CN114891818B

CN114891818B - CD47-VE-M fusion protein, preparation method and application thereof

Info

Publication number: CN114891818B
Application number: CN202210667685.XA
Authority: CN
Inventors: 王贵学; 李姝雨; 张涛; 袁坤山; 张海军
Original assignee: Chongqing University
Current assignee: Chongqing University
Priority date: 2022-06-13
Filing date: 2022-06-13
Publication date: 2023-09-01
Anticipated expiration: 2042-06-13
Also published as: CN114891818A

Abstract

The invention relates to the technical field of biomedicine, and discloses a preparation method of a CD47-VE-M fusion protein, which is characterized in that a CD47 extracellular region, a VE-cadherein extracellular EC1-2 region and Mfp-5 are fused and expressed by genetic engineering and molecular biological technical means to obtain a multifunctional fusion protein CD47-VE-M; also disclosed are uses of the CD47-VE-M fusion proteins. The invention can promote endothelial functionalization as a new method and a new technical means, can improve the endothelial injury repair capability, enhance biocompatibility and has the characteristics of high adhesiveness, endothelialization promotion and anti-inflammatory; in addition, CD47 is used as a new star target point in the tumor world at present, and is used for reducing the adhesion of inflammatory cells and platelets so as to inhibit restenosis and thrombosis in a stent, so that the concept and method for inhibiting restenosis or thrombosis by using various drugs in a drug eluting stent are broken, and a new idea is provided for material surface modification.

Description

CD47-VE-M fusion protein, preparation method and application thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to a CD47-VE-M fusion protein, a preparation method and application thereof.

Background

Cardiovascular disease is a serious disease that seriously threatens human life, coronary artery embolism is one of the most common vascular stenosis type diseases. Percutaneous coronary intervention (Percutaneous coronary intervention, PCI) is currently the most common strategy for revascularization in patients with global obstructive coronary artery disease. With the massive use of drug eluting stents (Drug eluting stent, DES) in PCI therapy, problems such as restenosis and advanced thrombosis after implantation are increasingly apparent. Endothelial injury and inflammatory cascade caused by stent implantation inhibit formation of functionalized endothelium, and are initiating factors for initiating restenosis and late thrombosis. Therefore, the surface modification of the vascular implant, the restoration capability of endothelial injury and the enhancement of biocompatibility are realized, and the new functions of anti-inflammatory, antithrombotic and endothelial functionalization promotion are important points and hot points in the current vascular implant research field.

Intravascular stents are intended to enlarge the vessel and prevent stenosis, however, stents as foreign implants can also cause blood clotting and thrombosis, resulting in restenosis within the stent, one of the approaches to address restenosis within the stent is to rapidly endothelialise the stent and reduce inflammation. VE-cadherin (Vascular endothelial cadherin, VE-cadherin) is a member of the classical cadherin family, with a modular structure of 5 outer domains, a transmembrane domain, and a cytoplasmic tail. Regardless of the organ specificity, diversity, and contact of endothelial cells with other cells, the adherent junctions are common to all endothelial phenotypes. They are characterized by the presence of endothelial specific VE-cadherein and by their close structural and functional association with actin filament cytoskeleton via connexins (e.g. catenin, etc.). VE-cadherein is a type II calcium dependent adhesion molecule that forms the backbone of the adhesive linkage and is therefore expressed in all endothelial cells. Mussels secrete mussel foot proteins (Mytilus foot proteins, mfps) to form secondary lines and adherent plaques, enabling them to adhere to various surfaces (e.g., rock, wood, metal surfaces, marine shells, etc.) in a moist environment. CD47 is a transmembrane protein, widely expressed on various cell types, CD47 belongs to the immunoglobulin superfamily, and is a supramolecular complex composed of integrins, G proteins and cholesterol. Typically, CD47 on healthy cells acts as a "don't eat me" receptor preventing phagocytosis by macrophages, however, if CD47 expression is down-regulated, aging and unwanted cells will be removed by phagocytosis.

Fusion proteins are a class of proteins that integrate two or more different protein domains into one molecule, and researchers have been mimicking the strategy of nature for many years, creating artificial fusion proteins by using recombinant DNA techniques or post-translational modification methods with various applications. Recently, artificial fusion proteins have also been constructed as novel protein switches in some synthetic biological applications; in addition, recombinant fusion proteins, such as engineered antibody fragments, have become a new class of therapeutic agents. The invention uses the technical means such as genetic engineering and molecular biology to fusion express the functional structural domains such as CD47 extracellular region, vascular endothelial cadherin (VE-cadherin) extracellular EC1-2 region and mussel foot protein (Mfp-5) to obtain a multifunctional fusion protein CD47/VE-cadherin/Mfp-5 (CD 47-VE-M for short) with high adhesiveness, endothelialization promotion and anti-inflammatory properties.

Disclosure of Invention

Based on the problems, the invention provides a CD47-VE-M fusion protein, a preparation method and application thereof, and the invention obtains a multifunctional fusion protein with high adhesiveness, endothelialization promotion and anti-inflammatory properties.

In order to solve the technical problems, the invention provides a preparation method of a CD47-VE-M fusion protein, which comprises the following steps:

s1: amplifying the CD47 extracellular domain fragment, the VE-cadherein extracellular EC1-2 region fragment and the Mfp-5 fragment by PCR;

s2: the three fragments amplified in the step S1 are used as templates, primers are designed to be amplified again through PCR, so that the amplified CD47 extracellular domain fragment, VE-cadherein extracellular EC1-2 region fragment and Mfp-5 fragment are provided with homology arms and corresponding linker, the corresponding linker comprises linker-a and linker-b, the amino acid sequence of the linker-b is GGGGS, the amino acid sequence of the linker-a is shown as SEQ ID NO.1, and the re-amplified primer sequences are as follows: the forward primer sequence for amplifying the CD47 extracellular domain fragment is shown as SEQ ID NO.2, the reverse primer sequence for amplifying the CD47 extracellular domain fragment is shown as SEQ ID NO.3, the forward primer sequence for amplifying the VE-cadhererin extracellular EC1-2 region fragment is shown as SEQ ID NO.4, the reverse primer sequence for amplifying the VE-cadhererin extracellular EC1-2 region fragment is shown as SEQ ID NO.5, the forward primer sequence for amplifying the Mfp-5 fragment is shown as SEQ ID NO.6, and the reverse primer sequence for amplifying the Mfp-5 fragment is shown as SEQ ID NO.7;

s3: then carrying out double enzyme digestion on the pCold TF vector by utilizing enzymes EcoR I and BamH I to linearize the pCold TF vector, then carrying out multi-segment homologous recombination by using ClonExpress Ultra One Step Cloning Kit to sequentially carry out homologous recombination on a CD47 extracellular domain segment with a homology arm and a corresponding linker, a VE-cadherein extracellular EC1-2 region segment and an Mfp-5 segment on the pCold TF vector to obtain a pCold TF-CD47-VE-M recombinant vector, and transforming the pCold TF-CD47-VE-M recombinant vector into BL21 (DE 3) escherichia coli competent cells to induce expression to obtain a CD47-VE-M fusion protein;

in the homologous recombination process, a linker-a is used for connecting the CD47 extracellular domain fragment and the VE-cadherin extracellular EC1-2 region amino acid sequence, a linker-b is used for connecting the VE-cadherin extracellular EC1-2 region and the Mfp-5 region amino acid sequence, and the amino acid sequence of the obtained CD47-VE-M fusion protein is shown in SEQ ID NO.8.

