CN114875068B

CN114875068B - Novel neuron labeling technique

Info

Publication number: CN114875068B
Application number: CN202210462352.3A
Authority: CN
Inventors: 闻捷; 李莎娜
Original assignee: Anhui Provincial Hospital First Affiliated Hospital of USTC
Current assignee: Anhui Provincial Hospital First Affiliated Hospital of USTC
Priority date: 2022-04-27
Filing date: 2022-04-27
Publication date: 2023-05-09
Anticipated expiration: 2042-04-27
Also published as: CN114875068A

Abstract

The invention provides application of oatp1A1 gene or OPTP1A1 protein in preparing a composition or a kit for marking neurons, and also provides application of oatp1A1 gene or OPTP1A1 protein in tracing neurons and/or monitoring neuron cell activities, wherein the oatp1A1 gene or OPTP1A1 protein can be used for marking specific neurons and analyzing the structure and functions of loops in which the neurons participate, and is expected to have various application prospects in research of basic neuroscience and chronic nervous system diseases.

Description

Novel neuron labeling technique

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a neuron labeling technology.

Background

The brain of a mammal is a complex organ containing billions of neurons. These neurons form various neural circuits that control perception, cognition, emotion, and behavior. The development of in vivo neuronal labeling and imaging techniques is critical to the study of the structure and function of the neural circuit and can provide true physiological information that in vitro methods cannot provide.

Most of the currently owned neuron labeling technologies are optical labeling technologies with fluorescence, and by expressing fluorescent proteins in neurons, we can see the structure of neurons and label specific neurons. However, due to the poor light transmission, optical imaging of deep tissues (in vivo optical imaging below the cerebral cortex) is not possible in current whole brain imaging techniques (two-photon, three-photon, etc.) (Kim et al 2012; liu et al 2020). And MRI imaging has extremely high depth penetrability and better resolution, and can realize full brain imaging with depth and higher resolution. There are techniques for labeling neurons for neural circuit tracing using MRI imaging techniques, such as manganese augmentation Strong MRI (mecri) techniques, by using active manganese contrast agents, enable neurons to produce high signals in T1W. Active manganese contrast agent (MnCl 2) can enter neurons through voltage-gated ga2+ channels and transport anterogradely along axons, and mecri has been used for the tracking of sensory nerve loops for vision, pain, etc., which is used to explore functional links of neurons. However, mn2+ is toxic, which presents safety problems, and its transport in the brain is non-specific, which makes it difficult to accurately label neurons, nor is it targeted to a specific neural circuit, and thus has a limited range of use for megri (Deng et al, 2019). Yet another technique is to label neurons by using ferritin, which has paramagnetic properties and good paramagnetic effects after binding to iron, at T2W or T2 ^* The upper display low signal and ferritin is considered as an MRI reporter protein for detecting gene expression. At present, a neurotropic virus is used for transmitting ferritin genes into neurons, so that the neurons can express a large amount of ferritin, and then the neurons display low signals on T2W by gathering endogenous iron ions, so that the purpose of marking the neurons in corresponding loops is achieved. Since imaging contrast is dependent on the enrichment of endogenous iron ions in different tissue regions, ferritin also requires a certain time to replenish iron ions, which increases the complexity of MRI signals and results in less than ideal imaging contrast (Cai et al, 2021; zheng et al, 2019).

Disclosure of Invention

In order to have better imaging effect than ferritin after neuron labelling in MRI imaging and not dependent on limitation of endogenous substances on imaging effect, we studied using a neurotropic virus (rAAV 2-retro) (commercially available, for example, from the wunsch company (Brain VTA)) to deliver OATP1A1 protein gene and express the OATP1A1 protein in the neuronal membrane, and then by injection of Gd-EOB-DTPA, virus-infected neurons would take up Gd-EOB-DTPA via the OATP1A1 protein and then would appear high signals in T1W images, whereas non-virus-infected neurons would not appear Gd-EOB-DTPA uptake phenomena, and would not appear high signals in T1W images. We further employed a Dynamic Contrast Enhancement (DCE) based approach to provide quantitative information of labeled neurons throughout the brain. Experiments using this technique have tested that labeling of neurons and corresponding loop tracking can be performed.

In the prior art, in the study of mouse behaviours, the expression of the C-Fos protein in neurons was used as a marker for the activation of neurons in behaviours, for which the FosTRAP system (C-Fos-Cre-ERT mouse and stop system thereof) was developed, and the behavioural activated neurons during the injection of tamoxifen could be fluorescently labeled. However, this method has a disadvantage in that observation of whole brain tissue can be performed only by killing mice, and according to the technique of the present invention, a new mouse strain R26-e (CAG-LSL-Oatp 1 A1-P2A-EGFP-WPRE-polyA) 1 expressing OPTP1A1 protein is constructed, followed by intrathecal injection of Gd-EOB-DTPA for T1W imaging, which can be achieved by labeling and imaging of behavioural activated neurons during the injection of tamoxifen.

In the past, various useful proteins in vivo have been expected to be applied to neurons, but it has been difficult to realize them in practical use. The reason is that, as we know, selective expression of genes in cells, each protein can only be specifically present in a particular cell, thus allowing each cell to possess its unique function. In order to transfer a protein into a neuron, considering whether the protein gene can be expressed in a tissue cell or not, whether the protein can be folded in a new cell or not after the protein is expressed, in most cases, the protein needs molecular chaperones to be folded into a functional protein, the OATP1A1 protein is a membrane protein, and research reports that the OATP1A1 protein is positioned in a cell membrane and the PDZK1 protein is assisted, so that although the protein is expressed, the correct folding of a space and the positioning of the protein in a correct subcellular structure are huge problems of research. However, it is not known whether the protein can perform the corresponding function because the organism is complex, the brain tissue structure is complex and various, and whether the over-expression of the protein can cause the occurrence of neurological diseases or the occurrence of brain tissue atrophy is a serious problem to be considered in the in vivo study of animals. Post-translational modification of proteins is also a major problem, and the etiology of Alzheimer's disease is well known in neurological diseases, and Tau protein phosphorylation and aggregation of Tau proteins has been shown to be associated with such diseases. Transferring a protein from a cell to a neuron, which can translate, fold correctly, modify correctly, position correctly, and function normally, is difficult. Furthermore, since neuronal cells have a blood brain barrier, proteins are difficult to enter into neuronal cells for expression.

