CN114868647A - Breeding method of fresh-eating and storage-resistant II type red-pulp apples - Google Patents
Breeding method of fresh-eating and storage-resistant II type red-pulp apples Download PDFInfo
- Publication number
- CN114868647A CN114868647A CN202210656771.0A CN202210656771A CN114868647A CN 114868647 A CN114868647 A CN 114868647A CN 202210656771 A CN202210656771 A CN 202210656771A CN 114868647 A CN114868647 A CN 114868647A
- Authority
- CN
- China
- Prior art keywords
- parent
- pulp
- red
- genotype
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 235000021016 apples Nutrition 0.000 title claims abstract description 40
- 238000009395 breeding Methods 0.000 title claims abstract description 11
- 238000003860 storage Methods 0.000 title claims description 30
- 244000141359 Malus pumila Species 0.000 title 1
- 241000220225 Malus Species 0.000 claims abstract description 62
- 235000013399 edible fruits Nutrition 0.000 claims abstract description 33
- 238000012216 screening Methods 0.000 claims abstract description 11
- 238000009331 sowing Methods 0.000 claims abstract description 7
- 230000010154 cross-pollination Effects 0.000 claims abstract description 4
- 108090000623 proteins and genes Proteins 0.000 claims description 42
- 238000011144 upstream manufacturing Methods 0.000 claims description 24
- 101150018508 S3 gene Proteins 0.000 claims description 17
- 238000000034 method Methods 0.000 claims description 13
- 239000002253 acid Substances 0.000 claims description 11
- 230000001737 promoting effect Effects 0.000 claims description 9
- 239000007787 solid Substances 0.000 claims description 9
- 229930002877 anthocyanin Natural products 0.000 claims description 8
- 235000010208 anthocyanin Nutrition 0.000 claims description 8
- 239000004410 anthocyanin Substances 0.000 claims description 8
- 150000004636 anthocyanins Chemical class 0.000 claims description 8
- 230000010152 pollination Effects 0.000 claims description 8
- 230000035784 germination Effects 0.000 claims description 7
- 238000003752 polymerase chain reaction Methods 0.000 claims description 7
- 235000020989 red meat Nutrition 0.000 claims description 6
- 239000004576 sand Substances 0.000 claims description 6
- 239000002689 soil Substances 0.000 claims description 6
- 238000012408 PCR amplification Methods 0.000 claims description 5
- 210000000349 chromosome Anatomy 0.000 claims description 5
- 230000007774 longterm Effects 0.000 claims description 4
- 241000332371 Abutilon x hybridum Species 0.000 claims description 3
- 241000422846 Sequoiadendron giganteum Species 0.000 claims description 3
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 3
- 230000007480 spreading Effects 0.000 claims description 3
- 239000011248 coating agent Substances 0.000 claims description 2
- 238000000576 coating method Methods 0.000 claims description 2
- 235000019640 taste Nutrition 0.000 abstract description 2
- 230000002068 genetic effect Effects 0.000 description 5
- 239000003550 marker Substances 0.000 description 4
- 239000003147 molecular marker Substances 0.000 description 4
- 230000008569 process Effects 0.000 description 4
- 230000001488 breeding effect Effects 0.000 description 3
- 230000000644 propagated effect Effects 0.000 description 3
- 101150010882 S gene Proteins 0.000 description 2
- 235000019606 astringent taste Nutrition 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 238000001514 detection method Methods 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 239000000796 flavoring agent Substances 0.000 description 2
- 235000019634 flavors Nutrition 0.000 description 2
- 235000013372 meat Nutrition 0.000 description 2
- 239000013641 positive control Substances 0.000 description 2
- 230000005849 recognition of pollen Effects 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- VGGSQFUCUMXWEO-UHFFFAOYSA-N Ethene Chemical compound C=C VGGSQFUCUMXWEO-UHFFFAOYSA-N 0.000 description 1
- 239000005977 Ethylene Substances 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 230000024321 chromosome segregation Effects 0.000 description 1
- 235000009508 confectionery Nutrition 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 150000008442 polyphenolic compounds Chemical class 0.000 description 1
- 235000013824 polyphenols Nutrition 0.000 description 1
- 230000006798 recombination Effects 0.000 description 1
- 238000005215 recombination Methods 0.000 description 1
