CN114854783B - Recombinant lactococcus lactis expressing epidemic strain S1 of PEDV as well as preparation method and application thereof - Google Patents
Recombinant lactococcus lactis expressing epidemic strain S1 of PEDV as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN114854783B CN114854783B CN202210545480.4A CN202210545480A CN114854783B CN 114854783 B CN114854783 B CN 114854783B CN 202210545480 A CN202210545480 A CN 202210545480A CN 114854783 B CN114854783 B CN 114854783B
- Authority
- CN
- China
- Prior art keywords
- pedv
- recombinant
- lactococcus lactis
- group
- ice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/746—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
- A61K2039/541—Mucosal route
- A61K2039/542—Mucosal route oral/gastrointestinal
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/20011—Coronaviridae
- C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/20011—Coronaviridae
- C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/20011—Coronaviridae
- C12N2770/20051—Methods of production or purification of viral material
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Communicable Diseases (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Mycology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A recombinant lactococcus lactis expressing an epidemic strain S1 of PEDV and a preparation method and application thereof relate to the field of medical engineering, and the preparation method comprises the following steps: preparing a recombinant plasmid pNZ8149-PEDVS 1-jl; preparation of lactic acid bacteria NZ3900 competence; electrotransformation is carried out to prepare PEDV epidemic strain S1 gene recombinant lactococcus lactis; carrying out PCR identification on the PEDV epidemic strain S1 gene recombinant lactococcus lactis by utilizing a specific identification primer; the specific identification primer sequences are shown as SEQ ID NO.1 and SEQ ID NO. 2. The invention adopts the epidemic strain of PEDV which has obvious pertinence to the prevention and treatment of the disease, and the epidemic strain of PEDV is compared with the vaccine strain by sequencing, so the invention can effectively solve the problem of non-ideal immune effect of the vaccine strain and optimize the problem of low bioactivity of the protein expressed by the previous research.
Description
Technical Field
The invention relates to the technical field of medical engineering, in particular to a recombinant lactococcus lactis expressing an epidemic strain S1 of PEDV, and a preparation method and application thereof.
Background
The inactivated vaccine XJ-DB similar to the epidemic strain JMSE-PEDV-20210506 in sequence has better immune response to the sow, and the immune sow IgA and IgG antibodies are improved obviously to have better protective effect to piglets. After the PEDV G2 group strain FJzz1 is continuously transmitted in Vero cells for 200-generation injection to infect the suckling piglets, no obvious pathological tissue change exists, and the piglets are induced to generate pro-inflammatory cytokines such as TNF-alpha, IL-1 beta, IL-8 and the like, so that the FJzz1-f200 attenuated live vaccine has development potential. In terms of vaccines, there are viral vector vaccines, subunit vaccines, oral vaccines and the like, which are prepared by using an adenovirus vector to carry the S gene of G2A group PEDV strain CH/HBXT/2018 (GenBank accession number MH 816969), and which induce a significant level of PEDV-specific humoral immune response (p < 0.05) in piglets after vaccination. Oral vaccines are of interest by way of combined carrier and mucosal immunization.
The existing recombinant lactobacillus casei PEDV oral vaccine effectively induces the mucous membrane immune response of mice which secrete SIgA as a basis and the humoral immune response of the mice which secrete IgG through oral administration, and the recombinant bacterium can grow in an environment without adding D-alanine, so that the plasmid Alr gene can work normally in the defective bacteria. The S gene of PEDV is used by Mengoru Guo to construct recombinant lactococcus lactis, which has remarkable stimulation effect on spleen lymphocyte proliferation (p < 0.01) and stimulates mice to increase IL-4, IFN-gamma, specific SIgA and IgG (p < 0.01) after oral immunization. And the lactobacillus has the health care effects of regulating the balance of intestinal flora, killing acid-free pathogenic microorganisms and the like, and provides an effective strategy for replacing antibiotics and resisting PEDV infection in the future.
Disclosure of Invention
Aiming at the problems existing in the prior art, the invention aims to provide a recombinant lactococcus lactis for expressing an epidemic strain S1 of PEDV, and a preparation method and application thereof.
The technical scheme adopted by the invention for solving the technical problems is as follows:
the invention relates to a preparation method of a recombinant lactococcus lactis expressing a PEDV epidemic strain S1 gene, which comprises the following steps:
step one, preparing a recombinant plasmid pNZ8149-PEDV S1-jl;
step two, preparing the competent lactobacillus NZ 3900;
step three, electrotransformation is carried out to prepare PEDV epidemic strain S1 gene recombinant lactococcus lactis;
step four, performing PCR identification on the PEDV epidemic strain S1 gene recombinant lactococcus lactis by using a specific identification primer; the specific identification primer sequences are shown as SEQ ID NO.2 and SEQ ID NO. 3.
As a preferred embodiment, the first step specifically includes the following steps: respectively inoculating recombinant DH5 alpha glycerol bacteria and lactobacillus expression vector pNZ8149 into liquid LB culture medium containing kanamycin, respectively extracting plasmids after shake cultivation, and connecting a target gene and a recovery product of the lactobacillus expression vector pNZ8149 through ANZAT4 DNALigase at room temperature after double enzyme digestion to obtain recombinant plasmids pNZ8149-PEDV S1-jl.
As a preferred embodiment, the recombinant DH 5. Alpha. Glycerinum is prepared as follows: optimizing the PEDV epidemic strain S1 gene sequence recorded in GenBank, connecting a target gene fragment with a plasmid pET-30a, constructing a recombinant plasmid pET-30a-S1, carrying out transformation treatment on the recombinant plasmid pET-30a-S1, extracting the transformed recombinant plasmid pET-30a-S1, and identifying the recombinant plasmid pET-30a-S1 by adopting PCR, double enzyme digestion and sequencing; melting competent cells DH5 alpha on ice, slightly shaking to mix internal cells uniformly, adding 5-10uL of recombinant plasmid pET-30a-S1 into the competent cells DH5 alpha, slightly mixing uniformly, and standing in an ice bath for 30min; placing the mixed solution in a water bath at 42 ℃ for heat shock for 90s, then rapidly transferring the mixed solution into an ice bath, and standing for 5min; adding 800 mu L of the prepared and preserved sterile LB liquid medium into a centrifuge tube, and shaking and culturing at 160-180rpm of a shaking table at 37 ℃ for 2 hours to revive bacteria; 80 mu L of the bacterial liquid is coated on an LB agar plate, and is cultivated for 1h in a normal way, and then is cultivated in an incubator at 37 ℃ overnight in an inverted way, so that single colony is grown.
In a preferred embodiment, the second step specifically includes the following steps: inoculating lactobacillus NZ3900 aseptically into 5mL M17 liquid culture medium containing 1% glucose, standing at 30deg.C, and anaerobic culturing for 24 hr; inoculating the obtained culture into 10mL of M17 liquid culture medium containing 1% glucose according to the volume ratio of 1:20, and standing and anaerobic culturing for 24h at 30 ℃; inoculating the obtained culture into an M17 liquid culture medium, culturing for 3-4 hours, taking two centrifuge tubes, subpackaging the obtained bacterial liquid, standing for 10min on ice, centrifuging for 10min at the temperature of 4000r/min and 4 ℃, discarding the supernatant, and collecting bacterial precipitate; respectively adding 50mL of precooled solution I into a centrifuge tube, re-suspending and precipitating, standing on ice for 20min, centrifuging at4 ℃ and 4000r/min for 10min, pouring out the supernatant, and collecting bacterial precipitate; respectively adding 50mL of solution II into a centrifuge tube, suspending the precipitate by a liquid transfer device, standing on ice for 20min, centrifuging at4 ℃ for 10min at 4000r/min, pouring out the supernatant, and collecting bacterial precipitate; adding 12mL of precooled solution I into a centrifuge tube, suspending the precipitate by a pipette, standing on ice for 20min, centrifuging at4 ℃ and 4000r/min for 10min, pouring out the supernatant, and collecting the bacterial precipitate; adding 500 mu L of precooled solution I into a centrifuge tube respectively, suspending the precipitate by a pipette, subpackaging the precipitate at the amount of 40 mu L per tube, and preserving the precipitate at-80 ℃ for later use;
the solution I:0.5M sucrose, 10% glycerol, 115℃for 20min;
the solution II:0.5M sucrose, 10% glycerol and 0.05M EDTA,115℃for 20min.
As a preferred embodiment, the third step specifically includes the following steps: taking lactic acid bacteria NZ3900 competent cells, and thawing on ice; taking 10 mu L of the connection product and 100 mu L of lactic acid bacteria NZ3900 competent cells, uniformly blowing by a pipette, and transferring to a precooled electrorotating cup; placing on ice for 5min, placing into an electroconverter for electric shock, wherein the electric shock parameters are as follows: 2000V,400 Ω,25 μF,2mm; then adding 800 mu L of precooled M17 recovery culture medium, blowing and mixing uniformly, transferring into a 1.5mL precooled centrifuge tube, placing on ice for 5min, and carrying out anaerobic culture at 30 ℃ for 2h; 100. Mu.L of the bacterial liquid was aspirated and plated on Elliker medium, and the cells were anaerobically cultured at 30℃for 24 hours to observe colony morphology.
As a preferred embodiment, the M17 recovery medium contains 1% glucose, 0.5mol/L sucrose, 20mmol/LMgCl 2 And 2mmol/L CaCl 2 The method comprises the steps of carrying out a first treatment on the surface of the The Elliker medium contained 0.5% glucose, 0.5% lactose and 0.04% bromocresol purple.
As a preferred embodiment, the fourth step specifically includes the following steps: the Elliker culture medium is provided with light yellow positive colonies and milky white negative colonies, 1 positive colony and 1 negative colony are respectively inoculated into an M17 liquid culture medium for culture, plasmids are respectively extracted, PCR identification is carried out by using specific identification primers, the sequences of the specific identification primers are shown as SEQ ID NO.2 and SEQ ID NO.3, a target gene fragment with the size of 2379bp is obtained as a result, the sequence of the target gene fragment is shown as SEQ ID NO.3, and the PEDV epidemic strain S1 gene recombinant lactococcus lactis NZ3900/pNZ8149-PEDV S1-jl is successfully prepared.
As a preferred embodiment, the fourth step specifically includes the following steps: the PCR identification reaction program is that denaturation at 94 ℃ for 5min, annealing at 94 ℃ for 1min and annealing at 62 ℃ for 1min, renaturation at 72 ℃ for 1min, circulation is carried out for 35 times, and final temperature extension at 72 ℃ is carried out for 10min; after completion of the reaction, the PCR product was detected by 0.8% agarose gel electrophoresis.
The invention relates to a recombinant lactococcus lactis for expressing an epidemic strain S1 of PEDV.
The invention relates to an application of recombinant lactococcus lactis expressing an epidemic strain S1 of PEDV in preparing an oral vaccine for preventing porcine epidemic diarrhea (epidemic strain).
The beneficial effects of the invention are as follows:
1. according to the invention, the epidemic strain PEDV is selected as a recombinant lactococcus lactis research object, so that the recombinant lactococcus lactis of the epidemic strain can be prepared in time according to epidemic conditions, and an oral vaccine can be developed. The invention adopts epidemic strains of PEDV and has obvious pertinence to the prevention and the treatment of the disease. PEDV is an epidemic strain, and after sequencing comparison, the PEDV is different from a vaccine strain, PEDV S gene in Jilin region is cloned and then sent to Shanghai worker for sequencing, and the result shows that the epidemic strain of PEDV in local region has relatively close homology with most epidemic strains in China and is clustered in GII group. The invention selects the PEDV wild strain G2A group S1 gene insert plasmid pNZ8149 to construct recombinant plasmid, and makes the recombinant plasmid electrotransfer into lactococcus lactis NZ3900 to prepare the oral vaccine. The S1 region of the S protein has the function of combining with a receptor to generate an immune response, so that the S1 protein is selected. The recombinant lactococcus lactis is induced by Nisin with the final concentration of 2ng/mL, and clear bands with the size of 86kDa are obtained through SDS-PAGE and Western-blot detection, so that the successful expression of the target protein is proved, in addition, the PEDV hyperimmune serum is used as a primary antibody, and the result shows that the expressed S protein can react with the PEDV hyperimmune serum specifically. Therefore, the invention can effectively solve the problem of unsatisfactory immunization effect of vaccine strains.
2. According to the invention, a PEDV epidemic strain S1 gene with better protein expression activity is selected as an entry point for oral vaccine research of recombinant lactococcus lactis, an electric conversion method is adopted, a food-grade Nisin with a final concentration of 2ng/mL is added for inducing recombinant lactococcus lactis, so that the recombinant lactococcus lactis successfully expresses PEDV S1 protein, the expressed protein can react with PEDV hyperimmune serum specifically through SDS-PAGE and Western-blot detection, 16 piglets are fed to the recombinant lactococcus lactis after being induced by Nisin respectively, and the recombinant lactococcus lactis is divided into a lactobacillus group, a commercial vaccine group, a combined use group and a control group, and each group has 4 random piglets. The oral vaccine constructed by the invention can better generate specific IgG antibodies when used for immunizing piglets, and can stimulate the piglets to generate high-level specific IgG antibodies when used in combination with commercial vaccine of the oral recombinant lactococcus group, and the oral vaccine constructed by the invention has better protection effect on the piglets when used together with commercial vaccine; compared with commercial vaccines, the oral vaccine constructed by the experiment can stimulate piglets to generate specific SIgA antibodies more, and has better protection effect in intestinal mucosa immunization; the combined use of the constructed oral vaccine and the commercial vaccine can stimulate piglets to generate higher specific SIgA antibodies, has better effect of generating specific SIgA antibodies than the single immunization of swine infectious gastroenteritis and swine epidemic diarrhea combined live vaccine and the oral vaccine, lays a foundation for the optimization of subsequent vaccines and the combined use and development of other vaccines, and improves the biological activity of expressed proteins.
Drawings
FIG. 1 shows the plasmid bands of interest.
FIG. 2 shows the map of the enzyme digestion electrophoresis of the target gene (PEDV epidemic strain S1 gene).
FIG. 3 shows the gel recovery electrophoresis of the gene of interest (PEDV epidemic strain S1 gene).
FIG. 4 shows the plasmid pNZ8149 enzyme digestion electrophoresis.
FIG. 5 shows the recovery electrophoresis pattern of pNZ8149 plasmid gel.
FIG. 6 shows the results of medium selection after electrotransformation of recombinant lactococcus lactis.
FIG. 7 shows the PCR identification of positive colonies.
FIG. 8 shows SDS-PAGE analysis of recombinant lactococcus lactis expressed proteins.
FIG. 9 is a Western-blot analysis of recombinant lactococcus lactis expressed proteins (primary antibody is an anti-6 His tag antibody). In the figure, M: rainbow protein Maker,1-9: and (3) carrying out Western-blot analysis on the recombinant lactococcus lactis induced by Nisin.
FIG. 10 shows Western blot analysis of recombinant lactococcus lactis expressed proteins (primary antibody PEDV hyperimmune serum).
FIG. 11 shows the IgG levels of antibodies specific for PEDV S1 protein in the serum of immunized piglets.
FIG. 12 shows the levels of the antibody SIgA specific for PEDV S1 protein in the serum of immunized piglets.
FIG. 13 shows the results of cytokine IL-4 detection.
FIG. 14 shows the results of cytokine IFN-gamma detection.
Detailed Description
The technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
EXAMPLE 1 preparation of epidemic strain S1 of PEDV Gene recombinant lactococcus lactis
1. Designing a primer: according to the sequencing result and comparison information of the epidemic strain of PEDV, a Primer 5.0 is designed and synthesized to form a specific Primer, and Ji Linku Mei biological company is used for synthesis and identification.
PEDVS1-F：GGTACCATGAAGTCTTTAACCTACTTCTGG；
PEDVS1-R：GAGCTCCACCACCATCATCACCACACTAAAGTTGGTGGGAATAC。
2. Construction of recombinant plasmid pET-30a-S1
(1) Optimizing the PEDV epidemic strain S1 gene sequence recorded in GenBank, connecting a target gene fragment with plasmid pET-30a, and constructing recombinant plasmid pET-30a-S1;
(2) Carrying out transformation treatment on the recombinant plasmid pET-30a-S1;
(3) Extracting the converted recombinant plasmid pET-30a-S1;
(4) Identifying recombinant plasmid pET-30a-S1 by adopting PCR, double enzyme digestion and sequencing; synthesis was performed by jilin kumei biosome.
3. Preparation of recombinant DH5 alpha-glycerinum
Melting competent cells DH5 alpha on ice, slightly shaking to mix internal cells uniformly, adding 5-10uL of the connecting solution (recombinant plasmid pET-30 a-S1) into the competent cells DH5 alpha, slightly mixing uniformly, and standing in an ice bath for 30min; placing the mixed solution in a water bath at 42 ℃ for heat shock for 90s, then rapidly transferring the mixed solution into an ice bath, and standing for 5min, wherein a centrifuge tube is not required to be shaken in the process; adding 800 mu L of sterile LB liquid culture medium (without antibiotics) prepared and stored into a centrifuge tube, and shaking and culturing at 160-180rpm for 2h at 37 ℃ to revive bacteria; 80 mu L of the bacterial liquid is coated on an LB agar (containing Em 200 mu g/mL) plate, and is firstly cultivated for 1h in a normal way, then is inverted and cultivated in an incubator at 37 ℃ overnight (12-16 h), and single colony is grown.
4. Preparation of recombinant plasmid pNZ8149-PEDV S1-jl
30. Mu.L of recombinant DH 5. Alpha. Glycerol bacteria and lactic acid bacteria expression vector pNZ8149 were inoculated into 5mL of sterilized liquid LB medium (containing 1% kanamycin) and shake-cultured at 37℃under 160r/min for 14 hours, followed by extraction, and plasmids were extracted with Plasmid Mini Kit (OMEGA). Recombinant DH5 alpha glycerol bacteria containing recombinant plasmid pET-30a-S1 are resuscitated into bacteria liquid in a test tube of 5mL liquid LB culture medium containing 1% ampicillin, and plasmids are extracted, so that the target plasmid band can be clearly seen, and the size is 7801bp (figure 1); the extracted S1 plasmid DNA and pNZ8149 plasmid DNA were digested with SacI and KpnI, respectively, and the size of the target gene (PEDV epidemic strain S1 gene) was 2301bp (FIG. 2) by the digestion, and the size of the pNZ8149 plasmid was 2550bp (FIG. 4) by the digestion.
The recovered product of the target gene (PEDV epidemic strain S1 gene) (FIG. 3) and the recovered product of pNZ8149 plasmid (FIG. 5) were ligated with ANZA T4 DNA Ligase at room temperature for 15min to obtain recombinant plasmid pNZ8149-PEDV S1-jl.
5. Preparation of PEDV epidemic strain S1 gene recombinant lactococcus lactis by electrotransformation method
(1) Preparation of lactic acid bacteria NZ3900 competent
NZ3900 was inoculated into 100mL of M17 medium containing 1% glucose, anaerobic cultured at 30℃for 20 hours (OD.apprxeq.0.4), 50mL of bacterial liquid was collected at 4000rpm/min at4℃for 2min, and the supernatant was discarded. Standing on ice for 5min, adding 50mL precooled PBS, shaking uniformly, centrifuging at4 ℃ at 4000rpm/min for 2min, and discarding supernatant. 50mL of pre-cooled solution II is added, the suspension weight is blown and sucked by a pipette to uniformly precipitate, the solution is kept stand on ice for 15min, the temperature is 4 ℃ for 4000rpm/min, the solution is 2min, and the supernatant is discarded. 50mL of pre-cooled solution I is added, the suspension weight is blown and sucked by a pipette to uniformly precipitate, the solution is kept stand on ice for 15min, the temperature is 4 ℃ for 4000rpm/min, the solution is 2min, and the supernatant is discarded. Adding 20mL of pre-cooled solution II, blowing and sucking the suspension weight to uniformly precipitate by a liquid transferer, standing on ice for 15min, and removing the supernatant at the temperature of 4 ℃ at 4000rpm/min for 2 min. Adding 500 μl of pre-cooled solution II, sucking the suspension weight with a pipette, precipitating uniformly, packaging 100 μl, and preserving at-80deg.C. .
M17 medium: 7.6g of M17 medium was taken, 200mL of ddH2O was added, sterilized at 121℃for 15min, and 1% glucose was added at the time of use.
Solution I:17.2g glucose, 10% glycerol, 0.05M/L EDTA-2Na, ddH was added 2 O is fixed to 100mL, the pressure is high at 121 ℃, the sterilization is carried out for 15min, and the cooling is carried out for standby.
Solution II:17.2g glucose, 10% glycerol, and ddH were added 2 O is fixed to 100mL, the pressure is high at 121 ℃, the sterilization is carried out for 15min, and the cooling is carried out for standby.
(2) Electric conversion of lactic acid bacteria
Taking out competent cells of lactobacillus NZ3900 stored at-80deg.C, and thawing on ice; taking 10 mu L of the ligation product (recombinant plasmid pNZ8149-PEDV S1-jl) and 100 mu L of lactobacillus NZ3900 competent cells, blowing uniformly by a pipette, and transferring to a precooled electrorotating cup; placing on ice for 5min, placing into an electroconverter for electric shock, wherein the electric shock parameters are as follows: 2000V,400 Ω,25 μF,2mm; then 800. Mu.L of precooled M17 recovery medium (containing 1% glucose, 0.5mol/L sucrose, 20 mmol/LMgCl) was added 2 And 2mmol/L CaCl 2 ) Blowing and mixing uniformly, transferring into a centrifuge tube precooled by 1.5 and m L, placing the centrifuge tube on ice for 5min, and carrying out anaerobic culture for 2h at 30 ℃; 100. Mu.L of the bacterial liquid was aspirated and spread on an Elliker medium (containing 0.5% glucose, 0.5% lactose and 0.04% bromocresol purple), and anaerobic culture was performed at 30℃for 24 hours to observe colony morphology.
6. Results
As shown in FIG. 6, the purple Elliker medium had pale yellow positive colonies and milky white negative colonies, and 1 positive colony and negative colony each were inoculated into M17 liquid medium for cultivation. Plasmids were extracted separately using Plasmid Mini Kit (OMEGA Co.) and PCR was performed using specific identification primers (PEDVS 1-F: GGTACCATGAAGTCTTTAACCTACTTCTGG; PEDVS1-R: GAGCTCCACCACCATCATCACCACACTAAAGTTGGTGGGAATAC): denaturation at 94℃for 5min, 1min at 94℃for 1min, annealing at 62℃for 1min, renaturation at 72℃for 1min, 35 cycles, and final extension at 72℃for 10min. After completion of the reaction, the PCR product was detected by 0.8% agarose gel electrophoresis. The positive colony PCR identification result is: the target gene fragment (SEQ ID NO: 1) with the size of 2379bp is obtained and is shown in FIG. 7, thus showing that the PEDV epidemic strain S1 gene recombinant lactococcus lactis NZ3900/pNZ8149-PEDV S1-jl is successfully prepared.
The plasmid of the target positive bacterium was sent to biological company for SDS-PAGE analysis, and the result shows that the target gene (PEDV epidemic strain S1 gene) was successfully inserted into a lactobacillus expression vector pNZ8149 (FIG. 8), and the sizes of a band of HIS tag antibody (FIG. 9) and a band of PEDV hyperimmune serum antibody (FIG. 10) were 86kDa through Western immunoblotting (Western Blot, WB) verification.
