CN114846329A

CN114846329A - Long-afterglow luminous styrene polymer microsphere, and preparation method and application thereof

Info

Publication number: CN114846329A
Application number: CN201980103292.2A
Authority: CN
Inventors: 李富友; 徐�明; 陈锐; 吴勇
Original assignee: Shanghai Taihui Biotechnology Co ltd; Fudan University
Current assignee: Shanghai Taihui Biotechnology Co ltd; Fudan University
Priority date: 2019-12-05
Filing date: 2019-12-05
Publication date: 2022-08-02
Also published as: WO2021109059A1

Abstract

The invention relates to a long-afterglow luminescent styrene polymer microsphere, which comprises A) at least one light absorbent, B) at least one luminescent agentA gloss agent, C) at least one photochemical buffer agent of the formula (I), and

D) a support medium for adsorbing components a) to C), said support medium being styrene polymer microspheres; wherein the light absorber and the light emitter are structurally different compounds and the total content of the components A) to C) is 0.1 to 30%, preferably 0.2 to 25%, more preferably 0.5 to 20% and most preferably 1 to 15% based on the total mass of the components A) to D). The styrene polymer microspheres according to the invention are particularly suitable for immunochromatography detection techniques. In addition, the invention also relates to a test paper, a probe and a detection method for immunochromatography detection.

Description

Long-afterglow luminous styrene polymer microsphere, and preparation method and application thereof

Technical Field

The invention relates to a long-afterglow luminescent styrene polymer microsphere, a preparation method and application thereof, in particular to application of the long-afterglow luminescent styrene polymer microsphere in an immunochromatography detection technology.

Background

Immunochromatography assay (ICA) or Lateral flow immunoassay (LFA) was first used to detect human chorionic gonadotropin, and with the development of labeling technology, has also been widely used in the fields of medical testing, environmental monitoring, food safety, and the like. The immunochromatographic detection technology effectively combines the chromatographic technology and the antigen-antibody immunoreaction technology. In the immunochromatography detection technology, an immunochromatography detection test strip is often used, which has a main structure in which a polyvinyl chloride base plate is used as a support, and a sample pad (such as a glass cellulose membrane), a binding pad (such as a glass cellulose membrane), a nitrocellulose membrane (NC membrane) and a water absorption pad are arranged on the polyvinyl chloride base plate. When the sample flows under the capillary action, the antigen is combined with the probe on the combining pad to form immune complexes, the immune complexes are enriched and trapped on the detecting line (T line) of the NC membrane as the liquid continues to flow, the probe without the immune complexes is trapped by the quality control line (C line), and finally the probe is interpreted by naked eyes or an instrument.

The immunochromatographic detection test strip widely used at present mainly comprises a colloidal gold immunochromatographic test strip and a fluorescent immunochromatographic test strip. The traditional immunochromatography detection technology mainly takes colloidal gold as an output signal, and because the optical density of a colloidal gold probe is insufficient, the detection sensitivity is low, the quantification is difficult, and the requirement of clinical diagnosis cannot be met. Subsequently, fluorescent probes were developed for immunochromatographic detection, with fluorescent dye-based luminescent probes being most widely used. The fluorochrome is usually directly labeled on the antibody or the antibody-coated microsphere, or embedded in the nanosphere to modify the antibody, and the fluorochrome is excited by a light source such as ultraviolet light to emit light. However, during the detection of the luminescence signal, the spontaneous fluorescence signal interference exists in the sample such as blood, and the interference of the optical signal is also generated by the irradiation of the excitation light source, and these adverse factors seriously affect the accuracy and stability of the detection signal.

The long-afterglow luminescent material is a special luminescent material, which can emit light for a long time after the excitation light source is removed. In the prior art, the long-afterglow luminescent material usually has a luminescent life longer than one hundred milliseconds, and has important application value in the fields of biomedicine, life science and the like. At present, commercial long afterglow luminescent materials are inorganic long afterglow luminescent materials such as rare earth or transition metal doped aluminate, silicate, titanate or sulfide. The long-afterglow luminescent material is used as a signal indicating probe to be applied to immunochromatography detection, so that the interference of excitation light and background fluorescence can be avoided. For example, CN105929155A discloses a long-afterglow based immunochromatographic test paper and a detection method thereof, wherein an inorganic long-afterglow luminescent material is used, so that an interference signal is effectively eliminated, and the detection sensitivity and the quantitative accuracy of an object to be detected are improved.

These inorganic long persistence luminescent materials based on rare earth or transition metal doping are typically prepared by high temperature solid phase calcination. High temperature solid phase synthesis is the most common and effective production method of the material, mainly because high temperature is favorable for obtaining better long afterglow luminescence property, and the luminescence property of the inorganic long afterglow material synthesized by other non-high temperature methods is obviously reduced and is difficult to obtain wide application. However, the high-temperature solid-phase reaction conditions are harsh and high in energy consumption, the morphology of the material is difficult to control to be uniform, and the particle size of the material is generally large. Although the material synthesized by the high-temperature solid-phase method can be further reduced in size by means of milling and screening, the emission luminance sharply decreases after the particle size is reduced to the order of nanometers (for example, when the particle diameter is less than 1000 nm). For example, if the commercial micron-sized inorganic long-afterglow powder is ground to the order of 100nm, the luminance of the nano-microsphere may be reduced by two orders of magnitude.

In addition, in the application of lateral chromatography immunoassay, the high uniformity of the used luminescent probe has important significance for ensuring the repeatability and reliability of the detection result. However, the inorganic long-afterglow luminescent material used as the luminescent core in CN105929155A is inorganic particles (particle size is greater than 15nm, even up to 250nm), and the processability of the inorganic long-afterglow luminescent material in nano-scale is poor, and the surface of the material is not easy to modify functional groups for bioconjugation, so that it is difficult to obtain a large batch of uniform long-afterglow luminescent nanoprobes according to the technical scheme disclosed in CN 105929155A.

Therefore, the preparation of the inorganic long-afterglow luminescent microspheres and probes is difficult at present, and the inorganic long-afterglow luminescent microspheres and probes emit light weakly, so that the afterglow time when the long-afterglow luminescent signals gradually attenuate to the level visible to the naked eye is too short, and even the long-afterglow luminescent signals which are obviously visible to the naked eye can not be obtained at all. The detection of weak signals requires the aid of complex professional equipment, and the effectiveness is limited when applied to immunochromatography.

Disclosure of Invention

In view of the above-mentioned drawbacks of the prior art, the present invention provides an organic long-lasting phosphor microsphere based on styrene polymer, which has higher brightness and longer persistence time.

Different from the inorganic long-afterglow luminescent material based on the photophysical process in the prior art, the long-afterglow luminescent material is based on an organic system, the system utilizes the characteristic of photochemical reaction, introduces photochemical reaction between light energy input and light energy output, and organically fuses photophysics and chemistry. In the long-afterglow luminescent material based on the organic system, the luminescent process can involve photochemical interaction among a plurality of chemical substances, wherein the input excitation light energy is finally released in a luminescent form through a series of photochemical energy conversion and metabolic processes, so that the long-afterglow luminescence is realized. Energy conversion and metabolic processes include energy input, energy buffering, energy extraction, energy transfer, and energy release. The original very rapid photon radiation transition process (nanosecond magnitude to microsecond magnitude) is changed through photochemical reaction, energy is slowly released and is finally emitted in the form of light energy, so that the ultra-long light-emitting time (millisecond magnitude to hour magnitude) is obtained, and the limitation of short light-emitting life of organic molecules is greatly improved.

Further, the inventors have found that certain organic long persistence luminescent materials can be particularly suitably combined with styrene polymer microspheres to produce long persistence luminescent styrene polymer microspheres with higher persistence brightness and possibly longer persistence time, which are particularly suitable for immunochromatography detection. The luminescent core of the organic long afterglow system consists of molecular components and has good processability, for example, each molecular component in a solution is easy to disperse and adsorb in uniform styrene polymer microspheres to prepare large-batch long afterglow luminescent styrene polymer microspheres and probes with high uniformity. Even in many cases, the afterglow brightness can be improved to a level visible to the naked eye and above, and the long afterglow luminescence signal can be collected and analyzed by common electronic equipment such as a mobile phone, so that the practicability of the material is greatly improved.

In this application, the term photochemical reaction is a series of chain reactions, including photochemical addition, photooxidation, photochemical dissociation and bond breaking recombination.

In the present application, unless otherwise specified, the terms "long persistence luminescent styrene polymer microsphere", "long persistence material" and "long persistence nanosphere" have the same meaning and are used interchangeably.

Accordingly, in a first aspect, the present invention provides a long persistence luminescent styrene polymer microsphere comprising

A) At least one light-absorbing agent,

B) at least one luminescent agent which is a monomeric, non-polymeric compound and has a molecular weight of less than 10000g mol ^-1 ，

C) At least one photochemical buffer agent of formula (I),

wherein formula (I) is described in detail below, and

D) a support medium for adsorbing components a) to C), said support medium being styrene polymer microspheres;

wherein the total content of components A) to C) is from 0.1 to 30%, preferably from 0.2 to 25%, more preferably from 0.5 to 20% and most preferably from 1 to 15% based on the total mass of components A) to D).

Preferably, the long-lasting luminescent styrene polymer microspheres consist of components A) to D).

In a second aspect, the present invention provides a probe comprising the above-mentioned long-afterglow luminescent styrene polymer microsphere.

In a third aspect, the present invention provides a method for preparing the above-mentioned long-afterglow luminescent styrene polymer microspheres.

In a fourth aspect, the present invention provides a method for preparing a probe comprising the above-described long-afterglow luminescent styrene polymer microspheres.

In a fifth aspect, the present invention provides a test strip for immunochromatographic assay.

In a sixth aspect, the invention provides a method for immunochromatography detection by using the long-afterglow luminescent styrene polymer microspheres.

Other aspects of the invention are presented in the other independent and dependent claims.

Besides the advantages, the components of the long-afterglow luminescent styrene polymer microsphere are flexibly prepared, the composition and the properties of the material can be designed according to actual requirements, flexible and various nanostructures can be obtained, and the microsphere has tailorable luminescent performance. The wavelength of the excitation light with energy charging and the wavelength of the long afterglow luminescence can be respectively adjusted, and the combination scheme of the light absorbing agent and the luminous agent can be conveniently adjusted and replaced, so that the long afterglow luminescence with rich colors can be efficiently realized.

Preferably, the long persistence luminescent nanomaterial according to the present invention does not contain or contains a very small amount of inorganic long persistence components such as SrAl ₂ O ₄ :Eu ²⁺ ,Dy ³⁺ For example not more than 0.1% by weight, based on the material mixture.

