
＜223〉36 xaa is Phe or Val
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Glu or Asn
<220>
＜221〉variant
<222>(38)..(38)
＜223〉38 xaa is Asp or Lys
<220>
＜221〉variant
<222>(41)..(41)
＜223〉41 xaa is Ile or Val
<220>
＜221〉variant
<222>(43)..(43)
＜223〉43 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(50)..(50)
＜223〉50 xaa is Ile or Val
<220>
＜221〉variant
<222>(53)..(53)
＜223〉53 xaa is Ile or Val
<400>169
Figure A200780007847Q04111
<210>170
<211>39
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 xaa is Ala or Ser
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is Phe or Met
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Leu or Val
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(26)..(27)
＜223〉26 to 27 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is Ile or Leu
<220>
＜221〉variant
<222>(29)..(29)
＜223〉29 xaa is Leu or Val
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 xaa is Phe or Tyr
<220>
＜221〉variant
<222>(31)..(31)
＜223〉31 xaa is His or Lys
<220>
＜221〉variant
<222>(34)..(34)
＜223〉34 xaa is Ala or Asp
<220>
＜221〉variant
<222>(35)..(35)
＜223〉35 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(36)..(36)
＜223〉36 xaa is Pro or Val
<220>
＜221〉variant
<222>(37)..(38)
＜223〉37 to 38 Xaa is an arbitrary amino acid
<400>170
Figure A200780007847Q04131
<210>171
<211>831
<212>DNA
<213>Traustochytrium?sp.
<220>
<221>CDS
<222>(1)..(831)
<400>171
Figure A200780007847Q04132
Figure A200780007847Q04141
<210>172
<211>276
<212>PRT
<213>Traustochytrium?sp.
<400>172
Figure A200780007847Q04142
<210>173
<211>1047
<212>DNA
＜213〉marchantia
<220>
<221>CDS
<222>(1)..(1047)
<400>173
Figure A200780007847Q04161
Figure A200780007847Q04171
<210>174
<211>348
<212>PRT
＜213〉marchantia
<400>174
Figure A200780007847Q04172
<210>175
<211>831
<212>DNA
<213>Thraustochytrium?sp
<220>
<221>CDS
<222>(1)..(831)
<400>175
Figure A200780007847Q04191
Figure A200780007847Q04201
<210>176
<211>276
<212>PRT
<213>Thraustochytrium?sp
<400>176
Figure A200780007847Q04202
Figure A200780007847Q04211
<210>177
<211>879
<212>DNA
<213>Ostreococcus?tauri
<220>
<221>CDS
<222>(1)..(879)
<400>177
Figure A200780007847Q04212
Figure A200780007847Q04221
<210>178
<211>292
<212>PRT
<213>Ostreococcus?tauri
<400>178
Figure A200780007847Q04222
Figure A200780007847Q04231
<210>179
<211>873
<212>DNA
＜213〉marchantia
<220>
<221>CDS
<222>(1)..(873)
<400>179
Figure A200780007847Q04251
<210>180
<211>290
<212>PRT
＜213〉marchantia
<400>180
Figure A200780007847Q04261
<210>181
<211>873
<212>DNA
＜213〉exhibition leaf sword-like leave moss
<220>
<221>CDS
<222>(1)..(873)
<400>181
Figure A200780007847Q04262
Figure A200780007847Q04271
<210>182
<211>290
<212>PRT
＜213〉exhibition leaf sword-like leave moss
<400>182
Figure A200780007847Q04272
Figure A200780007847Q04281
<210>183
<211>957
<212>DNA
＜213〉Mortierella alpina
<220>
<221>CDS
<222>(1)..(957)
<400>183
Figure A200780007847Q04291
Figure A200780007847Q04301
<210>184
<211>318
<212>PRT
＜213〉Mortierella alpina
<400>184
Figure A200780007847Q04302
<210>185
<211>251
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(11)
＜223〉2 to 11 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(15)
＜223〉14 to 15 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(17)..(23)
＜223〉17 to 23 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(25)..(25)
＜223〉25 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(26)..(28)
＜223〉26 to 28 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(30)..(31)
＜223〉30 to 31 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(32)..(34)
＜223〉32 to 34 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(36)..(37)
＜223〉36 to 37 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(39)..(44)
＜223〉39 to 44 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(47)..(51)
＜223〉47 to 51 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(54)..(54)
＜223〉54 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(57)..(63)
＜223〉57 to 63 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(65)..(68)
＜223〉65 to 68 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(70)..(70)
＜223〉70 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(72)..(72)
＜223〉72 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(75)..(82)
＜223〉75 to 82 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(83)..(86)
＜223〉83 to 86 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(88)..(91)
＜223〉88 to 91 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(93)..(93)
＜223〉93 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(96)..(96)
＜223〉96 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(99)..(100)
＜223〉99 to 100 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(103)..(103)
＜223〉103 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(106)..(107)
＜223〉106 to 107 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(109)..(109)
＜223〉109 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(111)..(115)
＜223〉111 to 115 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(117)..(119)