Example 2 application of epidemic strain S1 of PEDV in recombinant lactococcus lactis
The porcine transmissible gastroenteritis and porcine epidemic diarrhea bivalent live vaccine is purchased from Hangzhou bleb animal vaccine Co. The 16 weaned piglets of 28 days of self-breeding in the laboratory are randomly divided into 4 groups, namely an oral recombinant lactococcus lactis group, a commercial vaccine group, a combined use group and a control group, and each group of 4 piglets. The recombinant lactococcus lactis group was fed 1mL of recombinant lactococcus lactis NZ3900/pNZ8149-PEDV S1-jl per head, 3d each time, 2 times of immunization, and 14d intervals. Each piglet of the commercial vaccine group is vaccinated with 1 part of porcine infectious gastroenteritis and porcine epidemic diarrhea bivalent live vaccine for 2 times at intervals of 14d. The combined use groups are immunized by using the porcine transmissible gastroenteritis and porcine epidemic diarrhea bivalent live vaccine twice, 1 part of each pig is vaccinated, and after immunization, 1mL of each pig is fed by recombinant lactococcus lactis NZ3900/pNZ8149-PEDV S1-jl, and 3d of each pig is continuously fed. The 4 piglets of each group of oral recombinant lactococcus lactis group, commercial vaccine group, combined use group and control group were collected with 0d, 14d, 21 and 35d of vena cava anterior blood respectively. Standing at 4deg.C overnight, centrifuging at 5000rpm/min for 2min, and collecting serum at-20deg.C for use in the next step of immunoassay.
Serum collected from 0d, 14d, 21, 35d was used to detect PEDV S1 protein specific IgG antibodies using ELISA kit. As shown in fig. 11 and table 1, the differences between the groups were insignificant at 0d (p > 0.05), and the commercial vaccine group, the oral recombinant lactococcus lactis group, and the combination group produced significant levels of specific IgG antibodies (p < 0.05) compared to the control group at 14d, wherein the combination group produced specific IgG antibodies at a level slightly higher than the commercial vaccine group and the oral recombinant lactococcus lactis group (p > 0.05), and the commercial vaccine group produced specific IgG antibodies at a level slightly higher than the oral recombinant lactococcus lactis group (p < 0.05). At 21d, the specific IgG antibody level produced by the commercial vaccine group, the oral recombinant lactococcus lactis group and the combined use group reaches a peak value, the combined use group is higher than the commercial vaccine group and the oral recombinant lactococcus lactis group (p < 0.05), the average SP value of the specific IgG antibody produced by the commercial vaccine group is 0.34 and higher than the average SP value of the oral recombinant lactococcus lactis group by 0.28 (p > 0.05), the specific IgG antibody level of the commercial vaccine group is reduced at 35d, but still higher than the commercial vaccine group and the oral recombinant lactococcus lactis group, the average SP value of the specific IgG antibody of the oral recombinant lactococcus lactis group is 0.238 and lower than the average SP value of the commercial vaccine group by 0.28, the difference between the two groups is not significant (p > 0.05), and the specific IgG antibody levels of the control groups of 0d, 14d, 21 and 35d have no significant difference (p > 0.05). Proved by the experiment, the PEDV epidemic strain S1 gene recombinant lactococcus lactis NZ3900/pNZ8149-PEDV S1-jl can stimulate piglets to generate more remarkable specific IgG antibodies.
TABLE 1 serum PEDV S1 protein-specific antibody IgG levels for immunized piglets
Serum collected from 0d, 14d, 21, 35d was used to detect PEDV S1 protein-specific SIgA antibodies using ELISA kit. As shown in fig. 12 and table 2, there was no significant difference between the groups at 0d (p > 0.05), and each group produced significant specific SIgA antibodies (p < 0.05) at 14d compared to the control group, and the combined use of the groups produced specific SIgA antibodies higher than the commercial vaccine group and the oral recombinant lactococcus lactis group (p > 0.05). The specific SIgA antibodies produced by the commercial vaccine group were slightly higher than those produced by the oral recombinant lactococcus lactis group (p > 0.05). The average value of the S/P of the specific SIgA antibody of each group reaches a peak value at 21d, the S/P average value of the specific SIgA antibody of the oral recombinant lactococcus group is 0.689 higher than the S/P average value of the commercial vaccine group by 0.651, the difference between the two groups is not obvious (P > 0.05), the S/P average value of the specific SIgA antibody of the combined group is 0.757, the difference between the specific SIgA antibody of the combined group and the specific SIgA antibody of the commercial vaccine group is obviously higher than that of the oral recombinant lactococcus group (P < 0.05), the difference between the specific SIgA antibody of the combined group and the commercial vaccine group is extremely obvious (P < 0.01), the specific SIgA antibody of each group except the control group is in a declining trend at 35d, the specific SIgA antibody of the combined group is still the highest, and the specific SIgA antibody of the commercial vaccine group is slightly lower than that of the oral recombinant lactococcus group (P > 0.05). Proved by the experiment, the PEDV epidemic strain S1 gene recombinant lactococcus lactis NZ3900/pNZ8149-PEDV S1-jl can stimulate piglets to generate obvious specific SIgA antibodies.
TABLE 2 level of PEDV S1 protein-specific antibodies SIgA in serum of immunized piglets
Serum collected from 0d, 14d, 21 and 35d was used to detect cytokine IL-4 in immunized piglets using ELISA kit. The results are shown in FIG. 13 and Table 3, and each group showed an upward trend from 0d to 21d except the control group. The commercial vaccine group, the oral recombinant lactococcus lactis group and the combined use group generate significant levels of cytokine IL-4 (p < 0.05) on piglet stimulation compared with the control group at 14d, the combined use group is higher than the commercial vaccine group and the oral recombinant lactococcus lactis group (p > 0.05), the commercial vaccine group and the oral recombinant lactococcus lactis group have insignificant differences (p > 0.05), the combined use group at 21d is slightly higher than the commercial vaccine group and the oral recombinant lactococcus lactis group (p > 0.05), and the commercial vaccine group is higher than the oral recombinant lactococcus lactis group (p > 0.05). The combination group produced very significantly different levels of cytokine IL-4 (p < 0.01) than the control group at 35d, which was still slightly higher than the commercial vaccine group and the oral recombinant lactococcus lactis group (p > 0.05), which was slightly higher than the commercial vaccine group (p > 0.05). Proved by the experiment, the PEDV epidemic strain S1 gene recombinant lactococcus lactis NZ3900/pNZ8149-PEDV S1-jl can better stimulate piglets to produce cytokine IL-4.
TABLE 3 detection results of cytokine IL-4
Serum collected from 0d, 14d, 21 and 35d was used to detect cytokine IFN-gamma in immunized piglets using ELISA kit. The results are shown in FIG. 14 and Table 4, and each group was on an upward trend from 0d to 35d, except the control group. At 14d, the commercial vaccine group, the oral recombinant lactococcus lactis group, the combined group produced significant levels of cytokine IFN-gamma (p < 0.05) for piglet stimulation compared to the control group, the combined group was higher than the commercial vaccine group, the oral recombinant lactococcus lactis group (p > 0.05), the oral recombinant lactococcus lactis group was slightly lower than the commercial vaccine group, the comparative difference was insignificant (p > 0.05), the combined group at 21d was slightly higher than the commercial vaccine group and the oral recombinant lactococcus lactis group (p > 0.05), the commercial vaccine group was higher than the oral recombinant lactococcus lactis group, and the difference was insignificant (p > 0.05). The commercial vaccine group, the oral recombinant lactococcus lactis group and the combined use group reach peak at 35d, wherein the combined use group generates the cytokine IFN-gamma (p < 0.01) with extremely obvious difference compared with the control group, and the combined use group generates the cytokine IFN-gamma (p < 0.05) with obvious difference compared with the oral recombinant lactococcus lactis group. The commercial vaccine group remained slightly higher than the oral recombinant lactococcus lactis group (p > 0.05). Proved by the experiment, the PEDV epidemic strain S1 gene recombinant lactococcus lactis NZ3900/pNZ8149-PEDV S1-jl can better stimulate piglets to produce cytokine IFN-gamma.
TABLE 4 detection results of cytokine IFN-gamma
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.
Sequence listing
<110> Jilin agricultural science and technology institute
<120> recombinant lactococcus lactis expressing epidemic strain S1 of PEDV, preparation method and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2379
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atgaagtctt taacctactt ctggttgttc ttaccagtac tttcaacatt tagcctacca 60
caagatgtca ccaggtgctc agctaacact aattttaggc ggttcttttc aaaatttaat 120
gttcaggcgc ctgcagttgt tgtactgggc ggttatctac ctattggtga aaaccagggt 180
gtcaattcaa cttggtactg tgctggccaa catccaactg ctagtggcgt tcatggtatc 240
tttgttagcc atattagagg tggtcatggc tttgagattg gcatttcgca agagcctttt 300
gaccctagtg gttaccagct ttatttacat aaggctacta acggtaacac taatgctact 360
gcgcgactgc gcatttgcca gtttcctagc attaaaacat tgggccccac tgctaataat 420
gatgttacaa caggtcgtaa ttgcctattt aacaaagcca tcccagctca tatgagtgaa 480
catagtgttg tcggcataac atgggataat gatcgtgtca ctgtcttttc tgacaagatc 540
tattattttt attttaaaaa tgattggtcc cgtgttgcga caaagtgtta caacagtgga 600
ggttgtgcta tgcaatatgt ttacgaaccc acctattaca tgcttaatgt tactagtgct 660
ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta tgctgccaat 720
gtatttgcta ctgagcccaa tggccacata ccagaaggtt ttagttttaa taattggttt 780
cttttgtcca atgattccac tttgttgcat ggtaaggtgg tttccaacca accattgttg 840
gtcaattgtc ttttggccat tcctaagatt tatggactag gccaattttt ctccttcaat 900
caaacgatcg atggtgtttg taatggagct gctgtgcagc gtgcaccaga ggctctgagg 960
tttaatatta atgacacctc tgtcattctt gctgtcattc ttgctgaggg ctctattgta 1020
cttcacactg ctttaggaac aaatctttct tttgtttgca gtaattcttc aaatcctcat 1080
ttagctacct tcaccatacc tctgggtgct acccaagtac cctattattg ttttcttaaa 1140
gtggatactt acaactccac tgtttataaa tttttggctg ttttacctcc taccgtcagg 1200
gaaattgtca tcaccaagta tggtgatgtt tatgtcaatg ggtttggata cttgcatctc 1260
ggtttgttgg atgctgtcac aattaatttc actggtcatg gcactgacga tgatgtttct 1320
ggtttttgga ccatagcatc gactaatttt gttgatgcac tcatcgaagt tcaaggaact 1380
gccattcagc gtattcttta ttgtgatgat cctgttagcc aactcaagtg ttctcaggtt 1440
gcttttgacc ttgacgatgg tttttaccct atttcttcta gaaaccttct gagtcatgaa 1500
cagccaactt cttttgtcac tttgccatca tttaatgatc attcttttgt taacattact 1560
gtctctgcgt cttttggtgg tcatagtggt gccaacctca ttgcatctga cactactatc 1620
aatgggttta gttctttctg tgttggcact agacaattta ccatttcact gttttataac 1680
gttacaaaca gttatggtta tgtgtctaac tcacaggata ctaattgccc tttcaccttg 1740
caatctgtta atgattacct gtcttttagc aaattttgtg tttctaccag ccttttggct 1800
agtgcctgta ccatagatct ttttggttac cctgagttcg gtagtggtgt taagtttacg 1860
tccctttatt ttcaattcac aaagggtgag ttgattactg gcacgcctaa accacttgaa 1920
ggtgttacgg acgtttcttt tatgactctg gatgtgtgta ccaagtatac tatctatggc 1980
tttaaaggtg agggtgtcat tacccttaca aattctagct ttttggcagg tgtttattat 2040
acatctgatt ctggacagct gttagccttt aagaatgtca ctagtggtgc tgtttattct 2100
gttacgccat gttctttttc agagcaggct gcatatgttg atgatgatat agtgggtgtt 2160
atttctagtt tgtctaactc cacttttaac agtactaggg agttgcctgg tttcttctac 2220
cattctaatg atggctctaa ttgtacagag cctgtgttgg tgtatagtaa cataggtgtt 2280
tgtaaatctg gcagtattgg ctatgtccca tctcagtctg gccaagtcaa gattgcaccc 2340
acggttactg ggaatattag tattcccacc aactttagt 2379
<210> 2
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
ggtaccatga agtctttaac ctacttctgg 30
<210> 3
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gagctccacc accatcatca ccacactaaa gttggtggga atac 44
Claims (3)
1. A preparation method of recombinant lactococcus lactis expressing epidemic strain S1 of PEDV, which is characterized by comprising the following steps:
step one, preparing a recombinant plasmid pNZ8149-PEDV S1-jl;
preparing recombinant DH5 alpha glycerinum, wherein the preparation process of the recombinant DH5 alpha glycerinum is as follows: optimizing the PEDV epidemic strain S1 gene sequence recorded in GenBank, connecting the optimized target gene fragment with plasmid pET-30a, constructing recombinant plasmid pET-30a-S1, converting recombinant plasmid pET-30a-S1, extracting the converted recombinant plasmid pET-30a-S1, and identifying the recombinant plasmid pET-30a-S1 by adopting PCR, double enzyme digestion and sequencing; melting competent cells DH5 alpha on ice, slightly shaking to mix internal cells uniformly, adding 5-10uL of recombinant plasmid pET-30a-S1 into the competent cells DH5 alpha, slightly mixing uniformly, and standing in an ice bath for 30min; placing the mixed solution in a water bath at 42 ℃ for heat shock for 90s, then rapidly transferring the mixed solution into an ice bath, and standing for 5min; adding 800 mu L of the prepared and preserved sterile LB liquid culture medium, and carrying out shake culture at 160-180rpm on a shaking table at 37 ℃ for 2 hours to revive bacteria; coating 80 mu L of bacterial liquid on an LB agar plate, firstly, culturing for 1h in a positive way, then culturing in an incubator at 37 ℃ in an inverted way overnight, and growing single bacterial colonies;
inoculating the recombinant DH5 alpha glycerol bacteria into a liquid LB culture medium containing kanamycin, extracting plasmids after shaking culture, carrying out double enzyme digestion on the extracted plasmids and a lactobacillus expression vector pNZ8149, and connecting the optimized target genes and a recovery product of the lactobacillus expression vector pNZ8149 through ANZA T4 DNA Ligase at room temperature to obtain recombinant plasmids pNZ8149-PEDV S1-jl;
step two, preparing the competent lactobacillus NZ 3900;
inoculating lactobacillus NZ3900 aseptically into 5mL M17 liquid culture medium containing 1% glucose, standing at 30deg.C, and anaerobic culturing for 24 hr; inoculating the obtained culture into 10mL of M17 liquid culture medium containing 1% glucose according to the volume ratio of 1:20, and standing and anaerobic culturing for 24h at 30 ℃; inoculating the obtained culture into an M17 liquid culture medium, culturing for 3-4 hours, taking two centrifuge tubes, subpackaging the obtained bacterial liquid, standing for 10min on ice, centrifuging for 10min at the temperature of 4000r/min and 4 ℃, discarding the supernatant, and collecting bacterial precipitate; respectively adding 50mL of precooled solution I into a centrifuge tube, re-suspending and precipitating, standing on ice for 20min, centrifuging at4 ℃ and 4000r/min for 10min, pouring out the supernatant, and collecting bacterial precipitate; respectively adding 50mL of solution II into a centrifuge tube, suspending the precipitate by a liquid transfer device, standing on ice for 20min, centrifuging at4 ℃ for 10min at 4000r/min, pouring out the supernatant, and collecting bacterial precipitate; adding 12mL of precooled solution I into a centrifuge tube, suspending the precipitate by a pipette, standing on ice for 20min, centrifuging at4 ℃ and 4000r/min for 10min, pouring out the supernatant, and collecting the bacterial precipitate; adding 500 mu L of precooled solution I into a centrifuge tube respectively, suspending the precipitate by a pipette, subpackaging the precipitate at the amount of 40 mu L per tube, and preserving the precipitate at-80 ℃ for later use;
the solution I:17.2g glucose, 10% glycerol, 0.05M/L EDTA-2Na, ddH was added 2 O is fixed to 100mL, the pressure is high at 121 ℃, the sterilization is carried out for 15min, and the cooling is carried out for standby;
the solution II:17.2g glucose, 10% glycerol, and ddH were added 2 O is fixed to 100mL, the pressure is high at 121 ℃, the sterilization is carried out for 15min, and the cooling is carried out for standby;
step three, electrotransformation is carried out to prepare PEDV epidemic strain S1 gene recombinant lactococcus lactis;
taking lactic acid bacteria NZ3900 competent cells, and thawing on ice; taking 10 mu L of recombinant plasmid pNZ8149-PEDV S1-jl and 100 mu L of lactobacillus NZ3900 competent cells, uniformly blowing by a pipette, and transferring to a precooled electrorotating cup; placing on ice for 5min, and placing into an electroconverter for electric shock; then adding 800 mu L of precooled M17 recovery culture medium, blowing and mixing uniformly, transferring into a centrifuge tube precooled by 1.5 and M L, placing the centrifuge tube on ice for 5min, and carrying out anaerobic culture for 2h at 30 ℃; 100 mu L of bacterial liquid is absorbed and coated on an Elliker culture medium, anaerobic culture is carried out for 24 hours at 30 ℃, and colony morphology is observed;
step four, performing PCR identification on the PEDV epidemic strain S1 gene recombinant lactococcus lactis by using a specific identification primer; the specific identification primer sequences are shown as SEQ ID NO.2 and SEQ ID NO. 3;
the Elliker culture medium is provided with light yellow positive colonies and milky white negative colonies, 1 positive colony and 1 negative colony are respectively inoculated into an M17 liquid culture medium for culture, plasmids are respectively extracted, PCR identification is carried out by using specific identification primers, the sequences of the specific identification primers are shown as SEQ ID NO.2 and SEQ ID NO.3, an optimized target gene fragment with the size of 2379bp is obtained, and the sequence of the optimized target gene fragment is shown as SEQ ID NO.1, so that PEDV epidemic strain S1 gene recombinant lactococcus lactis NZ3900/pNZ8149-PEDV S1-jl is successfully prepared.
2. The preparation method according to claim 1, wherein the M17 recovery medium contains 1% glucose, 0.5mol/L sucrose, and 20mmol/L MgCl 2 And 2mmol/L CaCl 2 The method comprises the steps of carrying out a first treatment on the surface of the The Elliker medium contained 0.5% glucose, 0.5% lactose and 0.04% bromocresol purple.
3. The method according to claim 1, wherein the fourth step comprises the steps of: the PCR identification reaction program is that denaturation is carried out at 94 ℃ for 5min, annealing is carried out at 94 ℃ for 1min and 62 ℃ for 1min, renaturation is carried out at 72 ℃ for 1min, the cycle is carried out for 35 times, and the final temperature at 72 ℃ is extended for 10min; after completion of the reaction, the PCR product was detected by 0.8% agarose gel electrophoresis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210545480.4A CN114854783B (en) | 2022-05-19 | 2022-05-19 | Recombinant lactococcus lactis expressing epidemic strain S1 of PEDV as well as preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210545480.4A CN114854783B (en) | 2022-05-19 | 2022-05-19 | Recombinant lactococcus lactis expressing epidemic strain S1 of PEDV as well as preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114854783A CN114854783A (en) | 2022-08-05 |
| CN114854783B true CN114854783B (en) | 2023-07-07 |
Family
ID=82639325
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210545480.4A Active CN114854783B (en) | 2022-05-19 | 2022-05-19 | Recombinant lactococcus lactis expressing epidemic strain S1 of PEDV as well as preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114854783B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074291A (en) * | 2012-12-20 | 2013-05-01 | 大连大学 | Recombinant porcine epidemic diarrhea virus (PEDV) lactococcus lactis and its construction method and use |
| CN106754984A (en) * | 2016-12-13 | 2017-05-31 | 华中农业大学 | Expression Porcine epidemic diarrhea virus S318The Recombinant Lactococcus lactis of gene and application |
-
2022
- 2022-05-19 CN CN202210545480.4A patent/CN114854783B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114854783A (en) | 2022-08-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106188307B (en) | A kind of fusion protein, preparation method and a boar oral vaccine or drug | |
| US20090117151A1 (en) | Vector for anti-hpv vaccine and transformed microorganism by the vector | |
| KR100578395B1 (en) | A killed lactic acid bacteria preparation with enhanced immunity and method for preparing the same | |
| CN107337718A (en) | A kind of gene for encoding carrying Cap gene of porcine circovirus type 2 and its application | |
| CN104693310B (en) | A kind of chimeric protein, virus-like particle and its application | |
| CN106928373A (en) | A kind of porcine mycoplasmal pneumonia multi-epitope mucosal vaccine | |
| CN115725002B (en) | Coli specific antigen fusion protein and recombinant lactococcus lactis thereof | |
| CN107529534A (en) | A kind of protective antigens of secondary poultry bacillus and its expression and application | |
| CN109303916A (en) | Coke dies GAP-associated protein GAP GSDMD and is preparing the application in ghost vaccine | |
| CN110408637A (en) | A kind of hemorrhagic disease of grass carp yeast oral vaccine and application | |
| CN112625095A (en) | Porcine rotavirus recombinant protein, recombinant adenovirus expressing protein and application | |
| CN104894045B (en) | A kind of recombinant Lactobacillus and its preparation method and application of coexpression VP 1 Gene of Foot-and-Mouth Disease virus and immunologic adjuvant ox IL-6 genes | |
| CN117431200A (en) | Recombinant bacillus subtilis for displaying Newcastle disease virus HN protein on spore surface, construction method and application | |
| CN104371025A (en) | Immunogenic protein aiming at cervical cancer and application of immunogenic protein | |
| CN114854783B (en) | Recombinant lactococcus lactis expressing epidemic strain S1 of PEDV as well as preparation method and application thereof | |
| CN109468256B (en) | Probiotic clone strain integrating four-copy F18 pilus operon gene and double-copy F4 pilus operon gene and construction method | |
| CN107523531A (en) | A kind of genetic engineering bacterium containing pMG36e pgsA gp85 recombinant plasmids | |
| CN110016457B (en) | Rough brucella abortus for recombining echinococcus granulosus Eg95gene and vaccine production method thereof | |
| CN101368167A (en) | Recombinant lactobacillus casei for co-expression of swine fever virus T cell epitope and pig parvoviral VP2 protein, and method of producing the same | |
| CN107586788A (en) | A kind of construction method of pMG36e pgsA gp85 recombinant plasmids | |
| CN109504643B (en) | Probiotic clone strain integrating four-copy functional F18 pilus operon gene, construction method and application | |
| CN107988130A (en) | Stablize lactic acid bacteria genetic engineering subunit vaccine strain of expression porcine rotavirus VP4 albumen and preparation method thereof | |
| CN113861277A (en) | Bovine rotavirus recombinant VP8 protein and application thereof | |
| CN106754984A (en) | Expression Porcine epidemic diarrhea virus S318The Recombinant Lactococcus lactis of gene and application | |
| CN112011555A (en) | Recombinant gene and recombinant plasmid for regulating and controlling salmonella self-lysis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |