CN114875060B - Use of dORF in enhancing translation of upstream encoding genes - Google Patents

Abstract

The invention discloses an application of dORF in enhancing upstream coding gene translation, and belongs to the technical field of genetic engineering. The invention discovers that a large amount of ribosome signals exist in a non-coding region of a gene by carrying out ribosome imprinting sequencing on ovules of Asian cotton in four different development periods of 0 day, 5 day, 10 day and 20 day and seedlings treated by 14 days and four abiotic stresses (ultraviolet, salt, high temperature and low temperature), and proves that an open reading frame with coding capability exists in the non-coding region of the gene and an open reading frame dORF with coding capability in a 3' UTR region downstream of the gene can enhance the translation capability of genes upstream of the ovules, and meanwhile, the same phenomenon exists in other monocotyledonous and dicotyledonous plants. Based on the function of dORF, the gene can be used as an element to regulate the translation efficiency of the gene, plays a role in a transgenic or stably expressed gene system, and has great application potential and application prospect.

Description

Use of dORF in enhancing translation of upstream encoding genes

Technical Field

The invention relates to the technical field of genetic engineering, in particular to application of dORF in enhancing upstream coding gene translation.

Background

In recent years, with the development of sequencing technology, a great breakthrough has been made in the research on protein level. With the advancement of ribosome imprinting sequencing technology and mass spectrometry sequencing methods, the conclusion that each eukaryotic messenger RNA (mRNA) encodes a protein has also been revised. Ribosome imprinting analysis reveals that the non-coding regions 5'UTR and 3' UTR of many genes have the potential to encode proteins, whereas long-chain non-coding RNA (lncRNA) has been shown to encode proteins in a variety of species and viruses. In most cases, an open reading frame with coding capacity located in the 5' UTR region of a gene is called uORF (upstream open reading frame), which inhibits the translational capacity of downstream genes.

The open reading frame with coding capacity in the 3' UTR region of genes, designated dORF (down stream open reading frame), has not been systematically studied in plants and animals for its associated features and functions. According to the data of the invention, dORF (down stream open reading frame) can promote the translation capacity of an upstream gene in plants, and the translation level of a regulatory gene can possibly become a new modification mode through dORF, so that the method has very important biological significance in cultivating high-yield varieties of plants and improving the response to stress.

Disclosure of Invention

The invention proves that the plant endogenous dORF (down stream open reading frame) has the capability of promoting the translation of an upstream gene, dORF can be used as a novel mode for regulating the translation level of the gene, and based on the fact, the invention provides the application of the dORF in enhancing the translation of the upstream coding gene.

The invention uses ovules of Asian cotton at four different development stages: ribosome imprinting sequencing was performed on seedlings treated with 0, 5, 10, 20, and 14 days and four abiotic stresses (uv, salt, high temperature, low temperature) first, the quality of the data was assessed, with a pronounced periodicity of 3-nt, indicating that acquisition was valid data. Next, a comprehensive annotation was made of asian cotton genome-wide sorf (small open reading frame), which found that there were a large number of open reading frames with coding potential in the non-coding region of the coding gene. The present invention has been developed to analyze the basic characteristics of these open reading frames with coding potential in order to further understand the significance of their existence. The upstream open reading frame uORF with coding capacity and the downstream open reading frame dORF with coding capacity have a shorter amino acid length, around 100 amino acids, compared to the coding region of the gene; translation ability is weak compared to the coding region of the gene.

To explore the biological significance and potential function of the presence of asian cotton sorf, the present invention first compared the translational efficiency of a gene containing uofs with genes not containing uofs at the same transcriptional level. 3000 examples were randomly selected according to the present invention, and found that the translation efficiency of the gene containing the uORF was significantly lower than that of the gene without the uORF, which is consistent with the presently known conclusions, whereas dORF shows the opposite trend, and that the translation efficiency of the gene containing the dORF is significantly higher compared to the gene without the dORF, which indicates that the dORF functions in the opposite direction to the uORF.

In order to demonstrate the presence of the dORF and to enhance the efficiency of translation of the upstream gene, the present invention demonstrates translation of the dORF in vitro using a tobacco transient transformation system by fusing a commercial FLAG tag to the dORF sequence using Tricine-SDS-PAGE. In order to demonstrate that the dORF has the function of enhancing the translation efficiency of the upstream gene, the present invention compares the translation efficiency of the upstream gene by deleting the dORF sequence, and the upstream gene selects the gene encoding firefly luciferase. By examining the activity of fluorescence, it was found that in the case of deletion of the dORF sequence such that the dORF cannot be translated, the fluorescence activity was significantly reduced, indicating that the non-translation of the dORF affects the level of translation of the upstream gene. In order to determine whether the dORF is passed through the transcription process and thus affects the translation product of the gene, the present invention uses rt-qpcr to quantify the level of gene transcription, and found that there is no difference in the level of transcription of the fluorescent gene compared to the unaltered dORF sequence. Indicating that the presence of the dORF does enhance the translational efficiency of the upstream gene without affecting the transcription level of the upstream gene.

From the above, it is clear that the dORF of the plant has application to enhance translation of the upstream encoding gene.

Further, the plant includes monocotyledonous plants, dicotyledonous plants.

Still further, the plants include Asian cotton, rice, tomato.

A method for enhancing the translation efficiency of a target gene by inserting a dORF of a plant into the 3' UTR region of the target gene.

Further, the sequence of the dORF includes but is not limited to the sequences shown in SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.8 and SEQ ID NO. 11.

Compared with the prior art, the invention has the following advantages and effects:

the invention discovers that the presence of dORF in the plant can promote the translation efficiency of the upstream coding gene for the first time, and proves the functions of translating dORF and enhancing the translation efficiency of the upstream gene under in vitro conditions. Based on the function of dORF, the gene can be used as an element to regulate the translation efficiency of the gene, plays a role in a transgenic or stably expressed gene system, and has great application potential and application prospect. The research of the invention shows that dORF with translation potential can improve the translation efficiency of upstream genes in monocotyledonous and dicotyledonous plants.

Drawings

FIG. 1 is the result of 3-nt periodic analysis of ribosomal stamp database data by bioinformatics.

Fig. 2 is a profile of the database data in asian cotton genome by bioinformatics statistics ribosomal imprinting.

FIG. 3 shows the tendency of translation efficiency of a gene containing uORF or dORF to a gene not containing uORF or dORF, respectively, under conditions of no difference in transcription level by bioinformatic analysis.

FIG. 4 is a schematic representation of a PGX-5dual vector. In the figure, 35S: a strong promoter; LUC: luciferases, firefly luciferases; sal, spe: restriction sites; REN: renilla luciferase; HA: commercial labels.

FIG. 5 is a visualization of the gene structure and ribosomal imprinting and polyA-seq sequencing data for four examples Ga13g02057, ga01g00361, ga05g01077, ga05g01995, indicating that the 3' UTR region of these genes contains dORFs (dashed boxes are annotated dORF positions).

FIG. 6 is a schematic representation of the product of the synthetic sequence ligation at PGX-5dual. In the figure, the dORF: the complete 3' UTR sequences for the four genes Ga13g02057, ga01g00361, ga05g01077, ga05g01995 were ligated to the vector using sal I and spe I restriction sites, respectively; delete: the annotated dORF sequences were deleted for the 3' UTR sequences of the four genes Ga13g02057, ga01g00361, ga05g01077, ga05g01995, the other sequences unchanged were ligated to the vector using sal I and spe I restriction sites, respectively.

FIG. 7 is a schematic diagram of vector construction product of dORF fusion FLAG tag annotated by gene Ga11g02302 and Tricine-SDS-page result diagram. In the figure, the dORF FLAG: ga11g02302 annotated dORF fusion FLAG tag was ligated to vector using sal I and spe I restriction sites; control: empty vector, dsorf: vector containing Ga11g02302 annotated dORF fusion FLAG.

FIG. 8 is a graph showing the results of double fluorescence detection, rt-qPCR and western blot of 4 genes. In the figure, LUC/REN activity: firefly enzyme activity/renilla luciferase activity; LUC mRNA level: firefly enzyme RNA expression level; delete: deletion of the dORF sequence of the gene 3' UTR, the other sequences being unchanged; UTR: a genetically complete 3' UTR sequence; sample: a protein sample; condral: internal reference, renilla luciferase.

FIG. 9 shows the tendency of translation efficiency of the gene containing uORF or dORF to the gene without uORF or dORF, respectively, by bioinformatic analysis using ribosomal imprinting and RNA-seq sequencing data of rice under conditions of no difference in transcription level.

FIG. 10 shows the tendency of translation efficiency of a gene containing uORF or dORF to a gene not containing uORF or dORF, respectively, under conditions of no difference in transcription level by bioinformatic analysis using ribosome imprinting and RNA-seq sequencing data of tomato.

Detailed Description

The following examples further illustrate the invention but are not to be construed as limiting the invention. Modifications and substitutions to methods, procedures, or conditions of the present invention without departing from the spirit and nature of the invention are intended to be within the scope of the present invention.

In the following examples, conventional methods are used unless otherwise specified.

Cotton and tobacco were cultivated as follows in the examples below:

cotton material planted in the greenhouse: cotton seed hulls of cotton seeds are removed, placed in a small basin containing vermiculite, transferred into a greenhouse at 28 ℃ for 14 days for culture, and respectively treated as follows: (1) The temperature of the incubator is adjusted to 50 ℃, cotton for 14 days is put into the incubator for 5 hours, and is quickly washed by pure water and is put into liquid nitrogen for quick freezing, and the sample is preserved at-80 ℃; (2) The temperature of the incubator is adjusted to 4 ℃, cotton for 14 days is put into the incubator for 15 hours, quickly washed by pure water, quickly frozen by liquid nitrogen, and the sample is preserved at-80 ℃; (3) Preparing 500mM NaCl, pouring 20mL into a small basin for culturing seedlings, culturing for 24 hours at 28 ℃, quickly flushing with pure water, putting into liquid nitrogen, quick freezing, and preserving the sample at-80 ℃; (4) The ultraviolet intensity of the incubator was adjusted to 1.24. Mu. Mol m ^-2 s ^-1 Culturing at 28deg.C for 2 hr, rapidly washing with pure water, quick freezing with liquid nitrogen, and preserving at-80deg.CThe method comprises the steps of carrying out a first treatment on the surface of the (5) Cotton seedlings grown normally for 14 days are quickly washed by pure water and put into liquid nitrogen for quick freezing, and samples are preserved at-80 ℃.

Tobacco material is planted in a greenhouse: tobacco seeds were spread evenly in small pots containing vermiculite and transferred to a 28℃greenhouse for 4-5 weeks.

Example 1 annotation and functional discovery of Asian cotton dORF

Ribosome imprinting data analysis

The quality of sequencing data was assessed by ribosome imprinting sequencing of ovules from four different developmental stages (0, 5, 10, 20) of asian cotton, and seedlings treated for 14 days and four abiotic stresses (uv, salt, high temperature, low temperature).

1. Raw sequencing data quality control: the sequencing adapter (AGATCGGAAGAG) of the original sequencing data (rawdata) and the sequence with the length greater than 40bp after the adapter removal were removed using the second generation sequencing quality control software cutadapt to obtain filtered cleardata.

2. Removal of rRNA, tRNA, snRNA contamination: the sequence alignment software bowtie was used to align the cleardata with rRNA, tRNA, snRNA in the Rfam database (https:// Rfam. Xfam. Org /), allowing up to two mismatches, leaving the sequence unaligned.

3. Alignment of sequences to a reference genome: the sequence alignment software STAR was used to align the unaligned sequences with Asian cotton reference genome, which allowed at most two mismatches, and the sequence and annotation files for the reference genome were from MaGenDB (http:// Magen. Whu. Edu. Cn /), resulting in the final alignment file.

4. Quality control of ribosome imprinting database establishment: the distribution of sequences over the genome was detected using the read_distribution. Py script of rseqc, and the periodicity of the ribosomal imprint sequencing data was detected using ribotricer.

The results are shown in FIG. 1, where the sequencing data has a significant periodicity of 3-nt, indicating that valid data was obtained.

(two) discovery of uORF and dORF annotation and function

1. Prediction of open reading frame: PRICE was used to predict open reading frames with potential coding capacity, resulting in annotated information for uORF and dORF.

The results are shown in FIG. 2, in which 75.65% of the sequencing data are distributed in the coding region of the Asian cotton genome, 0.48% in the intron region, 4.43% in the 5'UTR region, 2.96% in the 3' UTR region and 16.48% in the other regions.

2. Quantitative analysis of gene at transcription level and translation level and calculation of translation efficiency: quantifying the RNA-seq data and the ribo-seq data by salmon, and calculating the expression value of the gene at the transcription level and the translation level; the translation efficiency of the gene (translation efficiency=log2 (expression value of transcription level of gene/expression value of translation level of gene)) was calculated. 3000 examples were randomly chosen and analyzed as follows.

3. Effect of dsorf on gene translation efficiency: the genes were randomly sampled according to the expression values at the RNA level, and differences in translation efficiency between the genes with the dsorf and the genes with similar RNA levels but without the dsorf were counted.

As a result, as shown in FIG. 3, in the randomly selected example, the translation efficiency of the gene containing uORF was significantly lower than that of the gene containing no uORF, whereas dORF showed the opposite trend, and the translation efficiency of the gene containing dORF was significantly higher than that of the gene containing no dORF.

Demonstration of the function of (III) dORF

1. Construction of vectors

The vector was selected from the double fluorescent vector PGX (Guoyong Xu, uORF-mediated translation allows engineered plant disease resistance without fitness costs, 2017) and modified as follows: the carrier is named PGX-5dual by entrusting the sal I and spe I restriction enzyme cutting sites after the carrier LUC gene sequence of the Wuhan aoke Dingsheng biotechnology limited company.

The results are shown in FIG. 4, where sal I and spe I restriction sites are added after the LUC gene.

2. Selection of 3' UTR sequence containing dORF annotated Gene for Artificial Synthesis

By analysis of (one) and (two), the following 4 genes were selected: ga13g02057, ga01g00361, ga05g01077, ga05g01995. These 4 genes all contained annotations of the dORF, the 3' UTR sequences of the 4 genes were delegated to the Withania Dingsheng Biotech Co., ltd, and the dORF sequences annotated according to bioinformatics were deleted and ligated to the vector PGX-5dual using sal I and spe I restriction sites. The 3' UTR sequences with complete genes were synthesized and named Ga13g02057-3' UTR (SEQ ID NO. 1), ga01g00361-3' UTR (SEQ ID NO. 4), ga05g01077-3' UTR (SEQ ID NO. 7), ga05g01995-3' UTR (SEQ ID NO. 10), respectively; the sequences of the bioinformatically annotated dORFs in these sequences are shown as SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.8, SEQ ID NO.11, respectively. The sequences from which the dORF was deleted were designated Ga13g02057-dORF-delete (SEQ ID NO. 3), ga01g00361-dORF-delete (SEQ ID NO. 6), ga05g01077-dORF-delete (SEQ ID NO. 9), ga05g01995-dORF-delete (SEQ ID NO. 12), respectively. The synthesized sequence contains sal I and spe I cleavage sites at both ends.

FIG. 5 is a visualization of four gene ribosomal imprinting and polyA-seq sequencing data, showing that the four genes contain annotations of dORF and FIG. 6 is a schematic representation of the product of ligating the synthesized sequences onto the vector.

2. Transferring the successfully-connected vector into agrobacterium GV3101

Transferring the constructed plasmid into agrobacterium GV3101, and screening to obtain agrobacterium strain containing target gene. The method for transferring the agrobacterium comprises the following steps:

(1) And taking agrobacterium tumefaciens competence stored at-80 ℃ and inserting the agrobacterium tumefaciens competence into ice when the agrobacterium tumefaciens competence is partially melted at room temperature or at palm of a hand for a while and is in an ice water mixed state.

(2) 1 μg of plasmid DNA is added into each 100 μl of the mixture, the mixture is stirred by hands at the bottom of the tube and mixed well, and the mixture is placed on ice for 5 minutes, liquid nitrogen for 5 minutes, water bath at 37 ℃ for 5 minutes and ice bath for 5 minutes in sequence.

(3) 700. Mu.L of LB without antibiotics was added and cultured with shaking at 28℃for 2-3 hours.

(4) Centrifuging at 6000rpm for one minute to collect bacteria, collecting about 100 μl supernatant, gently blowing to resuspension bacteria block, coating on LB plate containing corresponding antibiotics, and culturing in 28 deg.C incubator for 2-3 days.

3. Transient transformation of tobacco systems

(1) Picking monoclonals in 5mL LB liquid medium, and shake culturing at 28-30 ℃. To LB, 100. Mu.g/mL gentamicin (Agrobacterium strain GV3101 harbors resistance) and 50. Mu.g/mL kanamycin (vector harbors) were added.

(2) 1mL of the overnight cultured Agrobacterium was transferred to 25mL of LB liquid medium (with gentamicin and kanamycin added, and autoclaved acetosyringone added). The OD value of the overnight cultured bacterial liquid was measured, and the OD value was adjusted to 0.4 using LB medium.

(3) Bacteria were collected by centrifugation at 5000g for 15 min and concentrated with a heavy suspension (10 mM MgCl) ₂ 10mM MES,5mM AS) was used to resuspend the cells, with a final OD600 of 0.4.

(4) After being placed at room temperature for 2-3 hours, tobacco is injected into a greenhouse at 28 ℃ for 4-5 weeks. The suspension was loaded into a 5mL syringe and the syringe was pressed with the thumb to inject liquid from the subleaf epidermis into the tobacco leaf. After injection, the leaves are placed in a 28 ℃ incubator for 2-3 days, and the leaves are placed in liquid nitrogen for quick freezing and are preserved at-80 ℃.

4. Extraction of tobacco proteins

Precooling a mortar with liquid nitrogen, cutting tobacco leaves of the injection bacteria liquid, putting the tobacco leaves into the mortar, adding the liquid nitrogen, rapidly grinding the tobacco leaves into powder, transferring the powder to a 1.5mL EP tube, adding 1mL of protein extract (10 mM Tric-HCl PH=8.0, 20mM EDTA PH= 8.0,1mM PMSF,1mM DTT,1%Triton-100), and performing ice lysis for 30min. Centrifuge at 12000rpm for 10min at 4℃and transfer supernatant to a new 1.5mL EP tube, supernatant being total protein of tobacco.

5. Tricine-SDS-page in vitro demonstration of translation of dORF

To demonstrate the translation of the dORF, the 3' UTR sequence of gene Ga11g02302 was synthesized by Wuhan Oncoder Dingsheng Biotechnology, inc., and FLAG tag (SEQ ID NO. 13) was fused before the stop codon of the annotated dORF sequence, using sal I and spe I restriction sites to ligate to PGX-5dual vector, extracting proteins by tobacco transient transformation method (same 3, 4), using Tricine-SDS-page (HermannTricine-SDS-PAGE, 2006) method using primary antibody FLAG-Tag (Wohan-Ann biosFLAG-Tag mouse mAb) and secondary antibody Goat anti-mouse (Agrisa), using empty vector as control, proving dTrue translation of the ORF.

The schematic of the vector construction product of the dORF fused FLAG tag annotated by Ga11g02302 and Tricine-SDS-page results are shown in FIG. 7, and the dORF fused FLAG tag can be translated.

6. Dual fluorescence detection

Double fluorescence detection was performed using Dual Luciferase Reporter Assay Kit of nanking.

50mg of tobacco leaves are taken, ground with liquid nitrogen, lysed with 200. Mu.L of lysate, centrifuged at 12000rpm for 5min, and the supernatant is taken. 20 mu L of supernatant is added into a black ELISA plate, 100 mu L Luciferase Assay Reagent II is added first, the measurement is carried out by using an ELISA instrument after 2s, and then 100 mu L of Stop & Glo Reagent is added for measurement. By double fluorescence detection, it was found that the activity of the LUC gene upstream of the deletion of the dsorf sequence was significantly reduced compared to the complete 3' utr sequence (fig. 8).

7. Western blot detection of Luciferase protein content

The extraction method of the tobacco protein is as described in 4, and the protein amount of the LUC gene is detected by western blot. The internal reference is REN sea kidney protein of PGX-5dual fusion HA label, the primary reference is HA-Tag (Wuhan Dynam organism HA-Tag mouse mAb), the secondary reference is Goat anti-mouse (Agrisa), and the internal reference western blot is consistent with the LUC protein method, and the method is as follows:

(1) Mixing 20 μl of protein sample with 4 μl of 5×SDS-locking buffer (Beijing full gold), and denaturing at 99deg.C for 5min;

(2) Carrying out polyacrylamide gel electrophoresis on the denatured sample, wherein the voltage of 90V is 30min, and the voltage of 150V is 1 hour;

(3) Cutting a nitrocellulose membrane with the same size as polyacrylamide gel, six pieces of filter paper with the same size as the sponge, and placing the filter paper and the sponge into a membrane transferring liquid for later use;

(4) Treating nitrocellulose membrane in absolute ethanol for 10-20s, transferring into pure water for 2-3min, and standing membrane transfer solution (formula see below);

(5) The porous filter comprises a layer of sponge, a layer of filter paper, a nitrocellulose membrane, polyacrylamide gel, a layer of filter paper and a layer of sponge;

(6) Placing the clamp into a film-transferring tank insect, wherein the black surface of the clamp faces the black surface of the tank, the white surface of the clamp faces the red surface of the tank, adding film-transferring liquid, covering a cover, placing the tank into an ice box, and carrying out electrophoresis for 2h under a constant current of 200 mA;

(7) Sealing with 5% fat-absorbing milk powder for 2h, TBST formula is shown below), and washing the membrane for 3 times each for 5min;

(8) Adding primary antibody working solution (Agrisa, LUC|Luciferase), incubating for 2h at room temperature, and washing the membrane with TBST for 3 times each for 5min;

(9) Adding secondary antibody working solution (Agrisa, coat anti-Rabbit), incubating at room temperature for 2h, and washing the membrane with TBST for 3 times and 5min each time;

(10) Uniformly spreading the developing solution on the film, and closing the developing box;

(11) Opening the developing box in the developing chamber, drawing out a film, folding up and taking the film as a mark, closing the developing box for timing exposure for 1min, then turning the film upside down, closing the developing box for exposure for 2min, putting the film into the developing instrument, and waiting for the film developing result.

The formula of the transfer film liquid comprises the following components: 8.8618g glycine was weighed into a 1L beaker, 60mL of absolute ethanol was added to the beaker, and ddH was added by stirring thoroughly ₂ O constant volume solution to 600mL for use.

TBST formula: weigh 8.8g NaCl into a 1L beaker, add 20mL 1M Tris-HCl (pH=8) and 800mL ddH to the beaker ₂ O is fully stirred and dissolved, added with 0.5mL Tween-20 and fully mixed evenly, and added with ddH ₂ O constant volume solution to 1L for standby.

The results are shown in FIG. 8, where the amount of protein in the LUC gene upstream of the deletion of the dORF sequence is significantly reduced compared to the complete 3' UTR sequence.

8. Detection of LUC Gene expression level by RT-PCR

Total plant RNA of tobacco plants was extracted using a polysaccharide polyphenol plant total RNA extraction kit (purchased from Tiangen Co., RNAprep Pure Plant Plus Kit (Polysaccharides & Polyphenolics-rich)) and reverse transcribed using a reverse transcription kit (purchased from Beijing full-size gold Co., easylScript One-Step gDNA Removal and cDNA Synethesis SuperMix) to obtain cDNA. Expression of LUC was detected by PCR using primers LUC-F, LUC-R, REN-F, REN-R (Table 1).

TABLE 1

Primer name	Primer sequence (5 '-3')
		LUC-F	GGATTACAAGATTCAAAGTGCG
LUC-R	TGATACCTGGCAGATGGAAC
		REN-F	CCTGGGACGAGTGGCCTGACA
REN-R	AGTTGCGGACAATCTGGACGAC

Example 2 analysis of the functions of the uORF and dORF of other plant species

To demonstrate that the phenomenon of enhanced upstream coding gene translation of the dORF is widespread in plant species, analysis of the uORF and dORF translation efficiency of rice and tomato was carried out using the analytical procedures of (one) and (two) using published ribosomal imprinting sequencing data and RNA-seq data of other plants (tomato data sources: hsin-Yen Larry Wu, gaoyuan Song, jusin W.Walley, polly Yingshan Hsu (2019) The Tomato Translational Landscape Revealed by Transcriptome Assembly and Ribosome profiling.plant Physiol.Sep;181 (1): 367-380.Published online 2019Jun 27.doi:10.1104/pp.19.00541; rice data sources: yang X, cui J, song B, yu Y, mo B and Liu L (2020) Construction of High-Quality Rice Ribosome Footprint Library. Front. 11:572237.Doi: 10.3389/fpls.2020.572237).

See fig. 9 and 10 for specific results: the translation efficiency of the gene containing the uORF is significantly lower than that of the gene without the uORF; whereas the dORF shows the opposite trend, the translation efficiency of the gene containing dORF is significantly higher compared to the gene without dORF.

Sequence listing

<110> university of Wuhan

<120> use of dORF in enhancing translation of upstream coding genes

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 564

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 1

gtcgactaaa gcaatacggg ggaatcgaaa gggcacaaga gttcgcaaaa gagaaagctg 60

atattgcaat caagagtctc caatgtcttc ttcaaagcga tttctggtta gggcttgaag 120

atatggtgat gtttaatcta gaaaggattg attagtttaa ctaatccaaa acaagcaaca 180

tgatacatga cagataaata ttgcatgaag ttgaagcctg taccaatata gaacagcttc 240

ttaggatatt aattggttcc ttgtcactgg ttgtatattc atacaaggct ttgagctttg 300

acttgagctc ctagtttcaa tgtcttcaaa ttataaattt gtctgagaaa aaataatttc 360

tctgttaaat taaattgatg aacaataaag tctttgtggt catcaatatt aagctaataa 420

acttctatta tgtatataag gaaacctatg ttataggggt ttctcttttt cttcttaaaa 480

gtatttgtgt ttgacgttta tatgaaaaag tgtgaattgg ctttgattgc tttcaattta 540

taatggttaa tattctagac tagt 564

<210> 2

<211> 35

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 2

atatggtgat gtttaatcta gaaaggattg attag 35

<210> 3

<211> 529

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 3

gtcgactaaa gcaatacggg ggaatcgaaa gggcacaaga gttcgcaaaa gagaaagctg 60

atattgcaat caagagtctc caatgtcttc ttcaaagcga tttctggtta gggcttgaag 120

tttaactaat ccaaaacaag caacatgata catgacagat aaatattgca tgaagttgaa 180

gcctgtacca atatagaaca gcttcttagg atattaattg gttccttgtc actggttgta 240

tattcataca aggctttgag ctttgacttg agctcctagt ttcaatgtct tcaaattata 300

aatttgtctg agaaaaaata atttctctgt taaattaaat tgatgaacaa taaagtcttt 360

gtggtcatca atattaagct aataaacttc tattatgtat ataaggaaac ctatgttata 420

ggggtttctc tttttcttct taaaagtatt tgtgtttgac gtttatatga aaaagtgtga 480

attggctttg attgctttca atttataatg gttaatattc tagactagt 529

<210> 4

<211> 239

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 4

gtcgacagaa agcgaagaag attaccggga cagccgaaga agatgatgag attctctaca 60

tattgataac atttttagaa cctatattgc atgttgttct tcatgttata tacttttgag 120

aacccattgc atatctttct tcatgatata tttctatttt tggaaccaat tgcatatttg 180

aactatttgt agacttcatt caaacatgca aatatattta gttaaaaatg gacactagt 239

<210> 5

<211> 57

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 5

aagcgaagaa gattaccggg acagccgaag aagatgatga gattctctac atattga 57

<210> 6

<211> 182

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 6

gtcgacagat aacattttta gaacctatat tgcatgttgt tcttcatgtt atatactttt 60

gagaacccat tgcatatctt tcttcatgat atatttctat ttttggaacc aattgcatat 120

ttgaactatt tgtagacttc attcaaacat gcaaatatat ttagttaaaa atggacacta 180

gt 182

<210> 7

<211> 1024

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 7

gtcgaccatg ctatatacac aagttagcca ttggattttt gagaaaatat ttctttgtta 60

ttttatttgt tctggagagt atttttggcg gaataggcca aacataggta ggttgtgtta 120

gtactaggtc acagtttatt ccttgattgg atttcatgcg tttgtacaga aaatgaaaaa 180

tcaaatgaag tttgtagatg agagtgcatt ggtcctcttt cagctttctt gatggacctc 240

actagcttgt tcctaagcaa atatatgctg gtaattttgt catatttctc ctcattttag 300

ctttaaacca gatgagttgt catcaaatat tcaactccca agttttaaat tgtgtctcac 360

tccacctatg ctctataaaa ataattttaa ccagtacaaa gttcctgtgt tagttgggtg 420

tcatttacta ttattattgc agagagttga aatctccctt tgaatggtag ttgtcatatg 480

actttgagaa aggatggtgt aattcatcaa cttatataac aatctcaccg gatataagat 540

atctttccaa agtcttatct cctcaaccaa caatggatcc acctcctcta cctccaactc 600

caccaccgac gacaccgctg ctagctccgt cacctccaga aggagggtta tgggaatcat 660

ggtaagatgt tctctccatt gttattgcat tttacttgtg catgaagaaa caaacaggga 720

aacatttctg acatttcaag ggctgctgcc tggttcccta tctgtttgca gtttgtggtt 780

tctgtgttgc tgtggaatat tcagaagctg ctgccctcca ctgtttgaac cagggccacc 840

tcctccgtag atctgcattc ttttttctct ttttggaatg tatgagtatt ttacaaggat 900

ttaattattt ggaacatgat gattggttct tgtggtttgt cattcttctt attatctgct 960

aatctatgta gcaactgaga ttagtgatgc aaaatttatg aatttatagc tttcttctac 1020

tagt 1024

<210> 8

<211> 278

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 8

atggatccac ctcctctacc tccaactcca ccaccgacga caccgctgct agctccgtca 60

cctccagaag gagggttatg ggaatcatgg taagatgttc tctccattgt tattgcattt 120

tacttgtgca tgaagaaaca aacagggaaa catttctgac atttcaaggg ctgctgcctg 180

gttccctatc tgtttgcagt ttgtggtttc tgtgttgctg tggaatattc agaagctgct 240

gccctccact gtttgaacca gggccacctc ctccgtag 278

<210> 9

<211> 746

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 9

gtcgaccatg ctatatacac aagttagcca ttggattttt gagaaaatat ttctttgtta 60

ttttatttgt tctggagagt atttttggcg gaataggcca aacataggta ggttgtgtta 120

gtactaggtc acagtttatt ccttgattgg atttcatgcg tttgtacaga aaatgaaaaa 180

tcaaatgaag tttgtagatg agagtgcatt ggtcctcttt cagctttctt gatggacctc 240

actagcttgt tcctaagcaa atatatgctg gtaattttgt catatttctc ctcattttag 300

ctttaaacca gatgagttgt catcaaatat tcaactccca agttttaaat tgtgtctcac 360

tccacctatg ctctataaaa ataattttaa ccagtacaaa gttcctgtgt tagttgggtg 420

tcatttacta ttattattgc agagagttga aatctccctt tgaatggtag ttgtcatatg 480

actttgagaa aggatggtgt aattcatcaa cttatataac aatctcaccg gatataagat 540

atctttccaa agtcttatct cctcaaccaa caatctgcat tcttttttct ctttttggaa 600

tgtatgagta ttttacaagg atttaattat ttggaacatg atgattggtt cttgtggttt 660

gtcattcttc ttattatctg ctaatctatg tagcaactga gattagtgat gcaaaattta 720

tgaatttata gctttcttct actagt 746

<210> 10

<211> 1977

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 10

gtcgacgaat gagatgtgtg tacggaaaag aatcgatcaa atgttcaata acaagtattc 60

atgcatattg aagatggata gaaagctttg ttggggtgat atatcagatt atcagagtcg 120

aagggaaaag cggtgtaaat aaaaacacct aacagaagcg tgtaacagtg tcattcggac 180

cggctggttt tgcagtggtg aatggatatt tttttgttgg gttagtgcac actttaatgt 240

agtataaaat gttgttttgt tttgtaatac aaatatttgt gttatatctt tttgttcatt 300

gtgtttatgc tatatataca tatcaggttt aaagaattat ttattaacat attaataatt 360

tatgctacat aaataatgca tttattttat ttatattaaa atatattata ttaaaaatgt 420

taatcactgt tagtaaaatt gattaaggtg ttaaaaaaat tgtaataaat aattaccttt 480

tttgtgtaaa taatattata tttgtgtaat agttttcctt ttttctaaag aaagccaaaa 540

agaaagtaaa tcgttggtga ataaattatc aataaatgaa aaaagggtca ataatatttg 600

ctggactccc tccctgaccg tcggtgtttc aaacagaagc agagcaactg ttttggtcgg 660

actcttttgg tggtttgttc cgatgttcaa agattgtggg tattggatct cgttttcttc 720

tcaatgttga cgcgtctgca gagtaacaaa cttttctcca aggtttgtat agttaaatgg 780

ggtttccttt ctacactttc gcttgcgtcg tattatctga cttattgttc tcgcgatctg 840

cgtttttatt tttaggttct tctgagtcgt tacaaaaacg ggtttcccaa tcttatctct 900

gggtctcaat ttttaagagg ttttaacgag attacaaagc ataggttttc tgtaatgtcg 960

ggtgaaaatc taagaagcct atctaacagt gcttccccga ggaattaccg agtcgtagtg 1020

gctgcaactc gtgaaatggg gatagggaaa gatggcaagt tgccatggag attgccttct 1080

gatctcaaat tcttcaagga acttacagtg acaacatcag atcctgagaa gaagaatgct 1140

gtagtaatgg gtagaaaaac ctgggagagt attccacttg agtttagacc tttacccggt 1200

cgcctgaatg ttgtccttac tcgttcccag agttctgata ttacaactgg agaaaatgtt 1260

gtaatatgtg ggagcattcc atcagctttg gaactattag ccgaggttcc ttattgtttt 1320

gcaatagaga aggtgtttgt cattggcggt ggccagatat tcaggtagat tttttagtaa 1380

aagttgttga atttcattgc atatttgttg gggaaagata atgttttgat gttttacaat 1440

gcagggaaac actcaatgct tcaggttgcg aagccattca cattactgaa attgggacaa 1500

gcattgaatg cgataccttc attccttcaa ttgactcgtc ttgtttccag ctgtggtact 1560

cttcgaagcc attggaagaa aataatgtcc ggttttcatt tgcaacttat gttcgtgtta 1620

gatctaggac aactgataat tatgaggtaa aagacttgag tttcttgccc aggatgattg 1680

ttgagagacg agatgaatga gtcaattagt aaataatact gagacttgtt catgaaacta 1740

tctcaagtga caagcaagac ccttgactgg ttagatacag aattcatttg cctaggtagt 1800

cttaaacctt ggttctctat gactctactg ctctttgcct tacattttat tgttgttgct 1860

gatgtttaaa tgtaaatatg agcatcatcc ccagtccacg ttgtgatttt gtacaatgta 1920

agtctatctt tgcagatctt ttcatcttct tatataacta aggtatttac tactagt 1977

<210> 11

<211> 48

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 11

atgttcaaag attgtgggta ttggatctcg ttttcttctc aatgttga 48

<210> 12

<211> 1929

<212> DNA

<213> Asian cotton (aseptic cotton)

<400> 12

gtcgacgaat gagatgtgtg tacggaaaag aatcgatcaa atgttcaata acaagtattc 60

atgcatattg aagatggata gaaagctttg ttggggtgat atatcagatt atcagagtcg 120

aagggaaaag cggtgtaaat aaaaacacct aacagaagcg tgtaacagtg tcattcggac 180

cggctggttt tgcagtggtg aatggatatt tttttgttgg gttagtgcac actttaatgt 240

agtataaaat gttgttttgt tttgtaatac aaatatttgt gttatatctt tttgttcatt 300

gtgtttatgc tatatataca tatcaggttt aaagaattat ttattaacat attaataatt 360

tatgctacat aaataatgca tttattttat ttatattaaa atatattata ttaaaaatgt 420

taatcactgt tagtaaaatt gattaaggtg ttaaaaaaat tgtaataaat aattaccttt 480

tttgtgtaaa taatattata tttgtgtaat agttttcctt ttttctaaag aaagccaaaa 540

agaaagtaaa tcgttggtga ataaattatc aataaatgaa aaaagggtca ataatatttg 600

ctggactccc tccctgaccg tcggtgtttc aaacagaagc agagcaactg ttttggtcgg 660

actcttttgg tggtttgttc cgcgcgtctg cagagtaaca aacttttctc caaggtttgt 720

atagttaaat ggggtttcct ttctacactt tcgcttgcgt cgtattatct gacttattgt 780

tctcgcgatc tgcgttttta tttttaggtt cttctgagtc gttacaaaaa cgggtttccc 840

aatcttatct ctgggtctca atttttaaga ggttttaacg agattacaaa gcataggttt 900

tctgtaatgt cgggtgaaaa tctaagaagc ctatctaaca gtgcttcccc gaggaattac 960

cgagtcgtag tggctgcaac tcgtgaaatg gggataggga aagatggcaa gttgccatgg 1020

agattgcctt ctgatctcaa attcttcaag gaacttacag tgacaacatc agatcctgag 1080

aagaagaatg ctgtagtaat gggtagaaaa acctgggaga gtattccact tgagtttaga 1140

cctttacccg gtcgcctgaa tgttgtcctt actcgttccc agagttctga tattacaact 1200

ggagaaaatg ttgtaatatg tgggagcatt ccatcagctt tggaactatt agccgaggtt 1260

ccttattgtt ttgcaataga gaaggtgttt gtcattggcg gtggccagat attcaggtag 1320

attttttagt aaaagttgtt gaatttcatt gcatatttgt tggggaaaga taatgttttg 1380

atgttttaca atgcagggaa acactcaatg cttcaggttg cgaagccatt cacattactg 1440

aaattgggac aagcattgaa tgcgatacct tcattccttc aattgactcg tcttgtttcc 1500

agctgtggta ctcttcgaag ccattggaag aaaataatgt ccggttttca tttgcaactt 1560

atgttcgtgt tagatctagg acaactgata attatgaggt aaaagacttg agtttcttgc 1620

ccaggatgat tgttgagaga cgagatgaat gagtcaatta gtaaataata ctgagacttg 1680

ttcatgaaac tatctcaagt gacaagcaag acccttgact ggttagatac agaattcatt 1740

tgcctaggta gtcttaaacc ttggttctct atgactctac tgctctttgc cttacatttt 1800

attgttgttg ctgatgttta aatgtaaata tgagcatcat ccccagtcca cgttgtgatt 1860

ttgtacaatg taagtctatc tttgcagatc ttttcatctt cttatataac taaggtattt 1920

actactagt 1929

<210> 13

<211> 63

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

atgatgaaga cgactatgac tttggtgtgg attatggatt acaaggacga cgatgacaag 60

tga 63

<210> 14

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

ggattacaag attcaaagtg cg 22

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

tgatacctgg cagatggaac 20

<210> 16

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

cctgggacga gtggcctgac a 21

<210> 17

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

agttgcggac aatctggacg ac 22

Claims (2)

1. Use of a plant's dORF for enhancing translation of an upstream coding gene, characterized in that:

the plant is selected from Asian cotton, rice and tomato;

the sequence of dORF is selected from the sequences shown in SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.8 and SEQ ID NO. 11.

2. A method for enhancing the translation efficiency of a target gene, comprising: the method is to insert the dORF of the plant into the 3' UTR region of the target gene;

the plant is selected from Asian cotton, rice and tomato;

the sequence of dORF is selected from the sequences shown in SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.8 and SEQ ID NO. 11.