CN114885950B - Application of colistin sulfate in pest control - Google Patents
Application of colistin sulfate in pest control Download PDFInfo
- Publication number
- CN114885950B CN114885950B CN202210408462.1A CN202210408462A CN114885950B CN 114885950 B CN114885950 B CN 114885950B CN 202210408462 A CN202210408462 A CN 202210408462A CN 114885950 B CN114885950 B CN 114885950B
- Authority
- CN
- China
- Prior art keywords
- spodoptera frugiperda
- colistin sulfate
- colistin
- larvae
- salt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
- A01N43/713—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with four or more nitrogen atoms as the only ring hetero atoms
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention belongs to the technical field of pesticides, discloses application of colistin sulfate in pest control, and particularly discloses application of colistin sulfate or salts thereof in pest control. The colistin sulfate or the salts thereof provided by the invention not only can delay the pupation time of the pest larvae, but also can enable the pest larvae to be abnormally pupated or even die without pupation, and has the insecticidal effect.
Description
Technical Field
The invention belongs to the technical field of pesticides, and particularly relates to application of colistin sulfate in pest control.
Background
As a newly discovered foreign invasive species, spodoptera frugiperda rapidly spreads in China, and brings great threat and influence on agricultural production activities in China. The traditional chemical pesticide is largely used for remedying the spodoptera frugiperda, so that not only can the environment and food be seriously polluted, but also the spodoptera frugiperda has generated resistance to various pesticides, so that a new target point needs to be searched urgently nowadays, and a novel pesticide is developed.
G4 The higher-order structure of DNA (G4-DNA, G4 structure) is complementary to the double helix structure of classical DNA, and in recent years, more and more researches show that G4 and i-motif structures (another higher-order structure which is complementary with G4 in sequence) are widely existed in organisms and play important functions in various biological processes such as DNA replication, gene transcription, RNA translation and telomere protection. The G4 structure and the binding protein thereof which participate in gene transcription regulation are expected to become a new target for pest control, and the combined small molecular compound is expected to play an important role as a target spot of a novel pesticide, so that the pesticide has a wide market prospect.
Colistin sulfate (molecular formula: C) 52 H 98 N 16 O 13 ·2H 2 SO 4 CAS No. 1264-72-8) also known as Colistin sulfate, colistin (Colistin), polymyxin E (Polymyxin E), colistin, etc., white or nearly white powder, odorless, bitter in taste, hygroscopic, readily soluble in water, slightly soluble in methanol, ethanol, acetone, ether, etc., free base slightly soluble in water, stable at a pH of 3-7.5. Colistin sulfate is produced by polymyxa, has strong antibacterial effect on gram-negative bacteria, is used for treating intestinal diseases caused by gram-negative bacteria, is used as feed additive, and has obvious growth promoting effect. At present, the application of colistin sulfate in pest control is not seen.
Disclosure of Invention
The object of the first aspect of the present invention is to provide the use of colistin sulfate or salts thereof for controlling pests.
The object of the second aspect of the invention is to provide the use of colistin sulphate or salts thereof for the preparation of a product for controlling pests.
The object of the third aspect of the present invention is to provide the use of colistin sulfate or a salt thereof for the preparation of G4-DNA binding agents.
The fourth aspect of the present invention aims at providing the application of colistin sulfate or salts thereof in preparing products for delaying the pupation time of lepidoptera insects.
The object of the fifth aspect of the present invention is to provide the use of colistin sulfate or a salt thereof for inhibiting the steroid hormone biosynthesis pathway.
It is an object of a sixth aspect of the present invention to provide a method for controlling pests.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
in a first aspect of the present invention, there is provided the use of colistin sulphate or a salt thereof for controlling pests.
Preferably, the pest is a lepidopteran insect.
Further preferably, the pests are one or more of prodenia litura, tobacco hornworm, cotton bollworm, plutella xylostella, beet armyworm and spodoptera frugiperda.
Still more preferably, the pest is spodoptera frugiperda.