The long afterglow luminescent styrene polymer microsphere of the present invention may have particle size of 5-1000 nm, preferably 50-800 nm, and most preferably 100-500 nm. In the context of the present invention, the morphology and particle size of all particles of the nanospheres can be characterized by images taken with an electron microscope and the average diameter of the nanospheres obtained from multiple measurements is recorded as the particle size. Methods for the characterization of such nanospheres are known to the skilled person and can be measured, for example, using Scanning Electron Microscopy (SEM) and Transmission Electron Microscopy (TEM) instruments.

Under the same test conditions, the luminous intensity of the long-afterglow luminous styrene polymer microspheres can far exceed the nanoscale commercial inorganic long-afterglow material SrAl ₂ O ₄ :Eu ²⁺ ,Dy ³⁺ The level of (c). In particular, the long-afterglow luminescent styrene polymer microspheres can continuously emit light after the excitation light is turned off, andthe long afterglow luminescence time may be up to 100 ms-3600 s, preferably 500 ms-1200 s, more preferably 1 s-600 s, most preferably 2 s-60 s. The long afterglow luminance of the long afterglow material can reach 0.1mcd m ^-2 –10000mcd m ^-2 Preferably at 0.32mcd m ^-2 –8000mcd m ^-2 More preferably at 1mcd m ^-2 –5000mcd m ^-2 . Based on the properties, the long-afterglow nano-microsphere can provide a complete material foundation for an immunochromatography detection technology.

In addition, the long-afterglow nano-microsphere can be used for preparing an immunochromatography nano-probe with high afterglow brightness, and a test strip for immunochromatography detection with high stability, good repeatability and high sensitivity can be obtained, wherein detection objects comprise mycotoxin, pathogenic bacteria, viruses, inflammatory factors, tumor markers and the like.

Light absorber and luminescent agent

In the present application, light absorbers and light emitters are known per se from the prior art. Light absorbers generally refer to substances that absorb and capture light energy from natural or artificial sources. The light absorber is selected from a range including conventional photosensitizing agents and other energy donor materials. And a luminescent agent generally refers to a substance that is capable of ultimately emitting energy in the form of light energy. The light-emitting agent may be a light-emitting substance capable of generating fluorescence, phosphorescence, or the like. Relevant light-emitting molecular groups are known per se and reference may be made, for example, to the reviewed article Nature Methods,2005,2, 910-.

In order to achieve the beneficial effects of the long afterglow materials of the present invention, in particular, for example, improvement of afterglow intensity and time, a clear distinction is made between the two components of the luminescent agent and the light absorbing agent in the compositions of the present invention, so that each component plays a role of absorbing light energy and releasing light energy, respectively, thereby achieving energy utilization paths of energy input, energy buffering and energy output after combination with the specially screened photochemical buffering agent. This also means that, in an advantageous embodiment, a compound which has both a light-absorbing group and a light-emitting group in its structure so that both functions can be performed in the same molecule is not a light-emitting agent or a light-absorbing agent according to the invention and does not give the excellent technical effects of the invention either. On one hand, if the compound is equivalent to packing and binding the light absorbent and the luminescent agent together with the properties of the light absorbent and the luminescent agent, the excitation and the luminescence properties of the long-afterglow material cannot be adjusted respectively, for example, when one compound is selected according to the requirement of actual excitation and energy charging, the luminescence property of the material is fixed at the same time, and vice versa; on the other hand, such a compound is equivalent to fixing the ratio of the light absorber to the luminescent agent to, for example, 1:1, and cannot adjust both the intensity of the light absorption degree and the level of the luminescence level; moreover, the number of materials having both the efficient light absorption function and the efficient light emission function is relatively small, which limits the variety of the long afterglow materials.

In the long afterglow luminescent material according to the present invention, the light absorbent and the luminescent agent are selected according to certain rule standards. In general, compounds having a relatively large molar absorption coefficient are selected as light absorbers, for example photosensitizers or energy donor dyes; while compounds with higher luminescence quantum efficiencies are selected as luminescent agents, for example luminescent dyes. In addition, the absorption peak of the light absorbent should overlap the emission peak of the light emitting agent as little as possible to avoid the adverse effect of the long afterglow luminescence being attenuated by the absorption of the absorbent.

The inventors of the present application found that, in the long-lasting luminescent styrene polymer microspheres according to the present invention, particularly in the aspect of immunochromatographic assay technology, from the viewpoint of enhancing the luminescent brightness or luminescent signal intensity, the light absorbing agent and the light emitting agent should advantageously be at least one compound of different molecular formulae or different structures, respectively, selected from the group consisting of: porphyrin and phthalocyanine dyes, metal complexes, acene compounds, BODIPY compounds, Quantum Dots (QDs), graphene, and derivatives or copolymers of these compounds. Advantageously, the luminophores used in the present invention are monomeric, non-polymeric compounds and have a molecular weight of less than 10000g mol ^-1 . In the context of the present application, the molecular weight refers to the weight average molecular weight of the compound, which can pass through the matrixMeasuring by spectrum, gas chromatography, and liquid chromatography. An alternative instrument may be, for example, a mass spectrometer, or a liquid-mass spectrometer. Herein, the non-polymeric compound means that the compound structure does not include more than 2 repeating units obtained by polymerization or oligomerization.

More advantageously, particularly from the viewpoint of immunochromatographic detection techniques, the light-absorbing agent and the light-emitting agent preferably used for the long-afterglow styrene polymer microspheres of the present invention are each selected from the following.

(1) Light absorber

Preferably, the light absorber may be selected from the group consisting of porphyrins and phthalocyanines, transition metal complexes, Quantum Dots (QDs), and derivatives or copolymers of these compounds. These compounds are known per se to the person skilled in the art, some non-limiting examples of light absorbers being mentioned below.

As porphyrin-based dyes and complexes thereof, mention may be made, for example, of the following compounds:

as phthalocyanine type dyes and complexes thereof, for example, the following may be mentioned:

in the structural formulae of these light absorber compounds shown above,

x represents a halogen such as F, Cl, Br, I; and

m ═ metal elements such as Al, Pd, Pt, Zn, Ga, Ge, Cu, Fe, Co, Ru, Re, Os, and the like.

Each substituent R is as R _1-24 Represents H, hydroxyl, carboxyl, amino, mercapto, ester, aldehyde, nitro, sulfonic acid, halogen, or alkyl, alkenyl, alkynyl, aryl, heteroaryl with N, O or S, alkoxy, alkylamino having 1 to 50, preferably 1 to 24, e.g. 2 to 14 carbon atoms, or combinations thereof. Preferably, the above-mentioned group R is as R _1-24 Each independently selected from methoxy, ethoxy, dimethylamino, diethylamino, methyl, ethyl, propyl, butyl, tert-butyl, phenyl or combinations thereof.

Transition metal complexes which can be used as light absorbers are known per se, and are preferably complexes of porphyrins and phthalocyanines dyes as those shown above.

Suitable quantum dot materials include, for example, graphene quantum dots, carbon quantum dots, and heavy metal quantum dots.

Heavy metal quantum dots include, for example, Ag ₂ S, CdS, CdSe, PbS, CuInS, CuInSe, CuInGaS, CuInGaSe and InP quantum dots. The outer layer can be coated with shell layer of Ag to form core-shell structure ₂ One or more of S, CdS, CdSe, PbS, CuInS, CuInSe, CuInGaS and CuInGaSe, or ZnS layer.

Preferably, the quantum dots are modified with surface ligands, which may be, for example, oleic acid, oleylamine, octadecene, octadecylamine, n-dodecyl mercaptan, combinations thereof, and the like. In some more advantageous cases, the ligands on the surface of the quantum dots are partially exchanged by a ligand exchange strategy to molecular structures containing triplet states, such as carboxyanthracene, carboxytetracene, carboxypentacene, aminoanthracene, aminotetracene, aminopentacene, mercaptoanthracene, mercaptotetracene, mercaptopentacene, and the like.

In a more preferred embodiment, the light absorber is preferably selected from complexes of porphyrins and phthalocyanines, Quantum Dots (QDs), and derivatives of these compounds. Such as one or more of these exemplary compounds:

and also quantum dot materials such as graphene quantum dots, CdSe quantum dots, PbS quantum dots and the like.

(2) Luminescent agent

Preferably, the luminescent agent may be selected from iridium complexes, rare earth complexes, acene-based compounds, BODIPY-based compounds, and derivatives and copolymers of these compounds.

As the BODIPY-based compound, for example, the following compounds can be mentioned:

as the acene-based compounds, there may be mentioned, for example, the following compounds:

in the structural formulae of these luminescent agent compounds shown above,

n is an integer of 0 or more, for example, 0, 1, 2, and 3;

each substituent R is as R _1-16 Represents H, hydroxyl, carboxyl, amino, mercapto, ester, aldehyde, nitro, sulfonic acid, halogen, or has 1 to 50, preferably 1 to 24, e.g. 2 to 14, carbon atomsAlkyl, alkenyl, alkynyl, aryl, heteroaryl with N, O or S, alkoxy, alkylamino, or combinations thereof. Preferably the group R is as R _1-16 Selected from methoxy, ethoxy, dimethylamino, diethylamino, methyl, ethyl, propyl, butyl, tert-butyl, phenyl; or a combination thereof.

In iridium complexes suitable as luminescent reagent, the composition of the ligand may be a combination of one or more different ligands, the schematic structure of which and the type of a part of the C-N, N-N, O-O and O-N ligands are exemplarily shown below (the C-N, N-N, O-O and O-N ligands shown therein are schematic structures thereof and are respectively highlighted by the coordination of the iridium atom Ir with the C and N atoms, two O atoms and O and N atoms in the ligand, such representation being familiar and understood to those skilled in the art):

(wherein DMSO is dimethyl sulfoxide)

Wherein the C-N ligand may have, for example, the following structure:

the O — N ligand may have, for example, the following structure:

the N-N ligand may have, for example, the following structure:

the rare earth complex as a luminescent agent may be, for example, a structure in which the central atom is a lanthanoid, the ligand is coordinated with the central atom with O or N, and the central atom is generally Eu, Tb, Sm, Yb, Nd, Dy, Er, Ho, Pr, or the like. These rare earth complexes have a coordination number of about 3 to 12, preferably 6 to 10. In actual rare earth complexes, the ligand species, number of each ligand, and total coordination number may vary. Rare earth complexes and their ligands can be referred to, for example, in the review article coord. chem. rev. 2015, 293-.