＜223〉117 to 119 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(126)..(126)
＜223〉126 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(129)..(130)
＜223〉129 to 130 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(133)..(134)
＜223〉133 to 134 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(136)..(138)
＜223〉136 to 138 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(143)..(143)
＜223〉143 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(148)..(149)
＜223〉148 to 149 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(153)..(154)
＜223〉153 to 154 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(157)..(158)
＜223〉157 to 158 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(160)..(160)
＜223〉160 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(163)..(179)
＜223〉163 to 179 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(180)..(185)
＜223〉180 to 185 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(187)..(188)
＜223〉187 to 188 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(190)..(191)
＜223〉190 to 191 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(194)..(198)
＜223〉194 to 198 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(200)..(201)
＜223〉200 to 201 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(203)..(208)
＜223〉203 to 208 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(209)..(209)
＜223〉209 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(212)..(217)
＜223〉212 to 217 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(219)..(220)
＜223〉219 to 220 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(223)..(225)
＜223〉223 to 225 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(227)..(227)
＜223〉227 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(233)..(246)
＜223〉233 to 246 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(247)..(250)
＜223〉247 to 250 xaa is arbitrary amino acid or does not have amino acid
<400>185
<210>186
<211>60
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(4)
＜223〉3 to 4 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Leu, Met or Val
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 xaa is Phe or Ile
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Ile, Leu or Val
<220>
＜221〉variant
<222>(15)..(18)
＜223〉15 to 18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Lys or Arg
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Ile, Leu or Val
<220>
＜221〉variant
<222>(22)..(22)
＜223〉22 xaa is Ser or Thr
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Phe or Val
<220>
＜221〉variant
<222>(26)..(26)
＜223〉26 xaa is Ile or Val
<220>
＜221〉variant
<222>(30)..(30)
＜223〉30 xaa is Ala or Ser
<220>
＜221〉variant
<222>(31)..(31)
＜223〉31 xaa is Ser or Thr
<220>
＜221〉variant
<222>(33)..(34)
＜223〉33 to 34 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(38)..(38)
＜223〉38 xaa is Ala, Ile or Leu
<220>
＜221〉variant
<222>(39)..(39)
＜223〉39 xaa is Ile or Val
<220>
＜221〉variant
<222>(40)..(40)
＜223〉40 xaa is Ala or Thr
<220>
＜221〉variant
<222>(41)..(42)
＜223〉41 to 42 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(45)..(45)
＜223〉45 xaa is Gly or Asn
<220>
＜221〉variant
<222>(47)..(47)
＜223〉47 xaa is Asp or Glu
<220>
＜221〉variant
<222>(50)..(50)
＜223〉50 xaa is Phe or Trp
<220>
＜221〉variant
<222>(52)..(52)
＜223〉52 xaa is Ala or Thr
<220>
＜221〉variant
<222>(53)..(53)
＜223〉53 xaa is Ala or Ile
<220>
＜221〉variant
<222>(57)..(57)
＜223〉57 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(58)..(58)
＜223〉58 xaa is Ile or Val
<400>186
Figure A200780007847Q04391
<210>187
<211>23
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is Leu or Met
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is Phe or Tyr
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Ala or Cys
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is Glu or Gly
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is Ala, Ile or Val
<220>
＜221〉variant
<222>(11)..(11)
＜223〉11 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is Ala or Gln
<220>
221〉variant
<222>(14)..(17)
＜223〉14 to 17 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Leu or Val
<220>
＜221〉variant
<222>(21)..(21)
＜223〉21 xaa is Phe or Trp
<400>187
Figure A200780007847Q04411
<210>188
<211>24
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(3)..(4)
＜223〉3 to 4 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Ile or Leu
<220>
＜221〉variant
<222>(6)..(7)
＜223〉6 to 7 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is Ile or Leu
<220>
＜221〉variant
<222>(10)..(11)
＜223〉10 to 11 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Ser or Thr
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 xaa is Leu or Met
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(21)..(22)
＜223〉21 to 22 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is Phe or Tyr
<400>188
Figure A200780007847Q04421
<210>189
<211>20
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Ile or Leu
<220>
＜221〉variant