Preferably, the colistin sulfate or a salt thereof is used for controlling pests by binding to a G4 structure in the body of the pests.
Preferably, the colistin sulfate or the salt thereof is contained in an amount of 50 to 300. Mu.M; further 100 to 300. Mu.M; further 200 to 300. Mu.M.
In a second aspect of the invention, there is provided the use of colistin sulphate or a salt thereof in the manufacture of a product for the control of pests.
Preferably, the pest is a lepidopteran insect.
Further preferably, the pests are one or more of prodenia litura, tobacco hornworm, cotton bollworm, plutella xylostella, beet armyworm and spodoptera frugiperda.
Still more preferably, the pest is spodoptera frugiperda.
Preferably, the product is an insecticide or a pesticide.
Preferably, the product can be prepared into conventional dosage forms for use, such as dry powder, wettable powder, emulsifiable concentrate, microemulsion, paste, granules or suspension.
Preferably, the colistin sulfate or a salt thereof is used for controlling pests by binding to a G4 structure in the body of the pests.
Preferably, the colistin sulfate or the salt thereof is contained in an amount of 50 to 300. Mu.M; further 100 to 300. Mu.M; further 200 to 300. Mu.M.
In a third aspect of the invention, there is provided the use of colistin sulphate or a salt thereof in the preparation of a G4-DNA binding agent.
Preferably, the colistin sulfate or the salt thereof is contained in an amount of 50 to 300. Mu.M; further 100 to 300. Mu.M; further 200 to 300. Mu.M.
In a fourth aspect of the invention, there is provided the use of colistin sulphate or a salt thereof in the manufacture of a product for delaying the time to pupation of an insect of the order lepidoptera.
Use of colistin sulphate or a salt thereof for delaying the time to pupate lepidopteran insects.
Use of colistin sulphate or a salt thereof for the preparation of a product for promoting the metamorphosis of lepidopteran insects.
Use of colistin sulphate or a salt thereof for promoting the metamorphosis development of lepidopteran insects.
Preferably, the lepidoptera insect is one or more of prodenia litura, tobacco hornworm, cotton bollworm, plutella xylostella, beet armyworm and spodoptera frugiperda; further comprises Spodoptera frugiperda.
Preferably, the colistin sulfate or the salt thereof is contained in an amount of 50 to 300. Mu.M; further 100 to 300. Mu.M; further 200 to 300. Mu.M.
In a fifth aspect of the invention, there is provided the use of colistin sulphate or a salt thereof for inhibiting the steroid hormone biosynthesis pathway.
Use of colistin sulphate or a salt thereof for the preparation of a product for inhibiting the steroid hormone biosynthetic pathway.
Preferably, the colistin sulfate or the salt thereof is contained in an amount of 50 to 300. Mu.M; further 100 to 300. Mu.M; further 200 to 300. Mu.M.
In a sixth aspect of the present invention, there is provided a method for controlling pests, which comprises applying colistin sulfate or a salt thereof to the pests or a habitat of the pests.
Preferably, an effective dose of colistin sulfate or a salt thereof is applied to the pests or to the habitat of the pests.
The present invention provides a method for controlling pests, which comprises treating the pests, their food products, their habitat or breeding ground (soil, area, material or environment in which the pests are growing or may grow, or the materials, cultivated plants, plant propagation material (such as seeds), soils, surfaces or spaces to be protected from attack or infestation by the pests with colistin sulphate or a salt thereof.
In general, an "effective amount" means the amount of active ingredient required to achieve an observable effect on growth, including the effects of necrosis, death, retardation, prevention and removal, destruction or otherwise reducing the presence and activity of the target organism. For colistin sulfate or salts thereof used in the present invention, the effective amount may vary. The effective amount of the colistin sulfate or salt thereof also varies depending on the prevailing conditions, such as the desired pesticidal effect and duration, climate, target species, locus, mode of application, etc.
The invention has the beneficial effects that:
the colistin sulfate or the salts thereof provided by the invention not only can delay the pupation time of the pest larvae, but also can enable the pest larvae to be abnormally pupated or even die without pupation, and has the insecticidal effect.
After the colistin sulfate or the salt thereof is combined with the G4 structure, the genes related to various metabolic pathways in spodoptera frugiperda bodies are reduced, and the genes related to the biosynthesis of steroid hormones are reduced, so that spodoptera frugiperda larvae can not normally molt and die in the pupation process.
Drawings
FIG. 1 is a circular dichroism map of the G4 structure in combination with colistin sulfate.
FIG. 2 is a statistical graph of the number of spodoptera frugiperda deaths within 180h for different treatment groups.
FIG. 3 is a statistical graph showing the pupation number of Spodoptera frugiperda in 180 hours in different treatment groups.
FIG. 4 shows the mortality and pupation rates of Spodoptera frugiperda in different treatment groups.
FIG. 5 is a graph showing a comparison of Spodoptera frugiperda larvae from different treatment groups.
FIG. 6 is a graph of abnormal pupation of Spodoptera frugiperda larvae in experimental groups.
FIG. 7 shows genes differentially expressed by Spodoptera frugiperda in experimental and control groups; wherein A is a control group and B is an experimental group.
FIG. 8 shows GO enrichment and KEGG enrichment results of up-regulated genes of Spodoptera frugiperda in experimental and control groups.
Fig. 9 is the top 20 significant GO term enriched by down-regulated gene GO of spodoptera frugiperda in experimental and control groups.
Figure 10 is the results of the first 20 significant pathways enriched by KEGG, a down-regulated gene for spodoptera frugiperda in experimental and control groups.
Detailed Description
The present invention will now be described in detail with reference to specific examples, but the scope of the present invention is not limited thereto.
The materials, reagents and the like used in the present examples are commercially available materials and reagents unless otherwise specified.
Example 1 interaction of colistin sulfate with the G4 Structure
Preparing 200. Mu.L of G4 detection solution, wherein the detection solution contains 5. Mu.M of DNA probe (the DNA probe can form a G4 structure, and the nucleotide sequence of the DNA probe is GTGCGGCGCGCGAGGGCCGAGGGCGGGCAA (SEQ ID NO: 1)), 100mM KCl and 50mM Tris-HCl (pH7.4)); fully and uniformly mixing the prepared G4 detection solution, and annealing at 95 ℃ for 10min; after the reaction is finished, placing the DNA probe in hot water of 95 ℃, slowly cooling the temperature to room temperature (25 ℃) in a room, and taking at least 4 hours to enable the DNA probe to form a G4 structure; adding colistin sulfate with different concentrations (the concentrations are 0 μ M, 50 μ M, 100 μ M and 200 μ M respectively) into the detection solution with the G4 structure formed, incubating overnight at 4 ℃, and placing the mixture in a circular dichroism chromatograph for CD detection, wherein the detection conditions are as follows: 200 mu L of sample to be detected is added into a CD detection quartz cuvette, a detection port (the direction of the quartz cuvette is unchanged during each detection) is arranged, the wavelength is adjusted to be 220 nm-350 nm, the bandwidth is adjusted to be 1.0nm, the reaction time is 0.5s, the scanning speed is 100nm/min, and the average value is obtained by repeating the scanning for 3 times.
The G4 structure has a different configuration, distinguished primarily by the fact that successive G's form the four-sided course of the structure. The case where the adjacent continuous G chains have uniform spatial orientation is called parallel G4 structure, and the parallel G4 structure has a pair of typical positive peaks around 260nm and 240nm negative peaks in the CD result. As can be seen from FIG. 1, when colistin sulfate was not added, the CD result showed a positive peak at 265nm and a negative peak at 240nm, which are characteristic peaks of the G4 structure, demonstrating that the DNA probe synthesized by us can form the G4 structure in vitro and is a parallel G4 structure. When colistin sulfate with different concentrations is added, the CD characteristic peak of the G4 structure is obviously changed, and the characteristic peak is obviously changed when the colistin sulfate concentration is higher, which shows that the colistin sulfate can be combined with the G4 structure, and the high concentration (200 mu M) has a quite strong effect with the G4 structure.