In a more preferred embodiment, the luminescent agent is selected from the group consisting of iridium complexes, rare earth complexes, BODIPY compounds, perylene, and derivatives of these compounds. Such as one or more of these exemplary compounds:

photochemical buffer agent

In the long persistence luminescent materials according to the present invention, a photochemical buffer is important. The photochemical buffering agent mainly has the function of photochemical energy conversion, and different from a luminescent agent with the main function of luminescence, the buffering agent molecules do not emit light or emit light very weakly, and the molecular structure of the buffering agent does not generally comprise a group or a conjugated structure which can directly emit light. In particular, the photochemical buffering agents according to the invention are distinguished in kind from luminescent or light-absorbing agents, in particular those luminescent or light-absorbing agent substances listed in the invention. The photochemical buffering agent can assist in participating in photochemical reaction, and a bridge for energy exchange and storage is constructed between the luminous agent and the light absorbent. The energy extraction process of transition between energy levels is activated through a reaction step of addition, rearrangement or bond breaking in a photochemical reaction.

The photochemical buffering agents according to the invention are preferably non-polymeric, small-molecule compounds, preferably with a molecular weight of less than 2000g mol ^-1 More preferably less than 1000g mol ^-1 . By a compound which is not a polymer is meant that the compound is not obtained by conventional polymerisation, preferably the compound contains no or no more than 2 repeating units.

In particular, the inventor finds that some specific buffer compounds are particularly suitable for preparing the nano microspheres with stability and good long-afterglow luminescence performance. The buffer agent in the long-afterglow luminescent styrene polymer microsphere is selected from the following structural formula (I):

wherein the content of the first and second substances,

g and T are heteroatoms selected from O, S, Se and N;

R ₁ ' and R ₂ ' and R ₄ ' to R ₈ ' are each independently selected from H, hydroxyl, carboxyl, amino, mercapto, ester, nitro, sulfonic, halogen, amide, or alkyl, alkenyl, alkynyl, alkoxy, alkylthio, alkylamino, aryl, aralkyl, heteroaryl or heteroaralkyl having N, O or S, or combinations thereof, having 1 to 50, preferably 1 to 24, carbon atoms, such as 2 to 14, wherein the aryl, aralkyl, heteroaryl or heteroaralkyl optionally has one or more substituents L; and

l is selected from hydroxyl, carboxyl, amino, thiol, ester, nitro, sulfonic, halogen, amide, or alkyl, alkenyl, alkynyl, alkoxy, and alkylamino groups having 1 to 50, preferably 1 to 24, such as 2 to 14, or 6 to 12 carbon atoms, or combinations thereof; and

R ₃ ' is an electron withdrawing group or an aryl group comprising an electron withdrawing group.

In the context of this application, "aryl" means a group or ring formed by an aromatic compound as distinguished from an aliphatic compound, which is directly linked to another structural group or fused to another ring structure by one or more single bonds, and is thus distinguished from a group linked to another structural group by a spacer such as an alkylene or ester group, for example, an "aralkyl" or "aryloxy" or "arylester group". Similarly, they can be viewed as groups formed by replacing a ring carbon atom on an aryl group with a heteroatom N, S, Se or O, or replacing a carbon atom on an aliphatic ring, such as a cyclic olefin, with the heteroatom "heteroaryl". Furthermore, unless indicated to the contrary, the term "aryl" or "heteroaryl" also includes aryl or heteroaryl groups substituted or fused with aryl, heteroaryl groups, such as biphenyl, phenylthienyl or benzothiazolyl groups. In addition, the "aryl" or "heteroaryl" may also include groups formed from aromatic or heteroaromatic compounds having functional groups such as ether groups or carbonyl groups, such as anthrone, diphenyl ether, or thiazolone, and the like. Advantageously, the "aryl" or "heteroaryl" according to the invention has 4 to 30, more preferably 5 to 24, for example 6 to 14 or 6 to 10 carbon atoms. The term "fused" then means that the two aromatic rings have a common edge.

In the context of the present application, the terms "alkyl", "alkoxy" or "alkylthio" refer to straight-chain, branched or cyclic, saturated aliphatic hydrocarbon radicals which are linked to other radicals by single bonds, oxy or thio groups, preferably having from 1 to 50, more preferably from 1 to 24, for example from 1 to 18, carbon atoms. The term "alkenyl" or "alkynyl" refers to a straight, branched or cyclic unsaturated aliphatic hydrocarbon group having one or more C-C double or triple bonds, preferably having from 2 to 50, more preferably from 2 to 24, such as from 4 to 18 carbon atoms.

In the context of this application, the term "alkylamino" refers to one or more alkyl-substituted amino groups, including monoalkylamino or dialkylamino groups, such as methylamino, dimethylamino, diethylamino, dibutylamino and the like.

In the context of this application, the term "halogen" includes fluorine, chlorine, bromine and iodine.

In the context of the present application, the term "electron-withdrawing group" is understood to mean a group which, when it substitutes a hydrogen on an aromatic or heteroaromatic ring, results in a reduction in the density of the electron cloud on the ring. Such groups are widely known in the chemical arts. Preferably, in the present invention, the electron withdrawing group is selected from nitro, halogen, haloalkyl, sulfonic acid, cyano, acyl, carboxyl and/or combinations thereof.

Furthermore, in the context of the present application, the substituents listed in the definitions of the individual substituents can combine with one another to form new substituents in accordance with the principle of valency, which means, for example, C1-C6 alkyl estervinylenes (C1-C6 alkyl estervinylenes) formed by alkyl, ester and vinyl groups combining with one another _1-6 alkyl-O-C (═ O) -C ═ C-) is also within the definition of relevant substituents.

In a preferred embodiment, the ring portion

Can be selected from

More preferably, G and T are selected from S and O, most preferably one of G and T is S and the other is O.

In a preferred embodiment, R ₁ ' and R ₂ ' and R ₄ ' to R ₈ ' each is independently selected from an alkyl, alkoxy, alkylamino or aryl group having 1 to 18, preferably 1 to 12, more preferably 1 to 16 carbon atoms or itCombinations of these, wherein the aryl group may be substituted or unsubstituted by one or more groups L and is preferably phenyl substituted or unsubstituted by one or more L.

Preferably, L is selected from hydroxyl, sulfonic acid, halogen, nitro, straight or branched alkyl having 1 to 12, more preferably 1 to 6 carbon atoms, alkoxy, alkylamino, amino, or combinations thereof.

More preferably, the group R ₁ ' and R ₂ ' and R ₄ ' to R ₈ ' is selected from methoxy, ethoxy, dimethylamino, diethylamino, dibutylamino, methyl, ethyl, propyl, butyl, tert-butyl, or combinations thereof.

More preferably, the group R ₃ ' is selected from an electron withdrawing group or an aryl group comprising an electron withdrawing group, preferably selected from nitro, cyano, halogen, haloalkyl and/or combinations thereof. Accordingly, the aryl group containing an electron withdrawing group preferably includes an aryl group having one or more substituents selected from nitro, cyano, halogen and/or haloalkyl on the ring, preferably a phenyl group such as a fluorophenyl group or a perfluorophenyl group.

In a particularly preferred embodiment, the photochemical buffering agent is selected from compounds such as:

carrier medium

The long-afterglow styrene polymer microsphere of the invention must contain styrene polymer microsphere as component D) carrier medium in addition to the above-mentioned component A) light absorbent, component B) luminescent agent and component C) photochemical buffer. Optionally, other processing aids for the preparation of the nanospheres or components for further improving the long-lasting glow luminous effect can be included in addition to these.

According to the present invention, the styrene polymer microspheres are particularly well able to adsorb the specific components a) to C) as described above, thereby forming stable nanospheres supporting components a) to C).

In the present application, the "styrene polymer microspheres" are formed from styrene polymers. The "styrene polymer" refers to a homopolymer of styrene or a high molecular copolymer thereof with other copolymerizable monomers. Examples of such copolymerizable monomers include alkenes, alkynes, ethylenically unsaturated carboxylic acids or anhydrides or amides or esters thereof, and the like, and their derivative forms having one or more substituents, such as butadiene, maleic anhydride, (meth) acrylic acid or (meth) acrylamide, and the like. As used herein, the term "alkene" or "alkyne" refers to a straight, branched or cyclic unsaturated aliphatic hydrocarbon having one or more C-C double or triple bonds, preferably having from 2 to 50, more preferably from 2 to 24, such as from 4 to 18 carbon atoms. The term "unsaturated carboxylic acid" is intended to mean in particular aliphatic ethylenically unsaturated carboxylic acids, i.e. having the formula Y-COOH, wherein Y is a C2-C18, for example C3-C8, linear, branched or cyclic aliphatic alkyl radical having one or more C-C double bonds instead of a C-C single bond, more preferably (meth) acrylic acid. The "substituent" includes halogen, amino, amide, aldehyde, carboxyl and/or the like.

Preferably, the surface of the styrene polymer microsphere may contain coupling groups selected from amino groups, amide groups, carboxyl groups, and/or aldehyde groups, so that the surface of the nanoparticle of the present invention may be better coupled with antibodies or aptamers capable of immunoreacting with a specific antigen using the groups. Preferred comonomers therefore have one or more groups selected from amino, amide, carboxyl and/or aldehyde groups, such as (meth) acrylic acid, (meth) acrylamide or amino-substituted olefins, etc.

According to an advantageous embodiment of the invention, the styrene polymer forming said microspheres contains from 1% to 15%, more preferably from 2% to 10%, by weight of the total of all the monomers, of the above-mentioned comonomers. Preferably, the styrene polymer or microspheres thereof according to the present invention contain from 0.05% to 5%, more preferably from 0.1% to 2%, based on the total weight of the polymer, of coupling groups as described above. Such preferred styrene polymers are readily available and are particularly suitable for immunoassay applications.

In a more preferred embodiment, the styrene polymer is a copolymer formed from styrene, (meth) acrylic acid or an ester thereof or (meth) acrylamide and optionally other comonomers.

Further, the coefficient of variation of the particle size of the styrene polymer microspheres according to the present invention is less than 10%, preferably less than 5% and more preferably less than 3%. Coefficient of Variation (CV) represents the ratio of the standard deviation of the data to the mean, which is a statistical measure of the dispersion of data points around the mean in a series of data. Within the scope of the present invention, the smaller the variation coefficient of the particle size of the styrene polymer microspheres is, the more favorable the stable and repeatable detection effect in practical application can be obtained. Those skilled in the art are familiar with the method of measuring the coefficient of variation and the measuring instrument to be used.

In the scope of the invention, as a styrene polymer carrier medium, a styrene polymer which is synthesized in a microsphere form can be directly adopted. The styrene polymer may be prepared by suitable free radical polymerization reactions known to those skilled in the art. Depending on the different polymerization and processing techniques, the microspheroidal support medium may comprise a microsphere structure as follows: core-shell structures, oil-in-water structures, water-in-oil structures, mesoporous structures, hollow structures, swellable structures, and the like. Preferably, the structure of the styrene polymer microsphere is selected from a hollow structure, a mesoporous structure and a core-shell structure. The different structures can be selected according to the loading amount, for example, the styrene polymer microspheres with hollow structures can absorb more of the components A), B) and C. Generally, as the particle size of the styrene polymer microspheres increases, the number or mass of components a), B) and C) contained in a single microsphere increases, whereby the long-afterglow luminescence enhancement of a single microsphere is advantageous for the efficient detection of test signals during immunochromatography; however, too large a particle size is not favorable for lateral chromatography of the microspheres on a test strip. Therefore, in order to obtain a desired immunochromatographic detection effect, the long-afterglow luminescent styrene polymer microspheres of the present invention advantageously have a particle size in the range of 5nm to 1000nm, more preferably 50nm to 800nm, most preferably 100nm to 500 nm.

In an advantageous embodiment, the total content of the components a) to C) is from 0.1% to 30%, preferably from 0.2% to 25%, more preferably from 0.5% to 20% and most preferably from 1% to 15%, based on the total mass of the components a) to D). When the total content of components a) to C) is too low, i.e., the content of component D) is too high, the luminance of the long-afterglow luminescence decreases, so that effective immunoassay based on the long-afterglow luminescence signal cannot be performed. When the total content of the components A) to C) is too high, namely, the content of the component D) is too low, the formed nano microspheres have poor dispersibility and stability, for example, particle agglomeration and sedimentation phenomena are easy to occur, and even materials cannot form a monodisperse nano structure, so that the application requirements of immunoassay cannot be met.

In addition, in the long afterglow material composition according to the present invention, the effect of the long afterglow can be further improved by adjusting the molar ratio of the light absorbing agent to the light emitting agent within an appropriate range. In an advantageous embodiment, the molar ratio of light absorber to luminescent agent is in the range from 1:2 to 1:10000, preferably from 1:10 to 1:8000 or from 1:50 to 1:6000, more preferably from 1:100 to 1:4000 or from 1:200 to 1: 2000. In an advantageous embodiment, the photochemical buffer may be present in an amount of from 0.1% to 80%, preferably from 0.3% to 60%, more preferably from 0.5% to 40%, most preferably from 1% to 20%, based on the total mass of the three components A) to C) of the material.

When the proportion of the light absorber is too high, there is an adverse effect that the long-afterglow luminescence is reduced by the absorption of the light absorber. When the proportion of the light absorber is too low, the energy of the absorbed excitation light is relatively limited, and the long afterglow luminescence is also weak. In addition, when the photochemical buffering agent is too small, the energy buffering capability is weak, and the performance of the long afterglow luminescence is adversely affected, for example, the stability and luminescence brightness of the long afterglow luminescence are affected. When too much buffering agent is added in the system, collision energy transfer among all components is hindered, and the buffered energy cannot be effectively transmitted out and is dissipated, so that the long afterglow luminescence performance is reduced.

The long afterglow material of the present invention may be processed directly from solution to prepare long afterglow luminescent styrene polymer microsphere for use in immunochromatographic test paper detection.

The excitation and emission wavelengths of the long-afterglow luminescent material system are easy to regulate and control, and the long-afterglow luminescent material can cover purple, blue, green, yellow, red and near infrared spectral regions. By selecting the type of light absorber or light emitter and appropriate structural modifications as necessary, the operable range of both excitation and emission is very wide, so that the actual combination of excitation and emission properties is very rich. Preferably, the adjustable range of the wavelength of the excitation light is 300nm to 1000 nm. The long afterglow luminescence may be luminescence based on an up-conversion mechanism, luminescence based on a down-conversion mechanism, or luminescence with zero stokes shift. When the light with the wave band of lambda 1 is used for excitation, the wave band of the emitted light of the long afterglow luminescence lambda 2 is flexibly distributed, and the long afterglow luminescence can cover all the wave bands of ultraviolet visible near infrared. When the lambda 1 is less than the lambda 2, the light with the shorter wavelength is excited to realize the light emission with the longer wavelength, namely the wavelength of the excitation light is red-shifted than that of the emission light, and the light emitting device belongs to a conventional down-conversion light emitting mode; when the lambda 1 is more than lambda 2, the light with the longer wavelength is excited to realize the light emission with the shorter wavelength, namely the wavelength of the excitation light is blue-shifted than that of the emission light, and the light emission belongs to an up-conversion light emitting mode; when λ 1 is λ 2, i.e. the excitation light wavelength is in the same band as the emission light wavelength, it belongs to the light emission mode with zero stokes shift.

Various light sources can be used to energize the long persistence luminescent materials of the present invention. Common light source lighting equipment, point light sources, annular light sources and indoor and outdoor natural illumination can excite and charge the long afterglow luminescent agent system based on a photochemical mechanism. In a preferred embodiment, the light sources include solid-state lasers, gas lasers, semiconductorsLasers, photodiodes, D65 standard light sources, styrene polymer light emitting diodes, ultraviolet lamps, flashlights, xenon lamps, sodium lamps, mercury lamps, tungsten filament lamps, incandescent lamps, fluorescent lamps, and natural sunlight, as well as combinations of these light sources. In a more preferable scheme, a laser and a light emitting diode are used as excitation light sources, the light output by the light sources has good monochromaticity and high brightness, and can be selectively and rapidly excited to charge energy, and in practical application, the light emitted by the light sources can be focused, diffused, annular and collimated light beams. The light output intensity of the excitation light source can have a wide range of power densities (1 μ W cm) ^-2 –1000W cm ^-2 ) The excitation time also has a wide dynamic range (1 mus-1 h). In addition, the excitation light output by the light source may be continuous light, pulsed light, or an output mode of a combined mode, where the pulsed light is modulatable and has a wide modulation frequency range (0.001 Hz-100 KHz). In an advantageous embodiment, the required excitation time of the ultra-bright long-afterglow luminescent material according to the invention is short, and the irradiation time of the excitation light is 0.1s to 100s, preferably 0.5s to 60s, more preferably 1s to 30s, and most preferably 2s to 10 s.

In a second aspect, the present invention relates to a probe comprising the above-mentioned long-afterglow luminescent styrene polymer microsphere. The probe comprises the long-afterglow luminescent styrene polymer microsphere and the antibody or aptamer loaded or coupled on the microsphere.

In an advantageous embodiment, the antibody or aptamer is preferably present in the probe in an amount of 1% to 20%, more preferably 2% to 15%, and most preferably 5% to 12% by mass of the entire probe.

Suitable antibodies or aptamers are not, in theory, particularly limited. Preferably they are capable of specific immunological binding to an antigen of interest to be detected, including mycotoxins, pathogenic bacteria, viruses, inflammatory factors or tumour markers, preferably selected from C-reactive protein (CRP) antibodies, serum amyloid (SAA) antibodies, Procalcitonin (PCT) antibodies, alpha-fetoprotein (AFP) antibodies, carcinoembryonic antigen (CEA) antibodies, Prostate Specific Antigen (PSA) antibodies, cardiac troponin (CTn-I) antibodies, Human Chorionic Gonadotropin (HCG), anti-streptolysin o (aso), Rheumatoid Factor (RF) and/or oligonucleotide fragments.

In a third aspect, the present invention relates to a method for preparing the long persistence luminescent styrene polymer microsphere as described above, which comprises the following steps:

(1) providing components A) to C); and

(2) the components A) to C) are dispersed and adsorbed onto the support medium component D) in a dispersion or solution.

Here, it may be advantageous to first mix the components a) to C) with one another and then disperse or dissolve them in a suitable solvent, or to disperse or dissolve the components a) to C) in succession in a suitable solvent, to form a solution. Suitable solvents are not particularly limited as long as they form a stable solution or dispersion, and may be, for example, liquid paraffin, a mixture of phenethyl alcohol-ethylene glycol and water, a mixture of mesitylene and ethanol, tetrahydrofuran, dichloromethane, or the like.

After the solution or dispersion comprising components a) to C) is obtained, the support medium microspheres or a solution or dispersion thereof may be added thereto. Alternatively, the solution or dispersion comprising components a) to C) may also be added to the solution or dispersion comprising microspheres of the support medium. The carrier medium may be dispersed with water or other suitable solvent, such as deionized water, Phosphate Buffered Saline (PBS), Borate Buffered Saline (BBS), and the like.

In the preparation of the solution or dispersion, if necessary, an auxiliary device such as ultrasonic waves, a high-pressure homogenizer, or the like may be used, or appropriate heating may be performed with stirring.

After the stable dispersion of the long-lasting luminescent styrene polymer microspheres comprising the components A) to D) is obtained in the step (2), the dispersion can be directly used for subsequent utilization without treatment as required, such as for preparing test paper suitable for immunoassay. Alternatively, an antibody or aptamer may be further adsorbed or modified on the obtained nanosphere, thereby obtaining the probe according to the present invention.

The preparation of the probes is known per se or can be obtained by a person skilled in the art with slight modifications according to known techniques. The preparation method mainly comprises the step of carrying out biological coupling on the long-afterglow luminescent styrene polymer microspheres and the antibody or aptamer through functional reactive groups such as carboxyl, amino and aldehyde groups. For example, the coupling may be formed by a carboxyl-amino reaction or an aldehyde-amino reaction. Generally, the corresponding coupling method is selected according to the condition of the functional groups on the surface of the nano microsphere.

Accordingly, a fourth aspect of the present invention relates to a method for producing the probe as described above.

In a fifth aspect, the present invention provides a test strip for immunochromatography detection comprising the long-afterglow luminescent styrene polymer microspheres or the probe as described above. The test paper comprises a sample pad, a combination pad, a test line and a quality control line, wherein the long afterglow luminescent styrene polymer microspheres or the probe are arranged on the combination pad.

The structure of test strips used in immunochromatographic detection techniques is known per se. The sample pad, the combination pad, the test line and the quality control line can be attached to a bottom plate, such as a PVC bottom plate. For the structure of such a test strip, reference may be made to, for example, patent document CN105929155A, which is disclosed herein and incorporated herein in its entirety.

In one exemplary structure as shown in fig. 3, the test paper comprises a PVC base plate 1, a sample pad 2, a binding pad 3, a nitrocellulose membrane 4 and a water absorbent pad 5 are sequentially disposed on the base plate 1, wherein a test line 6 and a quality control line 7 are sequentially disposed on the nitrocellulose membrane 4 along a direction from the sample pad 2 to the water absorbent pad 5.

The immunochromatography technology mainly comprises double-antibody sandwich and competition methods. The double-antibody sandwich method is mainly used for detecting macromolecular substances such as proteins and the like, such as tumor markers, viruses, inflammatory factors and the like. These detection methods are known per se. In an exemplary embodiment, the method uses a pair of paired antibodies directed to different epitopes of antigen, the capture antibody is fixed on the T line of NC membrane, the detection antibody coupling modified nano-probe is fixed on the binding pad, and the secondary goat-anti-mouse (or donkey-anti-mouse, goat-anti-rabbit, rabbit-anti-mouse, etc.) antibody is fixed on the C line of NC membrane as quality control line. In the detection process, a sample is dripped on the sample pad, the sample flows from left to right through capillary action and sequentially passes through the combination pad, and the T line and the C line generate specific immunoreaction. The competition method is mainly used for detecting small molecular substances. In the method, for example, a whole antigen (a coupling product of a small molecule and a macromolecule) can be fixed on an NC membrane to form a T line, an antibody coupling modified nano probe is fixed on a binding pad, and a goat anti-mouse (or donkey anti-mouse, goat anti-rabbit, rabbit anti-mouse and the like) secondary antibody is used as a C line. In the detection process, a sample is dripped on the sample pad and sequentially passes through the combination pad, the T line and the C line through capillary action, and the antigen fixed on the T line can be competitively combined with the free antigen and the antibody in the sample. The general procedures for immunochromatographic detection methods are known to those skilled in the art and embodiments of the methods are given by way of example in the examples of the present application.

Finally, the invention also relates to a method for immunochromatographic detection, which comprises the following steps:

(1) providing the long-afterglow luminescent styrene polymer microspheres or the probe or the test paper;

(2) irradiating the styrene polymer microspheres or the probes or the test paper with exciting light; and

(3) the irradiation is stopped and the light emission signal is read.

Compared with similar technology using inorganic long afterglow material, such as CN105929155A, the immunochromatography detection method of the present invention has more advantages. First, the excitation wavelength is more widely selectable, including the wavelength range of ultraviolet, visible, and near-infrared light. Secondly, the absorption cross section of the long-afterglow luminescent styrene polymer microspheres is larger by several orders of magnitude, which enables the time for charging energy by light irradiation to be shorter, such as 2 s-10 s being most preferable. In addition, the long-afterglow luminescent styrene polymer microsphere has higher long-afterglow luminescent brightness which exceeds the macroscopic brightness level, and the alternative detection equipment is more common. Preferably, the instrument for reading the luminescence signal in the detection is a smart phone, a luminescence imaging system, a professional long afterglow luminescence detection device, or the like. More preferably, the detection device is a common commercial mobile phone, and is provided with software for reading signals, so that data analysis of signal intensity can be performed on pictures taken by the mobile phone.

Drawings

FIG. 1 is a schematic structural diagram of a probe comprising a long persistence luminescent styrene polymer microsphere according to the present invention. As can be seen, the components A) to C) are adsorbed on the carrier medium nanospheres, and the carrier medium is also coupled with antibodies or aptamers.

FIG. 2 is a schematic diagram of the luminescence mechanism of the long persistence luminescent nanomaterial according to the present invention.

FIG. 3 is a schematic diagram of the immunochromatographic test strip of the present invention, which comprises a PVC base plate 1, wherein a sample pad 2, a binding pad 3, a nitrocellulose membrane 4 and a water absorption pad 5 are sequentially arranged on the base plate 1; the nitrocellulose membrane 4 is also provided with a test line 6 and a quality control line 7 in this order along the direction from the sample pad 2 to the absorbent pad 5, and the direction indicated by the arrow in the figure is the lateral chromatographic direction.

FIG. 4 is a transmission electron micrograph of the 300nm styrene polymer nanospheres with carboxyl group synthesized in example 1

FIG. 5 is a transmission electron microscope image of the long-lasting styrene polymer nanospheres of example 2.

FIG. 6 is a graph showing the storage stability of the long persistence styrene polymer nanospheres tested in example 29 of the present invention.

FIG. 7 is a standard curve of C-reactive protein (CRP) detection based on the long-afterglow luminescent nano-materials of the embodiment 33 of the invention.

FIG. 8 is a diagram showing the effect of detecting C-reactive protein (CRP) by using a long-afterglow immunochromatographic test strip, wherein the pictures are taken by a mobile phone. The long afterglow signal indicating probes used in the immunochromatographic test strip are different, the left graph (a) is a CRP detection effect graph of the long afterglow luminescent nano material based on the embodiment 33 of the invention, and the right graph (b) is an inorganic long afterglow SrAl prepared based on the comparative embodiment 12 ₂ O ₄ :Eu ²⁺ ,Dy ³⁺ And (3) a CRP detection effect graph of the nano material.

FIG. 9 is a standard curve for serum amyloid (SAA) detection based on the long persistence luminescent nanomaterial of example 34 of the present invention.

FIG. 10 is a standard curve for Procalcitonin (PCT) detection based on the long persistence luminescent nanomaterials of example 35 of the present invention.

FIG. 11 is a calibration curve for the detection of alpha-fetoprotein (AFP) based on the long persistence luminescent nanomaterials of example 36 of the present invention.

FIG. 12 is a calibration curve for carcinoembryonic antigen (CEA) detection based on the long persistence luminescent nanomaterial of embodiment 37 of the present invention.

FIG. 13 is a standard curve for Prostate Specific Antigen (PSA) detection based on the long persistence luminescent nanomaterials of example 38 of the present invention.

FIG. 14 is a standard curve for the detection of cardiac troponin (cTn-I) based on the long-lasting luminescent nanomaterial of example 39 according to the present invention.

FIG. 15 is a standard curve for Human Chorionic Gonadotropin (HCG) detection based on the long persistence luminescent nanomaterial of example 40 of the present invention.

FIG. 16 is a standard curve of the anti-streptolysin O (ASO) detection of the long-afterglow luminescent nano material according to the embodiment 41 of the invention.

FIG. 17 is a standard curve for Rheumatoid Factor (RF) detection based on the long persistence luminescent nanomaterial of embodiment 42 of the present invention.

Examples

1. Performance test method

In the long persistence luminescence test of the present invention, a wavelength tunable laser (Opolette 355) from the company of Opotek, inc. In certain cases, a Light Emitting Diode (LED) is also used as an excitation light source, and the power density of the excitation light is kept uniform. The excitation light with specific wavelength irradiates the sample for energy charging, and the irradiation energy charging time is 3 s. And after the energy charging is finished, the laser is turned off, and the light emitting performance is tested. The long residual luminescence intensity was measured using a fluorescence spectrometer (Edinburgh FS-5) from Edinburgh Instrument, England. The long afterglow luminance was measured using a long afterglow test system (OPT-2003) of the beijing obodi photoelectric technology ltd. The invention uses a commercial smart phone or a common digital camera to take a picture and records a bright field and a long afterglow luminous picture.

Phrase as used herein "Macroscopic "is a term of art in the field of long persistence luminescent materials, meaning that the luminescent brightness of the material is greater than or equal to 0.32 mcd.m ^-2 Visible light is typically visible to the naked eye at levels of radiation at and above this brightness. The phrase "emission time" as used herein is a term of art in the field of long persistence luminescent materials and refers to the time that elapses when the emission brightness of the material decays to a level that is visible to the naked eye. The phrase "blue long afterglow luminescence" as used herein is a representation of the long afterglow luminescence color of a material, meaning that there is significant long afterglow luminescence generation in the blue wavelength interval; similarly, the description correspondingly applies to the description of the other colors used herein. In a practical case, there may be an error in the observation result such as a light emission color or a light emission time due to a difference in the observation method or due to an influence of an individual difference.

2. List of raw materials used

3. Preparation of long afterglow luminous nano material

Example 1

Synthesizing styrene polymer nano-microsphere as carrier medium of long-afterglow luminescent material. The styrene polymer nano-microsphere is synthesized by an emulsion polymerization method: 39.3g of styrene, 2.1g of methacrylic acid and 0.5g of sodium dodecylbenzenesulfonate were first dispersed in 100mL of ultrapure water, and the solution was charged into a 500mL three-necked flask, and nitrogen was introduced while maintaining the temperature at 25 ℃ and stirring was continued for 30 minutes. The temperature was then slowly raised to 70 ℃ and 0.3g of potassium persulfate (dissolved in 25g of ultrapure water) was immediately added and the reaction was continued for 4 hours. After the reaction is finished, washing the reaction product by using ultrapure water and ethanol, and standing the reaction product at normal temperature for later use. The surface of the styrene polymer nano microsphere prepared by the method contains carboxyl, and the content of the carboxyl measured by an electric conductivity titration method accounts for 0.2 percent of the total weight of the styrene polymer microsphere. The scanning electron microscope image of the prepared styrene polymer nanospheres is shown in fig. 4, the particle size is 300nm and is very uniform, and the statistical coefficient of variation among the nanoparticles is less than 5%. For those skilled in the art, the synthesis and control method of the styrene polymer nanospheres is easy to understand, and other styrene polymer nanospheres with different particle sizes can be obtained by adjusting the addition amount of the synthesis raw materials.

Example 2

Preparing the long-afterglow luminescent styrene polymer microspheres. Adding a light absorbent PdOEP, a luminescent agent Eu-1 and a photochemical buffer agent CA-1 into 5mL of benzyl alcohol-ethylene glycol-water (v: v: v, 1:8:1) solution, wherein the concentration of PdOEP is 5 mu mol L ^-1 The concentration of CA-1 is 3mmol L ^-1 Eu-1 concentration of 5mmol L ^-1 . After the components were dispersed by ultrasonic, 50mg of the styrene Polymer (PS) nanospheres of example 1 having carboxyl groups on the surface at 300nm were added and heated at 110 ℃ for 30 min. Then, the solution is cooled to room temperature, centrifugally washed 3 times by using ethanol and water, and finally the nanoparticles are dispersed in water for storage, wherein the appearance under a scanning electron microscope is shown in fig. 5. As can be seen from the electron microscope picture, the light absorbent, the luminescent agent and the photochemical buffering agent are absorbed to the styrene polymer nano-carrier in the processThe appearance of the styrene polymer nano-microsphere is still maintained as it is, and the appearance is not damaged. Testing the afterglow performance of the prepared long afterglow luminescent nano particles, and preparing the long afterglow luminescent nano particles into 1mg mL ^-1 A concentrated aqueous solution. First, excitation light with a wavelength of 365nm was irradiated for 3 seconds for charging, and after completion of charging, the light source was turned off, and the test results are shown in table 1.

COMPARATIVE EXAMPLE 1(C1)

The inorganic long afterglow styrene polymer microsphere is prepared from commercial inorganic long afterglow materials. In the preparation, dispersion polymerization methods known to the person skilled in the art are used. In the commercialized inorganic long afterglow material, SrAl ₂ O ₄ :Eu ²⁺ ,Dy ³⁺ The material is a green long-afterglow luminescent material with the highest brightness at present and has very wide application. Commercial SrAl ₂ O ₄ :Eu ²⁺ ,Dy ³⁺ The material is long afterglow powder obtained by high temperature sintering and grinding. First, SrAl having a particle size of about 250nm was obtained by centrifugal separation ₂ O ₄ :Eu ²⁺ ,Dy ³⁺ The inorganic long-afterglow nano-microsphere adopts hexadecyl trimethyl ammonium bromide (CTAB) to carry out oleophylic treatment on the inorganic long-afterglow nano-microsphere under the assistance of ultrasound. Then, 15g of styrene and 1g of methacrylic acid were dispersed in 80mL of an ethanol-water mixed solution (v: v, 1:3), the solution was added to a 250mL three-necked flask, 1g of CTAB-treated inorganic long-afterglow nanospheres was added, nitrogen was introduced, the temperature was maintained at 25 ℃, and stirring was continued for 30 minutes. The temperature was then slowly raised to 70 ℃ and 0.2g of azobisisobutyronitrile (dissolved in 25mL of ethanol) was immediately added and the reaction was continued for 4 hours. After the reaction is finished, washing the reaction product by using ultrapure water and ethanol, and standing the reaction product at normal temperature for later use. Finally obtaining the inorganic long-afterglow nano-microspheres wrapped by the styrene polymer through gradient centrifugation and filtration, wherein the particle size is about 300 nm. Following the procedure of example 2, inorganic long persistence styrene polymer microspheres were formulated to 1mg mL ^-1 The aqueous solution with concentration tests the afterglow performance of the nano-microsphere, the result is observed by naked eyes without any afterglow light,the long persistence luminescence intensities measured with the instrument are shown in table 1.

Examples 3 to 12

The procedure of example 2 was repeated, wherein the molar ratio of the three components, light absorber, photochemical buffer and light emitter, was maintained at 1:600:1000, except as shown in Table 1.

COMPARATIVE EXAMPLES 2 to 3(C2 AND C3)

The procedure of example 1 was repeated, wherein the molar ratio of the three components, light absorber, photochemical buffer and light emitter, was maintained at 1:600:1000, except as shown in Table 1.

COMPARATIVE EXAMPLE 4(C4)

The long-afterglow nano-microsphere is prepared by taking NCBS as a light absorbing agent, PFVA as a luminescent agent, DO as a photochemical buffering agent and styrene polymer nano-microsphere as a nano-carrier. The light absorber NCBS, the luminescent agent PFVA and the photochemical buffer agent DO are added into 5mL of benzyl alcohol-glycol-water (v: v, 1:8:1) solution, wherein the concentration of PdOEP is 5 mu mol L ^-1 The concentration of CA-1 is 3mmol L ^-1 Eu-1 concentration of 5mmol L ^-1 . After the components were dispersed by ultrasonic, 50mg of the styrene polymer nanospheres of example 1 having carboxyl groups on the surface at 300nm were added and heated at 110 ℃ for 30 min. Then, the mixture was cooled to room temperature, washed 3 times by centrifugation using ethanol and water, and finally the nanoparticles were dispersed in water for storage. The afterglow performance of the prepared long afterglow luminescent styrene polymer microspheres is tested according to the method of the embodiment 2, and the long afterglow luminescent styrene polymer microspheres are prepared into 1mg mL ^-1 A concentrated aqueous solution. Firstly, excitation light with the wavelength of 808nm is used for energy charging for 3s, the light source is turned off after the energy charging is finished, and consequently, no afterglow light is observed by naked eyes, and the long afterglow luminous intensity tested by means of an instrument is shown in table 1.

COMPARATIVE EXAMPLE 5(C5)

The operation of comparative example 4 was repeated except for the differences shown in Table 1.

TABLE 1

Example 13

Preparing the long-afterglow luminescent styrene polymer microspheres. Adding a light absorbent PdPc, a luminescent agent Eu-2 and a photochemical buffering agent CA-1 into 5mL of benzyl alcohol-ethylene glycol-water (v: v, 1:8:1) solution, wherein the concentration of PdPc is 200 mu mol L ^-1 The concentration of CA-1 is 2mmol L ^-1 Eu-2 concentration of 10mmol L ^-1 . After the components are subjected to ultrasonic dispersion, 50mg of styrene polymer nano microspheres with carboxyl on the surface of 300nm are added, and the mixture is heated for 30min at 110 ℃. Then, the mixture was cooled to room temperature, washed 3 times by centrifugation using ethanol and water, and finally the nanoparticles were dispersed in water for storage. Testing the afterglow performance of the prepared long afterglow luminescent nano particles, and preparing the long afterglow luminescent nano particles into 1mg mL ^-1 A concentrated aqueous solution. First, the light source was turned off after the charging was completed by irradiating the laser beam with excitation light having a wavelength of 730nm for 3 seconds, and the test results are shown in Table 1.

Examples 14 to 19

The procedure of example 13 was repeated except that shown in Table 2, wherein the concentration of the luminescent agent Eu-2 was 10mmol L ^-1 。

COMPARATIVE EXAMPLES 6 to 7(C6 AND C7)

The procedure of example 13 was repeated except that the difference is shown in Table 2, wherein the concentration of the light absorber PdPpc was 10mmol L ^-1 。

TABLE 2

Example 20

Mixing light absorbent PdPpc, luminescent agent Eu-2 and lightThe chemical buffer CA-1 is mixed in dichloromethane, and ultrasonic wave is used to assist the dissolution of each component, and finally, a uniform and transparent solution is formed. In the solution, the molar ratio of the light absorbent PdPpc, the photochemical buffer agent CA-1 and the luminescent agent Eu-2 is 1:600: 2000. Then, the dichloromethane solvent was removed to obtain an oily mixture of three components A), B) and C). 2mg of the three-component mixture was weighed, added to 5mL of benzyl alcohol-ethylene glycol-water (v: v, 1:8:1) solution containing 50mg of styrene polymer nanospheres, and heated at 110 ℃ for 30 min. Then, the mixture was cooled to room temperature, washed 3 times by centrifugation using ethanol and water, and finally the nanoparticles were dispersed in water for storage. The long afterglow luminescent styrene polymer microsphere is prepared into 1mg mL ^-1 The afterglow performance of the prepared long afterglow luminescent styrene polymer microspheres is tested by aqueous solution with concentration. First, the light source was turned off after the charging was completed by irradiating the laser beam with excitation light having a wavelength of 730nm for 3 seconds, and the test results are shown in Table 3. The ABC three components account for the total weight of the microspheres by mass percent according to the following method. Fully dissolving the prepared long-afterglow styrene polymer microspheres in tetrahydrofuran, separating three components A), B) and C), and calculating the mass fractions of the three components in the nano microspheres. In addition, whether the obtained long-afterglow nanospheres precipitate after standing in the aqueous solution for one month is observed.

Examples 21 to 23

The procedure of example 20 was repeated except that the carrier medium and the component content in the nanomaterial (as shown in table 3) were varied to obtain different mass fractions of the ABC three-component in the total weight of the microspheres by adjusting the mass of the oily three-component mixture added. The test results are shown in table 3.

COMPARATIVE EXAMPLES 8 to 9(C8 AND C9)

COMPARATIVE EXAMPLE 10(C10)

Mixing a light absorbing agent PdPpc, a luminescent agent Eu-2 and a photochemical buffering agent CA-1 in dichloromethane, and using ultrasonic waves to assist the dissolution of all components to finally form a uniform and transparent solution. In the solution, the molar ratio of the light absorbent PdPpc, the photochemical buffer agent CA-1 and the luminescent agent Eu-2 is 1:600: 2000. Then, the dichloromethane solvent was removed to obtain an oily mixture of three components A), B) and C). 10mg of the three-component mixture was weighed and added to 10mL of mesitylene-ethanol (v: v, 1:1) solution. After the components are subjected to ultrasonic dispersion, 50mg of silicon nano microspheres (the particle size is 300nm) with amino groups on the surfaces are added, and the mixture is heated for 2 hours at 80 ℃. Then, cooling to room temperature, centrifugally cleaning for 3 times by using ethanol and water, and finally dispersing the nano microspheres into water for storage. Testing the afterglow performance of the prepared long afterglow luminescent styrene polymer microspheres, and preparing the long afterglow luminescent styrene polymer microspheres into 1mg mL ^-1 A concentrated aqueous solution. First, the light source was turned off after the charging was completed by irradiating the laser beam with excitation light having a wavelength of 730nm for 3 seconds, and the test results are shown in Table 3. The ABC three components account for the total weight of the microspheres by mass percent according to the following method. Dissolving the prepared long-afterglow silicon nano-microsphere in toluene, fully ultrasonically dissolving the three adsorbed ABC components, then separating the three components A), B) and C), and calculating the mass fractions of the three components in the nano-microsphere.

COMPARATIVE EXAMPLE 11(C11)

Mixing a light absorbing agent PdPpc, a luminescent agent Eu-2 and a photochemical buffering agent CA-1 in dichloromethane, and using ultrasonic waves to assist the dissolution of all components to finally form a uniform and transparent solution. In the solution, the molar ratio of the light absorbent PdPpc, the photochemical buffer agent CA-1 and the luminescent agent Eu-2 is 1:600: 2000. Then, the dichloromethane solvent was removed to obtain an oily mixture of three components A), B) and C). Weighing 10mg of the three-component mixture, adding the three-component mixture into tetrahydrofuran containing 50mg of block copolymer F127, fully dissolving, then removing the tetrahydrofuran, dispersing the obtained composition into 2mL of water by using ultrasonic waves, and obtaining the long-afterglow nano-microspheres uniformly dispersed in the water by centrifugation and filtration. Method according to example 2Testing the afterglow performance of the prepared long afterglow luminescent styrene polymer microspheres, and preparing the long afterglow luminescent styrene polymer microspheres into 1mg mL ^-1 A concentrated aqueous solution. First, the excitation light with a wavelength of 730nm was used for charging for 3s, and the light source was turned off after the charging was completed, and the test results are shown in table 3. The ABC three components account for the total weight of the microspheres by mass percent according to the following method. Fully dissolving the prepared long-afterglow styrene polymer microspheres in tetrahydrofuran, separating three components A), B) and C), and calculating the mass fractions of the three components in the nano microspheres.

TABLE 3

Example 24

Taking 80nm styrene polymer microspheres with carboxyl, centrifuging, removing a surfactant in the synthesis process, then re-dissolving 1g of PS microsphere solid into 100mL of ultrapure water, and performing ultrasonic treatment to form a dispersed phase. Then, 1mL each of 2% sodium dodecylbenzenesulfonate and 1% ethylenediamine polyoxyethylene polyoxypropylene block polyether was added to the PS microsphere aqueous solution, and the mixture was stirred. Taking the components A), B) and C) as shown in the table 4, dispersing in 10mL tetrahydrofuran solution to form a dispersed phase, wherein the concentrations of the three components A), B) and C) are respectively 5 mu mol L ^-1 、2mmol L ^-1 And 10mmol L ^-1 . After the solution formulation was complete, the styrene polymer phase was added rapidly to the aqueous phase, then gradually warmed to 50 ℃ and stirred for 10 h. And centrifuging the obtained long-afterglow PS microspheres with the particle size of 80nm, removing redundant dye, cleaning twice by using ultrapure water and ethanol, storing in the ultrapure water, and keeping away from light at normal temperature for later use.

Examples 25 to 28

The procedure of example 24 was repeated except for the particle size of the styrene polymer microspheres having carboxyl groups as a nano-carrier medium (as shown in table 4). The test results are shown in table 4.

TABLE 4

Example 29

10mg of the long-afterglow luminescent styrene polymer nanospheres prepared in example 3 were centrifuged, redissolved in 9.5mL of ultrapure water, sufficiently ultrasonically dispersed uniformly, 0.5mL of Tween 20(10 wt% aqueous solution) was added thereto, the prepared solution was dispensed into 10 1mL solutions, left out of the sun and left in a dark room, centrifuged every month, the supernatant was removed and redissolved in 1mL of water, and the long-afterglow luminescent intensities of the solutions were measured, respectively, as shown in FIG. 6. The test result shows that the long afterglow luminescence performance is kept stable, which indicates that the adsorbed long afterglow luminescence components A), B) and C) can not leak from the styrene polymer nano carrier medium.

Example 30

According to the preparation method of example 3, we repeated the same operation 10 times to prepare 10 batches of long-lasting luminescent styrene polymer microspheres. The prepared long persistence luminescent nanoparticles were prepared as 1mg mL by the method of example 3, respectively ^-1 The 10 batches of the long afterglow luminescent styrene polymer microspheres in the aqueous solution with the concentration are subjected to afterglow performance tests. The light source was turned off after the charging was completed by first irradiating the wafer for 3 seconds with excitation light having a wavelength of 540nm to obtain afterglow light intensities between 10 different batches, and the test results are shown in table 5. The analysis shows that the deviation of the 10-time long afterglow luminescence is less than 5%, which shows that the long afterglow luminescence system has good stability and repeatability.

TABLE 5

Batches of	Styrene Polymer sphere particle size (nm)	Long persistence luminous intensity (a.u.)
1	300	175650
2	300	181520
3	300	176254
4	300	178625
5	300	179534
6	300	177250
7	300	180462
8	300	180497
9	300	178564
10	300	176542

Example 31

Coupling Alpha Fetoprotein (AFP) antibody AFP-Ab through fluorescent long afterglow nano microsphere ₁ Preparing a probe:

1) taking 100mg of the long-afterglow luminescent styrene polymer microspheres prepared according to the embodiment 3, centrifuging, redissolving the microspheres into 18mL of BBS buffer solution with the pH value of 7.4, and fully and uniformly dispersing the microspheres by ultrasonic waves; 2) to this were added 10mg of 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC) and 2.5mg of N-hydroxysuccinimide sulfonic acid sodium salt (NHSS), respectively, and reacted at room temperature for 2 hours; 3) after the reaction was completed, the reaction mixture was centrifuged and washed, redissolved in 10mL of BBS buffer solution having pH 7.4, and 10mg of AFP-Ab was added thereto ₁ Reacting the monoclonal antibody at room temperature for 4 hours; 4) after the reaction is finished, centrifugally washing, redissolving into 10mL of BBS buffer solution with the pH value of 7.4, adding 100mg of BSA into the BBS buffer solution, and reacting for 2 hours at room temperature; 5) after the reaction, the reaction mixture was washed by centrifugation, redissolved in 10mL of BBS buffer solution having a pH of 7.4, and stored at 4 ℃ until use.

Example 32

Preparing a probe by coupling long-afterglow nano-microspheres with a Prostate Specific Antigen (PSA) aptamer:

1) 10mg of the long-afterglow luminescent styrene polymer nanospheres prepared in example 3 are centrifuged, redissolved in 1.8mL of BBS buffer solution (pH 7.4), and sufficiently and ultrasonically dispersed uniformly; 2) 1mg of EDC and 0.25mg of NHSS were added thereto, respectively, and the mixture was reacted with shaking at room temperature for 2 hours; 3) after the reaction was completed, the reaction mixture was washed by centrifugation, redissolved in 2mL of BBS buffer, and 20. mu.L of a solution containing 2. mu. mol mL of BBS buffer was added thereto ^-1 The PSA aptamer of (9), having the sequence of (NH) ₂ ATTAAAGCTCGCCATCAAATAGCTGC) at room temperature for 4 hours; 4) after the reaction was completed, the reaction mixture was washed by centrifugation, redissolved in 2mL of BBS buffer solution, and added thereto10mg of BSA, at room temperature for 2 hours; 5) after the reaction, the reaction mixture was washed 2 times by centrifugation, redissolved in 4mL of BBS buffer (pH 7.4), and stored at 4 ℃ for further use.

Example 33

Preparation of lateral chromatography immune test strip containing long-afterglow luminescent styrene polymer microspheres and application of lateral chromatography immune test strip in C-reactive protein (CRP) detection

(1) Preparation of an immunochromatographic test strip for detecting C-reactive protein (CRP):

1) the long-lasting nanoparticles of example 1 were coupled to CRP-Ab as follows ₁ : taking 100mg of the long-afterglow luminescent styrene polymer microspheres prepared in the embodiment 3, centrifuging, redissolving the microspheres into 18mL of BBS buffer solution with the pH value of 7.4, and fully and uniformly dispersing the microspheres by ultrasonic waves; 10mg of EDC and 2.5mg of NHSS were added thereto, respectively, and reacted at room temperature for 2 hours; after completion of the reaction, the reaction mixture was washed by centrifugation, redissolved in 10mL of BBS buffer solution having pH 7.4, and 10mg of CRP-Ab was added thereto ₁ Reacting the monoclonal antibody at room temperature for 4 hours; after the reaction is finished, centrifugally washing, redissolving into 10mL of BBS buffer solution with the pH value of 7.4, adding 100mg of BSA into the BBS buffer solution, and reacting for 2 hours at room temperature; after the reaction, the reaction mixture was washed by centrifugation, redissolved in 10mL of BBS buffer solution having a pH of 7.4, and stored at 4 ℃ until use.

2) Preparing an NC membrane of the CRP immunochromatographic test strip: CRP-Ab was treated with PBS buffer (1% BSA, 1% sucrose, 50mM NaCl and 0.5% TWEEN 20), respectively ₂ The monoclonal antibody type and donkey anti-mouse IgG are respectively 1mg mL ^-1 And 1mg mL ^-1 And, at 8mm intervals, scratched on a nitrocellulose membrane with a streaking machine, and dried overnight at 37 ℃.

3) Preparing a sample pad and a combined pad of the CRP immunochromatographic test strip: the sample pad of the CRP immunochromatographic test strip is glass fiber. The CRP immunochromatographic test strip combination pad is also made of glass fiber, and is characterized in that a long-afterglow luminescent styrene polymer nano probe is sprayed on the glass fiber.

And (3) probe spraying process on glass fiber: taking the fluorescent probe prepared in the step 1), centrifuging, and compounding with a membrane spraying buffer solutionDissolved in 20mg mL ^-1 The fluorescent probe solution was sucked back into the instrument by a membrane spraying instrument at 1.2. mu.L cm ^-1 The fluorescent probe was sprayed onto the glass fiber and baked at 37 ℃ overnight.

4) Assembling the CRP immunochromatographic test strip: sample pads are sequentially attached to the white PVC base plate in a staggered manner of 3mm, and CRP-Ab is marked ₁ Glass fiber of long persistence probe of monoclonal antibody type (conjugate pad) scratched with CRP-Ab ₂ The NC membrane of the T line and the C line of donkey anti-mouse IgG, and finally, the absorbent paper is pasted. And then cutting the assembled chromatography plate into test strips with the width of 3.8mm by a high-speed cutting machine, and fixing the test strips by using an upper plastic card shell and a lower plastic card shell which are matched to obtain the immunochromatographic test strips.

(2) Establishment of CRP standard curve:

1) diluting CRP antigen stock solution into whole blood CRP antigen solutions with different concentrations of 0 μ g mL ^-1 、0.1μg mL ^-1 、0.5μg mL ^-1 、5μg mL ^-1 、20μg mL ^-1 、40μg mL ^-1 、160μg mL ^-1 And 320. mu.g mL ^-1 。

2) mu.L of the sample CRP antigen solution was added to 99. mu.L of PBS buffer (containing 1% BSA, 0.1% SDS, and 0.1% B66) and mixed well.

3) And adding 100 mu L of the mixed solution which is uniformly mixed into a sample adding hole of the immunochromatographic test strip, wherein the liquid can sequentially pass through the sample area, the detection area and the water absorption area through the capillary action. When the antigen solution is detected in the sample, the antigen is firstly combined with the long afterglow luminescent probe in the sample area to form immune complex, and then the immune complex and the CRP-Ab are electrophoresed to a test line (T line) along with the liquid ₂ A sandwich immune complex is formed, and the redundant long afterglow luminescent probe swims to a control line (C line) to be combined with the donkey anti-mouse secondary antibody. And when no antigen exists in the detection sample, the long afterglow luminescent probe is driven to directly swim to the C line to be combined with the donkey anti-rat secondary antibody.

4) After the reaction is carried out for 5 minutes, the immunochromatographic test strip is detected by using a long-afterglow luminescence detector. The irradiation time of the exciting light is 3s, and the long afterglow luminescence signals on the test paper strip begin to be collected after the excitation is stopped. The long afterglow luminescence intensities of the T line and the C line are measured, the ratio of the intensities is calculated, and a standard curve is established according to the corresponding relation between the ratio and the antigen concentration (figure 7). The long afterglow luminescence detector is a daily-used commercial smart phone, is provided with signal reading software, and can perform signal intensity data analysis on pictures shot by the mobile phone.

(3) Immunochromatography detection of CRP in actual samples:

the prepared long-afterglow luminescent nano indicating probe is only required to be excited by using excitation light irradiation before reading, and the excitation light is in a closed state in the subsequent reading process. In the detection of CRP samples, the immunochromatographic test strip (figure 8 left) based on the long-afterglow luminescent styrene polymer microspheres of the invention is found to have detection sensitivity which is improved by more than 100 times compared with a detection system (figure 8 right) based on inorganic long afterglow, but has no obvious change on the treatment requirement of a detection sample, and the part of the detection time only needs 3s on the excitation time. According to the detection result of the long afterglow luminescence immunochromatographic test strip, a sample contains 21 mug mL ^-1 The CRP antigen of (1).

COMPARATIVE EXAMPLE 12(C12)

The operation of example 33 was repeated except that: in the first step, CRP-Ab was coupled using inorganic long persistence nanospheres as in comparative example 1 ₁ . The prepared inorganic long-afterglow nano immunochromatographic test strip has weak long-afterglow luminescent signals, can not be seen by naked eyes and can not be shot by a mobile phone, as shown in the right graph in fig. 8.

Examples 34 to 42

The procedure in example 33 was repeated to obtain an antigen detection standard curve based on the long-lasting afterglow lateral chromatographic immunoassay strip, except that the target antigens were replaced with: SAA (example 34, fig. 9), PCT (example 35, fig. 10), AFP (example 36, fig. 11), CEA (example 37, fig. 12), PSA (example 38, fig. 13), cTn-I (example 39, fig. 14), HCG (example 40, fig. 15), ASO (example 41, fig. 16), and RF (example 42, fig. 17).

Example 43

CRP antigen standards purchased from the West-run were diluted to 21. mu.g mL ^-1 The samples were tested in 30 replicates. The samples to be tested were divided into 30 portions on average, and the test was carried out by repeating the procedure of example 33, and the results of the 30 tests are shown in Table 6. The 30-time detection results are analyzed, and the coefficient of variation of the detection results is found to be less than 5%, which shows that the long-afterglow luminescent probe and the immunochromatographic test strip detection method have good detection accuracy and repeatability.

TABLE 6

Claims

A long-afterglow luminescent styrene polymer microsphere comprises

A) At least one light-absorbing agent,

B) at least one luminescent agent which is a monomeric, non-polymeric compound and has a molecular weight of less than 10000g mol ^-1 ，

C) At least one photochemical buffer agent of formula (I),

wherein the content of the first and second substances,

g and T are heteroatoms selected from O, S, Se and N;

R ₁ ' and R ₂ ' and R ₄ ' to R ₈ ' are each independently selected from H, hydroxy, carboxy, amino, mercapto, ester, nitro, sulfonic, halogen, amide, or an alkane having 1 to 50, preferably 1 to 24, e.g., 2 to 14, carbon atomsA group, alkenyl, alkynyl, alkoxy, alkylthio, alkylamino, aryl, aralkyl, heteroaryl or heteroaralkyl having N, O or S, or combinations thereof, wherein the aryl, aralkyl, heteroaryl or heteroaralkyl optionally has one or more substituents L; and

l is selected from hydroxyl, carboxyl, amino, thiol, ester, nitro, sulfonic, halogen, amide, or alkyl, alkenyl, alkynyl, alkoxy, and alkylamino groups having 1 to 50, preferably 1 to 24, such as 2 to 14, or 6 to 12 carbon atoms, or combinations thereof; and

R ₃ ' is an electron withdrawing group or an aryl group comprising an electron withdrawing group, preferably selected from nitro, halogen, haloalkyl, sulfonic acid, cyano, acyl, carboxyl, and/or combinations thereof; and

D) a support medium for adsorbing components a) to C), said support medium being styrene polymer microspheres;

wherein the light absorber and the light emitter are structurally different compounds and the total content of the components A) to C) is 0.1 to 30%, preferably 0.2 to 25%, more preferably 0.5 to 20% and most preferably 1 to 15% based on the total mass of the components A) to D).
The long persistence luminescent styrene polymer microsphere of claim 1, wherein the ring portion is
Can be selected from
More preferably G and T are selected from S and O, most preferably one of G and T is S and the other is O.
The long-lasting luminescent styrene polymer microspheres of claim 1 or 2, wherein the group R ₁ ' and R ₂ ' toAnd R ₄ ' to R ₈ ' are each independently selected from alkyl, alkoxy, alkylamino or aryl groups having 1 to 18, preferably 1 to 12, more preferably 1 to 16 carbon atoms, or combinations thereof, wherein said aryl groups may be substituted or unsubstituted with one or more groups L and are preferably phenyl substituted or unsubstituted with one or more groups L.
A long persistence luminescent styrene polymer microsphere according to any of the preceding claims, wherein L is selected from hydroxyl, sulfonic acid group, halogen, nitro, linear or branched alkyl group having 1 to 12, more preferably 1 to 6 carbon atoms, alkoxy group, alkylamino group, amino group, or their combination;

more preferably selected from halogen, straight or branched alkyl, alkoxy, alkylamino having 1 to 12, more preferably 1 to 6 carbon atoms, or combinations thereof.
The long persistence luminescent styrene polymer microsphere of any one of the preceding claims, wherein the group R is ₁ ' and R ₂ ' and R ₄ ' to R ₈ ' is selected from methoxy, ethoxy, dimethylamino, diethylamino, dibutylamino, methyl, ethyl, propyl, butyl, tert-butyl, or combinations thereof.
The long persistence luminescent styrene polymer microsphere of any one of the preceding claims, wherein the group R is ₃ ' is selected from an electron withdrawing group or a phenyl group comprising an electron withdrawing group, preferably selected from nitro, cyano, halogen, haloalkyl and/or combinations thereof, and the aryl group comprising an electron withdrawing group is selected from one or more nitro, cyano, halogen and/or haloalkyl substituted phenyl groups.
The long persistent luminescent styrene polymer microsphere according to any one of the preceding claims, wherein the photochemical buffering agent is selected from one or more of the following compounds:
the long-lasting luminescent styrene polymer microspheres according to any one of the preceding claims, wherein the styrene polymer microspheres comprise coupling groups on their surface selected from amino, amide, carboxyl and/or aldehyde groups.
The long persistent luminescent styrene polymer microsphere according to any one of the preceding claims, wherein the styrene polymer comprises a homopolymer of styrene or a copolymer thereof with other copolymerizable monomers, wherein the copolymerizable monomers comprise olefins, alkynes, ethylenically unsaturated carboxylic acids or anhydrides or amides or esters thereof, and derivatives thereof having one or more substituents selected from halogen, amino, amide, aldehyde and/or carboxyl groups.
Long persistent light-emitting styrene polymer microspheres according to any one of the preceding claims, wherein the styrene polymer is selected from copolymers of styrene and aliphatic ethylenically unsaturated carboxylic acids or anhydrides or amides or esters thereof, preferably copolymers of styrene and ethylenically unsaturated carboxylic acids of the formula Y-COOH or amides thereof, wherein Y is a C2-C18 having one or more C-C double bonds replacing the C-C single bond, a linear, branched or cyclic aliphatic alkyl group such as C3-C8, more preferably the styrene polymer is a copolymer of styrene and (meth) acrylic acid and/or (meth) acrylamide.
A long lasting luminescent styrenic polymer microsphere according to any preceding claim, characterized in that the styrenic polymer comprises 1-15%, more preferably 2-10% comonomer by total weight of all monomers.
The long persistence luminescent styrene polymer microsphere of claim 8, wherein the styrene polymer comprises 0.05% to 5%, more preferably 0.1% to 2%, based on the total weight of the polymer, of coupling groups.
Long afterglow luminescent styrene polymer microspheres according to any one of the preceding claims, wherein the coefficient of variation of the particle size of the styrene polymer carrier medium is less than 10%, preferably less than 5% and more preferably less than 3%.
The long-afterglow luminescent styrene polymer microspheres of any one of the preceding claims, wherein said long-afterglow luminescent styrene polymer microspheres have a particle size in the range of 5nm to 1000nm, more preferably 50nm to 800nm, most preferably 100nm to 500 nm.
The long persistence luminescent styrene polymer microsphere of any of the preceding claims, wherein the molar ratio of the light absorber to the luminescent agent is in the range of 1:2 to 1:10000, preferably 1:10 to 1:8000 or 1:50 to 1:6000, more preferably 1:100 to 1:4000 or 1:200 to 1: 2000.
Long persistence luminescent styrene polymer microspheres according to anyone of the preceding claims, characterized in that the photochemical buffering agent is present in an amount of 0.1% to 80%, preferably 0.3% to 60%, more preferably 0.5% to 40%, most preferably 1% to 20% by mass of the total mass of components a) to C).
The long-afterglow luminescent styrene polymer microspheres of any one of the preceding claims, wherein the long-afterglow luminescent styrene polymer nanospheres consist of components a) to D).
A long-lasting luminescent organic nanosphere according to any of the preceding claims wherein the luminescent agent is selected from iridium complexes, rare earth complexes, acenes, BODIPY, and derivatives and copolymers thereof.
A probe comprising the long afterglow luminescent styrene polymer microsphere according to any one of claims 1 to 18 and an antibody or aptamer loaded or coupled thereto.
A probe according to claim 19, wherein the antibody or aptamer is present in the probe in an amount of preferably 1% to 20%, more preferably 2% to 15%, most preferably 5% to 12% by mass of the entire probe.
A probe according to claim 19 or 20, wherein the antibody or aptamer is preferably selected from a C-reactive protein (CRP) antibody, a serum amyloid protein (SAA) antibody, a Procalcitonin (PCT) antibody, an Alpha Fetoprotein (AFP) antibody, a carcinoembryonic antigen (CEA) antibody, a Prostate Specific Antigen (PSA) antibody, a cardiac troponin (CTn-I) antibody, a Human Chorionic Gonadotropin (HCG) antibody, an anti-streptolysin o (aso) antibody, a Rheumatoid Factor (RF) antibody and/or an oligonucleotide fragment.
A method for preparing the long persistence luminescent styrene polymer microsphere according to any one of claims 1 to 18, comprising the steps of:

(1) providing components A) to C); and

(2) the components A) to C) are dispersed and adsorbed onto the support medium component D) in a dispersion or solution.
The process according to claim 22, characterized in that components a) to C) are dispersed or dissolved using one or more solvents selected from liquid paraffin, a mixture of phenethyl alcohol-ethylene glycol and water, a mixture of mesitylene and ethanol, tetrahydrofuran and dichloromethane.
The method for preparing the probe according to claim 19, wherein an antibody or aptamer is adsorbed or modified on the long-lasting luminescent styrene polymer microsphere according to any one of claims 1 to 18.
The method according to claim 24, wherein comprising bioconjugating said long persistence light-emitting styrenic polymer microsphere with an antibody or aptamer through a functional reactive group such as carboxyl, amino, amide, and/or aldehyde group.
A test strip for immunochromatographic detection comprising the long-lasting luminescent styrene polymer microspheres according to any one of claims 1 to 18 or the probe according to any one of claims 19 to 21.
The test strip of claim 26, which comprises a bonding pad, a test line and a quality control line, wherein said long-afterglow luminescent styrene polymer microspheres or said probe are disposed on said bonding pad.
A method of immunochromatographic detection comprising the steps of:

(1) providing long persistence luminescent styrene polymer microspheres according to any one of claims 1 to 18, a probe according to any one of claims 19 to 21, or a dipstick according to any one of claims 26 to 27;

(2) irradiating the styrene polymer microspheres or the probe or the test paper with exciting light; and

(3) the irradiation is stopped and the light emission signal is read.
The detection method according to claim 28, wherein the tunable interval of the excitation wavelength is 300nm to 1000 nm.
The detection method according to claim 28, wherein the light irradiation time is 2s to 10 s.
The detection method according to claim 28, wherein the instrument for reading the luminescence signal is selected from a mobile phone, a luminescence imaging system and/or a professional long persistence luminescence detection device, more preferably a mobile phone.