CN114875023A

CN114875023A - Primer, probe, gene chip and kit for detecting avian adenovirus type 4 and application thereof

Info

Publication number: CN114875023A
Application number: CN202210383359.6A
Authority: CN
Inventors: 盛圆贤; 黄淑坚; 刘兆洁; 梅堃; 许芬芬; 柯骏鸿
Original assignee: Guangdong Huasheng Biotechnology Co ltd; Foshan University
Current assignee: Guangdong Huasheng Biotechnology Co ltd; Foshan University
Priority date: 2022-04-13
Filing date: 2022-04-13
Publication date: 2022-08-09

Abstract

The invention relates to the technical field of molecular biology, in particular to primers, probes, gene chips, a kit and application thereof for detecting avian adenovirus type 4. According to the diversity and regularity of related genes of FAdV-4, the primers and probes for detecting the avian adenovirus type 4 are obtained by combining the principle of a gene chip and the advantages of a TMB visual color development system, the gene chip for visual color development is established, and the aim of visually detecting the avian adenovirus type 4 is fulfilled. The gene chip has good specificity and sensitivity, and the detection sensitivity can reach 2.99 multiplied by 10 ² The copies/mu L has accurate, stable and quick result, and the result can be judged and read only by naked eyesHas great popularization value and wide commercial prospect.

Description

Primer, probe, gene chip and kit for detecting avian adenovirus type 4 and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a primer, a probe, a gene chip, a kit and application thereof for detecting avian adenovirus type 4.

Background

Fowl Adenovirus (Fowls Adenovirus, FAdV) belongs to the family of avian Adenoviridae (Adenovirus), the genus of avian Adenovirus (Aviadenovirus), and the FAdV which is mainly popular in China is FAdV-4, FAdV-8 and FAdV-11, wherein FAdV-4 is the specific pathogen of pericardial effusion-hepatitis syndrome (HHS). HHS caused by FAdV-4 can occur all the year round, but more frequently occurs in summer and autumn, and generally passes through in a recessive way. The disease mainly occurs in broilers of 3-5 weeks old, and poultry such as laying hens, pockmarkets, cherry valley ducks, geese and the like can also be infected by FAdV-4. Furthermore, pigeons, various types of falcon and parrots may also be hosts of FAdV-4. Vertical transmission is the primary mode of transmission of HHS, and extensive transmission of the disease can also result from exposure of the poultry to contaminated machinery, tools and manure. FAdV-4 generally exists in various poultry bodies, can be horizontally transmitted and vertically transmitted, and greatly improves the difficulty of prevention and control. Although there are many inactivated and attenuated vaccines on the market, there is no commercial vaccine that can completely prevent infection by FAdV-4. Therefore, it is important to improve the level of management of breeding and detection of breeders in the time of introduction, since it is not possible to prevent HHS by vaccination alone.

Current diagnostic methods for FAdV-4 include serological and molecular biological methods. An indirect Enzyme-linked immunosorbent assay (ELISA), a virus neutralization assay and an agar diffusion assay are widely applied to serological diagnosis of the avian adenovirus, and although a common serological detection method is simple in operation and low in cost, the detection sensitivity is low, and particularly, false negative easily appears in a detection result under the condition of low virus load; molecular biological diagnosis techniques of the avian adenovirus include PCR, qPCR, LAMP technology, gene microarray technology and the like, wherein the PCR and the qPCR are often used for laboratory detection of the avian adenovirus.

Polymerase Chain Reaction (Polymerase Chain Reaction, PCR): using DNA or cDNA as template, using a pair of oligonucleotide fragments respectively complementary with 5 'end and 3' end of template as primers, under the action of DNA polymerase, extending along the template chain according to the semi-reserved replication mechanism until completing new DNA synthesis, repeating the process, and then amplifying the target DNA fragment in short time to obtain a large amount of target fragments; the common PCR has the advantages of higher sensitivity and specificity, low requirement on sample purity, simple operation and lower cost; but depending on the specific primer design, and the result observation requires additional gel electrophoresis, there is also a greater probability of introducing contamination due to the increased processing steps and time.

Real-time fluorescent Quantitative PCR (Quantitative Real-time PCR, qPCR): the commonly used qPCR method is classified into a dye method (SYBR Green I method) and a probe method (Taqman probe method), both of which add a fluorescent group in the PCR reaction process, reflect the amplification of the product by the increase of a fluorescent signal, read a real-time fluorescent signal by a fluorescent quantitative PCR instrument in the process, and monitor the cycle number (Ct value) at which the fluorescent signal reaches a predetermined threshold. The Ct value is in negative correlation with the concentration of the viral nucleic acid, and the higher the concentration of the viral nucleic acid is, the smaller the Ct value is. Compared with the common PCR, the fluorescent quantitative PCR has more excellent sensitivity and specificity; compared with the Taqman probe method, the dye method has the advantage of low cost, but the probe method has higher sensitivity, so that different schemes are selected as required in actual detection; compared with the common PCR, the fluorescent quantitative PCR has more excellent specificity and sensitivity, does not need gel electrophoresis, has quicker reaction time, and greatly improves the stability and reliability of experimental results. However, this method also has the following limitations: the price of the instrument is higher, the single detection cost is higher than that of the common PCR, and the operator needs to have related experience.