- 238000005057 refrigeration Methods 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 150000003648 triterpenes Chemical class 0.000 description 1
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
- A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/74—Rosaceae, e.g. strawberry, apple, almonds, pear, rose, blackberries or raspberries
- A01H6/7418—Malus domestica, i.e. apples
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Environmental Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Mycology (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Physiology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of red-pulp apple cultivation, and provides a breeding method of a fresh-eating and storage-tolerant type II red-pulp apple, which comprises the following steps: step S1, parent selection; step S2, cross pollination; s3, picking fruits and taking seeds; step S4, sowing and raising seedlings; s5, screening qualified seedlings by SSR molecular markers; step S6, high connection; step S7, screening a superior line; and step S8, expanding propagation. By the technical scheme, the problems that the taste of the red-pulp apples is poor and the phenotype of the II-type red-pulp apples is difficult to identify in the young period in the related technology are solved.
Description
Technical Field
The invention relates to the technical field of red-pulp apple cultivation, in particular to a breeding method of a type II red-pulp apple suitable for fresh eating and storage.
Background
The red-pulp apples are more and more concerned by people because of bright color and rich functional components such as anthocyanin, polyphenol substances, triterpenes, Ca and the like, and are divided into two types, namely type I red-pulp apples and type II red-pulp apples. The I type red-pulp apple is red in tender branches, tender leaves, flowers, fruit peels and pulp, high in anthocyanin content, small in fruit size, high in acid content and poor in meat flavor, and after refrigeration treatment, the inner pulp is easy to brown and is accompanied with astringent taste, so that the red-pulp apple is not suitable for fresh eating. The II type red pulp apple has larger fruit, low acid content, better meat quality and flavor, difficult browning of the pulp and no astringent taste.
Research shows that all apples contain an S gene for regulating plant self-incompatibility, the S gene is positioned on chromosome 17, and the S genotype of a diploid apple is expressed by two S genes with different characters n The genetic constitution, for example, may be that the S genotype of apple is composed of S1S2, and may be that of apple is composed of S1S 3.
Type II red pulp apples contain a unique MdMYB110a gene, and the MdMYB110a gene is also located on chromosome 17 and linked with the S3 gene in type II red pulp apples 'ping pearl'. Some common type II red-fleshed apples are usually progeny of 'ping pearl' and therefore, for some common type II red-fleshed apples, they usually contain the S3 gene. The type II red-pulp apples and the offspring thereof have no color difference with common apples in childhood, so that fruit growers cannot judge in time, and some key cultivation time nodes of the type II red-pulp apples can be missed.
In addition, the apple also contains MdACS1 gene, MdACS1 gene regulates the synthesis of ethylene after fruit harvest and in the storage process, MdACS1 has two alleles, namely MdACS1-1 and MdACS1-2, wherein the homozygous MdACS1-2 is most resistant to storage, the heterozygous MdACS1-2 is more resistant to storage, and the homozygous MdACS1-1 is not resistant to storage. Therefore, in the breeding of a new apple variety, offspring containing the homozygous MdACS1-2 or heterozygous MdACS1-2 gene is usually selected, and a large number of offspring are propagated.
Despite the many advantages of red-fleshed apples, people prefer to select normal apples over normal apples because of their poor mouthfeel, and thus, there is a need for an improved type II red-fleshed apples to obtain a sweet and sour palatable red-fleshed apple.
Disclosure of Invention
The invention provides a breeding method of a type II red-pulp apple suitable for fresh eating and long-term storage, which solves the problems that the red-pulp apple in the related art has poor taste and the phenotype of the type II red-pulp apple is difficult to identify in the childhood.
The technical scheme of the invention is as follows: a breeding method of a fresh-eating and storage-resistant type II red-pulp apple comprises the following steps:
step S1, parent selection: selecting II type red-pulp apples as a parent I, and selecting common apples as a parent II; the storage-resistant gene of the first parent is homozygotic MdACS1-2, the titratable acid content of the second parent is between 0.2 and 0.5 percent, the soluble solid content is between 14 and 18 percent, and the S genotype of the first parent and the S genotype of the second parent cannot be completely same;
step S2, cross pollination: collecting small bell flowers or flowers which bloom initially, stripping off anthers, uniformly spreading the anthers on paper, baking for 12 hours under the light of 20-30 ℃, selecting undamaged flowers in the large bud period for pollination after pollen is completely scattered, dibbling central flowers, removing the rest flowers, bagging the flowers which finish pollination and listing;
step S3, picking fruits and taking seeds: after the hybrid fruits are ripe, picking the fruits, taking out the seeds, airing and storing; carrying out sand storage treatment on the seeds in winter;
step S4, sowing and seedling raising: accelerating germination of the seeds subjected to sand storage treatment, sowing the white buds downwards after the white buds are just exposed, applying soil and watering;
step S5, screening qualified seedlings by SSR molecular markers: taking genome DNA of red meat varieties known as type II and non-type II as templates, screening out a first upstream primer and a first downstream primer which are positioned in the same chromosome as MdMYB110a by adopting a PCR (polymerase chain reaction) technology, taking a known MdACS1 primer as a second upstream primer and a second downstream primer, and respectively calculating first target lengths of the first upstream primer and the first downstream primer and second target lengths of the second upstream primer and the second downstream primer; after 7-8 leaves grow out from the hybrid seedling, extracting DNA of fresh tender leaves, performing PCR amplification by using an anchor primer, performing agarose gel electrophoresis, and determining whether the seedling is qualified or not according to the length of a finally obtained target strip;
step S6, high connection: promoting growth of the qualified seedlings screened in the step S5, selecting high-position plump buds with more than 120 node positions to be grafted on big trees with the length of more than 6 years, and after the high-position plump buds are grafted and survive, bud carving, branch pulling, flower promoting and fruit promoting are carried out;
step S7, screening a superior line: after the fruit is ripe, observing the color of the fruit pulp and the storage stability of the fruit, and determining the content of soluble solid matters, titratable acid and fruit pulp anthocyanin; wherein, the pulp is red, the pulp anthocyanin content is more than or equal to 2mg/100gFW, the titratable acid content is between 0.5 and 0.6 percent, the soluble solid content is more than or equal to 15 percent, and the fruit storage tolerance base is homozygotic MdACS1-2 or heterozygotic MdACS 1-2;
step S8, propagation: and when the parameters in the step S7 meet the requirements, repeating the steps S6 to S7 for propagation, and obtaining a large number of red-pulp apple seedlings which are suitable for fresh eating and long-term storage.
As a further technical solution, in the step 1, when the S genotype of the first parent is completely different from the S genotype of the second parent, the first parent may be used as a male parent and a female parent.
As a further technical scheme, in the step 1, the non-S3 gene in the S genotype of the first parent is the same as that of the S genotype of the second parent, and the first parent serves as a male parent.
As a further technical solution, in the step 1, when the non-S3 gene in the S genotype of the first parent is the same as the S genotype of the second parent, the first parent is used as the female parent.
As a further technical scheme, in the step 1, when the S genotypes of the first parent and the second parent both contain the S3 gene, the first parent is used as a female parent.
As a further technical scheme, the gene sequence of the first upstream primer is ACCCGGAGTCATCCCTGTCTTA, the gene sequence of the first downstream primer is CAAACTGGGCTTTCCGTTAGGT, and the first target length is 393 bp.
As a further technical scheme, the gene sequence of the second upstream primer is AGAGAGATGCCATTTTTGTTCGTAC, the gene sequence of the second downstream primer is CCTACAAACTTGCGTGGGGATTATAAGTGT, and the second target length is 655 bp.