In summary, while those skilled in the art have been attempting to apply various related proteins to neurons, this has been difficult to achieve for various reasons. Through a great deal of experiments and creative labor, the OATP1A1 protein can be unexpectedly found to be successfully expressed in neuron cells, and then the in-vivo imaging of animals can be realized through intrathecal injection of Gd-EOB-DTPA, and the imaging effect is good.

The present invention is most different from the prior art in that OATP1A1 protein is transported into the cell membrane of neurons by virus and Gd-EOB-DTPA is transported into the inside of neurons by OATP1A1 protein, thereby achieving that only virus-infected neurons can express OATP1A1, while injected Gd-EOB-DTPA is ingested into only virus-infected neurons expressing OATP1A1 protein, gd-EOB-DTPA shows high signal in T1 imaging, so that virus-infected neurons will be highlighted in the image due to intracellular Gd-EOB-DTPA contained in the T1W image. After specific virus infection of neurons is achieved by the technology, whole brain image acquisition can be carried out on the mice, rather than the image acquisition of labeled neurons after mice are sacrificed as in the traditional fluorescence (such as slicing and transparent brain).

In particular, the present invention describes a new strategy for labeling and quantifying neurons using MRI. To demonstrate the ability of this novel approach, the present invention uses neurotropic viruses to deliver the Oatp1a1 gene to the target neural circuit. OATP1A1 protein is expressed in nerve cell membrane, and can increase the intake of specific magnetic resonance contrast agent (Gd-EOB-DTPA). The labeled neurons were "lightened" on MRI with T1 weighted image observations. The present invention further uses a method based on dynamic contrast enhancement to obtain measures that provide quantitative information for labeling neurons.

Specifically, the present invention provides the following embodiments:

1. use of the oatp1A1 gene or the OPTP1A1 protein for the preparation of a composition or kit for labeling neurons.

2. The use according to item 1, wherein the oatp1a1 gene is introduced and expressed in neuronal cells, preferably by a neurotropic virus (e.g. rAAV 2-retroviruses).

3. The use of item 1, wherein the composition or kit further comprises a specific magnetic resonance contrast agent (e.g., gd-EOB-DTPA).

4. Use of the oatp1A1 gene or the OPTP1A1 protein for neuronal tracking and/or monitoring neuronal cell activity.

5. The use according to item 4, wherein the oatp1a1 gene is introduced and expressed in the neuronal cells, preferably by a neurotropic virus (e.g. rAAV 2-retroviruses).

6. The use according to any one of items 1 to 3 or the use according to any one of items 4 to 5, wherein the oatp1a1 gene is introduced into neurons of a mammal.

7. The use or use of clause 6, wherein the mammal is a rodent (e.g., mouse, rat), or monkey.

8. A method of preparing a transgenic mouse comprising introducing and expressing an oatp1a1 gene in the mouse.

9. The method of claim 8, wherein the mouse is a C57BL/6J mouse.

10. Use of a transgenic mouse obtained according to the preparation method of items 8-9 for exploring neuronal function and/or monitoring neuronal cell activity.

In particular embodiments of the invention, SSp refers to primary somatosensory cortex (primary somatosensory cortex), SSs refers to secondary somatosensory cortex (secondary somatosensory cortex), MOp refers to primary movement region (Primary motor area), MOs refers to secondary movement region (Secondary motor area), RT refers to reticulum nucleus (reticular nucleus), VIS refers to visual area, PO refers to thalamo metacarpal group (posterior thalamic nuclear group), EPv refers to inner pyriform nucleus, ventral portion (Endopiriform nucleus).

In a specific embodiment of the invention, the amino acid sequence of the OATP1A1 protein is as shown in SEQ ID NO:5, the nucleotide sequence of the Oatp1a1 gene is shown as SEQ ID NO: shown at 6.

The technical effects are as follows:

the present invention proposes a new neuron labeling, imaging and quantification strategy. In particular, the present invention uses neurotropic viruses to deliver the reporter gene oatp1a1 to the targeted neural circuit and demonstrates its ability to label and image neurons, which provides an effective method for obtaining a full brain map of labeled neurons in the targeted neural circuit. The results show that Oatp1a1 can be used as an effective reporter gene, can be used for observing neurons, can potentially help research on structural and functional neuroscience, and is expected to have various application prospects in research on basic neuroscience and chronic nervous system diseases. Furthermore, the method of the invention may also provide quantitative analysis of neuronal markers.

By taking up the drug Gd-EOB-DTPA by the OATP1A1 protein, it is possible to dispense with the help of substances inherent in brain tissue, for example, the ferritin technology in the prior art requires the help of enrichment of endogenous iron ions of tissue, which requires a certain time and the extent of enrichment of iron ions also affects its imaging effect in T2 (Zheng et al, 2019). In experiments, the imaging effect of the technology is better than that of ferritin in T2, and the signal of the marked neuron is obviously compared with the brain tissue signal value of the surrounding unmarked area. Moreover, the technology of the invention has great application potential in the gene operational space compared with MEMRI, and the Cre system and fluorescent protein are combined with neurotropic virus to label specific neurons and analyze the structure and function of loops in which the neurons participate in the prior art (Huang et al, 2019; xu et al, 2020). In the invention, the traditional fluorescent protein gene is changed into the oatp1a1 protein gene so as to achieve the same specific neuron labeling effect, and the mouse brain imaging with high spatial depth and high resolution can also be realized. The neural loop tracing can be performed by using the neuron labeling technology of the invention, and the neural loop tracing effect has been elucidated in the experimental verification. From the experimental results, it can be seen that in the selected somatosensory loop tracers, neurons in the loops marked in the image are significantly strongly compared to non-marked neurons. Further, the labeling effect of active neurons was achieved by constructing a new mouse strain R26-e (CAG-LSL-Oatp 1a 1-P2A-EGFP-WPRE-polyA) 1 containing Oatp1a1 gene on exploring neuronal function, enabling labeling of neurons activated by specific behavioral activities performed during the period of time of action of tower Mo Xi-and imaging after Gd-EOB-DTPA injection for a period of time, unlike observations which were conventionally made only after mice were sacrificed (Guenthner et al 2013).

Drawings

FIGS. 1A-B show the viral plasmid maps before and after transformation, wherein

FIG. 1A) shows a map of the plasmid rAAV-EF1A-EGFP-WPRE-hGH poly A of the rAAV2-retro-EGFP viral genome prior to engineering.

FIG. 1B) shows a map of viral genome plasmid rAAV-EF1a-oatp1a1-P2A-EGFP-WPRE, in which the oatp1a1 gene is linked to EGFP, and protein cleavage is performed using P2A, such that oatp1a1 forms a non-fusion protein with EGFP.

FIGS. 2A-F show in vitro verification and demonstration of nerve tracking of known nerve loops (SSp/SSs→PO) of OATP1A1 protein expression and its localization in neuronal membranes. Wherein, the liquid crystal display device comprises a liquid crystal display device,

FIG. 2A) schematic representation of viral genomes of rAAV2-retro-EF1 alpha-oatp 1a1-P2A-EGFP (upper) and rAAV2-retro-EF1 alpha-EGFP (lower) recombinant vectors.

FIG. 2B) when rAAV2-retro is injected with PO, the virus will reverse infect SSp and SSs (i.e., the neuronal axons are in the PO region, the cell bodies are in the SSp-SSs region, and the virus is reverse transported to the neuronal cell bodies by the neuronal axons).

Fig. 2C) fluorescence images of brain sections infected with both viruses. Arrows represent SSp and SSs (i.e., primary and secondary somatic cortical areas) regions containing neurons that project to the POs. EGFP (upper) and oatp1a1-EGFP (lower) labeled brain sections were taken at similar levels. The scale bar in the figure represents 500um.

FIG. 2D) detection of OATP1A1 expression and co-localization with EGFP in brain tissue by immunofluorescent staining in brain tissue sections. The left schematic representation represents the position of the brain slice taken during confocal imaging, the right is the fluorescent image of the imaged neuron, which is sequentially EGFP, A594 (immunofluorescent stained OATP1A1 protein), DAPI (fluorescent stained DNA), the Merge images of the three images represent the co-localization of EGFP, A594 (i.e., OATP1A1 protein), DAPI (i.e., DNA nucleus). The scale bar in the picture represents 50um.

FIG. 2E) ligation of the OATP1A1 protein gene of the viral gene sequence with the mCherry gene on the plasmid backbone by means of homologous recombination, so that the OATP1A1 protein with the mCherry fluorescent protein gene can be formed, thus the localization of the OATP1A1 protein in subcellular structures in neurons at the cellular level is seen.

FIG. 2F) it can be seen that red fluorescence is concentrated in the cell membrane under fluorescent microscopy and imaging of differential interference in SH-SY5Y cells, whereby we can see that OATP1A1 protein is localized on the cell membrane in neuronal cells.

FIGS. 3A-F show the diffusion and metabolism of Gd-EOB-DTPA in brain tissue. Wherein, the liquid crystal display device comprises a liquid crystal display device,

FIG. 3A) T1W and T2W images were acquired at 14T at different times after intrathecal injection of Gd-EOB-DTPA in normal mice. All images were registered and taken from the same level. Gd-EOB-DTPA was shown to diffuse from the lower skull to the upper brain and vanish after one week of Gd-EOB-DTPA injection.

FIG. 3B) metabolism of Gd-EOB-DTPA drug in various regions of brain tissue in a period of time before and after intrathecal injection of Gd-EOB-DTPA in mice 21 days after infection of left brain PO region with virus (rAAV-EF 1a-oatp1a 1-P2A-EGFP-WPRE-pA) was collected in 3T. It can be seen from the figure that only neurons in the virus-infected area have metabolic delays, i.e. brain tissue not expressing the OATP1Al protein area is metabolized after one day of Gd-EOB-DTPA injection, whereas neurons expressing the OATP1A1 protein area have a huge contrast difference with surrounding tissue signals after one day due to uptake of Gd-EOB-DTPA by neurons. I.e. one day later the signal difference versus the maximum time point, is the optimal time for observation.

Fig. 3C) also has the same result as 3T described above in 14T, and since the 14T resolution is higher than 3T, the arrows in the figure indicate the signal changes over time for the LP and S2 regions.

Fig. 3D) shows statistics of metabolism of drug Gd-EOB-DTPA at various time points for the thalamus region of the left and right brain (circled region overlapped into image in fig. 3B) taken as ROI in fig. 3B, respectively. The lower curve is the metabolism graph of Gd-EOB-DTPA in the control brain region (left circle in FIG. 3B) with time, and the upper curve is the metabolism graph of Gd-EOB-DTPA in the brain region (right circle in FIG. 3B) with time, wherein the Gd-EOB-DTPA is taken up by the neuron expressing OATP1A1 protein and has the largest signal difference with the control brain tissue after one day.

Fig. 3E) shows that the signal values of the pixels at the leftmost end of the dashed line of the image in fig. 3C are taken as the origin, and the changes of the values of the pixels at the same layer and the same line of the same layer in different time periods are depicted, wherein 5 curves respectively represent 5 key time points in fig. 3C. The uppermost peak in the graph is a signal value after one day, one line at the lower end of the peak is a signal value 2 hours after injection, and the maximum difference between the left and right signals at the time point after one day can be seen from LP and S2.

Fig. 3F) after MRI data acquisition, mice brain sections were subjected to fluorescent observation. The results indicate that fluorescence of labeled neurons co-localized with Gd-EOB-DTPA induced high signal on T1W (as indicated by the arrow).

Figures 4A-B show assessing brain parenchymal integrity in high resolution T1W and T2W images collected at 14T. All images are registered. Wherein, the liquid crystal display device comprises a liquid crystal display device,

FIG. 4A) T1W and corresponding T2W images in different levels of the same mouse one day after intrathecal injection of Gd-EOB-DTPA 21 days after infection with virus (rAAV-EF 1a-oatp1a 1-P2A-EGFP-WPRE-pA), the arrow positions are shown as virus infected areas, T1W and T2W image comparisons are performed on these areas, and only Gd-EOB-DTPA enriched areas present low signals in the rest positions except for the needle tract injury presenting low signals.

Fig. 4B) images of the same mice at the same injection level at different time points show that the low signal in T2W at Gd-EOB-DTPA enrichment site indicated by the arrow decreases with decreasing metabolism of Gd-EOB-DTPA and its concentration in brain tissue. The low signal in T2W disappeared after one week when Gd-EOB-DTPA was completely metabolized to resume the ground state. Thus, except for the needle tract injury, the low signal in the rest of T2W is due to enrichment of Gd-EOB-DTPA, not tissue lesions. As the T2W can reflect the pathological changes of tissues, the brain tissues of the mice have no pathological changes and injuries except the wound of the needle tract before and after the Gd-EOB-DTPA injection.

Fig. 5A-E show a comparison between MRI and fluorescence results. Wherein, the liquid crystal display device comprises a liquid crystal display device,

fig. 5A) T1W images taken from two mice infected with both viruses at 14T (upper panel: rAAV2-retro-oatp1a1-P2A-EGFP; the following figures: rAAV 2-retro-EGFP), images collected at five key time points. The arrows in the figure represent the areas of virus infection. The upper graph shows the neuronal uptake phenomenon of Gd-EOB-DTPA in the brain region of a mouse infected by rAAV2-retro-oatpla1-P2A-EGFP virus, and the lower graph shows the brain region of a mouse infected by rAAV2-retro-EGFP virus, and the Gd-EOB-DTPA uptake phenomenon does not appear.

Fig. 5B) MRI images were compared with fluorescence images, all collected from the same mice used in fig. 5A). Arrows indicate injection sites and cortical areas (virus infected areas) with high signals.

FIG. 5C) schematic of viral injection, wherein the left brain was injected with 200nl rAAV2-retro-EGFP and the right brain was injected with 200nl rAAV2-retro-oatp1a1-P2A-EGFP.

Fig. 5D) compares MRI images of the present invention with fluorescence images on their corresponding mice. The arrows represent the injection sites of the two viruses, respectively (right: rAAV2-retro-oatp1a1-P2A-EGFP; left: rAAV 2-retro-EGFP). Wherein, at Right site, high signal appears at the MRI mesothelial layer (indicated by arrow) due to the intake of Gd-EOB-DTPA by the OATP1A1 protein, whereas no intake phenomenon of Gd-EOB-DTPA occurs at Left due to the non-expression of OATP1A1 protein by the neurons infected with the control virus.

FIG. 5E) T1W images of normal mice (uninfected virus) and mice infected with pre-engineered EGFP virus obtained at 4 time points after intrathecal injection of Gd-EOB-DTPA. Neither case had Gd-EOB-DTPA intake the day after injection, and all images obtained one week after injection returned to baseline.

Fig. 6A-B show a regional comparison of T1W signals. The T1W image is registered to TMBTA-Brain-Template and the ROI is obtained from TMBTA-Brain-Atlas. Wherein, the liquid crystal display device comprises a liquid crystal display device,

FIG. 6A) T1W image is registered to TMBTA-Brain-Template. The ROI (SSp, SSs, MOp, MOs, RT, VIS, PO, EPv) of the TMBTA-Brain-Atlas is overlaid on the image.

Fig. 6B) compares T1W signal intensities between left and opposite side regions of 6 ROIs. The P values compared are shown above each graph. (P < 0.01:;0.01 < P < 0.05:;n=5).

FIG. 7 uses the Tofts model to quantitatively evaluate labeled neurons. Fig. 7A) a T1W image acquired at 1397 minutes. The fitted curves for two pixels located in the areas with (right) and without (left) projections are shown in fig. 7B). Gd concentration curves in CSF (cerebrospinal Fluid, cerebro-Spinal Fluid) (Cc) are marked in black. Fitting parameters K and vt are shown in fig. 7C) and 7D), respectively.

FIG. 8 shows a schematic of the system design strategy of transgenic mouse R26-e (CAG-LSL-Oatp 1a 1-P2A-EGFP-WPRE-polyA) 1.

Detailed Description

The present invention will be further described in detail below with reference to specific embodiments and with reference to the accompanying drawings, in order to make the objects, technical solutions and advantages of the present invention more apparent.

The methods used in the examples described below are conventional methods unless otherwise indicated, and the reagents used are commercially available reagents unless otherwise indicated.

Example 1:

in vitro experiments

Materials and methods

1. Animal preparation

The animals of this study were treated according to the protocol approved by the animal ethics committee of the university of science and technology of China (SYXK 2017-005). Male C57BL/6J mice (6-8 weeks old) were purchased from SPF (Beijing) Biotechnology Co. All animals were kept in a 12 hour/12 hour light and dark cycle room with sufficient food and water available at the appropriate temperature.

2. Virus construction

rAAV2-retro is a virus which can reversely infect neurons, the gene sequence (NM_ 013797.5) of OATP1A1 protein is searched in a nucleic acid database of NCBI, and the OATP1A1 protein gene is inserted into a virus genome to obtain recombinant virus rAAV-EF1a-OATP1A1-P2A-EGFP-WPRE-pA, so that the recombinant virus can express OATP1A1 protein in infected neurons when the neurons are infected. (wherein, the map of the recombinant virus rAAV-EF1a-oatp1a1-P2A-EGFP-WPRE-pA is shown in FIG. 1B, and the preparation is completed by Wohan Pivot technology Co.).

3. Virus injection

Prior to surgery, experimental mice were fixed in a stereotactic device (RWD, shenzhen, china) and ketamine was administered to reduce pain. During surgery, mice were anesthetized with isoflurane gas using an anesthesia machine (RWD, shenzhen, china) and maintained at body temperature with a heating pad. The microinjector is connected to a glass microelectrode, and the virus is injected into the left brain thalamus postthalamus nucleus (PO) area in a stereotactic manner: the dorsal ventral side (DV) 3.15mm, the anteroposterior side (AP) 2.03mm, the medial lateral side (ML) 1.30mm. Injecting the recombinant virus constructed in the step 2 as an experimental group and the virus before transformation as a control group, wherein the total amount is controlled between 200 and 300nl, and the injection speed is set to be 30nl/min. After injection, the glass microelectrode was left at the injection site for 5 minutes and then removed. The skin around the surgical site is sutured after the operation and sterilized. At the end of the experiment, gas anesthesia was stopped and the experimental mice were returned to the cage.

4. Fluorescence imaging and immunofluorescence

Mice infected with virus for more than 21 days were used for ex vivo experiments. Mice were anesthetized with isoflurane, hearts were perfused with PBS and 4% pfa, brains were removed and immersed in 4% pfa overnight. Thereafter, the brain is dehydrated with sucrose solution. The solution is dehydrated and settled by 20 percent of sucrose solution and then dehydrated and settled by 30 percent of sucrose solution. The dehydrated brain was coronally sectioned using a cryomicrotome (Leica, CM 1950) and OCT (optimal cutting temperature compound). For fluorescence imaging, the slice thickness was 40um, and for immunofluorescence, the slice thickness was 30um. Brain sections were stored in antifreeze (30% ethylene glycol, 20% glycerol, 50% pbs).

For fluorescence imaging, brain sections were washed with PBS (3 times 5 minutes each) in 24-well plates and then flattened on slides. Finally, brain sections were fixed with anti-fluorescence quencher (CC/Mount (TM) SIGMA) and coverslips. For immunofluorescence, the sections were washed with PBS (3 times 5 minutes each) in 24 well plates and then blocked with blocking buffer for immunostaining (proteontech catalog number PR30008, room temperature, shaker blocked, 1 hour). Sections were incubated with primary antibody (anti-Slco 1a1 polyclonal antibody, 1:300, rabbit, bioss) overnight at 4 ℃. Thereafter, the sections were washed with PBST (3 times for 5 minutes each) and incubated with secondary antibodies (CL 594-conjugated goat anti-rabbit IgG (H+L), 1:500, goat, proteintech, room temperature, 1 hour, protected from light). After washing (PBST, 3 times, 5 minutes each), the DNA was stained with DAPI (Methanoichikungunya MA 0128) for 10 minutes in a dark environment. The sections were then washed with PBS (2 times for 5 minutes each) and anti-fluorescence quencher was added dropwise to fix the sections. Nikon Ti2-E confocal microscope, FV-3000 confocal microscope and SLIDEVIEW VS200 were used for fluorescence imaging of sections.

5. Plasmid construction

Meanwhile, the invention also carries out in vitro cell experiments on the expression condition of OATP1A1 protein in the neuron cells, and the recombinant plasmid containing OATP1A1 gene is transfected into the neuron cells. Wherein, the construction of the recombinant plasmid is as follows:

pcDNA3.1 is a vector backbone with mCherry fluorescent protein (either offered by the spring bud teacher of the university of China science and technology or available from Siemens, V87020). The oatp1a1 gene was amplified from the viral plasmid constructed in step 2 (rAAV-EF 1a-oatp1a 1-P2A-EGFP-WPRE-pA). And the full-length oatp1a1 gene was cloned into the pcDNA3.1 vector backbone by homologous recombination. First, forward and reverse primers were synthesized from GENERAL BIOL company according to a map.

Forward primer of oatp1a 1-mCherry:

GAAAACTAAGCTGTGAGAATTCTGCAGATATCCAGCAC(SEQ ID NO：1)；

reverse primer of oatp1a 1-mCherry:

TCCTCTGTTTCTTCCATGGATCCCTTGTAC AGCTCGTCC(SEQ ID NO：2)。

forward primer of oatp1a 1:

ATGGAAGAAACAGAGAAAAAGG(SEQ ID NO：3)；

reverse primer of oatp1a 1:

TCACAGCTTAGTTTTCAGTTCTC(SEQ ID NO：4)。

the 50ul PCR system was as follows: 98 ℃ for 5min; 35 cycles of 98 ℃ for 30s, 58 ℃ for 30s and 72 ℃ for 2min for 30 s; 20min at 72 ℃. After PCR, we performed DNA gel electrophoresis and gel recovery to recover the target fragment. Next, a ClonExpress MultiS one-step cloning kit (Vazyme) was used for homologous recombination (reaction system: 5X CE Multis Buffer = 2ul,Exnase Multis =1 ul, PCR product of oatp1a1 fragment, pcDNA3.1-oatpla1-mCherry vector backbone and homology arm, and ddH2O=7ul). After centrifugation, the reaction was placed in PCR (30 min at 37 ℃). Thirdly, the constructed plasmid pcDNA3.1-oatp1a1-mCherry (10 ul) was transferred into DH 5. Alpha. Competent cells (Optimus Praeparatus). DH 5. Alpha. Was then incubated on ice for 20-25 min for plasmid enrichment and then heated in a 42℃water bath for 1 min30 sec. Thereafter, 1ml of LB medium was added to DH 5. Alpha. Competent cells, and the whole was placed in a shaking table at 37℃for 1 hour. After centrifugation, the bacterial solution was spread on ampicillin-resistant LB medium (1:1000) and incubated overnight in an incubator at 37 ℃. Monoclonal bacteria were selected and cultured and sent to the company (GENERAL BIOL) for sequencing. After sequence alignment, plasmids were extracted for cell experiments (plasmid extraction kit AXYGEN).

6. Cell experiment

SH-SY5Y cells (either offered by the spring bud teacher of the university of China, or available from Xinrun Biotechnology, CH 1030) were transfected with 2. Mu.g of the cDNA of Oatp1a1-mCherry of the plasmid constructed in step 5 using the jetPRIME transfection reagent (Polyplus) for 24 hours and then inoculated onto a glass-bottomed dish coated with poly-L-lysine. Imaging was performed using an Eclipse Ti inverted microscope (Nikon), CSU-X1 rotating disk unit (Yokogawa), DU-897U EMCCD camera (Andor), laser control module (Andor) and iQ3 imaging software with 100 times oil immersion lens (Andor).

Experimental results

Verification of SSp/SSs projection to PO by ex vivo fluorescence imaging

In this example, two viruses were used, one being the laboratory group virus (rAAV 2-retro-EF 1. Alpha. -OATP1 A1-P2A-EGFP), which expresses both OATP1A1 and EGFP in infected neurons. The other is a control virus (rAAV 2-retro-EF1 d-EGFP) which expresses EGFP alone. The vector structures of the two viruses are shown in FIG. 2A, and the recombinant viral genome plasmid map and viral genome plasmid map are shown in FIGS. 1A and 1B. The virus was injected into the postthalamus nucleus (PO) region as shown in figure 2B. PO is an important thalamus nucleus for somatosensory information processing. Both primary and secondary somatosensory cortex (SSp) areas in the cortex have neurons projecting into the PO area. 21 days after virus injection, brain sections were examined using fluorescence imaging. After the copolymer Jiao Pintu was taken, fig. 2C shows a similar slice of the brain. The fluorescence results of both groups indicate that the PO region receives projections from the SSp and SSs regions in the cortex (fig. 2C), consistent with previous reports in the literature. From the fluorescent image we can see that the OATP1A1 protein is expressed in neurons and co-localized with EGFP (FIG. 2D), i.e., the OATP1A1 protein can be delivered to neurons and expressed by recombinant viruses of the experimental group. Co-localization of the three fluorescent channels is shown in FIG. 2D.

In the cell experiments of this example, the OATP1A1 protein is a cell membrane protein. The inventors constructed the fusion protein Oatp1a1-mCherry to determine the location of this protein in neuronal cells. The constructed plasmid is shown in FIG. 2E (construction method see "plasmid construction" step 5 of "materials and methods" above). The recombinant plasmid was transferred into SH-SY5Y cells, and the gene was expressed to form oatp1a1-mCherry fusion protein (FIG. 2F). Localization of the OATP1A1 protein within neuronal cells was examined using fluorescence microscopy. Fluorescence imaging and differential interference imaging results support the conclusion that the OATP1A1 protein is located on neuronal cell membranes (fig. 2F). The arrow in FIG. 2F marks the position of mCherry after transfection of the recombinant plasmid, indicating that the OATP1A1 protein is mainly distributed on the cell membrane of SH-SY5Y cells.

Example 2:

in vivo experiments

Here, taking the example of labeling all neurons projected to the postthalamus nucleus PO region using this technique, an in vivo neuron labeling experiment was performed, and the following procedure was adopted.

1. Animal preparation

2. Virus construction

rAAV2-retro is a virus which can reversely infect neurons, the gene sequence (NM_ 013797.5) of OATP1A1 protein is searched in a nucleic acid database of NCBI, and the OATP1A1 protein gene is inserted into a virus genome to obtain recombinant virus rAAV-EF1a-OATP1A1-P2A-EGFP-WPRE-pA, so that the recombinant virus can express OATP1A1 protein in infected neurons when the neurons are infected. (wherein, the map of the recombinant virus rAAV-EF1a-oatp1al-P2A-EGFP-WPRE-pA is shown in FIG. 1B and the preparation thereof is completed by Wuhan Pivot Density science and technology Co., ltd.)

3. Virus injection

Prior to surgery, experimental mice were fixed in a stereotactic device (RWD, shenzhen, china) and ketamine was administered to reduce pain. During surgery, mice were anesthetized with isoflurane gas using an anesthesia machine (RWD, shenzhen, china). The body temperature of the mice was maintained with a heating pad. The microinjector is connected with a glass microelectrode, and the virus is injected into the left brain thalamus Postnuclear (PO) area in a stereotactic way: the dorsal ventral side (DV) 3.15mm, the anteroposterior side (AP) 2.03mm, the medial lateral side (ML) 1.30mm. Injecting the recombinant virus constructed in the step 2 as an experimental group and the virus before transformation as a control group, wherein the total amount is controlled between 200 and 300nl, and the injection speed is set to be 30nl/min. After injection, the glass microelectrode was left at the injection site for 5 minutes and then removed. The skin around the surgical site is sutured after the operation and sterilized. At the end of the experiment, gas anesthesia was stopped and the experimental mice were returned to the cage.

4. MRI in vivo experiments

MRI uses a 14T (Bruker AVANCE NEO 600 WB) scanner. Firstly, 1 to 1.5 percent of isoflurane and 0.3 to 0.5l/min of air are used for inducing the anesthetized mice, and 1 to 1.5 percent of isoflurane and 0.3 to 0.4l/min of air are used for maintaining anesthesia during imaging. 14T imaging T1W images were acquired using a standard bruker 2d T1-ray-Inv-Rec sequence (ti=1.05 s; te=5 ms; tr=3.8 s; pixel size=78.1×78.1 μm2; slice speed=0.5 mm; scan time=12 min) using a standard 2d T2-turbo re sequence (machine self-contained sequence) (te=2.8 ms; tr=2.8 s; pixel size=58.6×58.6 μm) ² The method comprises the steps of carrying out a first treatment on the surface of the slice thickness=0.5 mm; scan time=9 min) to acquire T2W images. 21 days after virus infection of mice, gd-EOB-DTPA (5 ul-8ul, bayer) was intrathecally injected into the spinal cord of the mice, and MRI images before and after Gd-EOB-DTPA injection were collected. After intrathecal injection of Gd-EOB-DTPA, the needle (0.5 ml,29G x1/2, KRUUS) was left at the injection site for 5 minutes. One T1W and one T2W image were acquired before Gd-EOB-DTPA injection, and one T1W and one T2W image were acquired one day after Gd-EOB-DTPA injection.

5. Data analysis

MRI images were analyzed using MATLAB (R2021 a). The T1W and T2W images were registered in FSL using FLIRT (Oxford, UK). Since FSL is designed for human MRI image processing, the resolution of all mouse images collected prior to registration is improved by a factor of 10. Regions of interest (ROIs) are mapped on MRI images and statistical data (mean, median and standard variation) within each region of interest are calculated. Using affine registration, the MRI images were also matched to a mouse brain map (a common mouse brain template TMBTA database). By matching the T1W and T2W images to the mouse brain map, we selected the target ROIs, including PO, RT, SSp, SSs, MOs, mop, VIS and EPv. P values were calculated in the brain around each ROI using the ANOVA test of MATLAB. Wherein EPv is a control region with no neurons (P > 0.05) significantly projected to the PO region, and the remaining regions are brain regions where the labeled neurons projected to the PO region are located (P < 0.01:; 0.01 < P < 0.05:; n=5).

6. Quantitative analysis

The t1_rare_inv_rec sequence (machine self-contained sequence) was used to acquire the T1W image on a 14T scanner (Bruker AVANCE NEO WB). The approximate MR signal intensity S is given by the following equation.

S＝S ₀ ·[1-2exp(-R ₁ ·TI)+exp(-R ₁ ·TR)]·exp(-R ₂ ·TE)#(1)

Where S0 is a scale factor proportional to spin density. Ti=1.05 s and tr=3.8 s represent the inversion recovery interval and repetition time, respectively, and R1 and R2 are longitudinal and transverse relaxation rate constants, respectively. The signal at the nth time point (Sn) is divided by the signal before injection, automatically eliminating S0 and R2.

It should be noted that accurate determination of Gd concentration (C) requires R ₁ (＝1/T ₁ ) Mapping. Here we assume that R ₁₀ ＝1s ^-1 And r is used for Gd-EOB-DTPA ₁ ＝6.9s ^-1 mM ^-1 C may be determined using equation (2).

The flow of Gd-EOB-DTPA from CSF into the tissue space was determined by standard Toffs model.

Wherein C is _t And C _c Representing Gd concentration in tissue and cerebrospinal fluid, respectively. K is a transfer constant, v _t Is the volume fraction of tissue that absorbs Gd-EOB-DTPA. The solution of the equation is shown below.

Images were acquired at five time points before (t=0 min) and after (t=114, 258, 1397 and 9996min, respectively) Gd injection. C (C) _c (t) is the average of the fourth intra-ventricular C values. Quantitative parameters K and v _t The determination of (4) may be made by fitting an experimental curve to the equation.

7. Construction of R26-e (CAG-LSL-Oatp 1a 1-P2A-EGFP-WPRE-polyA) 1 transgenic mouse strain and behavioral test

PCR amplification of fragments is performed by PCR on fragments oatp1a1-P2A-EGFP in recombinant viral plasmid rAAV-EF1a-oatp1a 1-P2A-EGFP-WPRE-pA. And (3) inserting a CAG-LSL-Oatp1a1-P2A-EGFP-WPRE-polyA expression frame into the Rosa26 gene locus in a fixed point manner by adopting a CRISPR/Cas9 technology through a homologous recombination mode. The brief procedure is as follows: cas9 mRNA and gRNA (GGGGACACACTAAGGGAGCTTGG) are obtained by means of in vitro transcription; a homologous recombinant vector (vector) was constructed by the method of In-Fusion cloning, and contained 3.3kb 5 'homology arm, CAG-LSL-Oatp1a1-P2A-EGFP-WPRE-polyA and 3.3kb 3' homology arm. Cas9 mRNA, gRNA and donor vector were microinjected into fertilized eggs of C57BL/6J mice to obtain F0 mice. And (3) performing PCR amplification and sequencing to identify positive F0 generation mice and mating the positive F1 generation mice with C57BL/6J mice. (this process is done by Shanghai Nannon model biological company). The prepared mice are injected with tamoxifen intraperitoneally, then activation of corresponding neurons is stimulated by 6h of behavioural stimulation, and intrathecal injection of Gd-EOB-DTPA and T1W imaging are carried out after protein accumulation for 3 days.

Experimental results

1. The brain parenchyma absorbs and eliminates Gd-EOB-DTPA within two weeks

To assess the diffusion and metabolism of Gd-EOB-DTPA in brain parenchyma, we first injected Gd-EOB-DTPA into the spinal canal of normal mice, and the diffusion and metabolism of injected Gd-EOB-DTPA was shown on T1W images obtained at 14T (fig. 3A). After intrathecal injection at a volume of 5-7ul, gd-EOB-DTPA concentrates at the skull base and is slowly transported to the midbrain. One day after injection, gd-EOB-DTPA in brain parenchyma and cerebrospinal fluid was washed away (FIG. 3A). Mice infected with rAAV2 were then evaluated for Gd-EOB-DTPA metabolism in vivo. rAAV2-Retro-EF1 alpha-oatp 1a1-P2A-EGFP was stereotactically injected into the left brain at 200nl volume and infected for 21 days. In vivo T1W images were collected using a 3T MRI scanner at different time points in two mice, as shown in fig. 3B. After injection, gd-EOB-DTPA gradually diffuses to the brain parenchyma and ventricles. The circles (right) in fig. 3B represent high signal areas that appear gradually over time on the T1W image. Co-localization of high signal regions on MRI and fluorescence images is shown in FIG. 3F, indicating that the signal delta on T1W MRI images is due to the uptake of Gd-EOB-DTPA by OATP1A 1. One day after injection, gd-EOB-DTPA was washed out from those brain regions not having OATP1A1 expression, while comparison was maintained from those brain regions having OATP1A1 expression (FIG. 3B). One week after injection, gd-EOB-DTPA was washed out in the whole brain (fig. 3B and D). MR signals were averaged in jin's brain and the average T1W signal intensities of the left thalamus (OATP 1A1 expression site: right circle in FIG. 3B) and right thalamus (OATP 1A1 non-expression site: left circle in FIG. 3B) were compared. The greatest difference in MRI signals between the OATP1A1 expressing and non-expressing regions occurred one day after Gd-EOB-DTPA injection (fig. 3b, d). The same phenomenon was observed at 14T (fig. 3C and E). After intrathecal injection of Gd-EOB-DTPA, the signals of the left lateral posterior thalamus nucleus (LP) and secondary somatosensory cortex (S2) areas showed high signals. The signal gradually increased and returned to baseline after one week. The maximum contrast between the OATP1A1 expressing and non-expressing regions occurred one day after Gd-EOB-DTPA injection, consistent with 3T results.

2. Viral infection and Gd-EOB-DTPA injection did not impair T2W brain parenchymal integrity

To assess the integrity of brain parenchyma after viral infection and Gd-EOB-DTPA injection, high resolution T1W and T2W images were collected at 14T. FIG. 4A shows T1W and T2W images collected one day after Gd-EOB-DTPA injection. The arrow indicates where neurons are located in the brain region projected onto the PO, i.e., the high signal region. The T2W images collected simultaneously did not show any abnormalities in the brain parenchyma in the same location, except for the needle tract lesions generated during stereotactic injection. Some Gd-EOB-DTPA enriched regions do show low signals, which may be caused by T2 relaxation effects of Gd-EOB-DTPA. Since Gd-EOB-DTPA completely disappeared after one week of injection, these low signals also disappeared at T2W, both T1W and T2W images restored to baseline (fig. 4B). It was shown that viral infection and Gd-EOB-DTPA injection did not impair brain parenchymal integrity.

3. MRI and fluorescence imaging show comparable results for neuronal markers

To demonstrate the accuracy of MRI-based neuron labeling, MRI results were compared to fluorescence results. 300nl of rAAV2-retro-oatp1a1-P2A-EGFP and rAAV2-retro-EGFP viruses were stereotactically injected into PO regions of two mice, respectively. After waiting 21 days, 7ul of Gd-EOB-DTPA was intrathecally administered. T1W images collected at 14T are shown in fig. 5A. The arrow in FIG. 5A indicates that uptake of Gd-EOB-DTPA occurs only in the OATP1A1 expression region. T1W images of mice infected with rAAV2-retro-EGFP virus and normal mice were also compared (FIG. 5E), in both cases no high signal contrast was found in the cortex. A comparison between MRI and fluorescence results is shown in fig. 5B. It indicates that the neuronal labeling on MRI is consistent with the fluorescence results, which is considered the gold standard for neuronal labeling. To further demonstrate the accuracy of MRI-based neuron labeling, we compared the two methods using one mouse. We injected 200nl of rAAV2-retro-EGFP virus into left PO (1.30, -2.03, -3.15) and 200nl of rAAV2-retro-oatp1al-P2A-EGFP virus into right PO (-1.30, -2.03, -3.15) (FIG. 5C). Both fluorescence and MRI images showed projections of neurons from cortex to PO in both hemispheres (fig. 5D). The labeling method of the present invention was shown to be consistent with the results of the fluorescent labeling method.

4. Imaging labeled neurons in the entire brain using in vivo MRI

21 days after virus injection (200 nl volume), experimental mice (n=5) were intrathecally dosed with Gd-EOB-DTPA. All MRI images were collected one day after Gd-EOB-DTPA injection. The T1W image was registered to TMBTA-Brain-Template and the z-value score was calculated to normalize the signal intensities from the different experiments. As shown in fig. 6A, the SSp and SSs regions exhibited high signals, consistent with previous reports, indicating that these regions contain neurons that project to the PO. High signals were also found in RT (reticuloendole), MOs (secondary motor zone), MOp (primary motor zone) and VIS (vision zone), all of which have neurons that project to the PO. Comparing the signals of these brain regions with those of the contralateral regions (fig. 6B), significant differences were found (p-value < 0.05). No significant difference was found in control EPv (inner piriform nucleus, ventral portion), indicating that this region has no neurons projecting into the PO region (fig. 6B). It was shown that following neuronal labelling by the expression of OATP1A1 protein by neurotropic viruses, the corresponding loop structure of neurons could be resolved.

5. Neuron markers can be quantified based on DCE-based analysis

The Toffs model is used to fit the Gd concentration curve to obtain quantitative parameters K and v _t As shown in fig. 7. The region containing the labeled neurons showed significantly higher v than the region not containing the labeled neurons _t Value indicating parameter v _t Is a useful biomarker for neuronal labeling, quantitatively and dynamically demonstrating that neurons containing the OATP1A1 protein can efficiently ingest Gd-EOB-DTPA.

6. Neuronal activity function detection in R26- (CAG-LSL-Oatp 1a 1-P2A-EGFP-WPRE-polyA) transgenic mice

After the neurotropic viruses perform neuron labeling, the corresponding loop structures can be analyzed. On the basis of the analysis loop, we further utilized this technique to prepare transgenic mice for analysis of neuronal function. Transgenic mouse R26- (CAG-LSL-Oatp 1a 1-P2A-EGFP-WPRE-polyA) preparation As shown in FIG. 8 and in the "7, R26-e (CAG-LSL-Oatp 1a 1-P2A-EGFP-WPRE-polyA) 1 transgenic mouse construction and behavior test" section of example 2. After the tamoxifen is injected, the mice are stimulated in a drug time window, so that the C-Fos expression of corresponding functional neurons is induced in the period, CRET2 connected with the C-Fos in the neurons is also expressed, the CRET2 enters a stop sequence in loxp in a cell nucleus to start the expression of OATP1A1 protein and EGFP protein expression of a target protein. Since the OATP1A1 protein localizes in the neuronal membrane, intrathecal injection of Gd-EOB-DTPA can be performed 3 days later and T1W imaging of neurons activated by drug action time behavior performed the fourth day. From the image, the brain region where the activated functional neurons are located can be observed. Since studies of different behaviors are critical for human brain diseases, such as depression caused by impaired brain neuron activity in certain areas, transgenic mice constructed according to the invention can be used for exploring basic studies of neuron function.

The foregoing description of the embodiments has been provided for the purpose of illustrating the general principles of the invention, and is not meant to limit the invention thereto, but to limit the invention thereto, and any modifications, equivalents, improvements and equivalents thereof may be made without departing from the spirit and principles of the invention.

Reference to the literature

Cai，A.，Zheng，N.，Thompson，G.J.，Wu，Y.，Nie，B.，Lin，K.，Su，P.，Wu，J.，Manyande，A.，Zhu，L.，et al. (2021).Longitudinal neural connection detection using a ferritin-encoding adeno-associated virus vector and in vivo MRI method.Hum Brain Mapp42，5010-5022.10.1002/hbm.25596.

Deng，W.，Faiq，M.A.，Liu，C.，Adi，V.，and Chan，K.C.(2019).Applications of Manganese-Enhanced Magnetic Resonance Imaging in Ophthalmology and Visual Neuroscience.Front Neural Circuits13，35.10.3389/fncir.2019.00035.

Guenthner，C.J.，Miyamichi，K.，Yang，H.H.，Heller，H.C.，and Luo，L.(2013).Permanent genetic access to transiently active neurons via TRAP：targeted recombination in active populations.Neuron 78，773-784.10.1016/j.neuron.2013.03.025.

Huang，L.，Xi，Y.，Peng，Y.，Yang，Y.，Huang，X.，Fu，Y.，Tao，Q.，Xiao，J.，Yuan，T.，An，K.，et al.(2019).A Visual Circuit Related to Habenula Underlies the Antidepressive Effects of Ligbt Therapy.Neuron102，128-142e128.10.1016/j.neuron.2019.01.037.

Kim，S.K.，Eto，K.，and Nabekura，J.(2012).Synaptic structure and function in the mouse somatosensory cortex during chronic pain：in vivo two-photon imaging.Neural P1ast 2012，640259.10.1155/2012/640259.

Liu，C.J.，Roy，A.，Simons，A.A.，Farinella，D.M.，and Kara，P.(2020).Three-photon imaging of synthetic dyes in deep layers of the neocortex.Sci Rep10，16351.10.1038/s41598-020-73438-w.

Xu，X.，Holmes，T.C.，Luo，M.H.，Beier，K.T.，Horwitz，G.D.，Zhao，F.，Zeng，W.，Hui，M.，Semler，B.L.，and Sandri-Goldin，R.M.(2020).Viral Vectors for Neural Circuit Mapping and Recent Advances in Trans-synaptic Anterograde Tracers.Neuron107，1029-1047.10.1016/j.neuron.2020.07.010.

Zheng，N.，Su，P.，Liu，Y.，Wang，H.，Nie，B.，Fang，X.，Xu，Y.，Lin，K.，Lv，P.，He，X.，et al.(2019).Detection of neural connections with ex vivo MRI using a ferritin-encoding trans-synaptic virus.Neuroimage197，133-142.10.1016/j.neuroimage.2019.04.039。

Claims

Use of the oatp1a1 gene in the preparation of a composition or kit for labelling neurons;

wherein the oatp1a1 gene is introduced and expressed in neuronal cells by rAAV 2-retroviruses.
2. The use of claim 1, wherein the composition or kit further comprises a specific magnetic resonance contrast agent.
3. The use according to claim 2, wherein the specific magnetic resonance contrast agent is Gd-EOB-DTPA.
Use of the oatp1a1 gene for the preparation of a composition or kit for neuronal tracking and/or monitoring neuronal cell activity;

wherein the oatp1a1 gene is introduced and expressed in neuronal cells by rAAV 2-retroviruses.
5. The use according to any one of claims 1-3 or the use according to claim 4, wherein the oatp1a1 gene is introduced into neurons of a mammal.
6. The use or use of claim 5, wherein the mammal is a rodent or monkey.
7. The use or use according to claim 6, wherein the mammal is a mouse or a rat.