Loop-mediated isothermal amplification (LAMP): the loop-mediated isothermal amplification method is a novel nucleic acid amplification method aiming at target genes4 specific primers are designed in 6 regions, under the action of strand displacement DNA polymerase, amplification is carried out at a constant temperature of 60-65 ℃, and 10 can be realized within 15-60 min ⁹ ～10 ¹⁰ The amplification of the target nucleic acid is performed, and the method has the characteristics of simple operation, strong specificity, easy detection of products and the like; however, in the experimental process of the technology, aerosol pollution caused by uncovering, partial functional partitions of a laboratory are not clear, and the like, so that the result judgment is influenced by false positive problems; moreover, the method has high requirements on primer design, so that the method is not suitable for limiting certain target genes.

DNA Microarray (DNA Microarray): DNA microarrays, also called oligonucleotide arrays, are developed based on the principle of nucleic acid hybridization, in which specific oligonucleotide probes are immobilized on a support in the form of a microarray, a large amount of nucleic acids labeled with fluorescein contained in a test sample can be hybridized with the specific probes under specific conditions, and the number and composition of target nucleic acids in the sample are analyzed by reading the presence or absence and intensity of hybridization signals with an instrument. The technology has the outstanding advantages that a large number of sequences in a detected sample can be detected and analyzed at one time, and the defects of complicated operation, low automation degree, small number of operation sequences, low detection efficiency and the like of the traditional nucleic acid blot hybridization technology are avoided. At present, the mainstream gene microarray solid phase mainly selects a polymer substrate (a nylon membrane, a nitrocellulose membrane, a glass slide and the like), a nucleic acid probe or a cDNA fragment is solidified on the surface of the polymer substrate, and then a target gene marked by an isotope is added to be hybridized with the nucleic acid probe or the cDNA fragment, and the target gene is identified through imaging by a radiation developing technology. This method also has certain limitations: isotope labeling detection requires special instruments for reading, and reading results also depend on professional personnel for processing and analysis.

Disclosure of Invention

The first aspect of the present invention aims to provide primers for detecting avian adenovirus type 4.

The second aspect of the present invention is directed to a probe for detecting avian adenovirus type 4.

The third aspect of the invention aims at providing a primer and probe combination for detecting avian adenovirus type 4.

The fourth aspect of the present invention is to provide a gene chip for detecting avian adenovirus type 4.

The fifth aspect of the present invention is directed to a kit.

The sixth aspect of the present invention is directed to applications of the primer of the first aspect, the probe of the second aspect, the primer-cassette probe set of the third aspect, the gene chip of the fourth aspect, or the kit of the fifth aspect of the present invention.

An object of the seventh aspect of the present invention is to provide a method for detecting avian adenovirus type 4 in a non-diagnostic destination.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

in a first aspect of the invention, primers for detecting avian adenovirus type 4 are provided, the primers comprising FADV-4-F and FADV-4-R; the sequence of the FADV-4-F is shown as SEQ ID NO. 2; the sequence of the FADV-4-R is shown as SEQ ID NO. 3.

Preferably, the 5' end of the FADV-4-R is connected with Biotin.

In a second aspect of the invention, there is provided a probe for detecting avian adenovirus type 4, said probe being at least one of P1, P2 and P3; the sequence of the P1 is shown as SEQ ID NO. 4; the sequence of the P2 is shown as SEQ ID NO. 5; the sequence of the P3 is shown as SEQ ID NO. 6.

Preferably, the probe is at least one of P2 and P3; further P2 or P3; further P3.

In a third aspect of the invention, there is provided a primer and probe combination for detecting avian adenovirus type 4 comprising a primer of the first aspect of the invention and a probe of the second aspect of the invention.

In a fourth aspect of the present invention, there is provided a gene chip for detecting avian adenovirus type 4, comprising the probe of the second aspect of the present invention.

Preferably, the gene chip further comprises: a chip carrier.

Preferably, the gene chip further comprises: a positive indicator probe.

Preferably, the sequence of the positive indicator probe is shown as SEQ ID NO. 7.

Preferably, the preparation method of the gene chip is as follows: the probe and/or the positive indication probe of the second aspect of the present invention is mixed with a spotting buffer to obtain a mixed solution, and then the mixed solution is spotted on a nylon membrane and crosslinked to obtain the probe and/or the positive indication probe.

Preferably, the final concentration of the probe in the mixed solution is 3-8 mu M.

Preferably, the final concentration of the positive indication probe in the mixed solution is 3-8 μ M.

Preferably, the spotting buffer is BST02010

Spotting buffer.

Preferably, the crosslinking condition is that crosslinking is carried out for 25-35 min under an ultraviolet lamp.

In a fifth aspect of the present invention, there is provided a kit comprising: at least one of the primer of the first aspect, the probe of the second aspect, the primer and probe combination of the third aspect, and the gene chip of the fourth aspect of the present invention.

Preferably, the kit comprises: the primer of the first aspect of the present invention and the gene chip of the fourth aspect of the present invention.

Preferably, the kit further comprises: streptavidin-HRP and TMB color development solution.

Preferably, the kit further comprises: hybridization buffer solution, washing solution, confining solution, positive indication sample loading probe and PCR amplification reagent.

Preferably, the hybridization buffer is B548205-0100 hybridization solution III.

Preferably, the wash solution comprises: wash I (1 XSSC buffer containing 0.1% SDS), Wash II (0.2 XSSC buffer containing 0.1% SDS) and Wash III (0.2 XSSC buffer).

Preferably, the sequence of the positive indication loading probe is shown in SEQ ID NO.8, and the 3' end of the positive indication loading probe is connected with Biotin.

Preferably, the PCR amplification reagents comprise: any one or a combination of at least two of Taq DNA polymerase, dNTPs and PCR buffer.

In a sixth aspect of the present invention, there is provided a primer of the first aspect, a probe of the second aspect, a primer and probe combination of the third aspect, a gene chip of the fourth aspect or a kit of the fifth aspect, wherein the primer and probe combination is used for detection of avian adenovirus type 4 of a non-diagnostic destination.

In a seventh aspect, the invention provides a method for detecting avian adenovirus type 4 in a non-diagnostic destination, which is performed by using the kit of the fifth aspect of the invention, and comprises the following steps:

1) extracting DNA in a sample;

2) taking the DNA extracted in the step 1) as a template, and carrying out PCR amplification reaction by using the primer in the kit of the fifth aspect of the invention to obtain a PCR amplification product;

3) placing the PCR amplification product on a gene chip in the kit of the fifth aspect of the invention for hybridization, introducing streptavidin-HRP into the hybridization reaction, and adding TMB color development liquid in the color development process to realize visual detection.

Preferably, the procedure of the PCR amplification reaction in the step 2) is 95 ℃ and 3 min; 95 ℃, 30s, 55 ℃, 30s, 72 ℃, 30s, 35 cycles; 72 ℃ for 5 min.

Preferably, the hybridization condition in the step 3) is 50-60 ℃ for 50-70 min.

The invention has the beneficial effects that:

according to the diversity and regularity of related genes of FAdV-4, the primers and probes for detecting the avian adenovirus type 4 are obtained by combining the principle of a gene chip and the advantages of a TMB visual color development system, the gene chip for visual color development is established, and the aim of visually detecting the avian adenovirus type 4 is fulfilled. The gene chip has good specificity and sensitivity, and the detection sensitivity can reach 2.99 multiplied by 10 ² The copies/mu L has accurate, stable and quick result, and the result can be read only by naked eyes, thereby having huge popularization value and wide commercial prospect.

Drawings

FIG. 1 is a schematic diagram of oligonucleotide visualization gene chip operation.

FIG. 2 is a schematic diagram of the gene chip array in example 2.

FIG. 3 is a graph showing the results of the detection of positive and negative samples by the gene chip in example 3.

FIG. 4 is a graph showing the results of the detection of positive and negative samples by the gene chip using different probes in example 3.

FIG. 5 is a graph showing the results of sensitivity measurement of the gene chip in example 4.

FIG. 6 is a graph showing the results of the specificity test of the gene chip in example 5.

Detailed Description

The present invention will be described in further detail with reference to specific examples.

The materials, reagents and the like used in the present examples are commercially available reagents and materials unless otherwise specified.

Example 1 design of primers and probes for detection of avian adenovirus type 4

(1) Designing a primer:

according to FAdV-4 virus related genes published in a GenBank database, a reference strain G U188428.1 is selected after data analysis. Designing a specific primer for the Hexon gene of FAdV-4 according to the gene conservation analysis, and adding a biotin label at the 5' end of a downstream primer. The sequence of the FAdV-4Hexon gene (GU188428.1) is as follows: ATGGCGGCCCTCACG CCCGACCTGACTACCGCGACTCCGCGGCTCCAGTATTTTCACATCGCGGGCCCCGGGAC GCGCGAATACCTCTCTGAGGACCTCCAACAGTTCATTTCCGCCACCGGAAGCTACTTTG ACTTGAAAAACAAGTTCAGACAGACGGTCGTGGCGCCCACCCGAAATGTCACGACAGA AAAGGCTCAACGGCTGCAAATCCGCTTTTACCCCATCCAAACCGACGACACGTCGACGG GCTACCGCGTGCGGTACAACATCAATGTGGGCGACGGTTGGGTCCTGGACATGGGGTCG ACCTATTTCGACATCAAGGGAATCCTAGACCGAGGGCCGTCCTTCAAGCCCTACTGCGG CACGGCTTACAACCCGCTGGCTCCCAAGGAGTCCATGTTTAACAACTGGTCGGAGACGG CGCCCGGGCAGAACGTGTCCGCCTCCGGTCAGCTGTCCAATGTCTATACCAACACGAGC ACCACCAAAGACACGACGGCGGCGCAGGTGACGAAGATTTCCGGCGTCTTTCCCAACC CCAACCAGGGACCCGGAATAAATCCTCTGCGGCAGGTAGAAAACGCCAACACCGGCGT GCTCGGTCGCTTCGCCAAGTCTCAGTACAATTACGCTTACGGTGCCTACGTCAAGCCCGT CGCCGCCGACGGTTCCCAGTCCCTCACGCAGACCCCCTACTGGATCATGAATAACGCGG GCACCGAATACCTGGGGGCGGTAGCCGTCGAGGACTACACCAACAGCCTCTCGTACCCA GATACCATGATCGTGCCGCCTCCCGAGGATTACGACGATTATAACATAGGCACCACGCGT GCGCTCAGGCCCAACTACATCGGGTTCAGGGATAACTTCATTAACCTGCTGTATCACGAC TCCGGCGTGTGCTCGGGCACCCTCAACTCGGAGCGTTCGGGCATGAACGTGGTGGTCG AGCTGCCCGACCGGAACACCGAGCTCAGCTACCAGTACATGCTGGCCGACATGATGTCC CGCCATCACTATTTCGCCCTGTGGAACCAGGCGGTTGACCAGTACGACCCCGAGGTGCG AGTCTTCTCCAATGACGGTTACGAGGAAGGCGCGCCCAGCTACGCCTTTAACCCCGAAG CGGTAGGCGCGGGAGAAGGCTACGGCCCCGATCTCAGTCAAATTAAACTCTACACCAAC AACACCGCCGCGAACGACAAAAACACCGCCGTGACCAACGCCACTACCAACTTCTACT TCGGCACGGTACCCTCCTACGAAATCGATATCAGCGCTACCCAGAGGCGCAACTTTATCA TGGCCAACATCGCCGAGTATCTGCCCGACCGTTACAAGTTTAGCATCTCCGGCTTCGACG CCACCAGCGTCGCGCCTACCACCTACGAGTACATGAACAAGCGCGTCCCCCTCACCAAC GTCGTCGACATGTTCACGAACGTGGGTGCGCGTTGGTCCATCGACCAGATGGACAACGT CAACCCCTTCAACCACCACAGAAACTGGGGGCTGAAATACCGCTCCCAGCTGCTGGGA AACAGCCGCTACGTCAACTTCCACATCCAAGTGCCCCAAAAATTCTTCGCCATCAAAAA CCTGCTGCTGCTCTCCGGCTCGTACACCTACGAGTGGGTGCTGCGCAAAGACCCCAACA TGATCCTACAATCCAGTCTGGGCAACGACCTGCGCGCCGACGGCGCCAGCATCGTCTAC AACGAGGTGAACCTCATGGCCAACTTCATGCCCATGGATCACAACACCAGTAACCAGCT CGAGCTGATGCTGAGAAACGCCACCAACGATCAGACCTTTGTGGACTACCTGGGAGCC AAAAACGCTCTCTACTCGGTGCCCGCGGGCTCCACCGCCCTCACCATCAACATTCCCGC TCGCACCTGGGAGGGGATGCGCGGGTGGTCCTTCACTCGCATCAAGGCGGCCGAGACG CCTCAGCTGGGCGCCCAGTACGACGTCAACTTCAAGTACTCGGGCAGCATCGCCTACTC AGACGGAGGCTTCTACCTCTCGCACACCTTCCGTAACATGAGCATCCTCTTCGACACGT CCATCAACTGGCCGGGCAACGACCGGTTGCTCACGCCTAACATGTTCGAGATCAAGCGC TCGGTGGCGCTCGACACCGAGGGCTTCACCATGAGCCAGTGCGACATCACCAAGGACT GGTACCTGATCCAGATGGCCACGAACTACAACTTCGTCTATAACGGCTATCGATTCTGGC CCGATCGTCAGTACTTCCACTACGACTTCCTGCGAAATTTCGACCCCATGACGCGCCAG GGACCCAACTTCGCATTGCCCGGCCTCTTCGACCTCGTGTCTTACACCCCTACCACGGA CAACAGCGGACAGCAGGCTAGTCAGGAAGCCGTGCGCAACAATTCTGGGTTTATCGCC CCCCGCTCCTGGCCCGTCTGGAGCGCTCACCAGGGCGAGAGCTGGCCCGCCAACTGGC CGTACCCGCTCTGCGGTCAGCAGGCCATCCAACCCGGACAGGTCCTCAGCTACAAGAA GTTCCTCTGCGACAACTACCTGTGGACCATCCCGTTCAGTTCCGACTTTATGTACATGGG CGAACTGACAGATCTGGGTCAGAACCCCATGTACACGAACAACTCGCACAGCATGGTCA TCAACTTCGAGCTCGATCCCATGGATGATCCCACTTACGTGTACATGCTCTATGGCGTGTT CGACACCGTTAGGGTCAACCAGCCCGAACGTAACGTGCTAGCTATGGCTTACTTCCGTA CGCCTTTCGCCACAGGCAACGCCGTGTAA (SEQ ID NO. 1). The sequences of the specific primers are shown in Table 1.

TABLE 1 specific primer sequences

(2) Designing a probe:

corresponding oligonucleotide probes (P1, P2 and P3) are designed according to amplification products of the specific primers (FADV-4-F, FADV-4-R), and meanwhile, a positive indication probe and a positive indication loading probe are designed, and probe sequences are shown in Table 2.

TABLE 2 oligonucleotide Probe sequences

EXAMPLE 2 preparation of Gene chip for detection of avian adenovirus type 4

The specific probe (P1, P2 and P3) and the positive indicator probe are respectively mixed with the spotting buffer (BST 02010)

Spotting buffer), diluted to a final concentration of 5 μ M, and the chip array designed according to fig. 2 was spotted on a nylon membrane using a microarray chip spotting system, followed by crosslinking under an ultraviolet lamp for 30min, sealed after completion, and stored at 4 ℃.

Example 3 method for detecting avian adenovirus type 4

A kit for detecting avian adenovirus type 4 comprising: the kit comprises a gene chip for detecting avian adenovirus type 4, FADV-4-F, FADV-4-R, TaKaRa Premix Taq, a positive indication sample loading probe, a hybridization buffer solution, a washing solution I (a 1 XSSC buffer solution containing 0.1% SDS), a washing solution II (a 0.2 XSSC buffer solution containing 0.1% SDS), a washing solution III (a 0.2 XSSC buffer solution), a confining liquid (a 5% skimmed milk powder solution), streptavidin-HRP incubation liquid and TMB double-component color development liquid (A liquid + B liquid).

1. Detection of Positive and negative samples

The detection method of the positive sample (standard plasmid, 3095bp, with the sequence shown as SEQ ID NO.9) and the negative sample (deionized water) adopts the kit for detecting the avian adenovirus type 4, the working principle diagram of the kit is shown as figure 1, and the specific steps are as follows:

(1) amplification of a sample to be tested

Extracting a sample to be detected, and carrying out PCR amplification by using nucleic acid of the sample to be detected as a detection template to obtain a PCR amplification product: the reaction system is shown in Table 3, and the reaction program is 95 ℃ for 3 min; 95 ℃, 30s, 55 ℃, 30s, 72 ℃, 30s, 35 cycles; 72 ℃ for 5 min.

TABLE 3 PCR amplification reaction System

(2) Hybridization of PCR products

Placing the PCR amplification product obtained in the step (1) in a PCR instrument to run a program: 10min at 95 ℃ followed by 5min of ice bath immediately; then, the PCR amplification product is spotted on the probe region (2 in FIG. 2, the probe is P3), the positive indication sample loading probe is spotted on the probe region (1 in FIG. 2, the probe is the positive indication probe), the sample spotting buffer is spotted on the probe region (3 in FIG. 2, the probe is P3), and the hybridization buffer (raw B548205-0100 hybridization solution III) is added to the gene chip after the whole gene chip is thoroughly moistened; followed by hybridization in an oven at 55 ℃ for 60min at 20 rpm.

(3) Elution is carried out

After hybridization, the plate was shaken at 100rpm in a horizontal shaking table at room temperature, washed 3 times in each of washing solution I (1 XSSC buffer containing 0.1% SDS), washing solution II (0.2 XSSC buffer containing 0.1% SDS) and washing solution III (0.2 XSSC buffer) in this order for 3min each time, the amount of the washing solution was such that the plate covered the plate, the washing solution was aspirated after each washing, and the plate was air-dried after the last washing.

(4) Sealing of

Adding membrane blocking solution (5% skimmed milk powder solution) into gene chip, and sealing with decolorizing shaker at 70rpm for 30 min. And after the reaction is finished, the sealing liquid is discarded.

(5) Enzyme linked

streptavidin-HRP (0.2M PBS buffer diluted 1:2000 fold) was added in the dark, incubated at 37 ℃ for 30min and discarded, followed by repetition of step (3).

(6) Color development

Mixing liquid A and liquid B of TMB bi-component color developing liquid: (

TMB two-component color development kit) are mixed into working solution in equal volume, and a preset locus of a gene chip is added, so that the working solution covers the substrate for 5-10 min and a detection result can be observed.

(7) And (5) judging a result:

as shown in fig. 3:

firstly, when a dark blue spot appears at a site 1, the gene chip works normally;

when 2 or more sites in the 3 sites 2 have dark blue spots, the FAdV-4 nucleic acid exists in the sample to be detected;

thirdly, when only 1 site 2 has a darker blue spot, the suspected FAdV-4 nucleic acid of the sample to be detected exists, and the sample needs to be detected again;

and fourthly, when the detection site does not develop color, the FAdV-4 nucleic acid does not exist in the sample to be detected or the nucleic acid quantity is lower than the lowest detection value of the gene chip.

2. Comparison of the Effect of different probes

The experimental method is the same as the steps of the detection method of the positive sample and the negative sample in 1, and only differs from the method in that the method comprises two groups of gene chips: wherein, the chip for FADV-4 positive detection comprises: the chip for FADV-4 negative detection comprises a positive control site (FADV-4 positive column 1 in FIG. 4) and FADV-4 detection sites (P1, P2, and P3,

columns

2, 3, and 4, respectively): a positive control site (negative column 1 of FADV-4 in FIG. 4) and a FADV-4 detection site (P1, P2, P3,

columns

2, 3, and 4, respectively).

The results are shown in FIG. 4: probe P3 was the darkest in color and probe P1 was the lightest in color, i.e., probe P3 performed the best.

Example 4 evaluation of sensitivity of Gene chip for detection of avian adenovirus type 4

The detection method of this example is the same as the steps of the detection of the positive sample and the negative sample in example 31, except that: in this example, the sample is a standard (3095bp, SEQ ID NO.9), the negative control is hybridization buffer, and the specific probe is P3. The results are shown in FIG. 5: the lowest detection limit of the gene chip for detecting the avian adenovirus type 4 can reach 2.99 multiplied by 10 ² copies/. mu.L, with good sensitivity.

Example 5 evaluation of specificity of Gene chip for detection of avian adenovirus type 4

The detection method of this example is the same as the steps of the detection of the positive sample and the negative sample in example 31, except that: in the present example, the sample is DTMUV (KY810819.1), nGoAstV (MN399857.1), GoAstV (MT 323163.1), IAV (LT598516.1), nGPV (KT935531.2), MDPV (AY510603), GRV (J X145335.1), NDRV (MT829224.1), NDV (KC542914.1), FAdV-4(3095bp, sequence such as SE Q ID NO.9), negative control (hybridization buffer), and the specific probe is P3. The results are shown in FIG. 6: when only the sample is F AdV-4, the gene chip develops color; and (3) simultaneously, performing gel electrophoresis on the PCR product obtained in the step (2), and showing that the gene chip for detecting the avian adenovirus type 4 provided by the invention has better specificity.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such modifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> China Huacheng Biotechnology Limited, Guangdong province

Foshan University of Science and Technology

<130>

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 2814

<212> DNA

<213> FAdV-4

<400> 1

atggcggccc tcacgcccga cctgactacc gcgactccgc ggctccagta ttttcacatc 60

gcgggccccg ggacgcgcga atacctctct gaggacctcc aacagttcat ttccgccacc 120

ggaagctact ttgacttgaa aaacaagttc agacagacgg tcgtggcgcc cacccgaaat 180

gtcacgacag aaaaggctca acggctgcaa atccgctttt accccatcca aaccgacgac 240

acgtcgacgg gctaccgcgt gcggtacaac atcaatgtgg gcgacggttg ggtcctggac 300

atggggtcga cctatttcga catcaaggga atcctagacc gagggccgtc cttcaagccc 360

tactgcggca cggcttacaa cccgctggct cccaaggagt ccatgtttaa caactggtcg 420

gagacggcgc ccgggcagaa cgtgtccgcc tccggtcagc tgtccaatgt ctataccaac 480

acgagcacca ccaaagacac gacggcggcg caggtgacga agatttccgg cgtctttccc 540

aaccccaacc agggacccgg aataaatcct ctgcggcagg tagaaaacgc caacaccggc 600

gtgctcggtc gcttcgccaa gtctcagtac aattacgctt acggtgccta cgtcaagccc 660

gtcgccgccg acggttccca gtccctcacg cagaccccct actggatcat gaataacgcg 720

ggcaccgaat acctgggggc ggtagccgtc gaggactaca ccaacagcct ctcgtaccca 780

gataccatga tcgtgccgcc tcccgaggat tacgacgatt ataacatagg caccacgcgt 840

gcgctcaggc ccaactacat cgggttcagg gataacttca ttaacctgct gtatcacgac 900

tccggcgtgt gctcgggcac cctcaactcg gagcgttcgg gcatgaacgt ggtggtcgag 960

ctgcccgacc ggaacaccga gctcagctac cagtacatgc tggccgacat gatgtcccgc 1020

catcactatt tcgccctgtg gaaccaggcg gttgaccagt acgaccccga ggtgcgagtc 1080

ttctccaatg acggttacga ggaaggcgcg cccagctacg cctttaaccc cgaagcggta 1140

ggcgcgggag aaggctacgg ccccgatctc agtcaaatta aactctacac caacaacacc 1200

gccgcgaacg acaaaaacac cgccgtgacc aacgccacta ccaacttcta cttcggcacg 1260

gtaccctcct acgaaatcga tatcagcgct acccagaggc gcaactttat catggccaac 1320

atcgccgagt atctgcccga ccgttacaag tttagcatct ccggcttcga cgccaccagc 1380

gtcgcgccta ccacctacga gtacatgaac aagcgcgtcc ccctcaccaa cgtcgtcgac 1440

atgttcacga acgtgggtgc gcgttggtcc atcgaccaga tggacaacgt caaccccttc 1500

aaccaccaca gaaactgggg gctgaaatac cgctcccagc tgctgggaaa cagccgctac 1560

gtcaacttcc acatccaagt gccccaaaaa ttcttcgcca tcaaaaacct gctgctgctc 1620

tccggctcgt acacctacga gtgggtgctg cgcaaagacc ccaacatgat cctacaatcc 1680

agtctgggca acgacctgcg cgccgacggc gccagcatcg tctacaacga ggtgaacctc 1740

atggccaact tcatgcccat ggatcacaac accagtaacc agctcgagct gatgctgaga 1800

aacgccacca acgatcagac ctttgtggac tacctgggag ccaaaaacgc tctctactcg 1860

gtgcccgcgg gctccaccgc cctcaccatc aacattcccg ctcgcacctg ggaggggatg 1920

cgcgggtggt ccttcactcg catcaaggcg gccgagacgc ctcagctggg cgcccagtac 1980

gacgtcaact tcaagtactc gggcagcatc gcctactcag acggaggctt ctacctctcg 2040

cacaccttcc gtaacatgag catcctcttc gacacgtcca tcaactggcc gggcaacgac 2100

cggttgctca cgcctaacat gttcgagatc aagcgctcgg tggcgctcga caccgagggc 2160

ttcaccatga gccagtgcga catcaccaag gactggtacc tgatccagat ggccacgaac 2220

tacaacttcg tctataacgg ctatcgattc tggcccgatc gtcagtactt ccactacgac 2280

ttcctgcgaa atttcgaccc catgacgcgc cagggaccca acttcgcatt gcccggcctc 2340

ttcgacctcg tgtcttacac ccctaccacg gacaacagcg gacagcaggc tagtcaggaa 2400

gccgtgcgca acaattctgg gtttatcgcc ccccgctcct ggcccgtctg gagcgctcac 2460

cagggcgaga gctggcccgc caactggccg tacccgctct gcggtcagca ggccatccaa 2520

cccggacagg tcctcagcta caagaagttc ctctgcgaca actacctgtg gaccatcccg 2580

ttcagttccg actttatgta catgggcgaa ctgacagatc tgggtcagaa ccccatgtac 2640

acgaacaact cgcacagcat ggtcatcaac ttcgagctcg atcccatgga tgatcccact 2700

tacgtgtaca tgctctatgg cgtgttcgac accgttaggg tcaaccagcc cgaacgtaac 2760

gtgctagcta tggcttactt ccgtacgcct ttcgccacag gcaacgccgt gtaa 2814

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (1，4，13，16，22)

<223> s = g or c; y = t or c; r = g or a

<400> 2

stcygaggac ctycarcagt tya 23

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence

<400> 3

ggtgctcgtg ttggtataga catt 24

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence

<400> 4

ggagacggcg cccgggcaga acgtgtccgc 30

<210> 5

<211> 40

<212> DNA

<213> Artificial sequence

<400> 5

tcggagacgg cgcccgggca gaacgtgtcc gcctccggtc 40

<210> 6

<211> 60

<212> DNA

<213> Artificial sequence

<400> 6

ccatgtttaa caactggtcg gagacggcgc ccgggcagaa cgtgtccgcc tccggtcagc 60

<210> 7

<211> 40

<212> DNA

<213> Artificial sequence

<400> 7

ctgacgagtg gcggacgggt gagtattttt tttttttttt 40

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence

<400> 8

tactcacccg tccgccactc gtcag 25

<210> 9

<211> 3095

<212> DNA

<213> Artificial sequence

<400> 9

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gcttgcatgc ctgcaggtcg 420

acgatctctg aggaccttca acagttcatt tccgccaccg gaagctactt tgacttgaaa 480

aacaagttca gacagacggt cgtggcgccc acccgaaatg tcacgacaga aaaggctcaa 540

cggctgcaaa tccgctttta ccccatccaa accgacgaca cgtcgacggg ctaccgcgtg 600

cggtacaaca tcaatgtggg cgacggttgg gtcctggaca tggggtcgac ctatttcgac 660

atcaagggaa tcctagaccg agggccgtcc ttcaagccct actgcggcac ggcttacaac 720

ccgctggctc ccaaggagtc catgtttaac aactggtcgg agacggcacc cgggcagaac 780

gtgtccgcct ccggtcagct gtccaatgtc tataccaaca cgagcaccat ctctagagga 840

tccccgggta ccgagctcga attcgtaatc atggtcatag ctgtttcctg tgtgaaattg 900

ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg 960

tgcctaatga gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc 1020

gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt 1080

gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct 1140

gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga 1200

taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc 1260

cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg 1320

ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg 1380

aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt 1440

tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt 1500

gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg 1560

cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact 1620

ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt 1680

cttgaagtgg tggcctaact acggctacac tagaagaaca gtatttggta tctgcgctct 1740

gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac 1800

cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc 1860

tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg 1920

ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta 1980

aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca 2040

atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc 2100

ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc 2160

tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc 2220

agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat 2280

taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt 2340

tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc 2400

cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag 2460

ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt 2520

tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac 2580

tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg 2640

cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat 2700

tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc 2760

gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc 2820

tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa 2880

atgttgaata ctcatactct tcctttttca atattattga agcatttatc agggttattg 2940

tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg 3000

cacatttccc cgaaaagtgc cacctgacgt ctaagaaacc attattatca tgacattaac 3060

ctataaaaat aggcgtatca cgaggccctt tcgtc 3095

Claims

1. Primers comprising FADV-4-F and FADV-4-R; the sequence of the FADV-4-F is shown as SEQ ID NO. 2; the sequence of the FADV-4-R is shown as SEQ ID NO. 3.

2. A probe that is at least one of P1, P2, and P3; the sequence of the P1 is shown as SEQ ID NO. 4; the sequence of the P2 is shown as SEQ ID NO. 5; the sequence of the P3 is shown in SEQ ID NO. 6.

3. A primer and probe combination comprising the primer of claim 1 and the probe of claim 2.

4. A gene chip comprising the probe according to claim 2.

5. The gene chip according to claim 4, wherein:

preferably, the gene chip further comprises: a chip carrier;

preferably, the gene chip further comprises: a positive indicator probe;

6. A kit, comprising: at least one of the primer set forth in claim 1, the probe set forth in claim 2, the primer and probe set forth in claim 3, and the gene chip set forth in any one of claims 4 to 5.

7. The kit of claim 6, wherein:

the kit comprises: the primer according to claim 1 and the gene chip according to claim 4.

8. The kit of claim 7, wherein:

the kit further comprises: streptavidin-HRP and TMB color development solution.

9. Use of the primer of claim 1, the probe of claim 2, the primer and probe combination of claim 3, the gene chip of any one of claims 4 to 5, or the kit of any one of claims 6 to 8 for the detection of avian adenovirus type 4 in a non-diagnostic destination.

10. A method for non-diagnostic detection of avian adenovirus type 4 comprising detection using a kit according to any one of claims 7 to 8;

preferably, the method comprises the steps of:

1) extracting DNA in a sample;

2) carrying out PCR amplification reaction by using the DNA extracted in the step 1) as a template and using the primer in the kit of any one of claims 7-8 to obtain a PCR amplification product;

3) placing the PCR amplification product on a gene chip in the kit of any one of claims 7-8 for hybridization, introducing streptavidin-HRP into the hybridization reaction, and adding TMB color development liquid during the color development process to realize visual detection.