<222>(4)..(5)
＜223〉4 to 5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Leu or Met
<220>
＜221〉variant
<222>(8)..(8)
＜223〉8 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(11)..(14)
＜223〉11 to 14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Gly, Ile or Val
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Ala or Ser
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(19)..(19)
＜223〉19 xaa is Trp or Tyr
<220>
＜221〉variant
<222>(20)..(20)
＜223〉20 xaa is Ala or Asp
<400>189
Figure A200780007847Q04431
<210>190
<211>18
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(5)
＜223〉2 to 5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(8)..(9)
＜223〉8 to 9 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(11)..(12)
＜223〉11 to 12 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(13)..(13)
＜223〉13 xaa is Phe or Leu
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Ile or Leu
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 Xaa is an arbitrary amino acid
<400>190
Figure A200780007847Q04441
<210>191
<211>18
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Pro or Thr
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is Glu or Pro
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Ile, Leu, Met or Val
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Leu, Met or Val
<220>
＜221〉variant
<222>(7)..(8)
＜223〉7 to 8 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Ile, Leu or Val
<220>
＜221〉variant
<222>(10)..(11)
＜223〉10 to 11 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(15)
＜223〉14 to 15 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(18)..(18)
＜223〉18 xaa is Gly or Leu
<400>191
Figure A200780007847Q04451
<210>192
<211>10
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(2)
＜223〉2 xaa is Ala, Gly or Asn
<220>
＜221〉variant
<222>(3)..(3)
＜223〉3 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(4)..(4)
＜223〉4 xaa is Ile, Leu or Met
<220>
＜221〉variant
<222>(5)..(5)
＜223〉5 xaa is Ile, Leu or Val
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Trp or Tyr
<220>
＜221〉variant
<222>(7)..(7)
＜223〉7 xaa is Ile, Leu or Val
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is Phe, Met or Val
<400>192
Figure A200780007847Q04461
<210>193
<211>1086
<212>DNA
＜213〉phytophthora infestans (Phytophthora infestans)
<220>
<221>CDS
<222>(1)..(1086)
<400>193
Figure A200780007847Q04471
Figure A200780007847Q04481
<210>194
<211>361
<212>PRT
＜213〉phytophthora infestans
<400>194
Figure A200780007847Q04491
<210>195
<211>1077
<212>DNA
＜213〉filament water mold (Saprolegnia diclina)
<220>
<221>CDS
<222>(1)..(1077)
<400>195
<210>196
<211>358
<212>PRT
＜213〉filament water mold
<400>196
Figure A200780007847Q04512
Figure A200780007847Q04521
<210>197
<211>359
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(2)..(5)
＜223〉2 to 5 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(12)..(12)
＜223〉12 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(14)..(14)
＜223〉14 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(18)..(19)
＜223〉18 to 19 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(23)..(26)
＜223〉23 to 26 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(33)..(33)
＜223〉33 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(35)..(38)
＜223〉35 to 38 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(40)..(40)
＜223〉40 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(42)..(45)
＜223〉42 to 45 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(47)..(48)
＜223〉47 to 48 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(51)..(52)
＜223〉51 to 52 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(54)..(60)
＜223〉54 to 60 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(62)..(62)
＜223〉62 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(64)..(65)
＜223〉64 to 65 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(67)..(68)
＜223〉67 to 68 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(71)..(72)
＜223〉71 to 72 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(75)..(76)
＜223〉75 to 76 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(87)..(87)
＜223〉87 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(90)..(90)
＜223〉90 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(97)..(98)
＜223〉97 to 98 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(101)..(102)
＜223〉101 to 102 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(104)..(105)
＜223〉104 to 105 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(109)..(109)
＜223〉109 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(118)..(119)
＜223〉118 to 119 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(133)..(133)
＜223〉133 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(136)..(136)
＜223〉136 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(140)..(140)
＜223〉140 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(142)..(144)
＜223〉142 to 144 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(146)..(149)
＜223〉146 to 149 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(151)..(155)
＜223〉151 to 155 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(158)..(158)
＜223〉158 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(161)..(162)
＜223〉161 to 162 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(165)..(166)
＜223〉165 to 166 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(168)..(169)
＜223〉168 to 169 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(172)..(174)
＜223〉172 to 174 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(177)..(177)
＜223〉177 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(179)..(180)
＜223〉179 to 180 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(183)..(184)
＜223〉183 to 184 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(186)..(187)
＜223〉186 to 187 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(191)..(192)
＜223〉191 to 192 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(195)..(195)
＜223〉195 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(196)..(197)
＜223〉196 to 197 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(199)..(199)
＜223〉199 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(202)..(202)
＜223〉202 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(204)..(205)
＜223〉204 to 205 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(206)..(207)
＜223〉206 to 207 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(210)..(212)
＜223〉210 to 212 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(215)..(217)
＜223〉215 to 217 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(219)..(220)
＜223〉219 to 220 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(224)..(224)
＜223〉224 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(226)..(226)
＜223〉226 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(230)..(230)
＜223〉230 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(232)..(232)
＜223〉232 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(245)..(245)
＜223〉245 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(250)..(250)
＜223〉250 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(271)..(272)
＜223〉271 to 272 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(278)..(278)
＜223〉278 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(284)..(284)
＜223〉284 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(297)..(298)
＜223〉297 to 298 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(301)..(302)
＜223〉301 to 302 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(304)..(305)
＜223〉304 to 305 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(307)..(307)
＜223〉307 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(309)..(309)
＜223〉309 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(313)..(314)
＜223〉313 to 314 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(320)..(320)
＜223〉320 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(324)..(327)
＜223〉324 to 327 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(329)..(330)
＜223〉329 to 330 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(334)..(334)
＜223〉334 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(336)..(338)
＜223〉336 to 338 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(340)..(341)
＜223〉340 to 341 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(347)..(348)
＜223〉347 to 348 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(349)..(352)
＜223〉349 to 352 xaa is arbitrary amino acid or does not have amino acid
<220>
＜221〉variant
<222>(357)..(357)
＜223〉357 xaa is an arbitrary amino acid
<400>197
Figure A200780007847Q04591
Figure A200780007847Q04601
<210>198
<211>60
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(10)..(10)
＜223〉10 xaa is Ala or Glu
<220>
＜221〉variant
<222>(15)..(15)
＜223〉15 xaa is Ala or Gly
<220>
＜221〉variant
<222>(36)..(36)
＜223〉36 xaa is Phe or Leu
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Ile or Val
<220>
＜221〉variant
<222>(43)..(43)
＜223〉43 xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(49)..(49)
＜223〉49 xaa is Ile or Val
<400>198
Figure A200780007847Q04611
<210>199
<211>60
<212>PRT
＜213〉artificial sequence
<220>
＜221〉variant
<222>(6)..(6)
＜223〉6 xaa is Ala or Cys
<220>
＜221〉variant
<222>(9)..(9)
＜223〉9 xaa is Gly or Ser
<220>
＜221〉variant
<222>(16)..(16)
＜223〉16 Xaa is an arbitrary amino acid
<220>
＜221〉variant
<222>(17)..(17)
＜223〉17 xaa is Leu or Val
<220>
＜221〉variant
<222>(20)..(21)
＜223〉20 to 21 xaa is Ile or Val
<220>
＜221〉variant
<222>(23)..(23)
＜223〉23 xaa is Cys or Thr
<220>
＜221〉variant
<222>(24)..(24)
＜223〉24 xaa is Phe or Ile
<220>
＜221〉variant
<222>(28)..(28)
＜223〉28 xaa is Ala or Leu
<220>
＜221〉variant
<222>(37)..(37)
＜223〉37 xaa is Lys or Arg
<220>
＜221〉variant
<222>(38)..(38)
＜223〉38 xaa is Leu or Val
<220>
＜221〉variant
<222>(52)..(52)
＜223〉52 xaa is Lys or Arg
<220>
＜221〉variant
<222>(55)..(55)
＜223〉55 xaa is Ile or Val
<220>
＜221〉variant
<222>(59)..(59)
＜223〉59 xaa is an arbitrary amino acid
<400>199
Figure A200780007847Q04631

Claims (18)

1. produce the method for timnodonic acid, clupanodonic acid and/or docosahexenoic acid in transgenic plant, it is included in provides coding to have at least a nucleotide sequence of the active polypeptide of Δ 6-desaturase in the plant; Coding has at least a nucleotide sequence of the polypeptide of Δ 6-elongase activity; Coding has at least a nucleotide sequence of the active polypeptide of Δ 5-desaturase; Have the polypeptide of Δ 5-elongase activity and at least a nucleotide sequence of coded delta 4-desaturase randomly with coding, wherein coding have Δ 5-elongase activity the nucleotide sequence of polypeptide because its codon that is adapted in one or more plant species is selected, compare with the nucleotide sequence in the source biology of this sequence and modified.
2. the process of claim 1 wherein that described nucleotide sequence is adapted to the codon selection in rape, soybean and/or flax at least.
3. claim 1 or 2 each methods consider that wherein the natural frequency of individual codon adapts to described nucleotide sequence.
4. any one method of claim 1 to 3, wherein said modified nucleotide sequence is corresponding to the nucleotide sequence of pointing out among the SEQ ID No.64.
5. any one method of claim 1 to 4, wherein said nucleotide sequence is expressed under the control of seed specific promoters.
6. the method for claim 5, wherein said promotor is USP, vicilin, rapeseed protein, Glp, SBP, superoxide oxygen also albumen (peroxireduxin), legumin, Fad3, conlinin or oleosin promotor.
7. the method for claim 6, the content of wherein how unsaturated C22 lipid acid in seed oil be by weight seed oil content 5% or higher.
8. the method for any one in the aforementioned claim wherein provides one or more nucleotide sequences extraly in plant, its coding has ω 3 desaturases and/or the active polypeptide of Δ 4-desaturase.
9. the method for claim 8, wherein the content of docosahexenoic acid in seed oil be by weight seed oil content 1% or higher.
10. the method for any one in the aforementioned claim, wherein timnodonic acid, clupanodonic acid and/or docosahexenoic acid are present in the plant with combining form mainly as ester such as phosphatide or triglyceride.
11. the method for any one in the aforementioned claim, wherein said plant are the oil-produced vegetable that is selected from colea, leaf mustard and soybean.
12. the method for any one in the aforementioned claim also comprises from plant absorbing timnodonic acid, clupanodonic acid and/or docosahexenoic acid with oil, lipid or free fatty acids form.
13. isolated nucleic acid molecule, it comprises the nucleotide sequence that shows as in SEQ ID No.64.
14. recombinant nucleic acid molecules, it comprises:
A) at least a promotor of activated one or more copies in vegetable cell,
B) at least a nucleotide sequence, its coding have the active polypeptide of Δ 6-desaturase,
C) at least a nucleotide sequence, its coding have the active polypeptide of Δ 5-desaturase,
D) at least a nucleotide sequence, its coding has the polypeptide of Δ 6-elongase activity,
E) at least a nucleotide sequence, its coding have Δ 5-elongase activity polypeptide and since the codon that is adapted in one or more plant species select, compare with the nucleotide sequence in the source biology of this sequence modified and
F) at least a terminator sequence of one or more copies.
15. the recombinant nucleic acid molecules of claim 14, the nucleic acid molecule of wherein said modification is corresponding to the nucleotide sequence of pointing out in SEQ ID No.64.
16. claim 14 or 15 any one recombinant nucleic acid molecules, it comprises one or more nucleotide sequences that coding has ω 3-desaturase and/or Δ-active polypeptide of 4-desaturase extraly.
17. transgenic plant, its comprise claim 22 to 25 any one recombinant nucleic acid molecules or be included in the nucleotide sequence of pointing out among the SEQ ID No.64.
18. the purposes that oil, lipid or free fatty acids claimed or that the method by claim 18 obtains are used to produce feed, food, makeup or medicine in the claim 19.
CNA2007800078470A 2006-02-21 2007-02-21 Preparation of polyunsaturated fatty acids Pending CN101400798A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE102006008030.0 2006-02-21
DE102006008030A DE102006008030A1 (en) 2006-02-21 2006-02-21 Preparation of polyunsaturated fatty acids in transgenic plants, useful e.g. for reducing risk of hypertension and heart disease, includes expressing a codon-optimized sequence for delta5-elongase
EP06120309.7 2006-09-07

Publications (1)

Publication Number Publication Date
CN101400798A true CN101400798A (en) 2009-04-01

Family

ID=38288851

Family Applications (1)

Application Number Title Priority Date Filing Date
CNA2007800078470A Pending CN101400798A (en) 2006-02-21 2007-02-21 Preparation of polyunsaturated fatty acids

Country Status (3)

Country Link
CN (1) CN101400798A (en)
DE (1) DE102006008030A1 (en)
ZA (1) ZA200807982B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104178479A (en) * 2014-09-03 2014-12-03 徐毅 Pavlova-viridis-derived delta-6 desaturase new gene
CN105189740A (en) * 2013-03-13 2015-12-23 帝斯曼营养品股份公司 Engineering microorganisms
CN107257630A (en) * 2014-11-14 2017-10-17 巴斯夫植物科学有限公司 The modification of vegetable lipid comprising PUFA
CN113423837A (en) * 2019-02-14 2021-09-21 嘉吉公司 Brassica plants producing increased levels of polyunsaturated fatty acids
CN114891822A (en) * 2022-06-29 2022-08-12 山东理工大学 Construction method of high-yield gamma-linolenic acid mucor circinelloides recombinant bacteria, recombinant bacteria constructed by method and application

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR059376A1 (en) 2006-02-21 2008-03-26 Basf Plant Science Gmbh PROCEDURE FOR THE PRODUCTION OF POLYINSATURATED FATTY ACIDS
PT2337791E (en) 2008-10-14 2013-11-29 Monsanto Technology Llc Utilization of fatty acid desaturases from hemiselmis spp
PL2376638T3 (en) 2008-12-12 2014-01-31 Basf Plant Science Gmbh Desaturases and process for the production of polyunsaturated fatty acids in transgenic organisms
PT2800563T (en) 2012-01-06 2018-11-07 Chrysalis Pharma Ag Dpa-enriched compositions of omega-3 polyunsaturated fatty acids in free acid form
KR20150028233A (en) 2012-05-07 2015-03-13 옴테라 파마슈티칼스, 인크. Compositions of statins and omega-3 fatty acids
CN116218683B (en) * 2022-11-03 2023-11-28 云南农业大学 Mortierella alpina and application thereof in biological prevention and control of pseudo-ginseng and growth promotion

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105189740A (en) * 2013-03-13 2015-12-23 帝斯曼营养品股份公司 Engineering microorganisms
US9873880B2 (en) 2013-03-13 2018-01-23 Dsm Nutritional Products Ag Engineering microorganisms
CN104178479A (en) * 2014-09-03 2014-12-03 徐毅 Pavlova-viridis-derived delta-6 desaturase new gene
CN107257630A (en) * 2014-11-14 2017-10-17 巴斯夫植物科学有限公司 The modification of vegetable lipid comprising PUFA
US11260095B2 (en) 2014-11-14 2022-03-01 Basf Plant Science Company Gmbh Modification of plant lipids containing PUFAs
US11484560B2 (en) 2014-11-14 2022-11-01 Basf Plant Science Company Gmbh Stabilising fatty acid compositions
US11613761B1 (en) 2014-11-14 2023-03-28 Bioriginal Food & Science Corporation Materials and methods for PUFA production, and PUFA-containing compositions
US11813302B2 (en) 2014-11-14 2023-11-14 Basf Plant Science Company Gmbh Brassica events LBFLFK and LBFDAU and methods for detection thereof
CN113423837A (en) * 2019-02-14 2021-09-21 嘉吉公司 Brassica plants producing increased levels of polyunsaturated fatty acids
CN114891822A (en) * 2022-06-29 2022-08-12 山东理工大学 Construction method of high-yield gamma-linolenic acid mucor circinelloides recombinant bacteria, recombinant bacteria constructed by method and application
CN114891822B (en) * 2022-06-29 2024-04-05 山东理工大学 Construction method of high-yield gamma-linolenic acid mucor circinelloides recombinant bacterium, recombinant bacterium constructed by method and application

Also Published As

Publication number Publication date
DE102006008030A1 (en) 2007-08-23
ZA200807982B (en) 2009-11-25

Similar Documents

Publication Publication Date Title
US10533182B2 (en) Oils, lipids and fatty acids produced in transgenic brassica plant
US10035989B2 (en) Method for producing polyunsaturated fatty acids in transgenic plants
AU2006226338B9 (en) Method for producing polyunsaturated C20 and C22 fatty acids with at least four double bonds in transgenic plants
NO20210501A1 (en) Process for the production of polyunsaturated fatty acids in transgenic organisms
US8134046B2 (en) Method for producing arachidonic acid and/or eicosapentaenoic acid in useful transgenic plants
EP1937805B1 (en) Process for the production of arachidonic acid and/or eicosapentaenoic acid
CN101400798A (en) Preparation of polyunsaturated fatty acids

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20090401