Furthermore, the amino acid sequence of the linker-a can also be SEQ ID NO.9, and the amino acid sequence of the obtained CD47-VE-M fusion protein is shown as SEQ ID NO.10.

Further, the PCR reaction system for the re-amplification in the step S2 is as follows:

reagent(s)	Volume (mu L)
		Template DNA	2
2×Max	25
		dNTP	1
Forward primer	1
		Reverse primer	1
DNA polymerase	1
		ddH ₂ O	19
Total volume of	50

The procedure of the PCR reaction for the re-amplification in step S2 is as follows:

temperature (. Degree. C.)	Time
		95	3min
95	15s(28cycle)
		58	15s(28cycle)
72	50s(28cycle)
		10	Hold

Further, the reaction system of the multi-fragment homologous recombination in the step S3 is as follows: the total volume was 10. Mu.L, wherein the linearized pCold TF vector was 2. Mu.L, the CD47 extracellular domain fragment was 1. Mu.L, the VE-cadherein extracellular EC1-2 domain fragment was 0.3. Mu.L, the Mfp-5 fragment was 0.5. Mu.L, the 2 XClonExpress Mix was 5. Mu.L, ddH ₂ O 1.2μL。

Furthermore, in the step S3, isopropyl-beta-D-thiogalactopyranoside IPTG is utilized to induce escherichia coli to express target protein CD47-VE-M fusion protein, and the induction conditions are as follows: escherichia coli bacterial liquid OD ₆₀₀ The value is 0.4-0.6, IPTG concentration is 0.4mM, induction temperature is 16 ℃, and induction time is 20h.

In order to solve the technical problems, the invention also provides the CD47-VE-M fusion protein.

In order to solve the technical problems, the invention also provides application of the CD47-VE-M fusion protein in preparing a vascular stent surface bioactive coating for promoting vascular injury repair.

Further, the preparation method of the active coating comprises the following steps: irradiating the front side and the back side of a 316L stainless steel sheet for 12 hours by using an ultraviolet lamp of an ultra-clean workbench, fully sterilizing the stainless steel sheet, diluting the CD47-VE-M fusion protein solution to the concentration of 10 mug/mL by using sterile PBS, filtering and sterilizing by using a 0.2 mu M filter membrane, placing the 316L stainless steel sheet into a 24-hole cell culture plate, adding an equal volume of diluted sterile protein solution into each hole, standing for 12 hours at room temperature, and coating the protein solution on the sterilized 316L stainless steel sheet by using a physical deposition mode to obtain an active coating.

Compared with the prior art, the invention has the beneficial effects that: the invention successfully constructs the multi-combination fusion protein (Mfp-5 is adhered to the surface of the stent, CD47 is anti-inflammatory and VE-cad promotes endothelial functionalization) to promote endothelial injury repair, and as a novel method and a novel technical means, the invention can promote endothelial functionalization, can improve endothelial injury repair capability, enhance biocompatibility, has high adhesion, endothelialization promotion and anti-inflammatory properties, can be used as a novel coating mode of a drug eluting stent for preventing restenosis and late thrombosis in the stent, and provides a novel strategy for clinically treating vascular stenosis diseases; in addition, CD47 is used as a new star target point in the tumor world at present, and is used for reducing the adhesion of inflammatory cells and platelets so as to inhibit restenosis and thrombosis in a stent, so that the concept and method for inhibiting restenosis or thrombosis by using various drugs in a drug eluting stent are broken, and a new idea is provided for material surface modification.

Drawings

FIG. 1 is a schematic diagram of a prokaryotic expression vector for a CD47-VE-M fusion protein according to an embodiment of the invention;

FIGS. 2a and 2b are gel electrophoresis patterns and SDS-PAGE and Western immunoblotting patterns of purified fusion proteins of recombinant vectors pCold TF-CD47-VE-M, pET a-VE-M and pET32a-VE, respectively, of an embodiment of the present invention;

FIGS. 3a and 3b are graphs showing the adhesion results of endothelial cells on different linker-linked CD47-VE-M fusion protein coatings and a comparison of the number of endothelial cells adhered on different linker-linked CD47-VE-M fusion protein coatings, respectively, according to an embodiment of the present invention;

FIG. 4 is a graph showing the results of hydrophobicity analysis of CD47-VE-M according to the example of the present invention;

FIG. 5 is a result of a conservation analysis of CD47-VE-M of the example of the invention;

FIGS. 6a and 6b are, respectively, a two-level structural analysis of CD47-VE-M and a predictive modeling of the three-level structure of CD47-VE-M according to an embodiment of the invention;

FIGS. 7a and 7b are graphs of AFM and SEM observations of surface topography and roughness results, respectively, of different coatings according to embodiments of the present invention;

FIGS. 8a and 8b are, respectively, water contact angles of different coating surfaces and topography of stent surface coatings before and after balloon expansion in accordance with embodiments of the present invention;

FIG. 9 shows the hemolysis rate of the 316L stainless steel and each protein coating according to the example of the present invention;

FIG. 10 is a graph showing the number and morphology of platelet adhesion on the surface of 316L stainless steel and different protein coatings according to an embodiment of the present invention;

FIG. 11 is a statistical chart of the adhesion number and proliferation ratio of endothelial cells on stainless steel and different protein coatings according to the example of the present invention;

FIGS. 12a and 12b are a statistical plot of the number of endothelial cells adhered to a 316L stainless steel and a different protein coating before and after blocking by VE-cadherin antibodies and a statistical plot of the endothelial cell infiltration capacity on the 316L stainless steel and the different protein coating, respectively, according to the examples of the present invention;

FIG. 13 is a graph showing statistics of scratch healing rates of endothelial cells on a 316L stainless steel and different protein coatings according to an embodiment of the present invention;

FIGS. 14a and 14b are a statistical plot of specific adhesion of the 316L stainless steel and the different protein coatings to ECs and a statistical plot of fluorescence intensity and transcript levels of endothelial cells VE-cadherein on the 316L stainless steel and the different protein coatings, respectively, according to the examples of the present invention;

FIGS. 15a and 15b are respectively the mRNA expression level of the tight junctions of endothelial cells on the 316L stainless steel and the different protein coatings and the eNOS expression level in the supernatant of endothelial cells adhered to the 316L stainless steel and the different protein coatings according to the examples of the present invention;

FIGS. 16a and 16b are, respectively, the effect of the 316L stainless steel and the different protein coating on the in vitro phagocytosis ability of macrophages and the in vitro phagocytosis of macrophages after the 316L stainless steel and the different protein coating were blocked by CD47 antibodies according to the examples of the present invention.

Detailed Description

For the purpose of making apparent the objects, technical solutions and advantages of the present invention, the present invention will be further described in detail with reference to the following examples and the accompanying drawings, wherein the exemplary embodiments of the present invention and the descriptions thereof are for illustrating the present invention only and are not to be construed as limiting the present invention.

Examples:

in this example, the present method for obtaining the target gene fragment (total RNA of endothelial cells is extracted, RNA is reverse transcribed into cDNA in vitro) is first used to obtain the target gene fragment CD47 extracellular domain fragment, VE-cadhererin extracellular EC1-2 region fragment and Mfp-5 fragment, and when the target gene fragment is amplified, VE-cadhererin extracellular domain, CD47 extracellular domain and Mfp-5 are respectively amplified by polymerase chain reaction (Polymerase chain reaction, PCR) through specific primer sequences listed in the following tables and respectively corresponding template cDNAs, and the PCR reaction system is as follows.

PCR primer sequence of the gene fragment of the entry

Table PCR reaction system

After the reaction system is blown and evenly mixed, the fragment amplification is carried out according to the PCR amplification program shown in the following table:

table PCR amplification procedure

And (3) recovering and purifying the PCR product by using the kit, and then carrying out a second PCR by using the amplified target fragment as a template, wherein the purpose of the PCR is to add a corresponding vector and a homologous arm of the fragment to be recombined to CD47, VE-cad and Mfp-5, and connect a corresponding linker at the same time so as to prepare for subsequent multi-fragment homologous recombination. The sequence of the primers designed in the second PCR amplification (i.e.amplification with homology arms and linker) is as follows:

CD47 forward primer:

TGGCTGATATCGGATCCATGTGGCCCCTGGTAGCG

CD47 reverse primer:

TCAATGTGCATGAATTCCTTCGCCGCCGCCTCCTTCGCCGCCGCCTCGTTATTCCTAGGAGGTTGTATAGTCTTCTGA

VE-cadherin forward primer:

TGGCTGATATCGGATCCATGTGGCCCCTGGTAGCG

VE-cadherin reverse primer:

TCAATGTGCATGAATTCCTTCGCCGCCGCCTCCTTCGCCGCCGCCTCGTTATTCCTAGGAGGTTGTATAGTCTTCTGA

mfp-5 forward primer:

GTACCCTCGAGGGATCCATGTGGCCCCTGGTAGCG

mfp-5 reverse primer:

TCGACAAGCTTGAATTCCTCGAGCTAACTGCTACCACCT

the second PCR amplification system was as follows:

reagent(s)	Volume (mu L)
		Template DNA	2
2×Max	25
		dNTP	1
Forward Primer	1
		Reverse Primer	1
DNA polymerase	1
		ddH ₂ O	19
Total	50

The second PCR amplification procedure was as follows:

Prokaryotic expression vectors were constructed and linearized by double digestion of pCold TF and pET32a vectors with the enzymes EcoRI and BamHI. And (3) performing multi-fragment homologous recombination by using ClonExpress Ultra One Step Cloning Kit of Nanjing Vazyme, so that CD47, VE-cad and Mfp-5 are subjected to sequential homologous recombination on pCold TF vectors, VE is connected to pET32a, VE-cad and Mfp-5 is connected to pET32a, and three recombinant vectors of pCold TF-CD47-VE-M, pET a-VE and pET32a-VE-M are obtained, wherein the pET32a-VE and pET32a-VE-M recombinant vectors are control groups of subsequent experiments. The specific experimental steps are as follows:

1) Preparing a reaction system shown in the following table on ice;

reaction system for table multi-fragment homologous recombination

2) Gently sucking and beating the system by using a pipetting gun, uniformly mixing, and collecting the reaction liquid to the bottom of a tube by short centrifugation;

3) The reaction solution was reacted at 50℃for 15 minutes using a PCR instrument, and then immediately cooled on ice.

(3) Recombinant product conversion

1) Placing a chemically competent cell DH5 alpha of escherichia coli for cloning on ice for thawing;

2) Adding 5-10 μl of recombinant product into 100 μl of competent cells, mixing with light elastic tube wall, and standing on ice for 30min;

3) Heat shock is carried out for 45s in a water bath at the temperature of 42 ℃, and then the mixture is immediately placed on ice for cooling for 2-3min;

4) 900. Mu.L of fresh LB liquid medium (without antibiotics) is added, and the mixture is shaken at 37 ℃ and 220rpm for 1h; ampicillin (Amp) resistant LB solid medium plates were pre-heated in a 37℃incubator;

5) Centrifuging the bacterial liquid at 5000rpm for 5min after shaking, and discarding 900 mu L of supernatant; re-suspending the bacteria with the remaining medium, gently plating on a plate containing Amp resistance with a sterile plating bar;

6) The coated plates were incubated upside down in a 37℃incubator for 12-16h.

(4) Identification of recombinant expression vectors

1) Picking up the single clone on the overnight culture plate in the step (3), placing the single clone in 15mL of fresh LB liquid medium containing Amp antibiotics, and shaking the single clone in a shaking table at 37 ℃ and 220rpm for 12-16h;

2) Taking the bacterial liquid which is shaken overnight as a template DNA, and carrying out colony PCR to identify the homologous recombination vector; the system and procedure for colony PCR are shown in the following table:

TABLE 2.10 colony PCR System

TABLE 2.11 colony PCR procedure

3) Detecting products of colony PCR by agarose gel electrophoresis;

4) And (3) sending corresponding bacterial liquid (100 mu L) with the electrophoresis detection result meeting the expected requirement to the Optimaceae company for sequencing, extracting plasmids from the residual bacterial liquid through a kit, and storing the plasmids in a refrigerator at the temperature of minus 20 ℃.

Induction expression of fusion proteins:

1) The successfully constructed pET32a, pET32a-VE-M and pCold TF-CD47-VE-M recombinant plasmids with correct sequences are respectively transformed into BL21 (DE 3) escherichia coli competent cells (the transformation steps are the same as DH5 alpha transformation); coating the transformed competent cells of the escherichia coli on LB solid medium containing Amp resistance, and placing the coated competent cells of the escherichia coli in a constant temperature incubator at 37 ℃ for inversion culture for 12-16h;

2) The monoclonal colony is picked up in 15mL LB (containing 0.1% Amp) liquid culture medium, and is shaken for 12-16h under the conditions of 37 ℃ and 220 rpm; sucking the shaken bacterial liquid according to the proportion of 1:100 is inoculated in fresh LB liquid medium containing Amp resistance for expansion culture until bacterial liquid OD ₆₀₀ The value reaches 0.4-0.6;

3) The addition of Isopropyl-beta-D-thiogalactopyranoside (IPTG) induces E.coli to express the target proteins, and the induction conditions of the proteins are shown in the following table:

TABLE 2.12 conditions for inducible expression of fusion proteins

4) Immediately placing the induced escherichia coli bacterial liquid on ice for cooling, and centrifuging for 10min at the temperature of 4 ℃ and at the speed of 8000 rpm;

5) Preparing a lysate: weigh 7.80g NaH ₂ PO ₄ ·2H ₂ O, 17.54g NaCl, 0.68g imidazole, deionized water to 1L, prepared to 50mM NaH ₂ PO ₄ The pH of the 300mM NaCl,10mM imidazole lysate was adjusted to 8.0 using NaOH solution. Weighing a proper amount of lysozyme powder, and dissolving the lysozyme powder in the lysate until the final concentration of the lysozyme is 1mg/mL; protease inhibitor (Phenylmethylsulfonyl fluoride, PMSF) was added to a final concentration of 1mM; placing the prepared lysate in a refrigerator at 4 ℃ for standby;

6) The bacterial liquid before centrifugation: lysate = 25:1, fully suspending the escherichia coli bacterial precipitate by using a lysate, uniformly mixing, and standing and cracking for 1h on ice;

7) Carrying out ice bath ultrasonic crushing on the mixed solution after the full cracking is finished, wherein the power of an ultrasonic crusher is set to 30%, the crushing time is 5min, and the stopping time is 5min until the liquid is clear and transparent; after ultrasonic crushing, centrifuging the liquid at 4 ℃ and 8000rpm for 10min, and placing the supernatant in a refrigerator at-80 ℃ for preservation;

8) The induced expression of the fusion protein is detected by SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and the result of protein electrophoresis is observed and analyzed by coomassie brilliant blue staining, and the fusion protein is purified and identified.

The endothelial adhesion properties of fusion protein coatings constructed by different linker were also studied in this example, and the method of constructing the coatings was as follows:

1) Irradiating the front side and the back side of the 316L stainless steel sheet for 12 hours by using an ultraviolet lamp of an ultra-clean workbench, so that the stainless steel sheet is fully sterilized;

2) The solution of the CD47-VE-M fusion protein constructed by linker-1, linker-2, linker-3, linker-4 and linker-5 is diluted to a concentration of 10 mu g/mL by sterile PBS, and filtered and sterilized by a 0.2 mu M filter membrane;

3) Placing a stainless steel sheet into a 24-hole cell culture plate, adding an equal volume of diluted sterile protein solution into each hole, standing for 12 hours at room temperature, and coating the protein solution on the sterilized 316L stainless steel sheet by using a physical deposition mode to obtain corresponding protein coatings, wherein each group of coatings is provided with 3 repetitions. The adhesion properties of the above coatings to endothelial cells were studied in comparison and bioinformatics analysis of the fusion proteins was performed.

FIG. 1 shows the recombinant protein vector (pCold TF-CD 47-VE-M) constructed in this example. As can be seen from FIG. 2a, the recombinant vector pCold TF-CD47-VE-M and recombinant vectors pET32a-VE and pET32a-VE-M containing the gene fragments of CD47, VE-cadherin and Mfp-5 were obtained successfully in this example. As can be seen from the sequencing results of the recombinant vectors by the company, three recombinant vectors, namely pCold TF-CD47-VE-M, pET32a-VE and pET32a-VE-M, were successfully constructed in this example, and the sequences of the recombinant fragments on the three vectors were completely correct. This shows that this example successfully obtained a prokaryotic expression vector for the CD47-VE-M fusion protein.

Because the gene fragments of the fusion protein are not simply and directly connected, five different types of linker are designed to complete the molecular construction of the fusion protein in the embodiment, the five linker are named as linker-1, linker-2, linker-3, linker-4 and linker-5 respectively, and the amino acid sequences of the five linker are as follows: linker-1: EAAAKEAAAKEF; linker-2: GGGGSGGGGSGGGGS; linker-3: CCGGAATTCATG; linker-4: KESGSVSSEQLAQFRSLD; linker-5: EGKSSGSGSESKST.

The five linker are connected with the CD47 extracellular domain and the VE-cadherin extracellular EC1-2 region amino acid sequence, and the linker-b (GGGGS) is used for connecting the VE-cadherin extracellular EC1-2 region and the amino acid sequence of Mfp-5. The amino acid sequence of the CD47/Linker-a/VE-cad/Linker-b/Mfp-5 after ligation is as follows (Linker-a is the above five Linker, in this example only the sequence linking Linker-1 and Linker-2 is given):

CD47/Linker-1/VE-cad/Linker-b/Mfp-5：

MWPLVAALLLGSACCGSAQLLFNKTKSVEFTFCNDTVVIPCFVTNMEAQNTTEVYVKWKFKGRDIYTFDGALNKSTVPTDFSSAKIEVSQLLKGDASLKMDKSDAVSHTGNYTCEVTELTREGETIIELKYRVVSWFSPNENEAAAKEAAAKEFMHIDEEKNTSLPHHVGKIKSSVSRKNAKYLLKGEYVGKVFRVDAETGDVFAIERLDRENISEYHLTAVIVDKDTGENLETPSSFTIKVHDVNDNWPVFTHRLFNASVPESSAVGTSVISVTAVDADDPTVGDHASVMYQILKGKEYFAIDNSGRIITITKSLDREKQARYEIVVEARDAQGLRGDSGTATVLVTLQDGGGGSSSEEYKGGYYPGNTYHYHSGGSYHGSGYHGGYKGKYYGKAKKYYYKYKNSGKYKYLKKARKYHRKGYKKYYGGGSS*

CD47/Linker-2/VE-cad/Linker-b/Mfp-5：

MWPLVAALLLGSACCGSAQLLFNKTKSVEFTFCNDTVVIPCFVTNMEAQNTTEVYVKWKFKGRDIYTFDGALNKSTVPTDFSSAKIEVSQLLKGDASLKMDKSDAVSHTGNYTCEVTELTREGETIIELKYRVVSWFSPNENGGGGSGGGGSGGGGSMHIDEEKNTSLPHHVGKIKSSVSRKNAKYLLKGEYVGKVFRVDAETGDVFAIERLDRENISEYHLTAVIVDKDTGENLETPSSFTIKVHDVNDNWPVFTHRLFNASVPESSAVGTSVISVTAVDADDPTVGDHASVMYQILKGKEYFAIDNSGRIITITKSLDREKQARYEIVVEARDAQGLRGDSGTATVLVTLQDGGGGSSSEEYKGGYYPGNTYHYHSGGSYHGSGYHGGYKGKYYGKAKKYYYKYKNSGKYKYLKKARKYHRKGYKKYYGGGSS*

in the embodiment, the purified 5 fusion proteins CD47-VE-M containing different linker-a are coated on the surface of 316L stainless steel by a physical deposition method to form a CD47-VE-M coating, and the activity of the CD47-VE-M of different linker is verified by inoculating endothelial cells on the protein coating of different linker and observing the adhesion condition of the coating on the endothelial cells.

See FIG. 2bA, wherein VE is VE-cadherin; VE-M is a fusion protein; CD47-VE-M is a fusion protein; it can be seen that although different types of linker may have activity or function differences, in protein electrophoresis, CD47-VE-M with different linker shows little difference in electrophoresis bands due to the substantially same molecular weight, and the purified protein electrophoresis image also shows that the molecular weight of VE protein is about 40KD, the molecular weight of VE-M fusion protein is about 62KD, and the molecular weight of CD47-VE-M fusion protein is about 137KD. In addition, the purified VE and VE-M, CD-VE-M are all collected from the supernatant of the broken thalli, which shows that the three proteins are expressed in a large amount in a soluble form in escherichia coli, and can be directly used for preparing a coating after purification without renaturation.

The VE protein and VE-M fusion protein are identified by the N-terminal antibody of VE-cadherin, the CD47 antibody is used for identifying the CD47-VE-M fusion protein, and the Western immunoblotting result shows that the purified VE protein, VE-M fusion protein and CD47-VE-M fusion protein have the EC1-2 of VE-cadherin, and VE-M-CD47 can be specifically combined with the CD47 antibody, so that the CD47-VE-M fusion protein has the CD47 extracellular domain. Since there is no specific antibody against Mfp-5 protein, the present example is temporarily unable to perform immunoblotting of Mfp-5, a functional moiety. The results of WB further confirm that this example did purify a trifunctional fusion protein with the CD47 extracellular domain, VE-cadherein extracellular EC1-2 segment and Mfp-5.

See fig. 3a and 3b, wherein 316L is 316L medical stainless steel; linker 1-5 is a CD47-VE-M fusion protein connected by different linkers; compared with a 316L stainless steel bare sheet, the quantity of endothelial cells adhered on a fusion protein CD47-VE-M coating connected by using a linker-1 and a linker-2 is increased by 2.5 times and 2.2 times respectively, so that the adhesion capacity of the endothelial is obviously improved, and the fact that the fusion protein CD47-VE-M connected by using the linker-1 and the linker-2 has normal functional activity is shown. The adhesion capability of the CD47-VE-M fusion protein coating connected by the linker-3, the linker-4 and the linker-5 on endothelial cells is not significantly different from that of 316L stainless steel, which shows that the three linkers have larger influence on the function of the constructed fusion protein, and the activity of the VE-cadherein domain is possibly influenced, so that the fusion protein is inactive or has lower activity. Since the linker-1-linked CD47-VE-M fusion protein had the strongest adhesion to endothelial cells, the protein was selected for further analysis in the relevant experiments of this example.

The basic physicochemical properties of the fusion protein CD47-VE-M constructed by linker-1 are analyzed by an online prediction server, and the result shows that the amino acid number of the fusion protein CD47-VE-M is 432, the theoretical relative molecular weight is 47993.85Da, the actual relative molecular weight after purification is 137kDa (pCold-TF chaperone containing 48 kDa), the theoretical isoelectric point (Isoelectric point, pI) is 8.45, the prediction half-life period is more than 30h in mammals, more than 20h in yeasts, and more than 10h in E.coli, and the gene engineering expression is facilitated. The instability index (Instability index) was 25.32 and the lipid solubility index (Aliphatic index) was 69.49, indicating good protein stability (instability index < 40, the peptide was considered a stable polypeptide). The overall average hydrophilicity value (GRAVY of-0.528) also shows that the fusion protein CD47-VE-M is a hydrophilic protein (GRAVY values positive indicate that the protein is a hydrophobic protein).

As shown in FIG. 4, the hydrophobicity analysis result shows that the CD47-VE-M fusion protein is a hydrophilic protein. Leucine 8 has the highest hydrophobicity (2.422), and lysine 417 has the strongest hydrophilicity (-3.033). As shown in FIG. 5, the N-terminal of the CD47-VE-M fusion protein has an immunoglobulin variable region (IgV) with a CD47 superfamily conserved domain, and the middle segment contains a cadherin tandem repeat domain and a cadherin repeat superfamily conserved domain. The E-value shows very high homology between the two. See FIG. 6a, the secondary structure of the CD47-VE-M fusion protein consists essentially of Alpha helices (18.06%), extended strands (30.32%), beta turns (14.12%), random coil (37.50%). The predicted tertiary structure of the CD47-VE-M fusion protein was simulated using SWISS-MODEL as shown in FIG. 6b.

In the embodiment, the surface characteristics and the microscopic morphology of the 316L stainless steel and different fusion protein coatings are observed through an atomic force microscope and a scanning electron microscope, and are shown in fig. 7a and 7b, wherein 316L SS is 316L medical stainless steel; VE is VE-cadherin; VE-M is a fusion protein; CD47-VE-M is a fusion protein; AFM results show that the roughness of the surfaces of the 316L stainless steel, the VE coating, the VE-M coating and the CD47-VE-M coating are respectively 9.35+/-2.1 nm, 13.05+/-1.6 nm, 16.42+/-1.8 nm and 23.12+/-0.9 nm, compared with the 316L stainless steel, the roughness of the surfaces of the different protein coatings is increased, but the roughness of all the protein coatings is far lower than the protein adsorption level (< 50 nm), the requirements of the country on the blood compatibility of bioactive materials are met, and platelet aggregation or thrombus formation cannot be caused. SEM results show specific topographical features of 316L stainless steel, VE-M and CD47-VE-M coatings at 1000-fold and 5000-fold magnification. AFM and SEM data show that the morphology of different coatings is changed, and particularly the morphology change of the CD47-VE-M coating is most obvious; the 316L stainless steel bare sheet has a rough surface with nano-scale metal stubs, which may be randomly formed metal textures when the stainless steel sheet is polished and mirror-finished; the VE, VE-M and CD47-VE-M coatings all showed effective adhesion of the corresponding proteins to the stainless steel sheet. Furthermore, it is evident that the VE, VE-M and CD47-VE-M coatings are not particularly uniform, which may be due to the physical deposition employed in the preparation of the coatings.

The hydrophilic and hydrophobic properties of the fusion protein coating are studied through a static water contact angle test in the embodiment, and related researches show that when the surface of the vascular implant material is too hydrophilic or too hydrophobic, the interaction of the vascular implant material with various cells and proteins can be affected, so that thrombus is formed. Referring to fig. 8a, the water contact angle of each coating surface is smaller than 90 degrees, which indicates that each protein coating has hydrophilic property; the water contact angle of the surface of the VE protein coating is 72.5+/-4.5 degrees, and the water contact angle is larger, so that the weakest hydrophilicity is shown; the water contact angle of the surface of the 316L stainless steel bare sheet is 38.4+/-4.1 degrees, the water contact angle is smaller, and the strongest hydrophilicity is shown; whereas the water contact angles of the surfaces of the VE-M and CD47-VE-M fusion protein coatings were 56.3+ -2.7℃and 43.9+ -3.3℃respectively, the hydrophilicity became more moderate relative to the 316L stainless steel and VE protein coatings. Therefore, the CD47-VE-M fusion protein coating can have better biocompatibility and is more beneficial to the application of vascular tissue engineering.

When a vascular stent is press fitted onto an angioplasty balloon and expanded, severe and complex deformations are experienced. This example takes an in vitro stent as an example, and the mechanical behavior of CD47-VE-M as a coating after stent expansion for 30s at 8atm pressure is observed and analyzed. See fig. 8b, the CD47-VE-M coating deposited on the stent is very uniform and continuous. Thus, the CD47-VE-M can be kept intact before and after stent expansion, and cannot break or fall off. This indicates that the CD47-VE-M fusion protein coating has sufficient flexibility to follow the deformation of the 316L stainless steel stent, allowing the balloon of the stent to expand without cracking or peeling from the stent wire.

The blood compatibility of the CD47-VE-M fusion protein was also studied in this example, and the hemolysis rates of the 316L stainless steel and the different protein coatings were examined by hemolysis experiments, and as shown in FIG. 9, the hemolysis rates of the 316L stainless steel, VE protein, VE-M and CD47-VE-M fusion proteins were 1.147.+ -. 0.09%, 1.953.+ -. 0.08%, 1.280.+ -. 0.10% and 1.227.+ -. 0.03%, respectively. Although the haemolysis rate of the VE protein coating was significantly higher than that of the other groups, the haemolysis rate of all samples to be tested was far less than the national standard (5%), and there was no significant difference in haemolysis rate between the 316L stainless steel, VE-M and CD47-VE-M groups, indicating that the CD47-VE-M fusion protein did not lead to haemolysis, with good haemocompatibility.

Referring to FIG. 10, the present example shows that the number of platelets adhered to the CD47-VE-M fusion protein coating is significantly reduced by the platelet adhesion test, and that the platelet shape remains substantially in the form of an unactivated disc without deformation and aggregation of the platelets. Thus, the CD47-VE-M fusion protein is capable of significantly inhibiting the adhesion, aggregation and activation of platelets in blood, showing very good blood compatibility.

The biological function of the CD47-VE-M fusion protein coating was also evaluated by a series of in vitro cell experiments. See fig. 11, fig. 12a, fig. 12b, fig. 13, fig. 14a, fig. 14b, fig. 15a, fig. 15b, fig. 16a, fig. 16b.

The in vitro endothelial cell adhesion and proliferation experiment proves that the CD47-VE-M fusion protein coating can significantly promote the adhesion and proliferation of endothelial cells. The remarkable promotion effect of the CD47-VE-M fusion protein coating on endothelial cell adhesion is verified by VE-cadherin antibody neutralization experiments, because the CD47-VE-M fusion protein contains VE-cadherin extracellular EC1-2 segments, and a large amount of adhesion of endothelial cells can be mediated by trans-dimer formation through interaction with endogenous VE-cadherin EC1 in endothelial cells. The interaction of VE-cadherin with alpha-catenin occurs through beta-catenin, which is the basis for dynamic participation in the cytoskeleton, and F-actin distribution of endothelial cells on the CD47-VE-M fusion protein coating is also mainly concentrated at cell junctions under the influence of VE-cadherin, and endothelial cell permeability is reduced, indicating that the CD47-VE-M fusion protein helps to maintain the adhesive junction and barrier function between cells. The CD47-VE-M fusion protein enhances the expression of endogenous VE-cadherin by its VE-cadherin active portion, followed by triggering intracellular signaling via the FAK/AKT/Bcl-2 pathway to promote proliferation and specific function of endothelial cells.

In this example, the effect of the CD47-VE-M fusion protein on endothelial cell infiltration capacity was analyzed by the hydrolytic capacity of endothelial cells on the coating of the fusion protein on gelatin substrate, and the effect of the CD47-VE-M fusion protein on endothelial cell migration rate was investigated by cell scratch healing experiments. The infiltration of endothelial cells to the substrate is a precondition for migration, and experimental results prove that the CD47-VE-M fusion protein remarkably promotes the infiltration capacity of endothelial cells to the substrate and remarkably improves the migration capacity of endothelial cells. Co-culture experiments of endothelial cells and smooth muscle cells (1:1) prove that the CD47-VE-M fusion protein coating has selective specificity for the adhesion of endothelial cells, the adhesion quantity of the endothelial cells is far greater than that of the smooth muscle cells, and the adhesion condition of the smooth muscle cells is not different among groups, so that the CD47-VE-M fusion protein specifically adheres to the endothelial cells. Through detection of the form and expression level of endogenous VE-cadherin on the fusion protein coating, the VE-cadherin extracellular activity domain in the CD47-VE-M fusion protein can obviously enhance the connection form of endogenous VE-cadherin of endothelial cells, so that the adhesion connection between adjacent endothelial cells is more compact, and the qPCR result shows that the gene transcription level of endogenous VE-cadherin of endothelial cells on the CD47-VE-M fusion protein coating is obviously increased. In addition, analysis of the transcript levels of the three tightly-linked proteins (ZO-1, claudin-5 and Occludin) of endothelial cells on the fusion protein coating revealed that the CD47-VE-M fusion protein coating was able to increase the transcript level of ZO-1, however, had no promoting effect on transcription of Claudin-5 and Occludin.

In the embodiment, the eNOS expression level of endothelial cells on the fusion protein coating is also detected by ELISA, and the result shows that the CD47-VE-M fusion protein coating remarkably improves the eNOS expression of the endothelial cells, and shows good endothelial friendly property of the CD 47-VE-M. The anti-inflammatory properties of the CD47-VE-M fusion protein coating were evaluated by phagocytosis of di dnps by macrophages in vitro. Experimental results show that the quantity of DiDNPs phagocytized by macrophages on the CD47-VE-M fusion protein coating at 0.5, 1, 2 and 4 hours is extremely lower than that of the other groups, and the DiDNPs show excellent phagocytosis inhibiting capability of the macrophages. The active binding site of the CD47 domain on the CD47-VE-M fusion protein is blocked by a CD47 antibody, the phagocytic capacity of macrophages on the CD47-VE-M coating is recovered to be normal, the amount of the phagocytic DiDNPs is basically equivalent at 0.5, 1, 2 and 4 hours, and no obvious difference exists, so that the CD47-VE-M fusion protein inhibits the phagocytosis of the macrophages through the CD47 domain, escapes immunity, and reduces the inflammatory infiltration degree of stent implantation sites.

The adhesion of the coating to the substrate and to the cells is critical for modification of the coating on the stent surface, and many methods for promoting re-endothelialization and endothelial functionalization have been reported at present, wherein biological methods are mainly antibody adhesion, transgene, fusion protein and the like. Both surface protein antibodies adhere well to transgenic endothelial cells, but transgenes are difficult to use clinically and have limited binding capacity for antibodies to adhere to materials. The fusion protein has good biocompatibility, and if the fusion protein with specific adhesion to endothelial cells and cell function promoting performance can be constructed, the adhesion, proliferation and migration of the endothelial cells can be selectively and specifically promoted, and the endothelial repair of the surface of the cardiovascular implant material can be accelerated. In vascular endothelial injury repair, the key of vascular steady-state reconstruction is that the anti-inflammatory and endothelial rapid functionalization are combined, and the construction of a multifunctional fusion protein active coating with high-strength material surface adhesion, endothelial and substrate adhesion enhancement and endothelial cell adhesion enhancement on the surface interface of implants such as vascular stents and the like can inhibit restenosis and thrombosis in the stent.

At present, accelerating the re-endothelialization of vascular stents is a long-standing hot spot field, and the functionalization of new endothelium has a crucial effect. The embodiment constructs the multi-combination fusion protein (Mfp-5 is adhered to the surface of the bracket, CD47 is anti-inflammatory and VE-cad promotes endothelial functionalization) by means of genetic engineering so as to promote endothelial injury repair, and is a novel method and a novel technical means for promoting endothelial functionalization. CD47 is used as a new star target in the tumor world at present, and in this embodiment, is used to reduce the adhesion of inflammatory cells and platelets, thereby inhibiting restenosis and thrombosis in the stent, and breaks through the concept and method of inhibiting restenosis or thrombosis in the drug-eluting stent by using various drugs, so that the introduction of CD47 factor is also a big spot of the present invention.

The above is an embodiment of the present invention. The foregoing embodiments and the specific parameters of the embodiments are only for clarity of description of the invention and are not intended to limit the scope of the invention, which is defined by the appended claims, and all equivalent structural changes made in the description and drawings of the invention are intended to be included in the scope of the invention.

Sequence listing

<110> university of Chongqing

<120> CD47-VE-M fusion protein, preparation method and application thereof

<130> 2022 month 6

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 12

<212> PRT

<213> Synthesis (Artificial synthesis)

<400> 1

Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu Phe

1 5 10

<210> 2

<211> 35

<212> DNA

<213> Synthesis (Artificial synthesis)

<400> 2

tggctgatat cggatccatg tggcccctgg tagcg 35

<210> 3

<211> 78

<212> DNA

<213> Synthesis (Artificial synthesis)

<400> 3

tcaatgtgca tgaattcctt cgccgccgcc tccttcgccg ccgcctcgtt attcctagga 60

ggttgtatag tcttctga 78

<210> 4

<211> 35

<212> DNA

<213> Synthesis (Artificial synthesis)

<400> 4

tggctgatat cggatccatg tggcccctgg tagcg 35

<210> 5

<211> 78

<212> DNA

<213> Synthesis (Artificial synthesis)

<400> 5

tcaatgtgca tgaattcctt cgccgccgcc tccttcgccg ccgcctcgtt attcctagga 60

ggttgtatag tcttctga 78

<210> 6

<211> 35

<212> DNA

<213> Synthesis (Artificial synthesis)

<400> 6

gtaccctcga gggatccatg tggcccctgg tagcg 35

<210> 7

<211> 39

<212> DNA

<213> Synthesis (Artificial synthesis)

<400> 7

tcgacaagct tgaattcctc gagctaactg ctaccacct 39

<210> 8

<211> 432

<212> PRT

<213> Synthesis (Artificial synthesis)

<400> 8

Met Trp Pro Leu Val Ala Ala Leu Leu Leu Gly Ser Ala Cys Cys Gly

1 5 10 15

Ser Ala Gln Leu Leu Phe Asn Lys Thr Lys Ser Val Glu Phe Thr Phe

20 25 30

Cys Asn Asp Thr Val Val Ile Pro Cys Phe Val Thr Asn Met Glu Ala

35 40 45

Gln Asn Thr Thr Glu Val Tyr Val Lys Trp Lys Phe Lys Gly Arg Asp

50 55 60

Ile Tyr Thr Phe Asp Gly Ala Leu Asn Lys Ser Thr Val Pro Thr Asp

65 70 75 80

Phe Ser Ser Ala Lys Ile Glu Val Ser Gln Leu Leu Lys Gly Asp Ala

85 90 95

Ser Leu Lys Met Asp Lys Ser Asp Ala Val Ser His Thr Gly Asn Tyr

100 105 110

Thr Cys Glu Val Thr Glu Leu Thr Arg Glu Gly Glu Thr Ile Ile Glu

115 120 125

Leu Lys Tyr Arg Val Val Ser Trp Phe Ser Pro Asn Glu Asn Glu Ala

130 135 140

Ala Ala Lys Glu Ala Ala Ala Lys Glu Phe Met His Ile Asp Glu Glu

145 150 155 160

Lys Asn Thr Ser Leu Pro His His Val Gly Lys Ile Lys Ser Ser Val

165 170 175

Ser Arg Lys Asn Ala Lys Tyr Leu Leu Lys Gly Glu Tyr Val Gly Lys

180 185 190

Val Phe Arg Val Asp Ala Glu Thr Gly Asp Val Phe Ala Ile Glu Arg

195 200 205

Leu Asp Arg Glu Asn Ile Ser Glu Tyr His Leu Thr Ala Val Ile Val

210 215 220

Asp Lys Asp Thr Gly Glu Asn Leu Glu Thr Pro Ser Ser Phe Thr Ile

225 230 235 240

Lys Val His Asp Val Asn Asp Asn Trp Pro Val Phe Thr His Arg Leu

245 250 255

Phe Asn Ala Ser Val Pro Glu Ser Ser Ala Val Gly Thr Ser Val Ile

260 265 270

Ser Val Thr Ala Val Asp Ala Asp Asp Pro Thr Val Gly Asp His Ala

275 280 285

Ser Val Met Tyr Gln Ile Leu Lys Gly Lys Glu Tyr Phe Ala Ile Asp

290 295 300

Asn Ser Gly Arg Ile Ile Thr Ile Thr Lys Ser Leu Asp Arg Glu Lys

305 310 315 320

Gln Ala Arg Tyr Glu Ile Val Val Glu Ala Arg Asp Ala Gln Gly Leu

325 330 335

Arg Gly Asp Ser Gly Thr Ala Thr Val Leu Val Thr Leu Gln Asp Gly

340 345 350

Gly Gly Gly Ser Ser Ser Glu Glu Tyr Lys Gly Gly Tyr Tyr Pro Gly

355 360 365

Asn Thr Tyr His Tyr His Ser Gly Gly Ser Tyr His Gly Ser Gly Tyr

370 375 380

His Gly Gly Tyr Lys Gly Lys Tyr Tyr Gly Lys Ala Lys Lys Tyr Tyr

385 390 395 400

Tyr Lys Tyr Lys Asn Ser Gly Lys Tyr Lys Tyr Leu Lys Lys Ala Arg

405 410 415

Lys Tyr His Arg Lys Gly Tyr Lys Lys Tyr Tyr Gly Gly Gly Ser Ser

420 425 430

<210> 9

<211> 15

<212> PRT

<213> Synthesis (Artificial synthesis)

<400> 9

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210> 10

<211> 435

<212> PRT

<213> Synthesis (Artificial synthesis)

<400> 10

Met Trp Pro Leu Val Ala Ala Leu Leu Leu Gly Ser Ala Cys Cys Gly

1 5 10 15

Ser Ala Gln Leu Leu Phe Asn Lys Thr Lys Ser Val Glu Phe Thr Phe

20 25 30

Cys Asn Asp Thr Val Val Ile Pro Cys Phe Val Thr Asn Met Glu Ala

35 40 45

Gln Asn Thr Thr Glu Val Tyr Val Lys Trp Lys Phe Lys Gly Arg Asp

50 55 60

Ile Tyr Thr Phe Asp Gly Ala Leu Asn Lys Ser Thr Val Pro Thr Asp

65 70 75 80

Phe Ser Ser Ala Lys Ile Glu Val Ser Gln Leu Leu Lys Gly Asp Ala

85 90 95

Ser Leu Lys Met Asp Lys Ser Asp Ala Val Ser His Thr Gly Asn Tyr

100 105 110

Thr Cys Glu Val Thr Glu Leu Thr Arg Glu Gly Glu Thr Ile Ile Glu

115 120 125

Leu Lys Tyr Arg Val Val Ser Trp Phe Ser Pro Asn Glu Asn Gly Gly

130 135 140

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Met His Ile

145 150 155 160

Asp Glu Glu Lys Asn Thr Ser Leu Pro His His Val Gly Lys Ile Lys

165 170 175

Ser Ser Val Ser Arg Lys Asn Ala Lys Tyr Leu Leu Lys Gly Glu Tyr

180 185 190

Val Gly Lys Val Phe Arg Val Asp Ala Glu Thr Gly Asp Val Phe Ala

195 200 205

Ile Glu Arg Leu Asp Arg Glu Asn Ile Ser Glu Tyr His Leu Thr Ala

210 215 220

Val Ile Val Asp Lys Asp Thr Gly Glu Asn Leu Glu Thr Pro Ser Ser

225 230 235 240

Phe Thr Ile Lys Val His Asp Val Asn Asp Asn Trp Pro Val Phe Thr

245 250 255

His Arg Leu Phe Asn Ala Ser Val Pro Glu Ser Ser Ala Val Gly Thr

260 265 270

Ser Val Ile Ser Val Thr Ala Val Asp Ala Asp Asp Pro Thr Val Gly

275 280 285

Asp His Ala Ser Val Met Tyr Gln Ile Leu Lys Gly Lys Glu Tyr Phe

290 295 300

Ala Ile Asp Asn Ser Gly Arg Ile Ile Thr Ile Thr Lys Ser Leu Asp

305 310 315 320

Arg Glu Lys Gln Ala Arg Tyr Glu Ile Val Val Glu Ala Arg Asp Ala

325 330 335

Gln Gly Leu Arg Gly Asp Ser Gly Thr Ala Thr Val Leu Val Thr Leu

340 345 350

Gln Asp Gly Gly Gly Gly Ser Ser Ser Glu Glu Tyr Lys Gly Gly Tyr

355 360 365

Tyr Pro Gly Asn Thr Tyr His Tyr His Ser Gly Gly Ser Tyr His Gly

370 375 380

Ser Gly Tyr His Gly Gly Tyr Lys Gly Lys Tyr Tyr Gly Lys Ala Lys

385 390 395 400

Lys Tyr Tyr Tyr Lys Tyr Lys Asn Ser Gly Lys Tyr Lys Tyr Leu Lys

405 410 415

Lys Ala Arg Lys Tyr His Arg Lys Gly Tyr Lys Lys Tyr Tyr Gly Gly

420 425 430

Gly Ser Ser

435

Claims

The preparation method of the CD47-VE-M fusion protein is characterized by comprising the following steps:

s1: amplifying the CD47 extracellular domain fragment, the VE-cadherein extracellular EC1-2 region fragment and the Mfp-5 fragment by PCR;

s2: the three fragments amplified in the step S1 are used as templates, primers are designed to be amplified again through PCR, so that the amplified CD47 extracellular domain fragment, VE-cadherein extracellular EC1-2 region fragment and Mfp-5 fragment are provided with homology arms and corresponding linker, the corresponding linker comprises linker-a and linker-b, the amino acid sequence of the linker-b is GGGGS, the amino acid sequence of the linker-a is shown as SEQ ID NO.1, and the re-amplified primer sequences are as follows: the forward primer sequence for amplifying the CD47 extracellular domain fragment is shown as SEQ ID NO.2, the reverse primer sequence for amplifying the CD47 extracellular domain fragment is shown as SEQ ID NO.3, the forward primer sequence for amplifying the VE-cadhererin extracellular EC1-2 region fragment is shown as SEQ ID NO.4, the reverse primer sequence for amplifying the VE-cadhererin extracellular EC1-2 region fragment is shown as SEQ ID NO.5, the forward primer sequence for amplifying the Mfp-5 fragment is shown as SEQ ID NO.6, and the reverse primer sequence for amplifying the Mfp-5 fragment is shown as SEQ ID NO.7;

s3: then carrying out double enzyme digestion on the pCold TF vector by utilizing enzymes EcoRI and BamHI to linearize the pCold TF vector, then carrying out multi-segment homologous recombination by using ClonExpress Ultra One Step Cloning Kit to sequentially carry out homologous recombination on a CD47 extracellular domain fragment with a homology arm and a corresponding linker, a VE-cadherein extracellular EC1-2 region fragment and a Mfp-5 fragment onto the pCold TF vector to obtain a pCold TF-CD47-VE-M recombinant vector, and transforming the pCold TF-CD47-VE-M recombinant vector into BL21 (DE 3) escherichia coli competent cells to induce expression to obtain a CD47-VE-M fusion protein;

in the homologous recombination process, a linker-a is used for connecting the CD47 extracellular domain fragment and the VE-cadherin extracellular EC1-2 region amino acid sequence, a linker-b is used for connecting the VE-cadherin extracellular EC1-2 region and the Mfp-5 region amino acid sequence, and the amino acid sequence of the obtained CD47-VE-M fusion protein is shown in SEQ ID NO.8.
2. The preparation method according to claim 1, wherein the amino acid sequence of linker-a can be SEQ ID NO.9, and the amino acid sequence of the obtained CD47-VE-M fusion protein is shown in SEQ ID NO.10.
3. The method according to claim 1, wherein the re-amplified PCR reaction system in step S2 is as follows:

the procedure of the PCR reaction for the re-amplification in step S2 is as follows:

temperature (. Degree. C.) Time 95 3min 95 15s(28cycle) 58 15s(28cycle) 72 50s(28cycle) 10 Hold

。
4. The method according to claim 1, wherein the reaction system for the multi-fragment homologous recombination in step S3 is as follows: the total volume was 10. Mu.L, wherein the linearized pCold TF vector was 2. Mu.L, the CD47 extracellular domain fragment was 1. Mu.L, the VE-cadherein extracellular EC1-2 domain fragment was 0.3. Mu.L, the Mfp-5 fragment was 0.5. Mu.L, the 2 XClonExpress Mix was 5. Mu.L, ddH ₂ O 1.2μL。
5. The preparation method according to claim 1, wherein in the step S3, isopropyl-beta-D-thiogalactopyranoside IPTG is used to induce escherichia coli to express the target protein CD47-VE-M fusion protein, and the induction conditions are as follows: escherichia coli bacterial liquid OD ₆₀₀ The value is 0.4-0.6, IPTG concentration is 0.4mM, induction temperature is 16 ℃, and induction time is 20h.
6. A CD47-VE-M fusion protein prepared by the method of any one of claims 1-5.
7. Use of the CD47-VE-M fusion protein of claim 6 for the preparation of a surface bioactive coating of a vascular stent for pro-vascular injury repair.
8. The use according to claim 7, wherein the active coating is prepared by the following method: irradiating the front side and the back side of a 316L stainless steel sheet for 12 hours by using an ultraviolet lamp of an ultra-clean workbench, fully sterilizing the stainless steel sheet, diluting the CD47-VE-M fusion protein solution to the concentration of 10 mug/mL by using sterile PBS, filtering and sterilizing by using a 0.2 mu M filter membrane, placing the 316L stainless steel sheet into a 24-hole cell culture plate, adding an equal volume of diluted sterile protein solution into each hole, standing for 12 hours at room temperature, and coating the protein solution on the sterilized 316L stainless steel sheet by using a physical deposition mode to obtain an active coating.