Example 2 insecticidal Effect of colistin sulfate on Spodoptera frugiperda
After confirming that colistin sulfate can be combined with a G4 structure, we begin to explore the insecticidal effect of colistin sulfate on Spodoptera frugiperda, and specific experiments are as follows:
taking 40 larvae of Spodoptera frugiperda of 6 days old, averagely dividing the larvae into two groups, wherein each group comprises 20 larvae, and the larvae are divided into an experimental group and a control group, wherein the experimental group comprises: spraying about 50 μ L of 120mM colistin sulfate solution to each larva at 10 am and 5 pm every day until the Spodoptera frugiperda larvae pupate; control group: approximately 50. Mu.L of water was sprayed onto each larva at 10 am and 5 pm each day until the Spodoptera frugiperda larvae pupate. Two groups of spodoptera frugiperda larvae are cultured under normal culture conditions (the humidity is 26 ℃, the relative humidity is 60%, and the photoperiod is 10 hours), and the survival quantity and the final pupation quantity of the spodoptera frugiperda larvae after each spraying are respectively observed and recorded.
Through observation (the growth conditions of all groups of spodoptera frugiperda are shown in figure 5) and statistics of the survival number and the final pupation number of the spodoptera frugiperda larvae of the control group and the experimental group, the result shows that the spodoptera frugiperda larvae of the control group do not die within 180 hours, the death rate is 0%, the spodoptera frugiperda larvae sprayed with colistin sulfate solution do not die within 100 hours, the spodoptera frugiperda larvae are all active, and the fact that the influence of the colistin sulfate on the spodoptera frugiperda larvae is small is shown; when the time exceeds 100 hours, the spodoptera frugiperda starts to enter a pupation stage, the spodoptera frugiperda in a control group can be normally pupated, the pupation quantity is continuously increased along with the time extension, 20 spodoptera frugiperda larvae are successfully pupated after 180 hours, the spodoptera frugiperda larvae sprayed with the colistin sulfate solution are delayed for about 24 hours relative to the pupation time of the spodoptera frugiperda larvae in the control group, the spodoptera frugiperda gradually dies from the pre-pupation stage, the death quantity is gradually increased along with the time extension, 12 spodoptera frugiperda larvae die in 180 hours, the death rate reaches 60%, only 6 spodoptera frugiperda successfully pupate, and the pupation success rate is 45% (fig. 2, fig. 3 and fig. 4); in addition, abnormal pupation of Spodoptera frugiperda larvae occurred in the experimental group (FIG. 6). The results show that colistin sulfate can not only make the spodoptera frugiperda larva pupate in time, but also more importantly can make the spodoptera frugiperda larva abnormally pupate or even can not pupate and die, so that the colistin sulfate can have certain influence on the abnormal development of the spodoptera frugiperda, and the colistin sulfate has certain insecticidal action on the spodoptera frugiperda from the overall mortality and pupation rate.
Example 3 Gene expression in Spodoptera following various treatments
On the basis of example 2, we further performed transcriptome sequencing of Spodoptera frugiperda larvae in the experimental and control groups, and analyzed the resulting transcriptome data, as follows: taking two ends of Spodoptera frugiperda at the end of an experimental group and a control group to perform transcriptome sequencing, performing quantitative analysis on obtained transcriptome data by using Salmonon, then analyzing gene quantitative data by using DESeq2 to obtain up-regulated and down-regulated genes and the number of the up-regulated and down-regulated genes of the experimental group relative to the control group, and finally performing GO enrichment analysis and KEGG enrichment analysis on the up-regulated and down-regulated genes respectively.
As a result, as shown in FIG. 7, by analyzing transcriptome data of spodoptera frugiperda larvae of the control and experimental groups, it was found that there were many differentially expressed genes in the two groups, and that most of the genes of spodoptera frugiperda larvae of the experimental group were expressed with their expression down-regulated relative to those of spodoptera frugiperda larvae of the control group in these differentially expressed genes (FIG. 7), indicating that the G4 structure is involved in regulation of gene expression, and that colistin sulfate binds to the G4 structure to affect gene expression. Further GO enrichment analysis and KEGG enrichment analysis are carried out on up-regulated genes and down-regulated genes, and we find that most of the first 20 significant GO term of the down-regulated genes are genes related to some metabolic processes (such as proteolysis, carbohydrate metabolism, single body metabolism and the like) (fig. 9), while most of the GO enrichment structures of the up-regulated genes are related to the development and differentiation of epidermal cells (fig. 8), and these results suggest that the abnormal pupation phenomenon of spodoptera frugiperda larvae is probably that the old epidermis cannot be normally sloughed off due to the development of the epidermal cells and the up-regulated genes, but the abnormal pupation phenomenon occurs because most of the genes in the metabolic processes are inhibited. While the most prominent 20 pathways enriched by KEGG for down-regulated genes are metabolic pathways (e.g. cytochrome P450 metabolism to xenobiotics, retinol metabolism, ascorbic acid and aldehydic acid metabolism, etc.), in addition to that, there is a Steroid hormone biosynthesis pathway (Steroid hormone biosynthesis pathway) which is down-regulated (fig. 10), wherein 20-hydroxyecdysone (20E) is one of the Steroid hormone biosynthesis pathways, 20E is an ecdysone, 20E can promote the apoptosis of larval tissues in insects and play a role as a regulatory factor in the neogenesis of adult tissues and in insect molting and molting metamorphosis, so it can be speculated that the binding of colistin sulfate to the G4 structure in an experimental group leads to the down-regulation of the Steroid hormone biosynthesis pathway resulting in the abnormal molting of spodoptera frugiperda larvae during the pupation process, which leads to the death of spodoptera larvae or abnormal molting.
In conclusion, the combination of colistin sulfate and the G4 structure can reduce the genes related to various metabolic pathways and the genes related to the biosynthesis of steroid hormones, so that the larvae of spodoptera frugiperda can not normally molt and die in the pupation process, and the colistin sulfate has a good insecticidal effect.
The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present invention. Furthermore, the embodiments of the present invention and features of the embodiments may be combined with each other without conflict.
SEQUENCE LISTING
<110> Lingnan laboratory of Guangdong province in modern agricultural science and technology
South China Normal University
Application of <120> colistin sulfate in pest control
<130>
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 33
<212> DNA
<213> Artificial sequence
<400> 1
gtgcggggcg cgagggggcc gaggggcggg caa 33
Claims (3)
1. Use of colistin sulphate or a salt thereof for controlling a pest, which is spodoptera frugiperda.
2. The use according to claim 1, wherein the colistin sulfate or salt thereof is present in an amount of 50 to 300. Mu.M.
3. A method for controlling pests, which comprises applying colistin sulfate or a salt thereof to a pest which is spodoptera frugiperda or a habitat of a pest.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210408462.1A CN114885950B (en) | 2022-04-19 | 2022-04-19 | Application of colistin sulfate in pest control |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210408462.1A CN114885950B (en) | 2022-04-19 | 2022-04-19 | Application of colistin sulfate in pest control |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114885950A CN114885950A (en) | 2022-08-12 |
| CN114885950B true CN114885950B (en) | 2023-03-24 |
Family
ID=82716772
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210408462.1A Active CN114885950B (en) | 2022-04-19 | 2022-04-19 | Application of colistin sulfate in pest control |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114885950B (en) |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS52154521A (en) * | 1976-06-15 | 1977-12-22 | Kayaku Antibiotic Research Co | Agricultural and horticultural drug |
| WO2001043766A1 (en) * | 1999-12-14 | 2001-06-21 | Asahi Kasei Kabushiki Kaisha | Colistin sulfate granules |
| AR035799A1 (en) * | 2001-03-30 | 2004-07-14 | Syngenta Participations Ag | INSECTICIDE TOXINS ISOLATED FROM BACILLUS THURINGIENSIS AND ITS USES. |
| EP2424488B1 (en) * | 2009-04-27 | 2023-06-07 | Premier Dental Products Company | Microencapsulated compositions and methods for tissue mineralization |
| GB201409451D0 (en) * | 2014-05-28 | 2014-07-09 | Ipabc Ltd | Antimicrobial preparations, methods for preparing the same and uses thereof to combat microorganisms |
| CN107873052B (en) * | 2015-05-14 | 2021-08-31 | 肯塔基大学研究基金会 | Compositions and methods for pest control management |
| CN112021336A (en) * | 2020-08-25 | 2020-12-04 | 广东省农业科学院植物保护研究所 | Method for preventing and treating Spodoptera frugiperda based on composite microbial quick-acting pesticide granules |
-
2022
- 2022-04-19 CN CN202210408462.1A patent/CN114885950B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114885950A (en) | 2022-08-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR20160079013A (en) | Strigolactone formulations and uses thereof | |
| Wang et al. | Functions of two Malus hupehensis (Pamp.) Rehd. YTPs (MhYTP1 and MhYTP2) in biotic-and abiotic-stress responses | |
| HU221991B1 (en) | Beauvericin detoxification compositions and methods | |
| Nanthakumar et al. | Decrease of rice plant resistance and induction of hormesis and carboxylesterase titre in brown planthopper, Nilaparvata lugens (Stål) by xenobiotics | |
| Ibraheem | Cyanobacteria as alternative biological conditioners for bioremediation of barren soil | |
| CN111264543B (en) | Purine base plant immunity inducing agent and application thereof | |
| Ballhorn et al. | Quantitative effects of enhanced CO2 on jasmonic acid induced plant volatiles of lima bean (Phaseolus lunatus L.) | |
| Li et al. | OsPAL2-1 mediates allelopathic interactions between rice and specific microorganisms in the rhizosphere ecosystem | |
| CN115572688A (en) | Bacillus cereus with high poisoning activity on plant parasitic nematodes and application thereof | |
| Qiu et al. | Use of Bacillus velezensis SDTB022 against tobacco black shank (TBS) and the biochemical mechanism involved | |
| CN114885950B (en) | Application of colistin sulfate in pest control | |
| KR20190051410A (en) | Composition and method of controlling virus mediated by small brown planthopper using dsRNA targeting nuclear receptor E75 gene of small brown planthopper | |
| Wang et al. | Gene analysis of genetically modified soybean lectin based on fluorescence quantitative PCR | |
| Liu et al. | The role of symbiotic fungi in the life cycle of Gastrodia elata Blume (Orchidaceae): a comprehensive review | |
| CN110951730B (en) | dsRNA of cryptopteris viridis V-ATPase-A gene, artificial feed and application thereof | |
| Aryati et al. | Effect of soybean variety and pest management on the sustainable production | |
| Torkamand et al. | Comparison of susceptibility of melon aphid populations, Aphis gossypii Glover (Hemiptera: Aphididae), from seven regions in Iran to pirimicarb and Malathion | |
| JP5366474B2 (en) | Gibberellin signaling pathway inhibitor for plants containing D-allose as an active ingredient and use thereof | |
| Torkamand et al. | Comparison of susceptibility of melon aphid, Aphis gossypii Glover (Hemiptera: Aphididae), to pirimicarb and malathion in seven regions in Iran | |
| KR101771841B1 (en) | Serratia glossinae GS2 strain having activities plant growth promotion and insecticide, and uses thereof | |
| CN110178856A (en) | Combination sterilization composition and its application for preventing and treating tomato root-knot eelworm disease | |
| CN111820237A (en) | Insecticidal composition and application thereof | |
| Ezin et al. | Gene expression and phenotypic characterization of flooding tolerance in tomato | |
| CN110495388B (en) | Application of lauric acid in preparation of plant resistance activator | |
| El Shamey et al. | Genetical analysis for allelopathic activity in some rice varieties |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |