CN114875070A - GLP-1R high expression vector, recombinant HEK293 cell based on GLP-1R high expression vector, construction method and application - Google Patents

Abstract

The invention discloses a GLP-1R high expression vector, a recombinant HEK293 cell based on the same, and a construction method and application of the recombinant HEK293 cell, wherein a GV358-GLP-1R eukaryotic cell expression vector is constructed by using GV358 lentiviral plasmid and is transfected to the HEK293 cell, a genetic engineering cell line HEK293-GLP-1R stably transferring full-length GLP-1R is obtained by screening puromycin, and the cell line can improve the protein expression of the full-length GLP-1R by 10.96 times compared with the HEK293 cell through Western blot experiments at the protein level; and the engineering cell line HEK293-GLP-1R can be used for screening medicines taking GLP-1R as targets, such as reducing blood sugar, reducing fat, improving cognitive function and the like.

Description

GLP-1R high expression vector, recombinant HEK293 cell based on GLP-1R high expression vector, construction method and application

Technical Field

The invention belongs to the technical field of biology, relates to construction of GLP-1R high-expression stable non-cancer cells, and particularly relates to a GLP-1R high-expression vector, a recombinant HEK293 cell based on the GLP-1R high-expression vector, a construction method and application of the recombinant HEK293 cell.

Background

G protein-coupled receptors (GPCRs) are the largest family of cell surface receptors in the human genome. GPCRs convert extracellular stimuli such as hormones and cytokines into intracellular signals, which are achieved by mediating downstream G-protein signaling through GPCR activation. In addition, receptor desensitization, β -arrestins signal recruitment, receptor endocytosis play a regulatory role in signal transduction. GPCR structures include the N-terminal extracellular domain (ECD), the C-terminal seven transmembrane domain (TMD), and the G protein (Nat Commun,2020,11(1): 1272). ECD is a spherical structure fixed by three pairs of conserved cysteine disulfide bonds, which comprises a trilayer stable structure of the α - β - β - α sheet, playing an important role in the downstream signaling activation pathway triggered by activation of the group B GPCR. G proteins are composed of 3 subunits, i.e., G α, G β and G γ, and activated GPCRs induce GDP exchange in the G α subunit, resulting in a conformational change in the G protein, allowing release of the G α subunit from the G β and G γ dimers, with free G α activating downstream second messengers. The two-domain binding model suggests that recognition of the C-terminus of peptide hormones via ECD is initiated, inducing the N-terminus of the peptide to penetrate into the core of the TMD receptor, resulting in conformational changes in the proximal end of TMD, triggering G-protein coupling and downstream signaling cascades (Nature,2018,555: 121-125).

The glucagon-like peptide-1 receptor (GLP-1R) is a B-group GPCR that is widely expressed in the intestinal tract, pancreas, central nervous system, heart, kidney, vasculature, and contains 463 amino acids. The N-terminal ECD of the GLP-1R is a peptide binding position, and the binding of the C-terminal of the peptide and the ECD has important significance for the specific recognition of a ligand. GLP-1R is a pleiotropic coupled receptor, accessible through a variety of pathways including G.alpha. _s 、Gα _i 、Gα _o 、Gα _q/11 The G protein coupling pathway within (Biochim Biophys,2001,1546: 79-86) is used for signaling. Among them, the role of GLP-1R in the G.alpha.s-coupled pathway has been well documented, increasing the level of the second messenger cAMP by increasing the level of adenosine triphosphate cyclase (AC), and subsequently promoting egg productionIncreased expression of Protein Kinase A (PKA) and cAMP-2 activated exchanger protein (exchange protein activated by cAMP-2, Epac2), thereby enhancing transcription and translation of the insulinotropic gene. In addition, GLP-1R activation is via inhibition of K ⁺ Channel activation, allowing voltage-dependent Ca ²⁺ Channel (voltage-dependent Ca) ²⁺ channels, VDCCs) to accelerate extracellular Ca ²⁺ Influx occurs, resulting in the effect of insulin secretion from the islet beta cells. Activation of GLP-1R also promotes transactivation of Epidermal Growth Factor Receptor (EGFR), enhances phosphatidylinositol 3 enzyme activity (PI 3K), promotes insulin receptor substrate 2 (IRS-2) signaling, enhances extracellular signal-regulated kinase 1 and 2 (ERK 1/2) activity, and promotes nuclear translocation of PKC ζ (Natl Acad Sci,2008,105:6614 and 6619). Moreover, GLP-1R activation has significant effects in reducing appetite, inhibiting gastric emptying, reducing inflammatory response, and reducing the incidence of cardiovascular adverse events in diabetic patients (Cell Metab,2016,24(1): 15-30).

Diabetes is a metabolic syndrome which seriously threatens human health, and the development of a novel hypoglycemic medicament becomes an important field of medicament research due to the limitation of the conventional hypoglycemic medicament. The broad effects exerted by GLP-1R agonists depend on the broad distribution of GLP-1R in the human body. The existing GLP-1R agonist is mainly based on structural modification of endogenous GLP-1, the action half-life period is prolonged while the internal activity is preserved, and the clinical application of the GLP-1R agonist is limited due to the characteristics of peptides. The non-peptide GLP-1R agonist is an important direction for developing new drugs, and has great clinical prospect. The GLP-1R is taken as a target spot, and the search of a medicament with an agonistic action on the GLP-1R becomes an important means for the research and development of diabetes treatment medicaments. The GLP-1R antagonist can be used as a laboratory tool drug to study the disease mechanism.

At present, the biological effect of GLP-1R is researched more, but the construction and the biological application of a full-length sequence GLP-1R vector are rarely reported.

Disclosure of Invention

The invention aims to provide a GLP-1R high expression vector, a recombinant HEK293 cell based on the GLP-1R high expression vector, a construction method and application.

In order to achieve the purpose, the invention adopts the following technical scheme to realize the purpose:

the invention discloses a GLP-1R high expression vector, which comprises a GLP-1R full-length gene, wherein the nucleotide sequence of the GLP-1R full-length gene is shown in SEQ.ID.NO. 1.

Preferably, the GLP-1R high expression vector is an exogenous expression vector.

Further preferably, the GLP-1R high expression vector is a GV358-GLP-1R eukaryotic cell expression vector constructed by a GV358 lentiviral plasmid.

The invention also discloses a GLP-1R high-expression HEK293 recombinant cell which is constructed by transfecting the GLP-1R high-expression vector to a host cell HEK293 cell.

The invention also discloses application of the high GLP-1R expression HEK293 recombinant cell in drug screening.

Preferably, the drug is a drug targeting GLP-1R.

Preferably, the medicament is a medicament for treating diabetes.

The invention also discloses a construction method of the HEK293 recombinant cell with high GLP-1R expression, which comprises the following steps:

1) constructing a GLP-1R high expression vector, namely a GV358-GLP-1R eukaryotic cell expression vector;

2) the GV358-GLP-1R eukaryotic cell expression vector was transfected into HEK293 cells.

Preferably, in step 1), the GV358-GLP-1R is used as a basic vector, and the primer sequences are as follows:

an upstream primer: ATGGATCTTCAGGCTCTACGT

A downstream primer: GTCTGCATTTGATGTCTGTCTTG

Constructing to obtain the GLP-1R high expression vector.

Preferably, in the step 2), a lentivirus packaging system containing a virus packaging helper plasmid and a tool vector plasmid carrying a target gene is adopted to be transferred into HEK293 cells;

the lentivirus packaging system comprises three plasmids of a GV lentivirus vector, a pHelper 1.0 vector and a pHelper 2.0 vector;

and adding puromycin with the concentration of 10 mu g/mL into a DMEM culture medium for screening for 14 days to obtain positive clone cells, selecting puromycin resistant monoclonal clones for subculture, adjusting the puromycin concentration in the DMEM complete culture medium to 5 mu g/mL after 4 weeks, and continuing culturing to obtain stable GV358-GLP-1R positive transfected clone cell strains, namely the GLP-1R high-expression HEK293 recombinant cells.

Compared with the prior art, the invention has the following beneficial effects:

1. the invention constructs a GLP-1R eukaryotic expression vector GV358-GLP-1R, and the gene sequencing result is consistent with that of a gene library human GLP-1R;

2. the invention further constructs the GV358-GLP-1R vector lentivirus transfected HEK293 cells (HEK293-GLP-1R cells). The host cell-HEK 293 cell is an immortalized cell of primary human embryonic kidney cell transfected with type 5 adenovirus (Ad5) DNA, and the expression quantity of various receptors contained in the cell is relatively low; compared with the HEK293 cell, the recombinant HEK293-GLP-1R cell has the advantages that the relative expression amount of GLP-1R of the recombinant HEK293-GLP-1R cell is remarkably increased, the expression of a cell surface molecular receptor is dominant, and the binding with a ligand is favorable, so that the sensitivity and the specificity of screening medicaments by taking GLP-1R as a target point are greatly increased.

3. The GV358-GLP-1R vector lentivirus transfection HEK293 cell (HEK293-GLP-1R cell) constructed by the invention can provide a better cell model for further researching the biological characteristics of GLP-1R and finding the effectiveness of functional protein.

4. In the treatment of diabetes, the development of GLP-1R agonist is an important field. Therefore, Ca is carried out on the liraglutide medicament (GLP-1R agonist medicament) on the market by using the constructed HEK293-GLP-1R cell ²⁺ The fluidity was measured and found to beThe liraglutide has good effect of increasing extracellular Ca on the recombinant HEK293-GLP-1R cells under a certain concentration ²⁺ The fluidity effect shows that the HEK293-GLP-1R cell can be applied to drug screening with GLP-1R as a target spot.

Drawings

FIG. 1 is a vector map of GV 358-GLP-1R;

FIG. 2 is an observation of green fluorescent protein expression under a fluorescence inverted microscope for determining the viral titer and infection conditions of formal transfection;

FIG. 3 is the addition of puromycin at various concentrations in DMEM medium to determine puromycin concentration in the formal transfection experiment;

FIG. 4 shows Western blots for detecting the GLP-1R protein expression level of HEK293-GLP-1R cells; wherein, (a) is a Western blots development result chart of the target protein; (b) is the result of quantification of the protein band in (a);

FIG. 5 is a qPCR quantitative determination of GLP-1R nucleic acid expression level;

FIG. 6 is a calcium fluidity test result of the efficiency quantification of the influence of liraglutide on the calcium fluidity of HEK293-GLP-1R and the calcium signal enhancement; wherein (a) is a graph of the results of the change of calcium signal intensity of HEK293-GLP-1R cells with time of liraglutide and control treatment; (b) is the effect of liraglutide and control treatment on the relative fluorescence intensity of calcium signals from HEK293-GLP-1R cells.

Detailed Description

In order to make the technical solutions of the present invention better understood, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

It should be noted that the terms "first," "second," and the like in the description and claims of the present invention and in the drawings described above are used for distinguishing between similar elements and not necessarily for describing a particular sequential or chronological order. It is to be understood that the data so used is interchangeable under appropriate circumstances such that the embodiments of the invention described herein are capable of operation in sequences other than those illustrated or described herein. Furthermore, the terms "comprises," "comprising," and "having," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed, but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.

The invention is described in further detail below with reference to the accompanying drawings:

the invention transfects HEK293 cells on the basis of constructing a eukaryotic expression vector GV358-GLP-1R of a GLP-1R full-length gene to obtain a recombinant HEK293-GLP-1R cell strain which stably and highly expresses GLP-1R molecules. The following detailed description of the invention is illustrative of the invention and is not to be construed as limiting.

1) Construction of GV358-GLP-1R expression vector

a. The invention takes GV358-GLP-1R shown in figure 1 as a basic vector (Jikai gene), and the primer sequences are as follows:

an upstream primer: ATGGATCTTCAGGCTCTACGT

A downstream primer: GTCTGCATTTGATGTCTGTCTTG

2) GV358-GLP-1R expression vector transfected HEK293 cells

b. Transferring a lentivirus packaging system containing a virus packaging auxiliary plasmid and a tool vector plasmid carrying a target gene into HEK293 cells (a lentivirus packaging loading system is purchased from Kjek genes and contains three plasmids of GV lentivirus vectors, pHelper 1.0 vectors and pHelper 2.0 vectors), adding puromycin with the concentration of 10 mu g/mL into a DMEM Medium (Dulbecco's Modified Eagle Medium) for screening for 14 days, then obtaining positive clone cells which are all provided with green fluorescence under an inverted fluorescence microscope, selecting puromycin resistant monoclones for subculture, adjusting the puromycin concentration in the DMEM complete Medium to 5 mu g/mL after 4 weeks, and continuing culturing to obtain stable GV358-GLP-1R positive transfected clone cell strains.

The high expression vector constructed by the invention comprises a GLP-1R full-length gene, and the nucleotide sequence of the GLP-1R full-length gene is shown in SEQ.ID.NO. 1.

Three mutation sites exist in the sequence, and the GAA synonymy mutation at the 468-470 site is GAG; the 595-597 AGG synonymous mutation is CGG; the 1269-and 1271-bits ATA are synonymously mutated to ATC.

c. Selection of lentivirus transfection conditions, as shown in FIG. 2, to determine the virus titer and transfection conditions for transfection, different titers of virus and infection enhancing fluid were added to the cell culture wells to facilitate entry of the expression vector system into the host cells, HEK293 cells transfected with GV358-GLP-1R, which were green fluorescent under a fluorescent inverted microscope due to the green fluorescent protein GFP gene in the transfected plasmid, and HEK293 cells not transfected with plasmid GV358-GLP-1R were non-fluorescent. The expression of GLP-1R of the recombinant HEK293-GLP-1R cell is observed under a fluorescence inverted microscope, as shown in figure 2, the HEK293 cell has no green fluorescence, while the green fluorescence of the recombinant HEK293-GLP-1R cell is brighter, the intensity of the fluorescence intensity is obviously related to the transfection efficiency, and in addition, the GLP-1R expression quantity of the successfully transfected cell can be obviously increased.

d. The transfection plasmid contains an anti-puromycin resistance gene, and GV358-GLP-1R positive cells can be screened by puromycin. As shown in FIG. 3, the viability of HEK293 cells was inversely related to the puromycin concentration in the culture medium, and after 48h of culture, the cells at higher concentrations were all dead, while the cells at lower concentrations were partially dead, and finally the puromycin concentration capable of killing HEK293 cells in 3 days was selected as the concentration of puromycin in the normal transfection, puromycin screening stable cells.

e. q-PCR detection of transfected cell lines: respectively extracting total RNA of cells which are not transfected and are transfected with empty plasmids and plasmids carrying target genes by adopting a TRIZOL kit, and carrying out reverse transcription by adopting the total RNA as a template and a cDNA synthesis kit of TAKARA company to obtain cDNA; respectively taking the obtained cDNA as a template, and carrying out PCR amplification on the full-length sequence of the GLP-1R gene.

The PCR reaction system is as follows:

Premix Ex Taq ^TM II 12.5 mu L; 0.5 mu L of upstream primer (sense, 20 mu mol/L); downstream primer (antisense, 20. mu. mol/L) 0.5. mu.L; template (cDNA) 2. mu.L; ddH ₂ O 9.5μL；Total：25μL。

And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 5s, extension at 60 ℃ for 30s, and circulation for 40 times; the q-PCR detection result is shown in FIG. 5, compared with the untransfected HEK293 cell and the HEK293 cell transfected with an empty plasmid, the GLP-1R gene level of the recombinant HEK293-GLP-1R cell is obviously increased, and the expression level of the nucleic acid with the highest expression GLP-1R is 25.43 times higher than that of the nucleic acid with the empty plasmid under the transfection condition.

Western blots detection of GLP-1R expression level: after lysis of cells with RIPA lysate, total cell protein was extracted and protein content was quantified by BCA method. After electrophoresis, membrane transfer, immunostaining (a primary antibody: GLP-1R rabbit monoclonal antibody purchased from Abcam company; a secondary antibody: HRP type goat anti-rabbit IgG (H + R), flur 488 purchased from Xian Zhuangzhi biological Limited company) and development, the experimental results are shown in figure 4, wherein, a control group is an untransfected HEK293 cell, a lentivirus group is an HEK293 cell transfected with an empty plasmid, and a lentivirus-GLP-1R group is an HEK293 cell transfected with a recombinant plasmid, compared with the former two groups, the expression level of GLP-1R protein of the recombinant HEK293-GLP-1R cell is obviously increased by 10.96 times;

3) effect analysis of recombinant HEK293-GLP-1R cells

g. Calcium ion fluidity monitoring the effect of HEK293-GLP-1R on extracellular calcium ion fluidity: taking HEK293-GLP-1R cells in logarithmic growth phase, digesting with 0.25% trypsin, counting according to 4 × 10 ³ The cells/well were inoculated into 96-well culture plates previously coated with 1 Xpolylysine in a volume of 100. mu.L/well at 37 ℃ with 5% CO ₂ Culturing for 24h under the saturated humidity condition, discarding the culture medium, adding warm CIB in advance, washing once, discarding the CIB, adding 50 mu l of incubation liquid containing Fluo-3 calcium ion fluorescent probe and F127 under the dark condition, placing in an incubator for incubation for 40min, and adding equivalent CIB into a control group; discarding the incubation solution after incubation, adding CIB, washing once, discarding the supernatant, adding CIB again in a volume of 100 μ l, taking a picture under green light of a fluorescence microscope after discarding CIB, treating in different wells after 5s of shooting without adding any treatmentFor all treatments, 100. mu.l CIB or 160nM liraglutide (prepared by CIB) was added, exposure time was set to 1s, pictures were taken every 3 seconds, each group was taken for 2min, and the change in fluorescence intensity in the images was analyzed by image analysis software for quantitative statistics, and FIG. 6 (a) shows the change in fluorescence intensity with time for different wells, and FIG. 6 (b) shows the quantitative results of the relative change in fluorescence intensity between groups. From the figure, it can be seen that liraglutide (GLP-1R positive drug) can significantly increase the intracellular calcium ion signal intensity of HEK293-GLP-1R, while treatment without any treatment (control) and solvent (vehicle) had less influence on the intracellular calcium ion signal intensity of HEK 293-GLP-1R. The results indicate that GLP-1R of HEK293-GLP-1R cells has the activity of receptor protein.

The above-mentioned contents are only for illustrating the technical idea of the present invention, and the protection scope of the present invention is not limited thereby, and any modification made on the basis of the technical idea of the present invention falls within the protection scope of the claims of the present invention.

Sequence listing

<110> university of west ampere traffic

<120> GLP-1R high expression vector, recombinant HEK293 cell based on same, construction method and application

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1780

<212> DNA

<213> Artificial Sequence

<400> 1

ggcttttttg ttagacgaag cttgggctgc aggtcgactc tagaggatcc ccgggtaccg 60

gtcgccacca tggccggcgc ccccggcccg ctgcgccttg cgctgctgct gctcgggatg 120

gtgggcaggg ccggcccccg cccccagggt gccactgtgt ccctctggga gacggtgcag 180

aaatggcgag aataccgacg ccagtgccag cgctccctga ctgaggatcc acctcctgcc 240

acagacttgt tctgcaaccg gaccttcgat gaatacgcct gctggccaga tggggagcca 300

ggctcgttcg tgaatgtcag ctgcccctgg tacctgccct gggccagcag tgtgccgcag 360

ggccacgtgt accggttctg cacagctgaa ggcctctggc tgcagaagga caactccagc 420

ctgccctgga gggacttgtc ggagtgcgag gagtccaagc gaggggagag aagctccccg 480

gaggagcagc tcctgttcct ctacatcatc tacacggtgg gctacgcact ctccttctct 540

gctctggtta tcgcctctgc gatcctcctc ggcttcagac acctgcactg cacccggaac 600

tacatccacc tgaacctgtt tgcatccttc atcctgcgag cattgtccgt cttcatcaag 660

gacgcagccc tgaagtggat gtatagcaca gccgcccagc agcaccagtg ggatgggctc 720

ctctcctacc aggactctct gagctgccgc ctggtgtttc tgctcatgca gtactgtgtg 780

gcggccaatt actactggct cttggtggag ggcgtgtacc tgtacacact gctggccttc 840

tcggtcttat ctgagcaatg gatcttcagg ctctacgtga gcataggctg gggtgttccc 900

ctgctgtttg ttgtcccctg gggcattgtc aagtacctct atgaggacga gggctgctgg 960

accaggaact ccaacatgaa ctactggctc attatccggc tgcccattct ctttgccatt 1020

ggggtgaact tcctcatctt tgttcgggtc atctgcatcg tggtatccaa actgaaggcc 1080

aatctcatgt gcaagacaga catcaaatgc agacttgcca agtccacgct gacactcatc 1140

cccctgctgg ggactcatga ggtcatcttt gcctttgtga tggacgagca cgcccggggg 1200

accctgcgct tcatcaagct gtttacagag ctctccttca cctccttcca ggggctgatg 1260

gtggccatct tatactgctt tgtcaacaat gaggtccagc tggaatttcg gaagagctgg 1320

gagcgctggc ggcttgagca cttgcacatc cagagggaca gcagcatgaa gcccctcaag 1380

tgtcccacca gcagcctgag cagtggagcc acggcgggca gcagcatgta cacagccact 1440

tgccaggcct cctgcagcgg tatggactac aaggatgacg atgacaagga ttacaaagac 1500

gacgatgata aggactataa ggatgatgac gacaaatgag ctagcctgtg gaatgtgtgt 1560

cagttagggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca aagcatgcat 1620

ctcaattagt cagcaaccag gtgtggaaag tccccaggct ccccagcagg cagaagtatg 1680

caaagcatgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg 1740

cccctaactc cgcccagttc cgcccattct ccgccccatg 1780

Claims (10)

1. A GLP-1R high expression vector is characterized in that the GLP-1R high expression vector comprises a GLP-1R full-length gene, and the nucleotide sequence of the GLP-1R full-length gene is shown in SEQ.ID.NO. 1.

2. The GLP-1R high expression vector of claim 1, wherein said GLP-1R high expression vector is an exogenous expression vector.

3. The GLP-1R high expression vector of claim 2, wherein the GLP-1R high expression vector is a GV358-GLP-1R eukaryotic expression vector constructed from a GV358 lentiviral plasmid.

4. A GLP-1R high-expression HEK293 recombinant cell is characterized in that the recombinant cell is constructed by transfecting a host cell HEK293 cell with the GLP-1R high-expression vector of any one of claims 1-3.

5. The use of the GLP-1R highly expressed HEK293 recombinant cell of claim 4 in drug screening.

6. The use of claim 5, wherein the medicament is a GLP-1R-targeted medicament.

7. The use of claim 5, wherein the medicament is a medicament for the treatment of diabetes.

8. A construction method of a GLP-1R high-expression HEK293 recombinant cell is characterized by comprising the following steps:

1) constructing a GLP-1R high expression vector, namely a GV358-GLP-1R eukaryotic cell expression vector;

2) the GV358-GLP-1R eukaryotic cell expression vector was transfected into HEK293 cells.

9. The method for constructing the HEK293 recombinant cell with high GLP-1R expression according to claim 8, wherein in the step 1), the GV358-GLP-1R is taken as a basic vector, and the primer sequences are as follows:

an upstream primer: ATGGATCTTCAGGCTCTACGT

A downstream primer: GTCTGCATTTGATGTCTGTCTTG

Constructing to obtain the GLP-1R high expression vector.

10. The method for constructing the HEK293 recombinant cell with high GLP-1R expression according to claim 8, wherein in the step 2), a lentivirus packaging system containing a virus packaging helper plasmid and a tool vector plasmid carrying a target gene is adopted to be transferred into the HEK293 cell;

the lentivirus packaging system comprises three plasmids of a GV lentivirus vector, a pHelper 1.0 vector and a pHelper 2.0 vector;

and adding puromycin with the concentration of 10 mu g/mL into a DMEM culture medium for screening for 14 days to obtain positive clone cells, selecting puromycin resistant monoclonal clones for subculture, adjusting the puromycin concentration in the DMEM complete culture medium to 5 mu g/mL after 4 weeks, and continuing culturing to obtain stable GV358-GLP-1R positive transfected clone cell strains, namely the GLP-1R high-expression HEK293 recombinant cells.

Images