As a further technical scheme, in the step S4, the temperature required for accelerating germination is 20-25 ℃, and the required time is 12-24 h.
As a further technical scheme, in the step S4, the thickness of the coating soil is 1-2 cm.
The beneficial effects of the invention are as follows:
1. through parent selection, pollination, seed selection and seedling culture, a large number of hybrid seedlings can be obtained, the seedlings are determined to contain MdMYB110a gene and MdACS1-2 gene in childhood by means of SSR molecular marker technology, the seedlings are propagated, the cost investment of manpower and test land is reduced, and the breeding process of the type II red-pulp apples which is suitable for fresh eating and is long in storage is accelerated;
2. common apples and red-pulp apples are selected as male parents and female parents in different modes, the combination of the male parents and the female parents which can not be hybridized and pollinated at all is eliminated according to the genotype, the probability of target seedlings obtained in the combination mode of the different male parents and the different female parents is analyzed, and the yield of type II red-pulp apples is improved;
3. a proper first upstream primer and a proper first downstream primer are designed aiming at the MdMYB110a gene, hybrid seedlings are screened by using an SSR molecular marker technology, a first target band formed by the first upstream primer and the first downstream primer has a small genetic distance with the MdMYB110a gene, linkage stability is kept more easily, the detection accuracy is improved, and the number of qualified seedlings is further increased.
Drawings
The present invention will be described in further detail with reference to the accompanying drawings and specific embodiments.
FIG. 1 is a process flow diagram of a method provided by the present invention;
FIG. 2 is an electrophoresis chart of PCR amplification results of a first upstream primer and a first downstream primer provided by the present invention;
FIG. 3 is an electrophoresis chart of the PCR amplification result of the second forward primer and the second backward primer provided by the invention;
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any inventive step, are intended to be within the scope of the present invention.
As shown in fig. 1, this example proposes a breeding method of fresh-eating and shelf-stable type ii red-pulp apples, comprising the following steps:
step S1, parent selection: selecting II type red-pulp apples as a parent I, and selecting common apples as a parent II; the storage-resistant gene of the first parent is homozygotic MdACS1-2, the titratable acid content of the second parent is between 0.2 and 0.5 percent, the soluble solid content is between 14 and 18 percent, and the S genotype of the first parent and the S genotype of the second parent cannot be completely same;
step S2, cross pollination: collecting small bell flowers or flowers which bloom initially, stripping off anthers, uniformly spreading the anthers on paper, baking for 12 hours under the light of 20-30 ℃, selecting undamaged flowers in the large bud period for pollination after pollen is completely scattered, dibbling central flowers, removing the rest flowers, bagging the flowers which finish pollination and listing;
step S3, picking fruits and taking seeds: after the hybrid fruits are ripe, picking the fruits, taking out the seeds, airing and storing; carrying out sand storage treatment on the seeds in winter;
step S4, sowing and seedling raising: accelerating germination of the seeds after sand storage treatment, sowing the white buds downwards after the buds are just exposed, applying soil and watering;
step S5, screening qualified seedlings by SSR molecular markers: using genome DNA of known type II red meat and non-type II red meat varieties as templates, screening out a first upstream primer and a first downstream primer which are positioned on the same chromosome as MdMYB110a by adopting a PCR (polymerase chain reaction) technology, referring to a known MdACS1 primer as a second upstream primer and a second downstream primer, and respectively calculating first target lengths of the first upstream primer and the first downstream primer and second target lengths of the second upstream primer and the second downstream primer; after 7-8 leaves grow out from the hybrid seedling, extracting DNA of fresh tender leaves, performing PCR amplification by using an anchor primer, performing agarose gel electrophoresis, and determining whether the seedling is qualified or not according to the length of a finally obtained target strip;
step S6, high connection: promoting growth of the qualified seedlings screened in the step S5, selecting high-position plump buds with more than 120 node positions to be grafted on big trees with the length of more than 6 years, and after the high-position plump buds are grafted and survive, bud carving, branch pulling, flower promoting and fruit promoting are carried out;
step S7, screening a superior line: after the fruit is ripe, observing the color of the fruit pulp and the storage stability of the fruit, and determining the content of soluble solid, titratable acid and the anthocyanin in the fruit pulp; wherein, the pulp is red, the pulp anthocyanin content is more than or equal to 2mg/100gFW, the titratable acid content is between 0.5 and 0.6 percent, the soluble solid content is more than or equal to 15 percent, and the fruit storage tolerance base is homozygotic MdACS1-2 or heterozygotic MdACS 1-2;
step S8, propagation: and (5) when the parameters in the step S7 meet the requirements, repeating the steps S6 to S7 for propagation, and obtaining a large number of red-pulp apple seedlings which are suitable for fresh eating and long-term storage.
The invention has the beneficial effects that:
1. through parent selection, pollination, seed selection and seedling culture, a large number of hybrid seedlings can be obtained, the seedlings are determined to contain MdMYB110a gene and MdACS1-2 gene in childhood by means of SSR molecular marker technology, the seedlings are propagated, the cost investment of manpower and test land is reduced, and the breeding process of the type II red-pulp apples which is suitable for fresh eating and is long in storage is accelerated;
2. common apples and red-pulp apples are selected as male parents and female parents in different modes, the combination of the male parents and the female parents which can not be hybridized and pollinated at all is eliminated according to the genotype, the probability of target seedlings obtained in the combination mode of the different male parents and the different female parents is analyzed, and the yield of type II red-pulp apples is improved;
3. a proper first upstream primer and a proper first downstream primer are designed aiming at the MdMYB110a gene, hybrid seedlings are screened by using an SSR molecular marker technology, a first target band formed by the first upstream primer and the first downstream primer has a small genetic distance with the MdMYB110a gene, linkage stability is kept more easily, the detection accuracy is improved, and the number of qualified seedlings is further increased.
The parent, namely the selected type II red-pulp apple variety in the invention is as follows: irodori, Nakanokirameki, Moon Rouge, Enbu, Nakanoshinku. The five varieties of type II red-fleshed apples are all from Japan.
In FIG. 2, the left most column is the DNA molecular weight standard Marker, the right most column is the positive control known as type II red meat, and the middle is the seedling to be detected. And (3) distinguishing whether the seedling to be detected contains a target strip or not and whether the seedling to be detected is a II-type red-pulp apple or not by referring to a Marker 400bp standard strip and a positive control 393bp target strip.
In FIG. 3, the leftmost column is DNA molecular weight standard Marker, and then the seedling to be detected is. The target band of MdACS1-2 is 655bp, the target band of MdACS1-1 is 489bp, and the reference Marker 500bp and 750bp standard bands distinguish whether the seedlings to be detected are homozygous MdACS1-2 or heterozygous MdACS 1-2.
Further, in the step 1, when the S genotype of the first parent is completely different from the S genotype of the second parent, the first parent may be used as both the male parent and the female parent.
In this embodiment, since the S genotypes of the first and second parents are completely different, the S genotype of the first parent may be selected as S1S3, and the S genotype of the second parent may be selected as S2S4, and 50% of the offspring will be the target seedlings regardless of whether the first parent is the male parent or the female parent.
Further, in the step 1, the non-S3 gene in the S genotype of the first parent is the same as the S genotype of the second parent, and the first parent serves as a male parent.
In this embodiment, since the non-S3 gene in the S genotype of the first parent is the same as the S genotype of the second parent, the S genotype of the first parent can be selected as S1S3, and the S genotype of the second parent can be selected as S1S2, and when the first parent is used as the male parent, 50% of the offspring will be the target seedling.
Further, in the step 1, when the non-S3 gene in the S genotype of the first parent is the same as the S genotype of the second parent, the first parent is used as the female parent.
In this embodiment, since the non-S3 gene in the S genotype of the first parent is the same as the S genotype of the second parent, the S genotype of the first parent can be selected as S1S3, and the S genotype of the second parent can be selected as S1S2, and when the first parent is used as the female parent, 25% of the offspring will be the target seedling.
Further, in the step 1, when the S genotypes of the first parent and the second parent both contain the S3 gene, the first parent is used as the female parent.
In this embodiment, since the S genotypes of the first and second parents both contain the S3 gene, and the genotypes of the first and second parents are not completely the same, the S genotype of the first parent can be selected as S1S3, and the S genotype of the second parent can be selected as S2S3, and when the first parent is used as the female parent, 25% of the offspring are the target seedlings.
According to the Mendel' S genetic law and the law of self-incompatibility of S genes, when the S genotypes of the first parent and the second parent are completely the same, the target seedling does not appear in the offspring. And on the premise that the S genotypes of the first parent and the second parent both contain the S3 gene, when the first parent is selected as a male parent, target seedlings do not appear in offspring. Although the MdMYB110a gene is linked to the S3 gene, since MdMYB110a gene is a gene specific to red-fleshed apples, even though ordinary apples contain the S3 gene, it does not contain the MdMYB110a gene, so that in the aforementioned case, when parent one is used as the male parent, red-fleshed apples are not produced in the offspring.
Further, the gene sequence of the first upstream primer is ACCCGGAGTCATCCCTGTCTTA, the gene sequence of the first downstream primer is CAAACTGGGCTTTCCGTTAGGT, and the first target length is 393 bp.
In this example, the gene sequence of the first upstream primer is ACCCGGAGTCATCCCTGTCTTA and the gene sequence of the first downstream primer is CAAACTGGGCTTTCCGTTAGGT for the MdMYB110a gene of red-fleshed apples, so that the first target length is 393bp, the genetic distance between the first target band and the MdMYB110a gene is small, the recombination rate is low during stable linkage and chromosome segregation, and the recognition rate of the MdMYB110a gene can be improved during SSR molecular marking.
Further, the gene sequence of the second upstream primer is AGAGAGATGCCATTTTTGTTCGTAC, the gene sequence of the second downstream primer is CCTACAAACTTGCGTGGGGATTATAAGTGT, and the second target length is 655 bp.
In the embodiment, the gene sequence of the second upstream primer is AGAGAGATGCCATTTTTGTTCGTAC, the gene sequence of the second downstream primer is CCTACAAACTTGCGTGGGGATTATAAGTGT and the second target length is 655bp for the MdACS1 gene, and the sequences of the pair of primers are all existing, so that the cultivation cost of the II type red-pulp apples can be reduced on the premise of ensuring accurate identification of the PCR technology.
Further, in the step S4, the temperature required for germination is 20-25 ℃, and the required time is 12-24 h.
Further, in the step S4, the thickness of the covering soil is 1-2 cm.
The present invention is not limited to the above preferred embodiments, and any modifications, equivalent substitutions, improvements, etc. within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (9)
1. A breeding method of a fresh-eating and storage-resistant type II red-pulp apple is characterized by comprising the following steps:
step S1, parent selection: selecting II type red-pulp apples as a parent I, and selecting common apples as a parent II; the storage-resistant gene of the first parent is homozygotic MdACS1-2, the titratable acid content of the second parent is between 0.2 and 0.5 percent, the soluble solid content is between 14 and 18 percent, and the S genotype of the first parent and the S genotype of the second parent cannot be completely same;
step S2, cross pollination: collecting small bell flowers or flowers which bloom initially, stripping off anthers, uniformly spreading the anthers on paper, baking for 12 hours under the light of 20-30 ℃, selecting undamaged flowers in the large bud period for pollination after pollen is completely scattered, dibbling central flowers, removing the rest flowers, bagging the flowers which finish pollination and listing;
step S3, picking fruits and taking seeds: after the hybrid fruits are ripe, picking the fruits, taking out the seeds, airing and storing; carrying out sand storage treatment on the seeds in winter;
step S4, sowing and seedling raising: accelerating germination of the seeds subjected to sand storage treatment, sowing the white buds downwards after the white buds are just exposed, applying soil and watering;
step S5, screening qualified seedlings by SSR molecular markers: using genome DNA of known type II red meat and non-type II red meat varieties as templates, screening out a first upstream primer and a first downstream primer which are positioned on the same chromosome as MdMYB110a by adopting a PCR (polymerase chain reaction) technology, referring to a known MdACS1 primer as a second upstream primer and a second downstream primer, and respectively calculating first target lengths of the first upstream primer and the first downstream primer and second target lengths of the second upstream primer and the second downstream primer; after 7-8 leaves grow out from the hybrid seedling, extracting DNA of fresh tender leaves, performing PCR amplification by using an anchor primer, performing agarose gel electrophoresis, and determining whether the seedling is qualified or not according to the length of a finally obtained target strip;
step S6, high connection: promoting growth of the qualified seedlings screened in the step S5, selecting high-position plump buds with more than 120 node positions to be grafted on big trees with the length of more than 6 years, and after the high-position plump buds are grafted and survive, bud carving, branch pulling, flower promoting and fruit promoting are carried out;
step S7, screening a superior line: after the fruit is ripe, observing the color of the fruit pulp and the storage stability of the fruit, and determining the content of soluble solid, titratable acid and the anthocyanin in the fruit pulp; wherein, the pulp is red, the pulp anthocyanin content is more than or equal to 2mg/100gFW, the titratable acid content is between 0.5 and 0.6 percent, the soluble solid content is more than or equal to 15 percent, and the fruit storage tolerance base is homozygotic MdACS1-2 or heterozygotic MdACS 1-2;
step S8, propagation: and (5) when the parameters in the step S7 meet the requirements, repeating the steps S6 to S7 for propagation, and obtaining a large number of red-pulp apple seedlings which are suitable for fresh eating and long-term storage.
2. The method as claimed in claim 1, wherein in step 1, the S genotype of the first parent is completely different from the S genotype of the second parent, and the first parent can be used as both male parent and female parent.
3. The method as claimed in claim 1, wherein in step 1, the non-S3 gene in the S genotype of the first parent is the same as the S genotype of the second parent, and the first parent serves as a male parent.
4. The method as claimed in claim 1, wherein in step 1, the non-S3 gene in the S genotype of the first parent is the same as the S genotype of the second parent, and the first parent is used as the female parent.
5. The method as claimed in claim 1, wherein in step 1, when the S genotypes of the first and second parents both contain S3 gene, the first parent is used as the female parent.
6. The method as claimed in claim 1, wherein the first upstream primer has a gene sequence of ACCCGGAGTCATCCCTGTCTTA, the first downstream primer has a gene sequence of CAAACTGGGCTTTCCGTTAGGT, and the first target length is 393 bp.
7. The method as claimed in claim 1, wherein the second forward primer has a gene sequence of AGAGAGATGCCATTTTTGTTCGTAC, the second backward primer has a gene sequence of CCTACAAACTTGCGTGGGGATTATAAGTGT, and the second target length is 655 bp.
8. The method as claimed in claim 1, wherein the temperature required for germination is 20-25 ℃ and the time required for germination is 12-24h in step S4.
9. The method as claimed in claim 1, wherein the thickness of the coating soil in step S4 is 1-2 cm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210656771.0A CN114868647B (en) | 2022-06-11 | 2022-06-11 | Breeding method of fresh-eating and storage-resistant II-type red-meat apples |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210656771.0A CN114868647B (en) | 2022-06-11 | 2022-06-11 | Breeding method of fresh-eating and storage-resistant II-type red-meat apples |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114868647A true CN114868647A (en) | 2022-08-09 |
| CN114868647B CN114868647B (en) | 2024-01-23 |
Family
ID=82680972
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210656771.0A Active CN114868647B (en) | 2022-06-11 | 2022-06-11 | Breeding method of fresh-eating and storage-resistant II-type red-meat apples |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114868647B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012044935A (en) * | 2010-08-27 | 2012-03-08 | Nagoya Univ | Red flesh apple and method for breeding the same |
| CN105359963A (en) * | 2015-12-04 | 2016-03-02 | 山东农业大学 | Method for cultivating easy-coloring apple variety |
| CN109852725A (en) * | 2019-04-12 | 2019-06-07 | 山东农业大学 | A kind of method of fruit resistant storage properties that identifying apple plants and its primer pair that uses |
-
2022
- 2022-06-11 CN CN202210656771.0A patent/CN114868647B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012044935A (en) * | 2010-08-27 | 2012-03-08 | Nagoya Univ | Red flesh apple and method for breeding the same |
| CN105359963A (en) * | 2015-12-04 | 2016-03-02 | 山东农业大学 | Method for cultivating easy-coloring apple variety |
| CN109852725A (en) * | 2019-04-12 | 2019-06-07 | 山东农业大学 | A kind of method of fruit resistant storage properties that identifying apple plants and its primer pair that uses |
Non-Patent Citations (2)
| Title |
|---|
| 常源升等: "苹果分子标记及辅助育种研究进展", 《园艺学报》 * |
| 韩婷婷 等: "‘金冠’和‘红勋1号’杂交后代遗传多样性分析", 《青岛农业大学学报（自然科学版）》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114868647B (en) | 2024-01-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhebentyayeva et al. | Apricot | |
| US10155955B2 (en) | Tomato plants resulting from the introgression of a trait from Solanum pennellii into S. lycopersicum and having an increased yield | |
| CN111356361B (en) | anti-CGMMV watermelon plant | |
| Sheikhi et al. | Pistachio (Pistacia spp.) breeding | |
| CN115843674B (en) | Breeding method and application of corn haploid induction line | |
| Quero-García et al. | Advances and challenges in cherry breeding | |
| Dondini et al. | Cherry breeding: sweet cherry (Prunus avium L.) and sour cherry (Prunus cerasus L.) | |
| US20190191645A1 (en) | Method for cultivating perennial rice using asexual propagation characteristic of oryza longistaminata | |
| CN111793710B (en) | SNP marker linked with cauliflower ball-bottom flower stalk branch angle, method and application | |
| CN108812297B (en) | Breeding method for shortening growth period of cabbage type rape and enhancing lodging resistance of cabbage type rape | |
| Usman et al. | Mandarin (Citrus reticulata blanco) breeding | |
| da Silva et al. | Pear (Pyrus spp.) breeding | |
| Quero-Garcı́a et al. | Breeding sweet cherries at INRA-Bordeaux: from conventional techniques to marker-assisted selectiona | |
| JP2011507508A (en) | How to improve the yield of cucumber plants | |
| CN110592255B (en) | Indel molecular marker closely linked with pepper cluster inflorescence gene, primer and application | |
| US20030135886A1 (en) | Cultivated tomato plant having increased brix value and method of producing same | |
| Kuden et al. | Peach breeding studies in Turkey and the evaluation of peach and nectarine hybrids | |
| Zarei et al. | Biodiversity, germplasm resources and breeding methods. | |
| Bhattarai et al. | Inheritance and linkage mapping of eastern filbert blight disease resistance in ‘Uebov’hazelnut | |
| Yamaguchi et al. | Early-maturing and chilling-tolerant soybean lines derived from crosses between Japanese and Polish cultivars | |
| CN111374041A (en) | Method for selecting rice blast resistant rice material with molecular marker assistance | |
| Cuenca et al. | Alborea: a new mid-late mandarin triploid hybrid [(Citrus clementina× C. tangerina)×(C. nobilis× C. deliciosa)] | |
| CN114868647A (en) | Breeding method of fresh-eating and storage-resistant II type red-pulp apples | |
| US10813319B2 (en) | Spinach variety NUN 06258 SPS | |
| Atanassova et al. | Expression of heterosis by hybridization |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |