CN114854656B - Recombinant bacterium for producing nicotinamide riboside - Google Patents

Abstract

The invention discloses a recombinant bacterium for producing nicotinamide riboside, belonging to the technical fields of genetic engineering and biological engineering. The invention strengthens enzyme gene ushA converted to NR by utilizing NAD derivative high-yield recombinant escherichia coli, knocks out deoD gene, rihA gene, rihB gene, rihC gene and pnuC gene, eliminates NR degradation path and cuts off NR inward intracellular transport path, thereby realizing NR biosynthesis. The invention further improves the accumulation of NR outside cells by adjusting the gene expression intensity, and further improves the accumulation amount of NR by optimizing the fermentation condition, so that more than 20g/L NR can be obtained under a 5L fermentation system, and the invention has wide application prospect in the fields of foods, medicines, cosmetics, feeds and textiles.

Description

Recombinant bacterium for producing nicotinamide riboside

Technical Field

The invention relates to recombinant bacteria for producing nicotinamide riboside, belonging to the technical fields of genetic engineering and biological engineering.

Background

Nicotinamide riboside (Nicotinamide riboside, NR) is nicotinamide adenine dinucleotide (Nicotinamide adenine dinucleotide, NAD) ⁺ ) One of the important precursor substances of (a). Studies have shown that exogenous supplementation with NR can be effective in supplying and increasing intracellular NADH levels. NADH has been proved to have various biological functions, such as anti-aging, anti-disease, anti-oxidation and the like, the biological functions of NR are also verified, and exogenous supplementation of NR can obviously improve the cold resistance of mice, improve the abundance of mitochondria and further properly prolong the service life.

As the important biological functions of NR are verified, NR-based synthesis is increasingly studied. But currently chemical synthesis is mainly focused on. In the Chinese patent application with publication number of CN110452277A, the inventor takes nicotinamide and 1,2,3, 5-tetraacetyl-beta-D-ribofuranose as substrates, and obtains the finished product NR through condensation reaction, acetyl deprotection reaction, column chromatography, distillation drying and recrystallization. In the chinese patent application publication No. CN111763235a, the inventors synthesized NR with ribofuranose, methyl nicotinate, and chloroform, adding trimethylsilyl triflate as a catalyst. Conversion efficiency is relatively high by chemical synthesis, but the addition of catalysts and toxic reagents limits the use of the produced NR in the food field.

Disclosure of Invention

In order to solve the problems, the application aims to find a bioconversion method for improving the yield of nicotinamide riboside, and nicotinamide with low cost is used as a substrate to produce the nicotinamide riboside through efficient conversion in a whole-cell catalysis mode.

The first object of the present invention is to provide a recombinant strain which can synthesize nicotinamide riboside by nicotinamide, wherein the strain is based on the original strain, the 5' -nucleotidase gene ushA is overexpressed, and the purine nucleoside phosphatase gene DeoD, the nicotinamide riboside transporter gene pnuC, the pyrimidine-specific ribonucleoside hydrolase gene rihA, the pyrimidine-specific ribonucleoside hydrolase gene rihB and the ribonucleoside hydrolase rihC are knocked out.

In one embodiment, the starting strain is escherichia coli.

In one embodiment, the starting strain knocks out at least one gene of nicotinamide mononucleotide amino hydrolase gene pncC, DNA binding transcription repressor/nicotinamide mononucleotide adenylate transferase gene nadR, DNA binding transcription repressor gene purR, and 5' -nucleotidase gene ushA.

In one embodiment, the starting strain is E.coli F004 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR) as disclosed in the patent application publication No. CN 112795582A.

In one embodiment, the DeoD Gene is as shown in Gene ID 945654, the pnuC Gene is as shown in Gene ID 945350, the rihA Gene is as shown in Gene ID 945503, the rihB Gene is as shown in Gene ID 946646 and the rihC Gene is as shown in Gene ID 944796; the ushA gene is shown in SEQ ID NO. 4.

In one embodiment, the BaPRS gene and the VpNadV gene are expressed using pET-28a (+) or pRSFDuet as vectors.

In one embodiment, the ushA gene is expressed using pACYCDuet-1 or pCDFDuet as a vector.

In one embodiment, the ushA gene and the BMpnuC gene are expressed using pACYCDuet-1 or pCDFDuet as vectors.

In one embodiment, the DeoD gene of recombinant escherichia coli F004 was knocked out using CRISPR-Cas9 gene editing system to obtain recombinant strain F005 (e.coli BL21 (DE 3), Δpncc, Δusha, Δnadr, Δpurr, Δdeod).

In one embodiment, recombinant strain F007 (e.coli BL21 (DE 3), Δpncc, Δusha, Δnadr, Δpurr, Δdeod, Δpnuc) was obtained using CRISPR-Cas9 gene editing system to knock out the pnuC gene of recombinant escherichia coli F005.

In one embodiment, the rila gene of recombinant escherichia coli F007 is knocked out using the CRISPR-Cas9 gene editing system to obtain recombinant strain F008 (e.coli BL21 (DE 3), Δpncc, Δusha, Δnadr, Δpurr, deoD, Δpnuc, Δrila).

In one embodiment, recombinant strain F009 (e.coli BL21 (DE 3), Δpncc, Δusha, Δnadr, Δpurr, deoD, Δpnuc, Δrilha, Δrilhb) is obtained using CRISPR-Cas9 gene editing system to knock out the rihB gene of recombinant escherichia coli F008.

In one embodiment, the rilc gene of recombinant e.coli F009 was knocked out using a CRISPR-Cas9 gene editing system to obtain recombinant strain F010 (e.coli BL21 (DE 3), Δpncc, Δusha, Δnadr, Δpurr, deoD, Δpnuc, Δrilha, Δrilhb, Δrilc).

The invention also provides a method for promoting the recombination of the escherichia coli to synthesize NR, which is to overexpress nicotinamide phosphoribosyl transferase gene VpNadV shown as SEQ ID NO.1, PRPP synthase gene BaPRS shown as SEQ ID NO.2 and nicotinamide mononucleotide transporter gene BMpnuC shown as SEQ ID NO.3 in the escherichia coli and knock out pncgene, ushA gene, nadR gene and purR gene, deoD gene, pnuC gene, rihA gene, rihB gene and rihC gene.

The invention also provides a method for producing nicotinamide riboside by taking nicotinamide as a substrate, which comprises the steps of culturing the recombinant strain at 35-37 ℃ for a period of time, inducing to produce nicotinamide riboside by using IPTG, and adding the substrate nicotinamide at the same time of adding an inducer.

In one embodiment, the induction is performed at 25 to 37 ℃.

In one embodiment, the method is to culture the recombinant bacterium in a fermentation medium at 35-37 ℃ to OD ₆₀₀ =0.6 to 1.0, cooling to 24 to 26 ℃, adding IPTG with the final concentration of 0.2 to 1mM, and adding nicotinamide with the concentration of 100 to 10 g/L.

In one embodiment, the fermentation medium contains KH ₂ PO ₄ 6～12g/L、K ₂ HPO ₄ 16-30 g/L, 5-10 g/L ammonium sulfate, 1-5 g/L, mgSO citric acid monohydrate ₄ .7H ₂ O1-5 g/L, yeast powder 10-30 g/L and glucose 15-50 g/L.

In one embodiment, the fermentation medium contains KH ₂ PO ₄ 3g/L、K ₂ HPO ₄ 7.33g/L, 0.85g/L of citric acid, 15g/L of ammonium sulfate, 5mL of metal ion solution and 20g/L, mgSO of glucose ₄ .7H ₂ O1 g/L and yeast powder 5g/L.

In one embodiment, the nicotinamide is added to the medium in one portion or in portions after the addition of the inducer.

In one embodiment, the divided portions are added in two portions, one nicotinamide every two hours; or four times, once every hour.

In one embodiment, the recombinant strain is cultured in LB medium to obtain seed culture solution, and then the seed culture solution is transferred into TB medium according to 1% -5% transfer amount.

The invention also provides application of the recombinant escherichia coli in preparing products containing nicotinamide riboside in the fields of foods, medicines, cosmetics, feeds and textiles.

The beneficial effects are that: the invention is based on the existing NAD derivative production strain, and based on CRISPR-Cas9 technology, enzyme genes which exist endogenously in escherichia coli and have decomposition effect on NAD derivatives are knocked out, degradation paths and transport proteins of NR are eliminated, an improved strain which is beneficial to NR accumulation is obtained, and the synthesis capability of NR is improved through over-expression of bacteria in-body source enzyme (ushA). 2g/L NR can be synthesized by using 1g/L nicotinamide on the shake flask level, and the conversion rate is more than 90%; at the level of a 5L fermentation tank, the concentration of the substrate is 15g/L, more than 20g/L NR can be obtained by the nicotinamide, the residual concentration of the substrate is 1g/L, and the conversion rate is more than 70%, so that the nicotinamide has industrial application potential.

Drawings

FIG. 1 is the identification of functional enzymes with the function of catalyzing the conversion of NAD derivatives to NR.

FIG. 2 is an LC-MS diagram of recombinant E.coli, control and standard.

FIG. 3 shows the effect of NR synthesis at different induction temperatures.

FIG. 4 shows the effect of NR synthesis at different IPTG concentrations.

FIG. 5 shows the effect of NR synthesis at various substrate nicotinamide addition concentrations.

FIG. 6 shows the effect of synthesis of NR from different recombinant strains.

FIG. 7 is a graph of NAD elimination ⁺ Effect of derivative transporter on NR production.

FIG. 8 shows the effect of producing NR at the 5L fermenter level by fed-batch.

FIG. 9 shows the effect of producing NR at the 5L fermenter level by fed-batch.

Detailed Description

Culture medium (one)

LB medium: 5g/L yeast extract powder, 10g/L peptone and 10g/L sodium chloride. 15g/L agar strips were added to prepare LB solid medium.

TB medium: 24g/L yeast extract powder, 12g/L peptone, 5g/L, K glycerol ₂ HPO ₄ 12.54g/L、KH ₂ PO ₄ 2.31g/L。

Fermentation medium 1: KH (KH) ₂ PO ₄ 6g/L～12g/L、K ₂ HPO ₄ 16 g/L-30 g/L, 5 g/L-10 g/L ammonium sulfate, 1 g/L-5 g/L, mgSO citric acid monohydrate ₄ .7H ₂ 1g/L to 5g/L of O, 10g/L to 30g/L of yeast powder and 15g/L to 50g/L of glucose.

Fermentation medium 2: KH (KH) ₂ PO ₄ 3g/L、K ₂ HPO ₄ 7.33g/L, 0.85g/L of citric acid, 15g/L of ammonium sulfate, 5mL of metal ion solution and 20g/L, mgSO of glucose ₄ .7H ₂ O1 g/L, yeast powder 5g/L and defoamer 0.01%.

Feed medium: glucose 700g/L, ammonium sulfate 73g/L, mgSO ₄ .7H ₂ O9 g/L, yeast powder 5g/L, metal ion solution 15mL and concentrated hydrochloric acid 1mL.

(II) solution

200g/L nicotinamide solution: 10g of nicotinamide was dissolved in 50mL of ultrapure water and sterilized by filtration.

Metal ion solution: 10g/L FeSO ₄ ·7H ₂ O，1.53g/L CaCl ₂ ，2.2g/L ZnSO ₄ ·7H ₂ O，MnSO4·4H ₂ O，1g/L CuSO ₄ ·5H ₂ O，0.1g/L(NH ₄ ) ₆ Mo ₇ O ₂₄ ·4H ₂ O，0.2g/L Na ₂ B ₄ O ₇ ·10H ₂ O，1g/L NiCl ₂ ，1g/L H ₃ BO ₃ 10mL/L HCl was used to formulate fermentation medium 2 and feed medium.

(III) HPLC detection of nicotinamide, NAD derivatives and NR: using a chromatographic column (250X 4.6mM,5 μm, thermo-Fisher, MA, USA), the detection conditions were carried out with an SPD-20A detector of Shimadzu, mobile phase 20mM ammonium acetate, containing 5% acetonitrile, at 30 ℃; flow rate: 1.0mL/min; detection wavelength: 259nm; column oven temperature: 30 ℃.

(IV) calculation of conversion rate: relative molecular mass of nicotinamide: 122, a step of; relative molecular mass of Nicotinamide Riboside (NR): 256. molar conversion (%) = (nicotinamide concentration +.122)/(NR/256) ×100%

And (V) a chemical conversion method of escherichia coli: e.coli JM109 is streaked on a solid LB plate and cultured for 12 hours at 37 ℃, single colony is selected and inoculated in a liquid LB culture medium, grown for 10 hours at 37 ℃ and 220r/min, transferred into a fresh 25mL liquid LB culture medium according to the inoculum size of 1 percent, cultured for 1.5 to 2 hours at 37 ℃, and the strain is subjected to OD ₆₀₀ Growing to 0.6-1, and collecting bacteria to prepare competent cells.

Preparation of E.coli competence A TaKaRa Competent Cell Preparation Kit competence preparation kit was used, and the specific procedure was described with reference to the use. The prepared competent cells are stored at-80 ℃ and can be transformed into plasmids or fragments and the like in the subsequent process.

And (six) plasmid assembly method: the Gibson reaction system was as follows, 50ng of DNA fragment was added, 100ng of vector was added, 5. Mu.L of Gibson mix was added, and sterile ultra-pure water was added to 10. Mu.L of the system. The reaction conditions were as follows, and the reaction was carried out at 50℃for 60 minutes, immediately after the completion of the reaction, on ice. mu.L was transformed into E.coli competent JM109.

The seamless cloning reaction system was as follows, 40ng of the target gene, 100ng of the vector was added, 5. Mu.L of the reaction enzyme mixture was added, and the mixture was supplemented to 10. Mu.L with sterile ultra-pure water. The reaction conditions were as follows, and the reaction was carried out at 50℃for 60 minutes, immediately after the completion of the reaction, on ice. mu.L was transformed into E.coli competent JM109.

(seventh) Strain

Recombinant E.coli F004 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR) are disclosed in the patent application publication No. CN 112795582A.

Example 1: construction of Gene expression vector related to Nicotinamide Nuclear glycoside Synthesis pathway

(1) Construction of VpNadV expression cassette

The VpNadV fragment was amplified by PCR using a VpNadV synthesis sequence (shown as SEQ ID NO. 1) as a template and a primer pair F1/R1, and Phanta Master mix (Vazyme Co.) was selected for amplification. Purifying the PCR product; vector pET-28a (+) is used as a template, a primer pair F2/R2 PCR is used for amplifying a vector fragment, and Phanta Master mix (Vazyme company) high-fidelity pfu enzyme is selected for amplification. The PCR product was subjected to product purification. The amplified fragments VpNadV and pET-28a (+) vector fragment are recombined into vector pET28a+VpNadV by a seamless cloning assembly method, and transformed into Escherichia coli JM109. The obtained vector is sent to Shanghai worker for sequencing, and the correct recombinant vector pET28a+VpNadV is obtained after the comparison is correct.

(2)NAD ⁺ Construction of derivative synthetic expression frame

A BaPRS synthetic sequence (shown as SEQ ID NO. 2) is used as a template, a primer pair F3/R3 is used for amplifying a BaPRS fragment by PCR, and Phanta Master mix (Vazyme company) high-fidelity pfu enzyme is selected for amplification. Purifying the PCR product; and (3) PCR amplifying the pET28a+VpNadV vector fragment by using the recombinant plasmid pET28a+VpNadV obtained in the step (1) as a template and using a primer pair F4/R4, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for amplification. The PCR product was subjected to product purification. The BaPRS fragment and pET28a+VpNadV vector fragment are recombined into a vector pET28a+BaPRS+VpNadV by a seamless cloning assembly method. And E.coli JM109 was transformed. The obtained vector is sent to Shanghai worker for sequencing, and the correct recombinant vector pET28a+BaPRS+VpNadV is obtained after the comparison is correct.

(3)NAD ⁺ Construction of expression frame of derivative transport vector

The BMpnuC fragment was amplified by PCR using a BMpnuC synthesis sequence (shown as SEQ ID NO. 3) as a template and a primer pair F5/R5, and Phanta Master mix (Vazyme Co.) was selected for amplification with high-fidelity pfu enzyme. Obtaining a gene BaPRS fragment, and purifying a PCR product; the vector pACYCDuet-1 is used as a template, a pACYCduet vector fragment is amplified by using a primer pair F6/R6, and the high-fidelity pfu enzyme of Phanta Master mix (Vazyme company) is selected for amplification. The PCR product was subjected to product purification. The BMpnuC fragment and the pACYCduet vector fragment are recombined into a vector pACYCduet+BMpnuC by a seamless cloning assembly method. And E.coli JM109 was transformed. The obtained vector is sent to Shanghai worker for sequencing, and the correct recombinant vector pACYCduet+BMpnuC is obtained after the comparison is correct.

(4) Construction of Nicotinamide Riboside (NR) synthetic expression cassette

The Escherichia coli K-12 genome is used as a template, a ushA gene fragment (shown as SEQ ID NO. 4) is amplified by PCR with a primer pair F7/R7, phanta Master mix (Vazyme company) high-fidelity pfu enzyme is selected for amplification, and the PCR product is purified. And (3) taking the recombinant plasmid pACYCDuet+BMpnuC constructed in the step (3) as a template, carrying out PCR amplification on pACYCduet+BMpnuC carrier fragments by using a primer pair F8/R8, and selecting Phanta Master mix (Vazyme company) for amplification. The PCR product was subjected to product purification. The fragment ushA gene fragment and the vector pACYCDuet+BMpnuC vector fragment were recombined into the vector pACYCDuet+ushA+BMpnuC by a seamless cloning assembly method. And E.coli JM109 was transformed. The obtained vector is sent to Shanghai worker for sequencing, and the correct recombinant vector pACYCDuet+ushA+BMpnuC is obtained after the comparison is correct.

TABLE 1 primer information

Example 2: high concentration NAD using NAD derivative transporter ⁺ Derivatives and their use as inhibitors of viral infection

NAD constructed in example 1 was expressed in strain F004 (E.coli. DELTA.pncΔnadR,. DELTA.purR,. DELTA.ushA, disclosed in the patent application publication No. CN 112795582A) ⁺ Derivative synthesis recombinant plasmid pET28a+BaPRS+VpNadV (disclosed in the patent application publication No. CN 112795582A) was obtained as recombinant strain NM001. pACYCDuet+BMpnuC constructed in example 1 is transformed into strain NM001 to obtain recombinant strain NM002 expressing transporter BMpnuC. Firstly streaking on LB solid plates containing resistance from-80 ℃, culturing overnight at 37 ℃, selecting single colony, inoculating in LB culture medium with corresponding resistance, culturing for 8-10 h at 37 ℃ and 220r/min, inoculating into fermentation culture medium 1 according to 1% transfer amount, and waiting for OD ₆₀₀ Cooling to 25 deg.c when reaching 0.6-1 deg.c, and adding 0.5mM IPTG to induce protein expression. The results show that shake flask levels can synthesize over 2.6g/L NAD derivatives by adding nicotinamide to fermentation medium 1 at a final concentration of 1 g/L. And adding 10g/L nicotinamide into the fermentation medium 1 at a 5L fermentation tank level to synthesize more than 20g/L Nicotinamide Mononucleotide (NMN), wherein the substrate is more than 3g/L, and the conversion rate is more than 60%.

Example 3: determination of genes catalyzing Nicotinamide riboside Synthesis

In order to screen more optimal 5 '-nucleotidase to catalyze the dephosphorylation of NAD derivative to generate Nicotinamide Riboside (NR), 5' -nucleotidase genes with different sources (comprising escherichia coli, bacillus subtilis and corynebacterium glutamicum) are respectively selected and connected to an expression vector pET-28a (+) to be expressed independently.

(1) Construction of ushA expression cassette

Using Escherichia coli K-12 genome as a template, performing PCR amplification of ushA fragment by using a primer pair F9/R9, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for performing under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 1min for 30 cycles; extending at 72deg.C for 5min. Purifying the PCR product; PCR amplifying the pET-28a (+) carrier fragment by using a carrier pET-28a (+) as a template and using a primer pair F10/R10, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for carrying out under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 3min for 30 cycles; extending at 72deg.C for 5min. The PCR product was subjected to product purification. The ushA fragment and pET-28a (+) vector fragment were recombined into the vector pET28a+ushA by a seamless cloning assembly method. And E.coli JM109 was transformed. The obtained vector is sent to Shanghai worker for sequencing, and the correct recombinant vector pET28a+ushA is obtained after the comparison is correct.

(2) Construction of the survivine expression cassette

Using the Escherichia coli K-12 genome as a template, carrying out PCR amplification on a survivinE fragment by using a primer pair F11/R11, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for carrying out under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 1min for 30 cycles; extending at 72deg.C for 5min. Purifying the PCR product; PCR amplifying the pET-28a (+) carrier fragment by using a carrier pET-28a (+) as a template and using a primer pair F12/R12, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for carrying out under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 3min for 30 cycles; extending at 72deg.C for 5min. The PCR product was subjected to product purification. The surviving E fragment and pET-28a (+) vector fragment were recombined into the vector pET28a+ surviving E by means of seamless cloning assembly. And E.coli JM109 was transformed. The obtained vector is sent to Shanghai worker for sequencing, and the correct recombinant vector pET28a+survivinE is obtained after the comparison is correct.

(3) Construction of yfrG expression cassette

Using the Escherichia coli K-12 genome as a template, carrying out PCR amplification on yfrG fragments by using a primer pair F13/R13, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for carrying out under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 1min for 30 cycles; extending at 72deg.C for 5min. Purifying the PCR product; PCR amplifying the pET-28a (+) carrier fragment by using a carrier pET-28a (+) as a template and using a primer pair F14/R14, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for carrying out under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 3min for 30 cycles; extending at 72deg.C for 5min. The PCR product was subjected to product purification. The yfrG fragment and pET-28a (+) vector fragment were recombined into vector pET28a+yfrg by a seamless cloning assembly method. And E.coli JM109 was transformed. The obtained vector is sent to Shanghai worker for sequencing, and the correct recombinant vector pET28a+yfrG is obtained after the comparison is correct.

(4) Construction of yjjG expression cassette

Performing PCR amplification on yjjG fragments by using an escherichia coli K-12 genome as a template and a primer pair F15/R15, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for performing under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 1min for 30 cycles; extending at 72deg.C for 5min. Purifying the PCR product; PCR amplifying the pET-28a (+) carrier fragment by using a carrier pET-28a (+) as a template and using a primer pair F16/R16, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for carrying out under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 3min for 30 cycles; extending at 72deg.C for 5min. The PCR product was subjected to product purification. The yjjG fragment and pET-28a (+) vector fragment were recombined into the vector pET28a+yjG by a seamless cloning assembly method. And E.coli JM109 was transformed. The obtained vector is sent to Shanghai worker for sequencing, and the correct recombinant vector pET28a+yjjG is obtained after the comparison is correct.

(5) Construction of CG0034 expression Box

The genome of corynebacterium glutamicum ATCC13032 is used as a template, a primer pair F16/R16 is used for PCR amplification of CG0034 gene fragments, and Phanta Master mix (Vazyme company) high-fidelity pfu enzyme is selected for carrying out under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 1min for 30 cycles; extending at 72deg.C for 5min. Purifying the PCR product; PCR amplifying the pET-28a (+) carrier fragment by using a carrier pET-28a (+) as a template and a primer pair F17/R17, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for carrying out under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 3min for 30 cycles; extending at 72deg.C for 5min. The PCR product was subjected to product purification. The CG0034 segment and pET-28a (+) vector segment are recombined into a vector pET28a+CG0034 by a seamless cloning assembly method. And E.coli JM109 was transformed. The obtained vector is sent to Shanghai worker for sequencing, and the correct recombinant vector pET28a+CG0034 is obtained after the comparison is correct.

(6) Construction of CG00397 expression frame

The CG00394 fragment is amplified by PCR with the Corynebacterium glutamicum ATCC 13032 genome as a template and the primer pair F18/R18, and the high-fidelity pfu enzyme of Phanta Master mix (Vazyme company) is selected for carrying out under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 1min for 30 cycles; extending at 72deg.C for 5min. Purifying the PCR product; PCR amplifying the pET-28a (+) carrier fragment by using a carrier pET-28a (+) as a template and a primer pair F19/R19, and selecting Phanta Master mix (Vazyme company) high-fidelity pfu enzyme for carrying out under the condition of pre-denaturation at 95 ℃ for 3min; the amplification stage was performed at 95℃for 15s,58℃for 15s,72℃for 3min for 30 cycles; extending at 72deg.C for 5min. The PCR product was subjected to product purification. The CG00394 fragment and the pET-28a (+) vector fragment are recombined into a vector pET28a+CG00397 by a seamless cloning assembly method. And E.coli JM109 was transformed. The obtained vector is sent to Shanghai worker for sequencing, and the correct recombinant vector pET28a+CG00397 is obtained after the comparison is correct.

The recombinant plasmids pET28a+ushA, pET28 a+survivinE, pET28a+yfrG, pET28a+yjjG, pET28a+CG0034 and pET28a+CG00397 constructed above are respectively transferred into recombinant escherichia coli F004 to respectively obtain NR001, NR002, NR003, NR004, NR005 and NR006. To verify the function of the enzyme gene, first streaked from-80℃onto LB solid plates containing resistance, Culturing overnight at 37deg.C, selecting single colony, inoculating into LB culture medium with corresponding resistance, culturing at 37deg.C and 220r/min for 8-10 hr, inoculating into fermentation culture medium 1 according to 1% transfer amount, and standing for OD ₆₀₀ At=0.6 to 1, the temperature was reduced to 25 ℃ and protein expression was induced by adding IPTG at a final concentration of 0.5 mM. After 12h, the cells were collected, washed 2 times with PBS buffer solution having pH=7.0, crushed by a homogenizer, and NAD derivative was added to the crushed cell solution at a final concentration of 1g/L, while Mg was added at a final concentration of 1g/L ²⁺ As can be seen from FIG. 1, only recombinant strain NR001 can degrade NAD derivative and has high catalytic activity, indicating that ushA derived from Escherichia coli has potential for synthesizing NR.

TABLE 2 primer information

Primer(s)	Sequence 5'-3'
		F9	AACTTTAAGAAGGAGATATACCATGAAATTATTGCAGCGGGGCG
R9	TTCGGGCTTTGTTACTGCCAGCTCACCTCACCT
		F10	GCTGGCAGTAACAAAGCCCGAAAGGAAGCTGAG
R10	CTGCAATAATTTCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGG
		F11	TAAGAAGGAGATATACCATGCGCATATTGCTGAGTAATGATGAC
R11	CTTTCGGGCTTTGTTACCATTGCGTGCCAACTCCC
		F12	CGCAATGGTAACAAAGCCCGAAAGGAAGCTGAG
R12	CAGCAATATGCGCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGG
		F13	ACTTTAAGAAGGAGATATACCATGCATATCAACATTGCCTGGCAG
R13	CTTTCGGGCTTTGTCACATTAGCGAGGGGATCAGG
		F14	CTCGCTAATGTGACAAAGCCCGAAAGGAAGCTGAGT
R14	CAATGTTGATATGCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG
		F15	AAGGAGATATACCATGAAGTGGGACTGGATTTTCTTTGATGC
R15	TCGGGCTTTGTCAGTGTTTACACAGGAGCTGCTCC
		F16	CTGTGTAAACACTGACAAAGCCCGAAAGGAAGCTGAGT
R16	CCAGTCCCACTTCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGG
		F17	GAAGGAGATATACCATGAAGAGGCTTTCCCGTGC
R17	TCCTTTCGGGCTTTGTTACATGAACTGCGCAAACATAGCCTG
		F18	CAGTTCATGTAACAAAGCCCGAAAGGAAGCTGAG
R18	GGGAAAGCCTCTTCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG
		F19	CAAATCTTTGCTTAACAAAGCCCGAAAGGAAGCTGAG
R19	AGTTTCCAGACTGCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG

Example 4: construction of a Strain conducive to Nicotinamide riboside biosynthesis

(1) Knock-out of the lytic gene DeoD

Knocking out a related enzyme gene DeoD involved in NR decomposition by using a CRISPR-Cas9 gene editing system, transferring a plasmid pCas9 containing Cas9 protein into competence of a strain F004 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR and ΔpurR) by a chemical conversion method, plating on a Kana-resistant plate, and culturing for 20h at 30 ℃ overnight; selecting single colony, inoculating in Kana-containing liquid LB, culturing at 30deg.C and 220r/min for 12 hr; 1-5% of inoculation amount by volume is transferred into fresh LB, and 10 g/L-50 g/L of A/L is added A arabinose; culturing at 30 deg.C for 1.5-2 hr until reaching OD ₆₀₀ When the ratio is=0.2, 10g/L to 50g/L of arabinose is added; continuing to culture until OD ₆₀₀ =0.6 to 1, and the bacterial harvesting preparation is electrotransport competent. Electrotransformation competent cells were washed twice with 10% sterile glycerol, resuspended with 10% glycerol and stored at-80 ℃.

The upstream fragment T-DeoD-UP of the homologous fragment T-DeoD was obtained by amplification with T-DeoD-1-F and T-DeoD-1-R, the downstream fragment T-DeoD-DN of the homologous fragment T-DeoD was obtained by amplification with T-DeoD-2-F and T-DeoD-2-R, and the homologous fragment T-DeoD was obtained by fusion PCR of the upstream fragment T-DeoD-UP and the downstream fragment T-DeoD-DN. The linear fragment of DeoD-sgRNA is obtained by amplifying DeoD-sgRNA-1-F and DeoD-sgRNA-1-R, and then transformed into E.coli JM109, and plasmid is extracted to obtain DeoD-sgRNA. Homologous fragments T-DeoD and DeoD-sgRNA were added to competent cells of strain F004 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR), gently mixed by blowing, and allowed to stand on ice for 20min. The mixture was then added to a 1mm electric beaker (as for pre-cooling on ice), 1.8kV was shocked for 5ms, and 1mL of pre-chilled LB liquid medium was added. After resuscitating for 1-2 hours at 30 ℃ and 220r/min by a shaking table, coating an LB plate added with corresponding antibiotics, and culturing for 24 hours at 30 ℃. Colony PCR was performed using the universal primer sgRNA-F (CTGTCCTTCTAGTGTAGCCGTAG) and the DeoD specific primer YAN-pncRNA-R (CGTTGTTCACTTCAACTAGTATTATACCTAGGAC), and positive transformants were selected to obtain strain F005 (E.coli BL21 (DE 3), ΔpncΔushA, ΔnadR, ΔpurR, ΔDeoD).

The obtained strain F005 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD) was subjected to the elimination of the plasmid used by the CRISPR-Cas9 system contained in the cells, comprising the following specific steps: bacterial strain F005 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD) was inoculated into liquid LB containing the corresponding resistance, IPTG was added at a final concentration of 0.5 mM-1 mM, the Cas9 protein was induced to cleave the plasmid DeoD-sgRNA, and after the completion of the elimination of the DeoD-sgRNA plasmid, pCas9 plasmid was continuously removed and inoculated into liquid LB medium without resistance at 42℃for 6 to 10 hours. After verification of pCas9 plasmid elimination, the strain was preserved at-80 ℃.

(2) Knockout transporter pnuC

Editing lines using CRISPR-Cas9 genesKnocking out the transporter pnuC gene, transferring the plasmid pCas9 containing the Cas9 protein into the competence of the strain F005 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR and ΔDeoD) constructed in the step (1) by a chemical conversion method, plating on a Kana-resistant plate, and culturing for 20h at 30 ℃ overnight; selecting single colony, inoculating in Kana-containing liquid LB, culturing at 30deg.C and 220r/min for 12 hr; transferring 1-5% of inoculation amount to fresh LB according to the volume, and simultaneously adding 10-50 g/L of arabinose; culturing at 30 deg.c for 1.5-2 hr until OD ₆₀₀ When the ratio is=0.2, 10g/L to 50g/L of arabinose is added; continuing to culture until OD ₆₀₀ Cells were collected and made electrically competent in=0.6 to 1. Electrotransformation competent cells were washed twice with 10% sterile glycerol, resuspended with 10% glycerol and stored at-80 ℃.

Constructing homologous fragment T-pnuC and pnuC-sgRNA plasmids according to the same strategy in the step (1), adding the homologous fragment T-pnuC and pnuC-sgRNA plasmids into competent cells of the strain F005, gently beating and mixing, and standing on ice for 20min. The mixture was then added to a 1mm electric beaker (as for pre-cooling on ice), 1.8kV was shocked for 5ms, and 1mL of pre-chilled LB liquid medium was added. After resuscitating for 1-2 hours at 30 ℃ and 220r/min by a shaking table, coating an LB plate added with corresponding antibiotics, and culturing for 24 hours at 30 ℃. Colony PCR was performed using the universal primer sgRNA-F (CTGTCCTTCTAGTGTAGCCGTAG) and pnuC specific primer YAN-pnuC-sgRNA-R (TGGCAAGGCCAATACACACTAGTAT), and positive transformants were screened to give strain F007 (E.coli BL21 (DE 3), ΔpncΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC).

The plasmid pnuC-sgRNA used by CRISPR-Cas9 system contained in the cells of strain F007 (e.coli BL21 (DE 3), Δpncc, Δusha, Δnadr, Δpurr, Δdeod, Δpnuc) was eliminated, in particular by the following steps: strain F007 (e.coli BL21 (DE 3), Δpncc, Δusha, Δnadr, Δpurr, Δdeod, Δpnuc) was inoculated into liquid LB containing the corresponding resistance, IPTG was added at a final concentration of 0.5mM to 1mM, cas9 protein was induced to cleave the plasmid pnuC-sgRNA, pCas9 plasmid was continuously removed after complete elimination of pnuC-sgRNA plasmid was verified, inoculated into liquid LB medium without resistance, and cultured at 42 ℃ for 6 to 10 hours. After verification of pCas9 plasmid elimination, the strain was preserved at-80 ℃.

(3) Knock-out of the lytic gene rihA

Knocking out related enzyme genes by using a CRISPR-Cas9 gene editing system, transferring a plasmid pCas9 containing Cas9 protein into the competence of a strain F007 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD and Δpnuc) constructed in the step (2) by a chemical conversion method, plating on a Kana-resistant plate, and culturing overnight at 30 ℃ for 20 hours; selecting single colony, inoculating in Kana-containing liquid LB, culturing at 30deg.C and 220r/min for 12 hr; transferring 1-5% of inoculation amount to fresh LB according to the volume, and simultaneously adding 10-50 g/L of arabinose; culturing at 30 deg.c for 1.5-2 hr until OD ₆₀₀ When the ratio is=0.2, 10g/L to 50g/L of arabinose is added; continuing to culture until OD ₆₀₀ =0.6 to 1, and the bacterial harvesting preparation is electrotransport competent. Electrotransformation competent cells were washed twice with 10% sterile glycerol, resuspended with 10% glycerol and stored at-80 ℃.

The homologous fragments T-rihA and rihA-sgRNA plasmids were constructed according to the same strategy as in step (1), added to competent cells of strain F007 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, Δpnuc) and gently mixed by blowing and standing on ice for 20min. The mixture was then added to a 1mm electric beaker (as for pre-cooling on ice), 1.8kV was shocked for 5ms, and 1mL of pre-chilled LB liquid medium was added. After resuscitating for 1-2 hours at 30 ℃ and 220r/min by a shaking table, coating an LB plate added with corresponding antibiotics, and culturing for 24 hours at 30 ℃. Colony PCR was performed using the universal primer sgRNA-F (CTGTCCTTCTAGTGTAGCCGTAG) and the rihA specific primer YAN-rihA-sgRNA-R (GTCGCAATCTAACAGAATACTAGTATTATACCTAGG), and positive transformants were screened to obtain strain F008 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, Δpnuc, ΔrihA).

The obtained strain F008 (E.coli BL21 (DE 3), ΔpncΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC, ΔrihA) was subjected to the elimination of the rihA-sgRNA plasmid of the CRISPR-Cas9 system contained in the cells, specifically comprising the steps of: when the strain F008 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC, ΔrihA) is inoculated to liquid LB with corresponding resistance, IPTG with the final concentration of 0.5 mM-1 mM is added to induce Cas9 protein to cleave the plasmid rihA-sgRNA, and after the completion of the elimination of the rihA-sgRNA plasmid, pCas9 plasmid is continuously removed and inoculated to liquid LB medium without resistance, and the culture is continued for 6-10 hours at 42 ℃. After verification of pCas9 plasmid elimination, the strain was preserved at-80 ℃.

(4) Knock out of the lytic gene rihB

Knocking out a decomposing gene rihB by using a CRISPR-Cas9 gene editing system, transferring a plasmid pCas9 containing Cas9 protein into a strain F008 (E.coli BL21 (DE 3)) constructed in the step (3) by a chemical conversion method, wherein the competence of DeltapncA, deltaushA, deltanadR, deltapurR, deltaDeoD, deltapnuC and DeltarilhA is achieved, plating on a Kana-resistant plate, and culturing for 20h at 30 ℃ overnight; selecting single colony, inoculating in Kana-containing liquid LB, culturing at 30deg.C and 220r/min for 12 hr; transferring 1-5% of inoculation amount to fresh LB according to the volume, and simultaneously adding 10-50 g/L of arabinose; culturing at 30 deg.c for 1.5-2 hr until OD ₆₀₀ When the length is 0.2, adding 1 to 5 percent of arabinose; continuing to culture until OD ₆₀₀ =0.6 to 1, and the bacterial harvesting preparation is electrotransport competent. Electrotransformation competent cells were washed twice with 10% sterile glycerol, resuspended with 10% glycerol and stored at-80 ℃.

The homologous fragments T-rihB and rihB-sgRNA plasmids were constructed according to the same strategy as in step (1), added to competent cells of strain F008 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC, ΔrihA) and gently mixed by blowing and standing on ice for 20min. The mixture was then added to a 1mm electric beaker (as for pre-cooling on ice), 1.8kV was shocked for 5ms, and 1mL of pre-chilled LB liquid medium was added. After resuscitating for 1-2 hours at 30 ℃ and 220r/min by a shaking table, coating an LB plate added with corresponding antibiotics, and culturing for 24 hours at 30 ℃. Colony PCR was performed using the universal primer sgRNA-F (CTGTCCTTCTAGTGTAGCCGTAG) and the rihA specific primer YAN-rihB-sgRNA-R (GTTTCGCTGCCATCATCACTAGT), and positive transformants were screened to obtain strain F009 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, Δpnuc, ΔrihA, ΔrihB).

The F009 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC, ΔrihA, ΔrihB) strain was engineered and used as a chassis strain for subsequent fermentation, requiring the removal of the plasmid used by the intracellular-contained CRISPR-Cas9 system. Eliminating rihB-sgRNA in the strain, which comprises the following specific steps: f009 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC, ΔrihA, ΔrihB) was inoculated into liquid LB containing the corresponding resistance, and the final concentration of 0.5 mM-1 mM IPTG was added to induce Cas9 protein to cleave the plasmid rihB-sgRNA, and after completion of the elimination of the rihB-sgRNA plasmid, pCas9 plasmid was continuously removed and inoculated into liquid LB medium without resistance at 42℃for 6 to 10 hours. After verification of pCas9 plasmid elimination, the strain was preserved at-80 ℃.

(5) Knockout of the lytic gene rilc

Knocking out a decomposition gene rilc by using a CRISPR-Cas9 gene editing system, transferring a plasmid pCas9 containing Cas9 protein into a strain F009 (E.coli BL21 (DE 3)), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC, ΔrilhA and ΔrilhB constructed in the step (4) by a chemical conversion method, plating on a Kana-resistant plate, and culturing overnight at 30 ℃ for 20 hours; selecting single colony, inoculating in Kana-containing liquid LB, culturing at 30deg.C and 220r/min for 12 hr; transferring 1-5% of inoculation amount to fresh LB according to the volume, and simultaneously adding 10-50 g/L of arabinose; culturing at 30 deg.c for 1.5-2 hr until OD ₆₀₀ When the length is 0.2, 10 g/L-50 g/L of arabinose is added; continuing to culture until OD ₆₀₀ =0.6 to 1, and the bacterial harvesting preparation is electrotransport competent. Electrotransformation competent cells were washed twice with 10% sterile glycerol, resuspended with 10% glycerol and stored at-80 ℃.

The homologous fragments T-rihC and rihC-sgRNA plasmids were constructed according to the same strategy as in step (1), added to competent cells of strain F009 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC, ΔrihA, ΔrihB), gently swirled, mixed, and allowed to stand on ice for 20min. The mixture was then added to a 1mm electric beaker (as for pre-cooling on ice), 1.8kV was shocked for 5ms, and 1mL of pre-chilled LB liquid medium was added. After resuscitating for 1-2 hours at 30 ℃ and 220r/min by a shaking table, coating an LB plate added with corresponding antibiotics, and culturing for 24 hours at 30 ℃. Colony PCR was performed using the universal primer sgRNA-F (CTGTCCTTCTAGTGTAGCCGTAG) and the rihA specific primer YAN-rihC-sgRNA-R (TTGCCGTGCACAGATGCA), and positive transformants were screened to give strain F010 (E.coli BL21 (DE 3), ΔpncΔushA, ΔnadR, ΔpurR, ΔDeoD, Δpnuc, ΔrihA, ΔrihB, ΔrihC).

The obtained plasmid rihC-sgrnas used by the CRISPR-Cas9 system contained in the cells of strain F010 (e.coll BL21 (DE 3), Δpncc, Δusha, Δnadr, Δpurr, Δdeod, Δpnuc, Δriha, Δrihb, Δrihc) were eliminated, in particular by the steps of: f010 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC, ΔrihA, ΔrihB, ΔrihC) was inoculated into liquid LB containing the corresponding resistance, and the final concentration of 0.5 mM-1 mM IPTG was added to induce the Cas9 protein to cleave the plasmid rihC-sgRNA, and after completion of the elimination of the rihC-sgRNA plasmid, pCas9 plasmid was continuously removed and inoculated into liquid LB medium without resistance at 42℃for 6 to 10 hours. After verification of pCas9 plasmid elimination, the strain was preserved at-80 ℃.

TABLE 3 primer information

Example 5: verification of Nicotinamide Nuclear glycoside biosynthesis Capacity

In the presence of NAD ⁺ On the basis of the strain with the derivative synthesis capability, after eliminating NR degradation and transport paths, endogenous 5' -nucleotidase (ushA) is enhanced, and NAD is overexpressed ⁺ Derivative transporter proteins that facilitate the synthesis of NAD ⁺ The derivative is transported and accumulated extracellular. NAD constructed as in example 1 was used as host bacteria with F010 E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC, ΔrihA, ΔrihB, and ΔrihC constructed in example 4 ⁺ The derivative synthetic plasmid pET28a+BaPRS+VpNadV and the NR synthetic plasmid pACYCDuet+ushA+BMpnuC are transformed into host bacteria to obtain a recombinant strain NR007.

To verify the ability of recombinant strain NR007 to synthesize NR, recombinant strain NR007 was streaked onto appropriately resistant LB solid plates and incubated overnight at 37 ℃; selecting single colony for inoculationCulturing in LB culture medium with corresponding resistance at 37 deg.C and 220r/min for 10-12 hr; transferring to 30mL fermentation medium 1 according to 2% transfer amount, culturing at 37deg.C to OD ₆₀₀ When the temperature is 0.6-1.0, the temperature is reduced to 25 ℃. Adding 0.2-0.5 mM IPTG, adding 1-3 g/L nicotinamide, sampling at regular time, and detecting the synthesis condition of NR by HPLC.

The results showed that the absorption peak in the sample was found to be consistent with the peak time of the standard NR in the HPLC test, and to further verify whether the sample was synthesized or not, the sample was subjected to LC-MS verification, and as shown in FIG. 2, the synthesis of NR was confirmed in the sample, and the extracellular accumulation of NR was induced for 24 hours to 700mg/L at a substrate nicotinamide concentration of 1 g/L.

Example 6: optimization of shake flask horizontal NR synthesis conditions

To further increase the amount of NR synthesis and increase the conversion rate, the recombinant strain NR007 constructed in example 5 and having the ability to synthesize NR was taken as an example, and the conditions of the NR fermentation process were optimized at the shake flask level, and mainly comprised of induction temperature, IPTG concentration, substrate addition concentration, and substrate addition mode.

(1) Influence of the Induction temperature on NR Synthesis

The recombinant strain NR007 constructed in example 5 was streaked onto LB solid plates of appropriate resistance and cultured overnight at 37 ℃; selecting single colony to inoculate in LB culture medium with resistance to Carna and streptomycin, culturing for 10-12 h at 37 ℃ and 220 r/min; transferring to 30mL fermentation medium 1 according to 2% transfer amount, culturing at 37deg.C to OD ₆₀₀ At 0.6 to 1.0, protein expression was induced at different temperatures (37 ℃ C., 30 ℃ C., 25 ℃ C.). Adding 0.2-0.5 mM IPTG and 1-3 g/L nicotinamide, sampling at regular time, and detecting the synthesis condition of NR by HPLC. As a result, as shown in FIG. 3, at a substrate nicotinamide concentration of 1g/L, NR 844mg/L could be synthesized at 30℃for 24 hours, which was 5.7% and 4.2% higher than 25℃and 37℃respectively, indicating that 30℃is more favorable for NR synthesis.

(2) Effect of IPTG concentration on NR Synthesis

The recombinant strain NR007 constructed in example 5 was streaked onto LB solid plates of appropriate resistance and cultured overnight at 37 ℃; pick sheetInoculating the bacterial colony into LB culture medium containing the resistance of the kana and the streptomycin, and culturing for 10-12 h at 37 ℃ and 220 r/min; transferring to 30mL fermentation medium 1 according to 2% transfer amount, culturing at 37deg.C to OD ₆₀₀ At 0.6-1.0, protein expression is induced at 30 ℃. IPTG with different final concentrations (0.2, 0.5 and 1.0 mM) and nicotinamide with a final concentration of 1-3 g/L are added respectively, sampling is carried out at fixed time, and the synthesis condition of NR is detected by HPLC. As shown in FIG. 4, NR 863mg/L was synthesized by induction with 0.5mM IPTG at a final concentration of 0.5mM under the condition of addition of 1g/L of nicotinamide as a substrate and an induction temperature of 30℃for 24 hours, and the synthesis capacities were improved by 19% and 6.5% respectively as compared with the final concentrations of 0.2 and 1.0mM IPTG.

(3) Effect of substrate addition on NR Synthesis amount

The recombinant strain NR007 constructed in example 5 was streaked onto LB solid plates of appropriate resistance and cultured overnight at 37 ℃; selecting single colony to inoculate in LB culture medium containing kana and streptomycin, culturing for 10-12 h at 37 ℃ and 220 r/min; transferring to 30mL fermentation medium 1 according to 2% transfer amount, culturing at 37deg.C to OD ₆₀₀ At 0.6-1.0, protein expression is induced at 30 ℃. Adding 0.5mM IPTG, respectively adding nicotinamide with different final concentrations (0.2, 0.5, 1.0, 2.0, 5.0 and 10.0 g/L), sampling at fixed time, and detecting the synthesis condition of NR by HPLC. As a result, as shown in FIG. 5, the yield of the bacterial NR was higher at a nicotinamide concentration of 1g/L, NR 871mg/L could be synthesized, and the molar conversion rate could reach 41.3%, possibly because too high nicotinamide was not favorable for obtaining higher concentration NR.

(4) Influence of the substrate addition mode on the amount of NR synthesized

Recombinant strain NR007 constructed in example 5 was streaked onto LB solid plates of appropriate resistance (Canada and streptomycin) and incubated overnight at 37 ℃; selecting single colony, inoculating in LB culture medium containing Canna and streptomycin resistance, and culturing at 37deg.C and 220rpm/min for 10-12 hr; transferring to 30mL fermentation medium 1 according to 2% transfer amount, culturing at 37deg.C to OD ₆₀₀ Protein expression was induced by addition of 0.5mM IPTG at a final concentration of 0.6-1.0 at 30 ℃. Nicotinamide was added in different ways, respectively:

group 1: adding nicotinamide with a final concentration of 1g/L at a time;

group 2: adding the nicotinamide twice, and adding the nicotinamide once every two hours from the time of adding the inducer, so that the final concentration of the nicotinamide is 500mg/L after each addition;

group 3: the addition was performed in four portions, with one nicotinamide addition per hour since the inducer addition, so that the final nicotinamide concentration was 250mg/L after each addition.

Samples were taken at regular time and HPLC was used to detect NR synthesis. The result shows that the nicotinamide is added in four times, the final concentration is 250mg/L in each hour, the NR synthesis amount of the recombinant strain NR007 is higher, and the NR yield can reach 980mg/L after 24 hours of induction.

Example 7: regulating gene expression intensity to improve NR synthesis ability

Recombinant strains were constructed according to the strategy of examples 1 to 4, except that NAD was added to the strain NR007 as shown in Table 5 ⁺ The derivative synthetic plasmid was changed from pET28a to pRSFDuet-1 and/or the transporter and NR synthetic plasmid was changed from pACYCDuet-1 to pCDFDuet-1, and the obtained recombinant strain was named NR008, NR009, NR010.

Streaking the recombinant strain on LB solid plates with proper resistance, and culturing overnight at 37 ℃; selecting single colony to inoculate in LB culture medium with corresponding resistance, culturing for 10-12 h at 37 ℃ and 220 r/min; transferring to 30mL fermentation medium 1 according to 2% transfer amount, culturing at 37deg.C to OD ₆₀₀ At 0.6-1.0, protein expression is induced at 30 ℃. The final concentration of 0.5mM IPTG was added and nicotinamide was added in four portions, 250mg/L final concentration was added every hour, samples were taken at regular time, and the synthesis of NR was examined by HPLC. As shown in FIG. 6, after 24 hours of induction, recombinant strains NR007-NR010 can accumulate 971mg/L, 951mg/L, 1031mg/L and 1096mg/L, respectively, and the recombinant strain NR010 is stronger in NR synthesis capacity, and is improved by 12.9%, 15.2% and 6.3% compared with NR007, NR008 and NR009, respectively. The recombinant strain NR010 increased the copy number of the NR synthetic plasmid compared to NR007, indicating that increasing the expression capacity of the NR synthetic plasmid is more conducive to extracellular accumulation of NR.

TABLE 4 recombinant bacteria and plasmid information

Recombinant bacterium designation	Comprising plasmids
		NR007	pET28a+BaPRS+VpNadV，pACYCDuet+ushA+BMpnuC
NR008	pRSFDuet+BaPRS+VpNadV，pACYCDuet+ushA+BMpnuC
		NR009	pRSFDuet+BaPRS+VpNadV，pCDFDuet+ushA+BMpnuC
NR010	pET28a+BaPRS+VpNadV，pCDFDuet+ushA+BMpnuC

Example 8: NAD elimination ⁺ Derivative transporter further increases NR extracellular synthesis

BMpnuc as NAD ⁺ Transport proteins of derivatives which are effective in converting intracellular NAD ⁺ The derivative is transported to the outside of the cell. However, the metabolic burden of the cells was increased, and the effect of BMpnuC on NR biosynthesis was confirmed. BMpnuC in the recombinant plasmid pCDFDuet+ushA+BMpnuC was removed by PCR to obtain recombinant plasmid pCDFDuet+ushA, NAD constructed in example 1 ⁺ The derivative synthetic plasmids pET28a+BaPRS+VpNadV and the NR synthetic plasmid pCDFDuet+ushA were transformed into F010 (E.coli BL21 (DE 3), ΔpncC, ΔushA, ΔnadR, ΔpurR, ΔDeoD, ΔpnuC, ΔrilA, ΔrilhB, ΔrilhC) to obtain a recombinant strain NR011.

Recombinant strain NR011 was streaked onto LB solid plates of appropriate resistance and cultured overnight at 37 ℃; pick sheetInoculating the bacterial colony into LB culture medium with corresponding resistance, culturing for 10-12 h at 37 ℃ and 220 r/min; transferring to 30mL fermentation medium 1 according to 2% transfer amount, culturing at 37deg.C to OD ₆₀₀ At 0.6-1.0, protein expression is induced at 30 ℃. The final concentration of 0.5mM IPTG was added, 1.0g/L nicotinamide was added, samples were taken at regular intervals, and the synthesis of NR was checked by HPLC. As shown in FIG. 7, the recombinant strain NR011 is stronger in NR synthesis capacity, 1610mg/L NR can be synthesized, and the extracellular synthesis amount of NR is increased by 43.4%. Description of NAD ⁺ Derivative transporters do not play a positive role in NR synthesis, but rather inhibit NR biosynthesis due to increased metabolic pressure.

Example 9: synthesis of NR by expansion culture of Strain NR004

To further increase the yield of NR, an expansion culture was performed using a 5L fermenter. Under the condition of larger fermentation scale, controlling pH, dissolved oxygen, biomass concentration and the like in the fermentation process, so that the growth environment of thalli is better, and higher NR yield is obtained. NR011 constructed in example 8 was streaked from glycerol tubes onto plates containing the corresponding resistance, incubated at 37℃for 12h; selecting single colony, inoculating in corresponding liquid LB, culturing at 37 deg.C and 220r/min for 10 hr, transferring to fermentation tank containing 5L fermentation medium 2 according to 5-20% transferring amount, and initially: the pH is controlled to be 6.0-7.0 by 35% ammonia water, the ventilation rate is 1 vvm-2 vvm, the rotation speed is 300 r/min-1000 r/min, the association with dissolved oxygen DO is controlled to be 30-50%, and the concentration of glucose is controlled to be below 5g/L by a feed medium. When DO rebound occurs, the temperature is reduced to 25-30 ℃ and induced by 0.5-1 mM IPTG, and nicotinamide with a final concentration of 2g/L (total 10 g/L) is added in the induction for 0h, 2h, 4h, 6h and 8h respectively. The supernatant was centrifuged and the yield concentration was measured by HPLC. The results show (FIG. 8), the accumulated NR can reach more than 9g/L after 40h of induction, the accumulated NR is basically stable, and the OD reaches 20-40.

Example 10: synthesis of NR by expansion culture of Strain NR004

The specific embodiment differs from example 9 in that the concentration of nicotinamide is controlled to be maintained at a relatively low concentration (< 3 g/L) by feeding the substrate nicotinamide in a fed-batch manner while IPTG is induced. As shown in FIG. 9, the accumulated NR amount can reach over 20g/L after 40h of induction, the accumulated extracellular NR amount is basically stable after 48h of fermentation, and the OD reaches 20-40.

While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of Jiangnan

<120> a recombinant bacterium producing nicotinamide riboside

<130> BAA220169A

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1494

<212> DNA

<213> artificial sequence

<400> 1

atgggcctga acctgaacca gaacatcgcg atcgcgaccg atagctacaa agtttctcac 60

tggtctcagt tcccgcgtgg tctggaatac tctcagtact atgttgaatc tcgtggcggt 120

aaattcgata aaatcatggt tgacggcatg gcgtatatgt gtcgtatcct ggaaaaaggt 180

gtgagcatga acgatgttaa acgtgcaaaa cgcctgttca aaaaacactt cggtagcgaa 240

gttttcaacg ataaaggttg ggatatcatc gttaacgaac tgaaaggtaa actgccgatc 300

aaaatccgtg cggtgaaaga aggtaccgtt gttccggtga aacacccgat cctgaccatc 360

gaaaacaccg atccgcgttt cggttggctg ccgggctacc tggaaacctt catcctgcgt 420

gcgctgtggt acccgaccac cgttgccacc atcagcttcg aagtgaagaa aattatccgt 480

cagttcatga agaaaaccgt tgatgatgaa cgtatcgcag aacaggaacc gttcaaactg 540

catgatttcg gtagccgtgg cgttagctct ggtgaatctg cggcgatcgg tggtagcgcg 600

cacctgaaaa acttcctggg taccgatacc gttgaagcgt tagtggcggt tgaagaactg 660

tatgcggaag acgttgaaga tttcatcgcg ggtttctcca ttccggcgcg tgaacacagc 720

accaccacca tctataaaga agcgggtgaa gatcaggcgt tcctgaactc tattgaacag 780

tggggtgcgg cgctgtacgc gtgcgtgatg gattcttacg attacgaagc ggcgatgaac 840

cgtgtttcta ccggccgttt caaagaactg attatctcca aaggtggcac cttcgttgcg 900

cgtccggatt ctggcgtgcc ggttgatgtt gttatgaaag gtctggaaat cctgggtaaa 960

aacgttggtt acaccatcaa ctctaaaggt tacaaagttc tgcacccgtc ttaccgtatc 1020

atccagggtg atggcgttaa catcgaagaa attcgtcgta tcctgagcta catggaatct 1080

aaaggttgga gcgctgaaaa catcgcgttc ggcatgggcg gcggcctgct gcagcagctg 1140

gatcgtgaca cccagcgttt cgcgatgaaa atgtctgcgg cgatcatcaa cggtgaatat 1200

gtttccgttt tcaaaatgcc gaaaactgat ccgaccaaag cgtctaaagc gggctttctg 1260

gacctgatcg cggttgatgc ggataacccg aacccggcgg cgcgtggtta tgttaccttc 1320

agctctgaag attacgataa ccgtgttcac ccgaaatccg ttatgcagac catcttcgaa 1380

gatggcgtta ccgtggcaga tttcagcctg gaagaagctc gtaaactgtc tgacgttcag 1440

gctgacttcc tgaacgaagg tgaatggaaa atcgcgaaaa agatccagac cgcg 1494

<210> 2

<211> 954

<212> DNA

<213> artificial sequence

<400> 2

atgagcaacg aatacggcga caagaatctg aagatcttca gcctcaacag caatccagaa 60

ctggccaaag agatcgccga caacgttggc gtgcagctgg gcaaatgcag cgttacccgc 120

ttcagcgatg gtgaggtgca gatcaacatc gaggagagca tccgtggctg cgactgctac 180

atcatccaga gcaccagtgc cccggtgaac gagcacatca tggagctgct catcatggtt 240

gacgcgctga aacgtgccag cgcgaaaacg atcaacatcg tgatcccgta ctacggctac 300

gcgcgccaag atcgtaaagc gcgcagtcgc gagccgatta ccgcgaagct gttcgccaat 360

ctgctggaaa ccgccggtgc gacccgtgtt attgcgctgg acatccacgc cccgcagatc 420

caaggctttt tcgacatccc gattgaccat ctgatgggcg tgccgattct gggccactac 480

ttcgagggca aggatctgaa ggatatcgtg atcgtgagcc cggatcatgg cggtgttacc 540

cgtgcgcgca aactcgccga tcgtctgaaa gcgccgatcg cgatcatcga caagcgccgt 600

ccgcgtccga atgaggttga ggtgatgaac atcgtgggca acgttgaagg caagacggcc 660

atcctcatcg acgacatcat tgacacggcg ggtacgatca cgctggccgc caatgcgctc 720

gtggaaaacg gcgcggcgga agtgtatgcg tgctgcaccc acccagttct gagtggccca 780

gcggttgagc gcatcaataa cagtaagatc aaggagctgg tggtgacgaa cagcatcaag 840

ctgccggaag agaaaaagat cgaacgcttc aaacaactca gcgtgggtcc actgctcgcg 900

gaagccatta tccgcgtgca cgagaaacag agcgtgagct atctgttcag ctaa 954

<210> 3

<211> 648

<212> DNA

<213> artificial sequence

<400> 3

atggtgcgca gcccgctgtt tctgctgatt agcagcatta tttgcattct ggtgggcttt 60

tatattcgca gcagctatat tgaaattttt gcgagcgtga tgggcattat taacgtgtgg 120

ctgctggcgc gcgaaaaagt gagcaacttt ctgtttggca tgattaccgt ggcggtgttt 180

ctgtatattt ttaccaccca aggcctgtat gcgatggcgg tgctggcggc gtttcagttt 240

atttttaacg tgtatggctg gtattattgg attgcgcgca gcggcgaaga aaaagtgaaa 300

ccgaccgtgc gcctggatct gaaaggctgg attatttata ttctgtttat tctggtggcg 360

tggattggct ggggctatta tcaagtgcgc tatctggaaa gcaccaaccc gtatctggat 420

gcgctgaacg cggtgctggg cctggtggcg cagtttatgc tgagccgcaa aattctggaa 480

aactggcatc tgtggattct gtataacatt gtgagcattg tgatttatat tagcaccggc 540

ctgtatgtga tgctggtgct ggcgattatt aacctgtttc tgtgcattga tggcctgctg 600

gaatggaaaa aaaaccataa agaacgcgaa cgcgtgaaca actatatt 648

<210> 4

<211> 1653

<212> DNA

<213> artificial sequence

<400> 4

atgaaattat tgcagcgggg cgtggcgtta gcgctgttaa ccacatttac actggcgagt 60

gaaactgctc tggcgtatga gcaggataaa acctacaaaa ttacagttct gcataccaat 120

gatcatcatg ggcatttttg gcgcaatgaa tatggcgaat atggtctggc ggcgcaaaaa 180

acgctggtgg atggtatccg caaagaggtt gcggctgaag gcggtagcgt gctgctactt 240

tccggtggcg acattaacac tggcgtgccc gagtctgact tacaggatgc cgaacctgat 300

tttcgcggta tgaatctggt gggctatgac gcgatggcga tcggtaatca tgaatttgat 360

aatccgctca ccgtattacg ccagcaggaa aagtgggcca agttcccgtt gctttccgcg 420

aatatctacc agaaaagtac tggcgagcgc ctgtttaaac cgtgggcgct gtttaagcgt 480

caggatctga aaattgccgt tattgggctg acaaccgatg acacagcaaa aattggtaac 540

ccggaatact tcactgatat cgaatttcgt aagcccgccg atgaagcgaa gctggtgatt 600

caggagctgc aacagacaga aaagccagac attattatcg cggcgaccca tatggggcat 660

tacgataatg gtgagcacgg ctctaacgca ccgggcgatg tggagatggc acgcgcgctg 720

cctgccggat cgctggcgat gatcgtcggt ggtcactcgc aagatccggt ctgcatggcg 780

gcagaaaaca aaaaacaggt cgattacgtg ccgggtacgc catgcaaacc agatcaacaa 840

aacggcatct ggattgtgca ggcgcatgag tggggcaaat acgtgggacg ggctgatttt 900

gagtttcgta atggcgaaat gaaaatggtt aactaccagc tgattccggt gaacctgaag 960

aagaaagtga cctgggaaga cgggaaaagc gagcgcgtgc tttacactcc tgaaatcgct 1020

gaaaaccagc aaatgatctc gctgttatca ccgttccaga acaaaggcaa agcgcagctg 1080

gaagtgaaaa taggcgaaac caatggtcgt ctggaaggcg atcgtgacaa agtgcgtttt 1140

gtacagacca atatggggcg gttgattctg gcagcccaaa tggatcgcac tggtgccgac 1200

tttgcggtga tgagcggagg cggaattcgt gattctatcg aagcaggcga tatcagctat 1260

aaaaacgtgc tgaaagtgca gccattcggc aatgtggtgg tgtatgccga catgaccggt 1320

aaagaggtga ttgattacct gaccgccgtc gcgcagatga agccagattc aggtgcctac 1380

ccgcaatttg ccaacgttag ctttgtggcg aaagacggca aactgaacga ccttaaaatc 1440

aaaggcgaac cggtcgatcc ggcgaaaact taccgtatgg cgacattaaa cttcaatgcc 1500

accggcggtg atggatatcc gcgccttgat aacaaaccgg gctatgtgaa taccggcttt 1560

attgatgccg aagtgctgaa agcgtatatc cagaaaagct cgccgctgga tgtgagtgtt 1620

tatgaaccga aaggtgaggt gagctggcag taa 1653

Claims (11)

1. A recombinant strain capable of synthesizing nicotinamide riboside by utilizing nicotinamide is characterized in that a 5' -nucleotidase gene is overexpressed on the basis of an original strainushA、Nicotinamide phosphoribosyl transferase geneVpNadVAnd PRPP synthase geneBaPRSAnd knocking out purine nucleoside phosphatase geneDeoDNicotinamide riboside transporter genes pnuCPyrimidine-specific ribonucleoside hydrolasesGenerihAPyrimidine-specific ribonucleoside hydrolase genesrihBAnd ribonucleoside hydrolase generihCThe method comprises the steps of carrying out a first treatment on the surface of the The original strain is knocked outpncC、ushA、nadR、purRColi BL21 (DE 3) of the gene;

the geneVpNadVThe nucleotide sequence of the gene is shown as SEQ ID NO.1BaPRSThe nucleotide sequence of the gene is shown as SEQ ID NO.2DeoDThe nucleotide sequence of (a) is shown as Gene ID 945654, the GenepnuCThe nucleotide sequence of (a) is shown as Gene ID 945350, the GenerihAThe nucleotide sequence of (a) is shown as Gene ID 945503, the GenerihBThe nucleotide sequence of (a) is shown as Gene ID 946646, the GenerihCThe nucleotide sequence of (a) is shown as Gene ID 944796; geneushAThe nucleotide sequence of (2) is shown as SEQ ID NO. 4;

the geneVpNadVSum geneBaPRSExpression with plasmid pET28a or pRSFDuet;

the geneushAExpressed with plasmid pACYCDuet-1 or pCDFDuet.

2. The recombinant bacterium according to claim 1, wherein pACYCDuet-1 or pCDFDuet is used as a vector for expressionushAGene and geneBMpnuCA gene; the saidBMpnuCThe nucleotide sequence of the gene is shown as SEQ ID NO. 3.

3. A method for promoting recombinant escherichia coli to synthesize nicotinamide riboside is characterized in that a 5' -nucleotidase gene is overexpressed on the basis of an original strain ushA、Nicotinamide phosphoribosyl transferase geneVpNadVAnd PRPP synthase geneBaPRSAnd knocking out purine nucleoside phosphatase geneDeoDNicotinamide riboside transporter genespnuCPyrimidine-specific ribonucleoside hydrolase genesrihAPyrimidine-specific ribonucleoside hydrolase genesrihBAnd ribonucleoside hydrolase generihCThe method comprises the steps of carrying out a first treatment on the surface of the The original strain is knocked outpncC、ushA、nadR、purRColi BL21 (DE 3) of the gene;

the geneVpNadVThe nucleotide sequence of the polypeptide is shown as SEQ ID NO.1The geneBaPRSThe nucleotide sequence of the gene is shown as SEQ ID NO.2DeoDThe nucleotide sequence of (a) is shown as Gene ID 945654, the GenepnuCThe nucleotide sequence of (a) is shown as Gene ID 945350, the GenerihAThe nucleotide sequence of (a) is shown as Gene ID 945503, the GenerihBThe nucleotide sequence of (a) is shown as Gene ID 946646, the GenerihCThe nucleotide sequence of (a) is shown as Gene ID 944796; geneushAThe nucleotide sequence of (2) is shown as SEQ ID NO. 4;

the geneVpNadVSum geneBaPRSExpression with plasmid pET28a or pRSFDuet;

the geneushAExpressed with plasmid pACYCDuet-1 or pCDFDuet.

4. A method for producing nicotinamide riboside by taking nicotinamide as a substrate is characterized in that the recombinant bacterium of claim 1 or 2 is cultured for a period of time at 35-37 ℃, and then IPTG is used for inducing the production of nicotinamide riboside, and the substrate nicotinamide is added.

5. The method of claim 4, wherein the inducing is performed at 25-37 ℃.

6. The method according to claim 4, wherein the recombinant bacterium is cultured in a fermentation medium at 35-37 ℃ to OD ₆₀₀ =0.6 to 1.0, cooling to 24 to 26 ℃, adding 0.2 to 1 mM IPTG, and adding 100 mg to 10g/L nicotinamide.

7. The method of claim 6, wherein the fermentation medium comprises KH ₂ PO ₄ 6~12 g/L、K ₂ HPO ₄ 16-30 g/L, 5-10 g/L ammonium sulfate, 1-g/L-5 g/L, mgSO citric acid monohydrate ₄ .7H ₂ O1-5 g/L, yeast powder 10-30 g/L and glucose 15-50 g/L.

8. The method according to any one of claims 4 to 7, wherein the nicotinamide is added to the medium in one portion or in several portions after the inducer is added.

9. The method of claim 8, wherein the divided portions are added in two portions, and nicotinamide is added every two hours.

10. The method of claim 8, wherein the portioning is four additions, one nicotinamide per hour.

11. Use of the recombinant bacterium of claim 1 or 2 in the preparation of a nicotinamide riboside-containing product in the field of food, health products, pharmaceuticals, cosmetics or feed.